Crispr-cas9 nickase promotion of cell death
Cas9 nickases are used to introduce single-strand breaks in gene amplification regions, converting them into lethal double-strand breaks to kill cancer cells, addressing the inefficacy and toxicity of conventional therapies and providing a potential cure for high-risk cancers.
Patent Information
- Application Number
- PCT/US2025/019912
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-14
- Filing Date
- 2025-03-14
- Publication Date
- 2025-09-18
AI Technical Summary
Conventional treatments for high-risk cancers, such as neuroblastoma, are ineffective and result in significant treatment-associated toxicity, with a survival rate of only 40-50% and no curative salvage therapy for refractory disease, and current therapies cause severe side effects like secondary malignancies and infertility.
The use of Cas9 nickases programmed to introduce single-strand breaks in gene amplification regions, which are converted into lethal double-strand breaks to induce replication stress and promote cancer cell death, while sparing healthy cells without gene amplifications.
This approach selectively targets and kills cancer cells with gene amplifications, reducing cancer symptoms and minimizing toxicity in healthy cells, offering a potential cure with reduced side effects.
Smart Images

Figure US2025019912_18092025_PF_FP_ABST
Abstract
Description
[0001] CRISPR-Cas9 Nickase Promotion Of Cell Death
[0002] Field Of The Invention
[0003] The present invention is related to the field of cancer therapy. In particular, the selective targeting of cancer cells comprising a region of gene amplification. Cas9 nickases programmed to introduce single strand breaks within the gene amplification region wherein the single stranded breaks are converted into a lethal number of double strand breaks (DSBs) that induce replication stress and promote cancer cell death. Cas9 nickase activity targeted to a nonamplified gene region does not result in a lethal number of DSBs in healthy, non-cancer cells. The present invention provides a method of treating any cancer cell by programming a Cas9 nickase to a target sequence within a region of gene amplification.
[0004] Background
[0005] Conventional treatment regimens of high-risk cancers (e.g., neuroblastoma) include doseintensive chemotherapy, surgery, radiotherapy, myeloablative chemotherapy with subsequent hematopoietic stem-cell rescue, and anti-GD2 immunotherapy. Regrettably, these intensive therapeutic regimens are frequently proven fruitless with a survival rate of only 40 - 50%. For those that survive, refractory disease onsets in -60% of cases with no curative salvage therapy currently available. Maris, J.M., “Recent advances in neuroblastoma” NEJM 362:2202-2211 (2021).
[0006] What’s more, those that remain in remission experience significant treatment-associated acute toxicity, such as secondary malignancy, impaired neurological and musculoskeletal development, renal and gastrointestinal dysfunction, hearing loss, and infertility among others. Matthay et al., “Neuroblastoma” Nature Reviews Disease Primers 2 (2016); Cohen et al., “Late effects in children treated with intensive multimodal therapy for high-risk neuroblastoma: High incidence of endocrine and growth problems” Bone Marrow Trans 49:502-508 (2014); Gurney et al., “Hearing loss, quality of life, and academic problems in long-term neuroblastoma survivors: A report from the Children’s Oncology Group” Pediatrics 120 (2007); and Applebaum et al., “Second malignancies in patients with neuroblastoma: The effects of riskbased therapy” Pediatric Blood and Cancer 62: 128-133 (2014). The inefficacy and detrimental side effects associated with conventional chemoradiotherapies constitutes both an urgent and unmet need for novel therapeutic developments for patients with neuroblastoma.
[0007] What is needed in the art is a composition and a method to selectively target an amplified gene to promote cancer cell death, whereas death in healthy, non-cancer cells not containing gene amplifications is not promoted.
[0008] Summary Of The Invention
[0009] The present invention is related to the field of cancer therapy. In particular, the selective targeting of cancer cells comprising a region of gene amplification. Cas9 nickases programmed to introduce single strand breaks within the gene amplification region wherein the single stranded breaks are converted into a lethal number of double strand breaks (DSBs) that induce replication stress and promote cancer cell death. Cas9 nickase activity targeted to a nonamplified gene region does not result in a lethal number of DSBs in healthy, non-cancer cells. The present invention provides a method of treating any cancer cell by programming a Cas9 nickase to a target sequence within a region of gene amplification.
[0010] In one embodiment, the present invention contemplates a method, comprising: a) providing: i) a Cas9 nickase or a messenger ribonucleic acid (mRNA) construct encoding a Cas9 nickase; ii) a cancer cell comprising amplified genomic loci; iii) a specific genomic target comprising a deoxyribonucleic acid (DNA) strand located within each of said amplified genomic loci; and iv) a single guide ribonucleic acid (sgRNA) complementary to at least a portion of said DNA strand; b) cleaving said DNA strand with said Cas9 nickase; and c) replicating said cleaved DNA strand that results in death of said cancer cell. In one embodiment, the cleaving results in a single stranded break (SSB). In one embodiment, said replicating converts said SSB into a double stranded break (DSB). In one embodiment, said amplified genomic loci comprises a plurality of first genes. In one embodiment, said amplified genomic loci comprises a plurality of second genes. In one embodiment, the number of said plurality of first or second genes range between approximately 5 - 2,000 gene copies. In one embodiment, said plurality of first genes include, but are not limited to, an MYCN gene or an ERBB2 (HER2) gene. In one embodiment, said plurality of second genes include, but are not limited to, an MYCN gene or an ERBB2 gene. In one embodiment, the method further comprises administering said Cas9 nickase or said mRNA construct and said sgRNA to said cancer cell. In one embodiment, said administering is selected from the group consisting of systemic, intravenous and intratumoral. In one embodiment, said administering comprises a lipid nanoparticle encapsulating said Cas9 nickase or said mRNA construct and said sgRNA. In one embodiment, the method further comprises expressing said encoded Cas9 nickase in said cancer cell. In one embodiment, the method further comprises contacting said Cas9 nickase or said expressed Cas9 nickase and said sgRNA with said DNA strand. In one embodiment, the method further comprises providing a patient exhibiting at least one cancer symptom. In one embodiment, the administering results in a reduction of said at least one cancer symptom. In one embodiment, said lipid nanoparticle comprises a component including, but not limited to, DLin-MC3-DMA, DSPC, cholesterol, PEG-DMG, DSPE-PEG, and DSPE-PEG-Maleimide. In one embodiment, said lipid nanoparticle comprises a targeting agent. In one embodiment, said targeting agent is attached to the surface of said lipid nanoparticle. In one embodiment, the targeting agent is a cancer targeting agent. In one embodiment, the cancer targeting agent comprises a disialoganglioside (GD2) antibody. In one embodiment, said mRNA construct further comprises a 3' untranslated region (3' UTR). In one embodiment, said mRNA construct further comprises a 5' UTR. In one embodiment, said mRNA construct further comprises a 3' UTR and a 5' UTR. In one embodiment, the 3' UTR encodes a motif including, but not limited to, a human hemoglobin alpha (hHBa) motif, an amino-terminal enhancer of split (AES) motif and a mitochondrially encoded 12S rRNA (mt-RNRl) motif. In one embodiment, the 5' UTR encodes a motif including, but not limited to, a human hemoglobin alpha (hHBa) motif, an amino-terminal enhancer of split (AES) motif and a mitochondrially encoded 12S rRNA (mt-RNRl) motif. In one embodiment, the mRNA construct further comprises an MYCN 3' UTR. In one embodiment, the mRNA construct further comprises an MYCN 5' UTR. In one embodiment, the mRNA construct further comprises an MYCN 3' UTR and an MYCN 5' UTR. In one embodiment, said mRNA construct comprises a hHBa 5’ UTR and MYCN 3’ UTR. In one embodiment, the Cas9 nickase is an SpyCas9D10Anickase. In one embodiment, the Cas9 nickase is an SpyCas9H840Anickase. In one embodiment, said mRNA construct is human codon optimized. In one embodiment, said mRNA construct further comprises at least one Nl- methylpseudouridine (ml'P). In one embodiment, said mRNA construct further comprises a Kozak sequence. In one embodiment, the mRNA construct further comprises a poly-A tail with a length ranging between 20 - 152 and 120 - 152 adenine (A) nucleotides.
[0011] Definitions
[0012] To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as “a”, “an” and “the” are not intended to refer to only a singular entity but also plural entities and also includes the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
[0013] The term "about" or “approximately” as used herein, in the context of any of any assay measurements refers to + / - 5% of a given measurement.
[0014] The term “gene amplification” or “amplified genes” refers to a gene copy number increase within a restricted region of a chromosome arm. It is prevalent in some tumors and is associated with overexpression of the amplified gene(s). An amplified genomic region can span a chromosome region of more than a megabase in length and may be composed of multiple genomic segments from different chromosomes. Amplified DNA can be organized as extrachromosomal elements, as repeated units at a single locus or scattered throughout the genome. Gene amplification may occur through mechanisms including, but not limited to, ectopic recombination, retrotransposition event, aneuploidy, chromothripsis, extrachromosomal DNA, polyploidy, and replication slippage.
[0015] As used herein, the terms "nucleic acid molecule encoding", "DNA sequence encoding," and "DNA encoding" refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
[0016] As used herein, the term “CRISPRs” or “Clustered Regularly Interspaced Short Palindromic Repeats” refers to an acronym for DNA loci that contain multiple, short, direct repetitions of base sequences. Each repetition contains a series of bases followed by 30 or so base pairs known as "spacer" sequence. The spacers are short segments of DNA from a virus or other selfish genetic element and may serve as a 'memory' of past exposures to facilitate an adaptive defense against future invasions. Transcription of the CRISPR array produces an RNA transcript that is processed into crRNAs that can be used to program Cas proteins for effector function. Doudna et al. Genome editing. The new frontier of genome engineering with CRISPR- Cas9” Science 346(6213): 1258096 (2014).
[0017] As used herein, the term “Cas” or “CRISPR-associated (cas)” refers to genes often associated with CRISPR repeat-spacer arrays.
[0018] As used herein, the term “Cas9” refers to a nuclease from type II CRISPR systems, an enzyme specialized for generating double-strand breaks in DNA, with two active cutting sites (the HNH and RuvC domains), one for each strand of the double helix. tracrRNA and crRNA processed from the RNA produced from the CRISPR array may be combined into a "singleguide RNA" (sgRNA) molecule that, mixed with Cas9, could find and cleave DNA targets through Watson-Crick pairing between the guide sequence within the crRNA or sgRNA and the target DNA sequence, Jinek et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity” Science 337(6096):816-821 (2012).
[0019] As used herein, the term “catalytically active Cas9” refers to an unmodified Cas9 nuclease comprising full nuclease activity.
[0020] The term “nickase” as used herein, refers to a protein that cleaves only a single DNA strand, either due to its natural function or because it has been engineered to cleave only a single DNA strand. For example, Cas9 nickase variants that have either the RuvC (e.g., D10A) or the HNH (e.g., H840A) domain mutated provide control over which DNA strand is cleaved and which remains intact. Multiple different mutations to the RuvC or HNH domains of Cas9 can yield a nickase: SpyCas9D10Ainactivates the RuvC domain and SpyCas9H840Ainactivates the HNH domain. Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity” Science 337(6096):816-821 (2012) and Cong et al. Multiplex genome engineering using CRISPR / Cas systems” Science 339(6121): 819-823 (2013). Alternatively, other programmable nickases are contemplated including, but not limited to Cas 12 nickases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). ZFNs and TALENs are composed of DNA-binding proteins and the FokI nuclease domain. The term, “trans-activating crRNA”, “tracrRNA” as used herein, refers to a small transencoded RNA. For example, CRISPR / Cas (clustered, regularly interspaced short palindromic repeats / CRISPR-associated proteins) constitutes an RNA-mediated defense system, which protects against viruses and plasmids. This defensive pathway has three steps. First a copy of the invading nucleic acid is integrated into the CRISPR locus. Next, CRISPR RNAs (crRNAs) are transcribed from this CRISPR locus. The crRNAs are then incorporated into effector complexes, where the crRNA guides the complex to the invading nucleic acid and the Cas proteins degrade this nucleic acid. There are several pathways of CRISPR activation, one of which requires a tracrRNA, which plays a role in the maturation of crRNA. TracrRNA is complementary to the repeat sequence of the pre-crRNA, forming an RNA duplex. This is cleaved by RNase III, an RNA-specific ribonuclease, to form a crRNA / tracrRNA hybrid. This hybrid acts as a guide for the endonuclease Cas9, which cleaves the invading nucleic acid.
[0021] The term “protospacer adjacent motif’ (or PAM) as used herein, refers to a DNA sequence that may be required for a Cas9 / sgRNA to form an R-loop to interrogate a specific DNA sequence through Watson-Crick pairing of its guide RNA with the genome. The PAM specificity may be a function of the DNA-binding specificity of the Cas9 protein (e.g., a “protospacer adjacent motif recognition domain” at the C-terminus of Cas9).
[0022] The terms “protospacer adjacent motif recognition domain”, “PAM Interacting Domain” or “PID” as used herein, refers to a Cas9 amino acid sequence that comprises a binding site to a DNA target PAM sequence.
[0023] The term “binding site” as used herein, refers to any molecular arrangement having a specific tertiary and / or quaternary structure that undergoes a physical attachment or close association with a binding component. For example, the molecular arrangement may comprise a sequence of amino acids. Alternatively, the molecular arrangement may comprise a sequence a nucleic acids. Furthermore, the molecular arrangement may comprise a lipid bilayer or other biological material.
[0024] As used herein, the term “sgRNA” refers to single guide RNA used in conjunction with CRISPR associated systems (Cas). sgRNAs are a fusion of crRNA and tracrRNA and contain nucleotides of sequence complementary to the desired target site. Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity” Science 337(6096):816- 821 (2012) Watson-Crick pairing of the sgRNA with the target site permits R-loop formation, which in conjunction with a functional PAM permits DNA cleavage or in the case of nuclease- deficient Cas9 allows binding to the DNA at that locus.
[0025] As used herein, the term “orthogonal” refers to targets that are non-overlapping, uncorrelated, or independent. For example, if two orthogonal Cas9 isoforms were utilized, they would employ orthogonal sgRNAs that only program one of the Cas9 isoforms for DNA recognition and cleavage. Esvelt et al., “Orthogonal Cas9 proteins for RNA-guided gene regulation and editing” Nat Methods 10(11): 1116-1121 (2013). For example, this would allow one Cas9 isoform (e.g. S. pyogenes Cas9 or SpyCas9) to function as a nuclease programmed by a sgRNA that may be specific to it, and another Cas9 isoform (e.g. N. meningitidis Cas9 or NmeCas9) to operate as a nuclease-dead Cas9 that provides DNA targeting to a binding site through its PAM specificity and orthogonal sgRNA. Other Cas9s include S. aureus Cas9 or SauCas9 and A. naeslundii Cas9 or AnaCas9.
[0026] The term “truncated” as used herein, when used in reference to either a polynucleotide sequence or an amino acid sequence means that at least a portion of the wild type sequence may be absent. In some cases, truncated guide sequences within the sgRNA or crRNA may improve the editing precision of Cas9. Fu, et al. “Improving CRISPR-Cas nuclease specificity using truncated guide RNAs” Nat Biotechnol. 2014 Mar;32(3):279-284 (2014).
[0027] The term “base pairs” as used herein, refer to specific nucleobases (also termed nitrogenous bases), that are the building blocks of nucleotide sequences that form a primary structure of both DNA and RNA. Double-stranded DNA or DNA-RNA duplexes may be characterized by specific hydrogen bonding patterns. Base pairs may include, but are not limited to, guanine-cytosine, adenine-thymine and adenine-uracil base pairs.
[0028] The term “genomic locus” as used herein, refers to a specific region of the genome that can be targeted by an sgRNA. In particular, a genomic locus encodes a specific genomic target.
[0029] The term “specific genomic target” as used herein, refers to any pre-determined nucleotide sequence capable of binding to a Cas9 protein contemplated herein. The target may include, but may be not limited to, a nucleotide sequence complementary to a programmable DNA binding domain or an orthogonal Cas9 protein programmed with its own guide RNA, a nucleotide sequence complementary to a single guide RNA, a protospacer adjacent motif recognition sequence, an on-target binding sequence and an off-target binding sequence.
[0030] As used herein, the term “edit” “editing” or “edited” refers to a method of altering a nucleic acid sequence of a polynucleotide (e.g., for example, a wild type naturally occurring nucleic acid sequence or a mutated naturally occurring sequence) by selective deletion of a specific genomic target or the specific inclusion of new sequence through the use of an exogenously supplied DNA template. Such a specific genomic target includes, but may be not limited to, a chromosomal region, extrachromosomal DNA, mitochondrial DNA, a gene, a promoter, an open reading frame or any nucleic acid sequence.
[0031] The term “substitute for” as used herein, refers to the switching the administration of a first compound or drug to a subject for a second compound or drug to the subject.
[0032] The term “suspected of having”, as used herein, refers a medical condition or set of medical conditions (e.g., preliminary symptoms) exhibited by a patient that is insufficient to provide a differential diagnosis. Nonetheless, the exhibited condition(s) would justify further testing (e.g., autoantibody testing) to obtain further information on which to base a diagnosis.
[0033] The term “at risk for” as used herein, refers to a medical condition or set of medical conditions exhibited by a patient which may predispose the patient to a particular disease or affliction. For example, these conditions may result from influences that include, but are not limited to, behavioral, emotional, chemical, biochemical, or environmental influences.
[0034] The term “effective amount” as used herein, refers to a particular amount of a pharmaceutical composition comprising a therapeutic agent that achieves a clinically beneficial result (i.e., for example, a reduction of symptoms). Toxicity and therapeutic efficacy of such compositions can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred. The data obtained from these cell culture assays and additional animal studies can be used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
[0035] The term “symptom”, as used herein, refers to any subjective or objective evidence of disease or physical disturbance observed by the patient. For example, subjective evidence is usually based upon patient self-reporting and may include, but is not limited to, pain, headache, visual disturbances, nausea and / or vomiting. Alternatively, objective evidence is usually a result of medical testing including, but not limited to, body temperature, complete blood count, lipid panels, thyroid panels, blood pressure, heart rate, electrocardiogram, tissue and / or body imaging scans.
[0036] The term “associated with” or “linked to” as used herein, refers to an art-accepted causal relationship between a genetic mutation and a medical condition or disease. For example, it is art-accepted that a patient having an HTT gene comprising a tandem CAG repeat expansion mutation has, or is a risk for, Huntington’s disease.
[0037] The term “disease” or “medical condition”, as used herein, refers to any impairment of the normal state of the living animal or plant body or one of its parts that interrupts or modifies the performance of the vital functions. Typically manifested by distinguishing signs and symptoms, it is usually a response to: i) environmental factors (as malnutrition, industrial hazards, or climate); ii) specific infective agents (as worms, bacteria, or viruses); iii) inherent defects of the organism (as genetic anomalies); and / or iv) combinations of these factors.
[0038] The terms "reduce," "inhibit," "diminish," "suppress," "decrease," “prevent” and grammatical equivalents (including “lower,” “smaller,” etc.) when in reference to the expression of any symptom in an untreated subject relative to a treated subject, mean that the quantity and / or magnitude of the symptoms in the treated subject is lower than in the untreated subject by any amount that is recognized as clinically relevant by any medically trained personnel. In one embodiment, the quantity and / or magnitude of the symptoms in the treated subject is at least 10% lower than, at least 25% lower than, at least 50% lower than, at least 75% lower than, and / or at least 90% lower than the quantity and / or magnitude of the symptoms in the untreated subject. The term "attached" as used herein, refers to any interaction between a first molecule and a second molecule. Attachment may be reversible or irreversible. Such attachment includes, but is not limited to, covalent bonding, ionic bonding, Van der Waals forces or friction, and the like.
[0039] The term "administered" or "administering", as used herein, refers to any method of providing a composition to a patient such that the composition has its intended effect on the patient. An exemplary method of administering is by a direct mechanism such as, local tissue administration i.e., for example, extravascular placement), oral ingestion, transdermal patch, topical, inhalation, suppository, subcutaneous or intravenous injection etc.
[0040] The term "patient" or “subject”, as used herein, is a human or animal and need not be hospitalized. For example, out-patients, persons in nursing homes are "patients." A patient may comprise any age of a human or non-human animal and therefore includes both adult and juveniles (i.e., children). It is not intended that the term "patient" connote a need for medical treatment, therefore, a patient may voluntarily or involuntarily be part of experimentation whether clinical or in support of basic science studies.
[0041] The term “affinity” as used herein, refers to any attractive force between substances or particles that causes them to enter into and remain in chemical combination. For example, an inhibitor compound that has a high affinity for a receptor will provide greater efficacy in preventing the receptor from interacting with its natural ligands, than an inhibitor with a low affinity.
[0042] The term “derived from” as used herein, refers to the source of a sample, a compound or a sequence. In one respect, a sample, a compound or a sequence may be derived from an organism or particular species. In another respect, a sample, a compound or sequence may be derived from a larger complex or sequence.
[0043] The term "pharmaceutically" or "pharmacologically acceptable", as used herein, refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
[0044] The term, "pharmaceutically acceptable carrier", as used herein, includes any and all solvents, or a dispersion medium including, but not limited to, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils, coatings, isotonic and absorption delaying agents, liposome, commercially available cleansers, and the like. Supplementary bioactive ingredients also can be incorporated into such carriers.
[0045] The term, "purified" or “isolated”, as used herein, may refer to a peptide composition that has been subjected to treatment (i.e., for example, fractionation) to remove various other components, and which composition substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the composition (i.e., for example, weight / weight and / or weight / volume). The term "purified to homogeneity" is used to include compositions that have been purified to ‘apparent homogeneity” such that there is single protein species (i.e., for example, based upon SDS-PAGE or HPLC analysis). A purified composition is not intended to mean that all trace impurities have been removed.
[0046] As used herein, the term "substantially purified" refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and more preferably 90% free from other components with which they are naturally associated. An "isolated polynucleotide" is therefore a substantially purified polynucleotide.
[0047] "Nucleic acid sequence" and "nucleotide sequence" as used herein refer to an oligonucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand.
[0048] The term "an isolated nucleic acid”, as used herein, refers to any nucleic acid molecule that has been removed from its natural state (e.g., removed from a cell and is, in a preferred embodiment, free of other genomic nucleic acid).
[0049] The terms "amino acid sequence" and "polypeptide sequence" as used herein, are interchangeable and to refer to a sequence of amino acids.
[0050] The term "portion" when used in reference to a nucleotide sequence refers to fragments of that nucleotide sequence. The fragments may range in size from 5 nucleotide residues to the entire nucleotide sequence minus one nucleic acid residue. When used in reference to an amino acid sequence refers to fragments of that amino acid sequence. The fragment may range in size from 2 amino acid residues to the entire amino acid sequence minus one amino acid residue.
[0051] The term "sample" or “biopsy” as used herein is used in its broadest sense and includes environmental and biological samples. Environmental samples include material from the environment such as soil and water. Biological samples may be animal, including, human, fluid (e.g., blood, plasma and serum), solid (e.g., stool), tissue, liquid foods (e.g., milk), and solid foods (e.g., vegetables). For example, a pulmonary sample may be collected by bronchoalveolar lavage (BAL) which comprises fluid and cells derived from lung tissues. A biological sample may comprise a cell, tissue extract, body fluid, chromosomes or extrachromosomal elements isolated from a cell, genomic DNA (in solution or bound to a solid support such as for Southern blot analysis), RNA (in solution or bound to a solid support such as for Northern blot analysis), cDNA (in solution or bound to a solid support) and the like.
[0052] As used herein, the terms "complementary" or "complementarity" are used in reference to "polynucleotides" and "oligonucleotides" (which are interchangeable terms that refer to a sequence of nucleotides) related by the base-pairing rules. For example, the sequence "C-A-G- T," is complementary to the sequence "G-T-C-A." Complementarity can be "partial" or "total." "Partial" complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. "Total" or "complete" complementarity between nucleic acids is where each and every nucleic acid base is matched with another base under the base pairing rules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods which depend upon binding between nucleic acids.
[0053] The term "poly A site" or "poly A sequence" as used herein denotes a sequence which directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded. The poly A signal utilized in an expression vector may be "heterologous" or "endogenous." An endogenous poly A signal is one that is found naturally at the 3' end of the coding region of a given gene in the genome. A heterologous poly A signal is one which is isolated from one gene and placed 3' of another gene. Efficient expression of recombinant DNA sequences in eukaryotic cells involves expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the poly adenylation signal and are a few hundred nucleotides in length.
[0054] As used herein, the term "gene" means the deoxyribonucleotide sequences comprising the coding region of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences or 5’-UTR. The sequences which are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' untranslated sequences or 3’-UTR. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene which are transcribed into heterogeneous nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5' and 3' end of the sequences which are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the untranslated sequences present on the mRNA transcript). The 5' flanking region may contain regulatory sequences such as promoters and enhancers which control or influence the transcription of the gene. The 3' flanking region may contain sequences which direct the termination of transcription, posttranscriptional cleavage and polyadenylation.
[0055] Brief Description Of The Figures
[0056] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0057] FIG. 1A: An exemplary illustration of a focal gene amplification diagram. Focal gene amplification can occur on distinct chromosomal regions as arrays of sequences Homogenously staining regions (HSRs) or Extrachromosomal DNA (ecDNA).
[0058] FIG. IB: Top Pathway: Transient single-strand breaks (SSBs) which are largely innocuous and quickly repaired in cells that are not actively dividing. Bottom Pathway: Persistent SSBs at high copy number loci within the genome in actively dividing cells (such as cancer cells) have a devastating effect through their conversion into highly cytotoxic single- ended double-strand breaks (DSBs) that occur in large numbers due to the large number of focal amplifications of the target locus.
[0059] FIG. 1C: A Cas9D10Anickase construct example showing how SSBs can be generated in a targeted manner.
[0060] FIG. ID: An illustrative schematic of SSB to DSB conversion. Cas9D10Ais directed to the target site by way of a guide RNA, generating persistent SSBs. During DNA replication, the various SSBs are converted into a lethal number of single-ended DSBs facilitating genomic collapse and cell death.
[0061] FIG. IE: Presentation of representative data showing the average MYCN genome copy number across various neuroblastoma cell lines and HEK293T cells obtained by qPCR (n = 3).
[0062] FIG. IF: Presentation of representative data showing the average MYCN genome copy number in the small cell lung cancer cell line, NCI-H69, and HFF cells as obtained by qPCR (n = 3).
[0063] FIG. 1G: Presentation of representative data showing the average ERBB2 (HERZ) genome copy number in the breast cancer cell line, BT-474, and HFF cells as obtained by qPCR (n = 3).
[0064] FIG. 1H: Presentation of representative data showing the average MYC genome copy number in the non-small cell lung cancer cell line, NCI-H2170, colorectal cancer cell line, NCI- H716, and HFF cells as obtained by qPCR (n = 3). FIG. II: An illustrative schematic of piggy Bac'-integrated sgRNA expression cassettes used to generate stable sgRNA expressing cell lines, and a schematic of in vitro transcribed Cas9D10A- mRNA constructs with variations in the 3’UTR delivered to cell lines.
[0065] FIG. 1J: Assessing the transfection efficiency and longevity of Cas9 protein in target cell lines when delivered as mRNA. SK-N-BE(2)C, NGP, SH-SY5Y, BT-474, and NCI-H2170 cells expressing AAVS1 targeting sgRNA were treated with mRNA (30 nM) encoding SpyCas9 fused at the C-terminus to copGFP by a flexible linker. QIBC expression analysis demonstrated high transfection efficiencies, and GFP positive cells out to 7-days post-treatment and a half-life of ~4 days for most cell lines (n = 3).
[0066] FIG. 2A: Exemplary data showing a positive control for nickase-based cell-killing. Long interspersed nuclear element 1 (LINE-1') is an endogenous transposable element exceeding >1000 copies in all human cell lines (n = 3). Dose dependent nickase toxicity is observed in all of the cell lines with this sgRNA.
[0067] FIG. 2B: Exemplary data showing that A7F( ’ALamplified neuroblastoma cells are rapidly depleted in a dose-dependent manner while neuroblastoma cells with a normal MYCN copy number (SH-SY5Y) and non-neuroblastoma cells (HEK293T) are not significantly affected (n = 3). CHP-212, the cell line with the most modest degree of MYCN amplification is only compromised at the higher Cas9 nickase doses.
[0068] FIG. 2C: Western blot of N-MYC protein expression levels from SK-N-BE(2)C or NGP cells expressing MYCN or AAVS1 sgRNA at 24-hours post-treatment with Cas9D10AmRNA. N- MYC expression remained comparable across all conditions. Outcomes indicate that N-MYC expression is not compromised when targeting Cas9D10Ato a non-genic sequence downstream of the MYCN 3’UTR supporting the notion that loss of cell viability is not due a loss of N-MYC expression.
[0069] FIG. 2D: MYCN expression analysis by qRT-PCR demonstrates a modest reduction in MYCN transcript copy number in SK-N-BE(2)C or NGP A / U W-amplified neuroblastoma cells up to 72-hours post-treatment with Cas9D10A-mRNA (30 nM) when targeting LINE-1 ox MYCN. Data are presented as individual data points around the mean ± s.d. and normalized to untreated cells as a baseline control. Data analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 relative to untreated cells. FIG. 2E: MCM7, a direct transcriptional target of the N-MYC transcription factor, functions to maintain genomic stability during S-phase of the cell cycle. MCM7 expression analysis by qRT-PCR was used as a means of assessing N-MYC activity. MCM7 expression analysis demonstrates an increase inA / CA / 7 expression in SK-N-BE(2)C orNGPMECJV- amplified neuroblastoma cells up to 72-hours post-treatment with Cas9D10A-mRNA (30 nM) when targeting LINE-1 or MYCN. Data are presented as individual data points around the mean ± s.d. and normalized to untreated cells as a baseline control. Data analyzed by multiple unpaired t- tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 relative to untreated cells.
[0070] FIG. 2F: Exemplary data showing that Cas9D10A- mediated cell-killing is not sequencespecific within the MYCN locus. SK-N-BE(2)C and NGP neuroblastoma cells expressing sgRNAs corresponding to alternative sequences within the MYCN gene locus were treated with Cas9D10A- mRNA (30 nM). Reduction in cell viability at 3-days post-treatment is comparable between alternative target sites in A / KCA-amplified neuroblastoma cells (n = 3). A schematic of the additional sgRNA target sites within the MYCN locus is shown. Additional target sites include exon 2 (sgMYCN-2), intron 1 (sgMYCN-3), and 3’UTR (sgMYCN-4). A table containing the sequences corresponding to each target site is shown.
[0071] FIG. 2G: Exemplary data showing that co-delivery of Cas9D10A- mRNA (30 nM) and synthetic sgRNA (300 pmoles) targeting LINE-1 demonstrates effective cell-killing in SK-N- BE(2)C, NGP, and SH-SY5Y cells at 3-days post-treatment (n = 3). Co-delivery of Cas9D10A- mRNA (30 nM) and synthetic sgRNA (300 pmoles) targeting MYCN demonstrates effective cellkilling in A / KGV-amplified neuroblastoma cells (SK-N-BE(2)C and NGP), and not in MYCN non-amplified (SH-SY5Y) neuroblastoma cells at 3-days post-treatment (n = 3).
[0072] FIG. 2H: Targeting of LINE-1 in BT-474, NCI-H716, or NCI-H2170 cells demonstrates a cytotoxic effect similar to that observed when targeting the MYCN locus in A / FGV-amplified neuroblastoma cells. All cells were assessed for changes in cell viability at 3-days post-treatment with Cas9D10A-mRNA (n = 3). Data are presented as mean ± s.d. and normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A.
[0073] FIG. 21: Targeting of ERBB2 (HER2) locus in BT-474 cells or MYC locus in NCI-H716 or NCI-H2170 cells demonstrates a cytotoxic effect similar to that observed when targeting the MYCN \ocm in MFCA-amplified neuroblastoma cells. All cells were assessed for changes in cell viability at 3-days post-treatment with Cas9D10A-mRNA (n = 3). Data are presented as mean ± s.d. and normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A.
[0074] FIG. 2J: Cas9D10A-mediated DNA damage at the MYCN locus promotes population collapse in MYC LV-amplified neuroblastoma cells. Proliferation of MFCW-amplified SK-N- BE(2)C, KELLY, NGP, CHP-212 cells; MYCN non-amplified SH-SY5Y cells; and MFCJV nonamplified, non-neuroblastoma HEK293T cells assessed by quantitative image-based cytometry (QIBC) assisted cell counting at 1-, 2-, and 3-days post-treatment with Cas9D10A-mRNA (30 nM) targeting LINE-1, MYCN, or AAVS1 (n = 3). All cell lines targeted at LINE-1 display substantial growth inhibition and population collapse, whereas all cell lines targeted at AAVS1 display no appreciable alterations in proliferation rate relative to an untreated control. Targeting MYCN was shown to inhibit growth and promote population collapse in MFCA-amplified neuroblastoma cells, whereas proliferation rates in MYCN non-amplified cells (SH-SY5Y & HEK293T) remained comparable to AA VS1- targeted and untreated controls.
[0075] FIG. 2K-A - 2K-L Evaluation of cell proliferation in the presence Cas9D10Atargeting different loci or small molecule inhibitors (SMIs) to be used in combination with Cas9D10A. Population dynamics of MFCA'-amplified cell cultures;
[0076] FIG. 2K-A: SK-N-BE(2)C sgRNA expressing cells;
[0077] FIG. 2K-B: KELLY sgRNA expressing cells;
[0078] FIG. 2K-C: NGP sgRNA expressing cells;
[0079] FIG. 2K-D: CHP-212 sgRNA expressing cells;
[0080] FIG. 2K-E: MYCN non-amplified SH-SY5Y sgRNA expressing cells;
[0081] FIG. 2K-F: non-neuroblastoma HEK293T sgRNA expressing cells;
[0082] FIG. 2K-G: ERBB2 (HER2)-amplified BT-474 sgRNA expressing cells;
[0083] FIG. 2K-H: MFC-amplified NCLH2170 sgRNA expressing cells; and FIG. 2K-I: MFC-amplified NCLH716 sgRNA expressing cells. sgRNA expressing cells monitored at 1-, 2-, and 3-days post-treatment with Cas9D10A-mRNA (30 nM; n = 3) or in the presence of each SMIs at concentrations <ICso in the absence of Cas9D10A co-delivery. Experiments designated by an sgRNA (e.g. sgLINE-1, sgAAVSl, sgMYCN-1, etc.) indicate cells that express that particular sgRNA and were treated with Cas9D10A. Targeting of AAVS1 with Cas9D10Adid not appreciably impact in the proliferation rate of any of the tested cell lines relative to a mock / untreated control. These observations are consistent with Cas9D10A- mediated cell-killing when targeting gene amplifications as opposed to simply a substantial reduction in the rate of cell proliferation.
[0084] FIG. 3A: An illustrative schematic of SpyCas9 DNA cleavage domains, HNH and RuvC, generate breaks the target and non-target DNA strands respectively. DNA cleavage within the non-target strand (not complementary to the guide RNA) by the RuvC domain is inactivated through theD10Amutation such that DNA cleavage only occurs within the target strand (complementary to the guide RNA; caret). DNA cleavage within the target strand (complementary to the guide RNA) by the HNH domain is inactivated through theH840Amutation such that DNA cleavage only occurs within the non-target strand (caret).
[0085] FIG. 3B: Exemplary data showing a comparison of cell viability in the .WFC / V-amplified neuroblastoma cell line SK-N-BE(2)C, expressing LINE-1 or MYCN targeting sgRNA when treated with Cas9D10Aor Cas9H840A- mRNA (30 nM) at 3-days post-treatment (n = 3). Representative image of surviving SK-N-BE(2)C cells stained with calcein AM is shown. Outcomes demonstrate a disproportionate response to Cas9D10A- mediated DNA damage.
[0086] FIG. 3 C: Exemplary data showing cumulative Cas9 nickase - mediated DNA damage in SK-N-BE(2)C cells quantified by single cell gel electrophoresis (comet assay) at 3-days posttreatment with either Cas9D10Aor Cas9H840A- mRNA (30 nM). DNA damaging activity of Cas9D10Ais demonstratively superior to Cas9H840Awhen targeting LINE-1 or MYCN, with no appreciable difference when targeting AAVS1 (n = 3). Representative images of treated cells are shown.
[0087] FIG. 3D: Exemplary data showing a comparison of cell viability in the ATFCTV-amplified (SK-N-BE(2)C and NGP), and MYCN non-amplified (SH-SY5Y) neuroblastoma cell lines expressing LINE-1 or MYCN targeting sgRNA when treated with Cas9D10Aor Cas9H840A(30 nM) at 3-days post-treatment (n = 3). Outcomes demonstrate a disproportionate response to Cas9D10A- mediated DNA damage in additional cell lines. No difference observed between either nickase variant when targeting MYCN in SH-SY5Y cells. FIG. 3E: Comparison of cell viability in the AfFOW-amplified (SK-N-BE(2)C and NGP), and MYCN non-amplified (SH-SY5Y) neuroblastoma cell lines expressing LINE-1 or MYCN targeting sgRNA when treated with Cas9D10A, Cas9H840A, or catalytically inactivated “dead” Cas9 (dCas9; 30 nM) at 3-days post-treatment (n = 3). Outcomes demonstrate a disproportionate response to Cas9D10A- mediated DNA damage in each cell line. Comparable activity observed between Cas9H840Aand dCas9 suggest effector binding at amplified loci, though less potent, is sufficient to induce replication stress. No difference observed between either nickase variant when targeting MYCN in SH-SY5Y cells.
[0088] FIG. 4A: Exemplary data showing cumulative DNA damage (ALXaline) and DSBs (neutral) quantified by single cell gel electrophoresis (comet assay) in SK-N-BE(2)C, KELLY, NGP, CHP-212, SH-SY5Y, and HEK293T cells expressing LINE-1 targeting sgRNA electroporated with Cas9D10A- mRNA (30 nM). DNA damage assessed at 3-days post-treatment (n = 150). Outcomes demonstrate a significant enrichment in DNA damage across all cell lines.
[0089] FIG. 4B: Exemplary data showing cumulative DNA damage (AZXaline) and DSBs (neutral) quantified by single cell gel electrophoresis (comet assay) in SK-N-BE(2)C, KELLY, NGP, CHP-212, SH-SY5Y, and HEK293T cells expressing MYCN targeting sgRNA electroporated with Cas9D10A- mRNA (30 nM). DNA damage assessed at 3-days post-treatment (n = 150). Outcomes demonstrate a significant enrichment in DNA damage in A / KGV-amplified cell lines, and no significant enrichment in DNA damage in MYCN non-amplified cell lines.
[0090] FIG. 4C: Exemplary data showing cumulative DNA damage (^LKaline) and DSBs (neutral) quantified by single cell gel electrophoresis (comet assay) in SK-N-BE(2)C, KELLY, NGP, CHP-212, SH-SY5Y, and HEK293T cells expressing AAVS1 targeting sgRNA electroporated with Cas9ul0A- mRNA (30 nM). DNA damage assessed at 3-days post-treatment (n = 150). Outcomes demonstrate no significant enrichment in DNA damage when targeting AAVS1.
[0091] FIG. 4D: A representative image of cumulative DNA damage (AZXaline; ALK) and DSBs (neutral; Neu) in SK-N-BE(2)C, KELLY, NGP, CHP-212, SH-SY5Y, and HEK293T cells treated cells treated with Cas9D10Atargeting LINE-1, MYCN, or AA ESI.
[0092] FIG. 4E: Exemplary data showing that Cas9D10A- mediated DNA damage promotes hyperactivation of the ATR - mediated DNA damage response pathway. Western blot of DNA damage markers from SK-N-BE(2)C cells expressing LINE-l, MYCN, or AAVS1 targeting sgRNA at 3-days post-treatment with Cas9D10A. LINE-1 and MYCN targeted cells demonstrate a substantial elevation in DNA damage markers.
[0093] FIG. 4F: Exemplary deep sequencing data of genomic DNA isolated from surviving SK- N-BE(2)C, NGP, and SH-SY5Y cells treated with Cas9D10Atargeting MYCN. Outcomes demonstrate the local mutagenic rate of Cas9D10Ais low, and concerns for target site depletion post-treatment is negligible, permitting the repeated use of a sgRNA in sequential treatments to promote cell death.
[0094] FIG. 4G: Extension of deep sequencing data presented in FIG. 4F. Mutation position distribution demonstrates deletions as the highest frequency sequence alteration in SK-N- BE(2)C, NGP, and SH-SY5Y cells treated with post-treatment with Cas9D10Atargeting MYCN, consistent with DNA resection following single-ended DSB (seDSB) formation.
[0095] FIG. 4H: Amplicon-sequencing of the sgMYCN-1 target site from genomic DNA isolated from surviving SK-N-BE(2)C cells expressing sgMYCN-1 at 3-days post-treatment with Cas9WT-mRNA (30 nM). Allele frequency tables reveal an array of sgMYCN-1 target site sequence alterations post-treatment with Cas9WTthat are consistent with the non-homologous end-joining DNA repair pathway.
[0096] FIG. 41: Amplicon-sequencing of the sgMYCN-1 target site from genomic DNA isolated from surviving SK-N-BE(2)C cells expressing sgMYCN-1 at 3-days post-treatment with Cas9D10A-mRNA (30 nM). Outcomes demonstrate the local mutagenic burden of Cas9D10Atreatment is low when targeting amplified loci relative to Cas9WT(See, Fig. 4H). Target site depletion post-treatment is negligible, likely permitting the continued use of an sgRNA in repeatdosing to promote cell death. Allele frequency tables reveal deletions as the highest frequency sequence-alteration, consistent with resection at the site of a seDSB or double-ended DSB (deDSB) produced during replication.
[0097] FIG. 5A: Flow cytometric analysis of SK-N-BE(2)C cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA at 1-, 2-, and 3-days post-treatment with Cas9D10A- mRNA (30 nM). LINE-1 and MYCN targeted cells present with an extension of S-phase of 1-day post-treatment and eventual arrest in G2 / M at 2-, and 3-days post-treatment with Cas9D10A(n = 3). AAYS1 targeted cells demonstrate no apparent alteration in cell cycle progression (n = 3). FIG. 5B: Exemplary data showing that replication stress may be marked by elevations in cytosolic Ca2+, and reactive oxygen species (ROS). Quantitative image-based cytometric (QIBC) analyses of intracellular Ca2+and ROS influx in SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA at 1-, 2-, and 3 -days post-treatment with Cas9D10A- mRNA (30 nM) (n = 3). Outcomes suggest Cas9D10A- mediated DNA damage induces substantial replication stress when targeting amplified loci.
[0098] FIG. 5C: Overexpression of RPA can fortify cells from the catastrophic effect of replication stress. Schematic of expression cassette and Western blot demonstrating RPA overexpression in SK-N-BE(2)C cells expressing LINE-1 or MYCN sgRNA are shown.
[0099] FIG. 5D: Excessive DNA resection by EXO1 propagates genomic instability and toxicity by interfering with DNA repair. Phosphorylation of EXO1 (pS746) by the ATR-CHK1 or CMKK2-AMPK axes modulates EXO1 activity in response to replication stress and serves to protect DNA ends exposed by DSBs from EXO1 - mediated resection. Impact of EXO 1 downregulation on cell viability assessed in SK-N-BE(2)C, or SK-N-BE(2)C-RPA(123) cells expressing LINE-1 or MYCN targeting sgRNA treated with Cas9D10A, Cas9D10A+ siRNA, or siRNA only. Cells treated with both Cas9D10A, and siRNA were transfected with siRNA for 24 hours prior to the delivery of Cas9D10A- mRNA (30 nM). For each condition, cell viability was assessed at 3-days post-treatment (n = 3). Independently, the downregulation of EXO1 and the upregulation of RPA attenuates Cas9D10A- induced toxicity (n = 3), supporting the notion of EXO1 hyper-resection and RPA depletion following Cas9D10A- mediated DNA damage. Data are presented as mean ± s.d. normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001.
[0100] FIG. 5E: DNA2 is partially redundant with EXO1 for DNA resection during S-phase DNA damage repair. Downregulation of EXO 1, but not DNA2, attenuates Cas9D10A- mediated toxicity. SK-N-BE(2)C cells expressing LINE-1 or MYCN targeting sgRNA were transfected with an siRNA targeting EXO1, DNA2, or a non-targeting control, recovered for 24 hours, and then treated with Cas9D10A-mRNA (30 nM). Changes in cell viability were assessed at 3-days post-treatment with Cas9D10A(n = 3). Data are presented as mean ± s.d. relative to an AAVS1 targeted control.
[0101] FIG. 5F: Downregulation of EXO 1 reduces Cas9D10A-induced toxicity in MYCN- amplified neuroblastoma cells. Proliferation of A / ECA-amplified sgRNA expressing SK-N- BE(2)C cells transfected with siRNA targeting EX01, DNA2, or non-targeting control for 24 hours prior to the delivery of Cas9D10A- mRNA (30 nM) was assessed by quantitative imagebased cytometry (QIBC) assisted cell counting at 1-, 2-, and 3-days post-treatment with Cas9D10Atargeting LINE-1, MYCN, or AAVS1 (n = 3). Data are presented as mean ± s.d.
[0102] FIG. 5G: Representative histograms of flow cytometric cell cycle analysis of SK-N- BE(2)C cells transfected with siRNA targeting EXO1, DNA2, or a non-targeting control without Cas9D10Adelivery at 1 -, 2-, and 3-days post-transfection (n = 3). In the absence of Cas9D10Acells treated with siEXOl displayed appreciable stalling in S-phase of the cell cycle after 48-hours (FIG. 5D - F). Conceivably, the increase observed in cell viability in SK-N-BE(2)C cells treated with Cas9D10Atargeting LINE-1 or MYCN may be due to slower rates of cell proliferation or a decrease in extensive 5’ DNA resection due to the reduction of EXO 1 activity.
[0103] FIG. 5H: Downregulation of EXO 1, but not DNA2 alters DNA repair outcomes for Cas9D10A-mediated editing in AYFCA-amplified neuroblastoma cells. Amplicon-sequencing of the sgMYCN-1 target site from genomic DNA isolated from surviving SK-N-BE(2)C cells transfected with a EXO1 or DNA2 - targeting siRNA for 24 hours prior to the delivery of Cas9D10A- mRNA (30 nM) at 3-days post-treatment with Cas9D10A. Editing outcomes suggest that the downregulation of EXO 1 activity alters DNA repair outcomes of Cas9D10A-mediated, replication-dependent DSBs as evident by the increased sequence modifications at the sgMYCN- 1 target site.
[0104] FIG. 51: Allele-frequency table corresponding to editing outcomes post-treatment of SK- N-BE(2)C EXO1 knockdown cells with Cas9D10A- mRNA targeting MYCN (30 nM; See, FIG. 5H).
[0105] FIG. 5 J: Allele-frequency table corresponding to editing outcomes post-treatment of SK- N-BE(2)C DNA2 knockdown cells with Cas9D10A- mRNA targeting MYCN (30 nM; See, FIG. 5H). FIG. 6A: Western blot of caspase-3 in NGP and SH-SY5Y cells expressing LINE-I, MYCN, or A A VS I targeting sgRNA to screen for the activation of intrinsic apoptosis factors in p53 wild-type neuroblastoma cells. Activation of caspase-3 was assessed at 3-days posttreatment with Cas9D10A- mRNA (30 nM). SH-SY5Y cells co-incubated with staurosporine (STS; 1 pM) included as a positive control. No apparent caspase-3 activation was detected when targeting LINE-1, MYCN, ox AAV SI with Cas9D10A. Observations support the notion of a cell death pathway alternative to canonical p53-dependent, caspase - mediated apoptosis.
[0106] FIG. 6B: ATKGV-amplified neuroblastoma cell lines, SK-N-BE(2)C (p53 -deficient) and NGP (p53-WT) expressing LINE-1 ox MYCN targeting sgRNA exhibit no appreciable change in Cas9D10A- mediated cell-killing efficacy when supplemented with a caspase-3 inhibitor, Z- DEVD-FMK (18 pM), at 3-days post-treatment with Cas9D10A- mRNA (30 nM; n = 3). No appreciable difference in the efficacy of Cas9D10A- mediated cell-killing was observed. Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using A4E57 sgRNA expressing cells as a baseline control.
[0107] FIG. 6C: F / FC.Y-amplified neuroblastoma cell lines, SK-N-BE(2)C (p53 -deficient) and NGP (p53-WT) expressing LINE-1 ox MYCN targeting sgRNA exhibit no appreciable change in Cas9D10A- mediated cell-killing efficacy when supplemented with pifithirin-a (PFTot) (20 pM), a presumed inhibitor of p53 activity and apoptosis, at 3-days post-treatment with Cas9D10A- mRNA (30 nM; n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. No appreciable difference in the efficacy of Cas9D10A- mediated cell-killing was observed. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0108] FIG. 6D: Exemplary data showing a Western blot of poly [ADP-Ribose] (PAR), and PARP1 in SK-N-BE(2)C cells expressing LINE-1, MYCN, oxAAVSl targeting sgRNA. Ca2+and ROS influx is known to elicit PARP1 hyperactivation subsequent to DNA damage. Enrichment of poly-ADP ribosylation of endogenous proteins is a marker of PARP1 hyperactivation. Cleavage of PARP1 is an indicator of cell death. SK-N-BE(2)C cells treated with Cas9D10A- mRNA (30 nM) targeting LINE-l or MYCN demonstrate enrichment of PARylation, and PARP1 cleavage at 3-days post-treatment. PARP1 cleavage fragments observed do not correspond to caspase-mediated cleavage (apoptosis), rather calpain and cathepsin proteases - indicative of necrotic cell death.
[0109] FIG. 6E: Exemplary data showing intracellular ATP and NAD+levels in SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing LINE-1, MYCN targeting sgRNA at 3-days post-treatment with Cas9D10A- mRNA (30 nM). Depletion of ATP and NAD+is consistent with PARP1 hyperactivation and is observed in response to Cas9D10A- mediated DNA damage at LINE-1 in all cells, and MYCN in ATFtW-amplified neuroblastoma cell lines (SK-N-BE(2)C and NGP; n = 3). Supplementation of Cas9D10Awith the PARP inhibitor, rucaparib (10 pM) attenuates the depletion of ATP and NAD+post-treatment with Cas9D10A.
[0110] FIG. 6F: Exemplary data showing a Western blot of calpain 1 and calpain 2 in SK-N- BE(2)C cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA treated with Cas9D10A- mRNA (30 nM) at 3-days post-treatment. Calpains are Ca21-activated cysteine proteases. Autoproteolytic cleavage suggest calpain activation, consistent with the PARP1 cleavage fragments demonstrated in FIG. 6D.
[0111] FIG. 6G: Calpain activity assessment in MFGV-amplified SK-N-BE(2)C and NGP cells expressing LINE-1, MYCN, or AAVS1 sgRNA at 3 days post-treatment with Cas9D10A-mRNA (30 nM; n = 3). Calpain activity was induced in both cell lines through the addition of CaC12 in the growth media. Data are presented as mean ± s.d. normalized relative to calpain activity of cells expressing AAFS1 targeting sgRNA treated with Cas9D10A. Data were analyzed multiple unpaired t-tests; ***, P < 0.001; ****, P < 0.0001.
[0112] FIG. 6H: ATKCN-amplified neuroblastoma cells display an enrichment in extracellular lactate dehydrogenase (LDH) LDH, a canonical marker of necrotic cell death, following treatment with Cas9D10Atargeting amplified loci. Lactate dehydrogenase (LDH) activity assessment in in ATFCV-amplified SK-N-BE(2)C and NGP cells expressing LINE-1, MYCN, or AAVS1 sgRNA at 3-days post-treatment with Cas9D10A-mRNA (30 nM; n = 3). Data are presented as mean ± s.d. and were analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** p < 0.01; ***, P < 0.001; ****, P < 0.0001 using untreated cells as a baseline control. FIG. 7A: Exemplary data showing that co-treatment of SK-N-BE(2)C, KELLY, NGP, CHP-212, and SH-SY5Y cells expressing LINE-1 targeting sgRNA with Cas9D10A- mRNA (7.5
[0113] - 30 nM) and a PARP inhibitor, rucaparib (10 pM). Inhibition of PARP1 in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). PARP inhibition in CHP-212 and KELLY cells did not demonstrate an appreciable change in cell viability.
[0114] FIG. 7B: Exemplary data showing that co-treatment of SK-N-BE(2)C, KELLY, NGP, CHP-212, and SH-SY5Y cells expressing MYCN targeting sgRNA with Cas9D10A- mRNA (7.5
[0115] - 30 nM) and a PARP inhibitor, rucaparib (10 pM). Inhibition of PARP1 in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). PARP inhibition in CHP-212 and KELLY cells did not demonstrate an appreciable change in cell viability.
[0116] FIG. 7C: Exemplary data showing co-treatment of BT474 cells expressing ERBB2 (HER2) targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a PARP inhibitor, rucaparib (10 pM). Inhibition of PARP1 in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0117] FIG. 7D: Co-treatment ofNCI-H716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) without or with a PARP inhibitor, rucaparib (10 pM). Inhibition of PARP1 in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0118] FIG. 7E: Co-treatment ofNCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) without or with a PARP inhibitor, rucaparib (10 pM). Inhibition of PARP1 in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0119] FIG. 7F: Supplementation of Cas9D10Awith PARP inhibitors, rucaparib (10 pM) and olaparib (10 pM), that have different allosteric effects on the recognition of DNA lesions by PARP1 were not observed to attenuate Cas9D10A- mediated DNA damage. SK-N-BE(2)C cells expressing either LINE-1 ox MYCN targeting sgRNA were assessed for changes in Cas9D10A- mediated DNA damage when applied in combination with different PARP inhibitors (10 pM). Individual cells were assessed for DNA damage at 3-days post-treatment by alkaline comet assay. Data are presented as individual data points around the median (black line; n = 50).
[0120] FIG. 7G: Comparable inhibition of Cas9D10A- mediated cell-killing is observed when using PARP inhibitors, rucaparib (10 pM) or olaparib (10 pM), that have different allosteric effects on the recognition of DNA lesions by PARP1. Experiments in A / FCA'-amplified neuroblastoma cells, SK-N-BE(2)C and NGP, when targeting LINE-1 with Cas9D10A-mRNA (30 pM; n = 3). These observations suggest that the reduced efficacy of Cas9D10A- mediated cellkilling when combined with a PARP inhibitor is due to a reduction in PARP1 catalytic activity (See, FIG. 6E). These observations are consistent with the extensive Cas9D10A-mediated DNA damage occurring during DNA replication leading to PARP1 hyperactivation followed by necrotic cell death.
[0121] FIG. 7H: Comparable inhibition of Cas9D10A- mediated cell-killing is observed when using PARP inhibitors, rucaparib (10 pM) or olaparib (10 pM), that have different allosteric effects on the recognition of DNA lesions by PARP1. Experiments in A / FGV-amplified neuroblastoma cells, SK-N-BE(2)C and NGP, when targeting MYCN with Cas9D10A-mRNA (30 pM; n = 3). These observations suggest that the reduced efficacy of Cas9D10A- mediated cellkilling when combined with a PARP inhibitor is due to a reduction in PARP1 catalytic activity (See, FIG. 6E). These observations are consistent with the extensive Cas9D10A-mediated DNA damage occurring during DNA replication leading to PARP1 hyperactivation followed by necrotic cell death.
[0122] FIG. 71: Evaluating the effects of low-dose PARP inhibitors on cell cycle progression in MFCA-amplified SK-N-BE(2)C cells. Representative histograms of flow cytometric cell cycle analysis of SK-N-BE(2)C cells supplemented with PARP inhibitors at their respective IC50. SK- N-BE(2)C cells were incubated with rucaparib (10 pM) or olaparib (10 pM) in the absence of Cas9D10Aand monitored for aberrations in cell cycle progression at 1-, 2-, and 3-days (n = 3). Only a modest increase in the fraction of cells in the G2 / M phase of the cell cycle was observed after 24-hours of incubation with either rucaparib or olaparib relative to an untreated control.
[0123] FIG. 8A: Exemplary data showing that co-treatment of SK-N-BE(2)C, KELLY, NGP, CHP-212, and SH-SY5Y cells expressing LINE-1 targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a calpain inhibitor, calpastatin (CAST; 20 nM). Inhibition of calpain in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0124] FIG. 8B: Exemplary data showing that co-treatment of SK-N-BE(2)C, KELLY, NGP, CHP-212, and SH-SY5Y cells expressing MYCN targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a calpain inhibitor, calpastatin (CAST; 20 nM). Inhibition of calpain in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0125] FIG. 8C: Exemplary data showing that co-treatment of BT474 cells expressing ERBB2 (HER2) targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a calpain inhibitor, calpastatin (CAST; 20 nM). Inhibition of calpain in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3).
[0126] FIG. 8D: Co-treatment ofNCLH716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) with or without a calpain inhibitor, calpastatin (20 nM). Inhibition of calpain in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** p < 0.01; ***, P < 0.001; ****, P < 0.0001.
[0127] FIG. 8E: Co-treatment ofNCLH2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) with or without a calpain inhibitor, calpastatin (20 nM). Inhibition of calpain in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001.
[0128] FIG. 9A: Exemplary data showing that co-treatment of SK-N-BE(2)C, NGP, and SH- SY5Y cells expressing LINE-1 targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a AURKA inhibitor, alisertib (0.5 pM). Inhibition of AURKA in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). Observations support the notion that cell division is a factor of Cas9D10A- induced toxicity.
[0129] FIG. 9B: Co-treatment of SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing MYCN targeting sgRNA with Cas9D10A- mRNA (7.5 - 30 nM) and a AURKA inhibitor, alisertib (0.5 pM). Inhibition of AURKA in the presence of Cas9D10Ais protective, as indicated by the reduced cell-killing efficacy of Cas9D10Aat 3-days post-treatment (n = 3). Observations support the notion that cell division is a factor of Cas9D10A- induced toxicity.
[0130] FIG. 10A: Surviving MFCA-amplified neuroblastoma cells demonstrate an enrichment in micronuclei formation. Flow cytometric analysis of nuclei and micronuclei for SK-N-BE(2)C cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA at 3-days post-treatment with Cas9D10A- mRNA (30 nM). Surviving LINE-1 and MYCN targeted cells display a substantial enrichment in micronuclei (n = 3). No appreciable enrichment was observed in AAVS1 relative to an untreated control (n = 3).
[0131] FIG. 10B: Presentation of representative data demonstrated in FIG. 10A. SK-N-BE(2)C cells expressing LINE-1 or MYCN targeting sgRNA demonstrate a substantial enrichment in micronuclei at 3-days post-treatment with Cas9D10A- mRNA (30 nM; n = 3). SK-N-BE(2)C cells expressing 44 VS1 targeting sgRNA did not demonstrate an appreciable enrichment in micronuclei relative to an untreated control (n = 3).
[0132] FIG. 10C: Representative image of Hoechst 33342 stained nuclei and micronuclei (MN) isolated from AfFCA-amplified, SK-N-BE(2)C neuroblastoma cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA at 3-days post-treatment with Cas9D10A- mRNA (30 nM).
[0133] FIG. 10D: MYCN copy number variance determined by real-time qPCR demonstrates a reduction in MYCN copy number at 3-days post-treatment with Cas9ul0A-mRNA (30 nM) when targeting MYCN in A7FCA -amplified cell lines (SK-N-BE(2)C and NGP) but not in MYCN nonamplified cells (SH-SY5Y; n = 6). Reduction of MYCN genome copy number was not observed to impair N-MYC expression (See, FIG. 2C). Data are presented as individual data points around the mean ± s.d. and normalized to untreated cells as a baseline control. Data analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 relative to untreated cells. FIG. 10E: Surviving ATKCY-amplified neuroblastoma cells demonstrate markers of neuronal differentiation. SK-N-BE(2)C cells expressing MYCN or AAVS1 targeting sgRNA treated with Cas9D10A- mRNA (30 nM) assessed for enrichment in the neuronal marker, class III beta-tubulin (TUBB3) at 5-days post-treatment. SK-N-BE(2)C cells treated with all-trans retinoic acid (ATRA; 10 pM) included as a positive control. MYCN targeted SK-N-BE(2)C cells demonstrate a significant enrichment in TUBB3 expression, whereas AAVS1 targeted SK-N- BE(2)C cells demonstrate no appreciable enrichment in TUBB3 relative to an untreated control (n = 3). Data are presented as mean ± s.d. normalized to untreated cells. Data were analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using untreated cells as a baseline control.
[0134] FIG. 10F: Surviving ATFCTV-amplified neuroblastoma cells demonstrate markers of reduced proliferation. SK-N-BE(2)C cells expressing MYCN or A AVS1 targeting sgRNA treated with Cas9D10A- mRNA (30 nM) assessed for a reduction in the proliferation marker, Ki-67 at 5- days post-treatment. SK-N-BE(2)C cells treated with ATRA (10 pM) included as a positive control. MYCN targeted SK-N-BE(2)C cells demonstrate a significant reduction in Ki-67 expression, whereas AAVS1 targeted SK-N-BE(2)C cells demonstrate no appreciable reduction in Ki-67 expression relative to an untreated control (n = 3). Data are presented as mean ± s.d. normalized to untreated cells. Data were analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** p < 0.01; ***, P < 0.001; ****, P < 0.0001 using untreated cells as a baseline control.
[0135] FIG. 10G: Representative image of immunocytochemistry data in FIG. 10E. SK-N- BE(2)C cells demonstrate an impaired proliferation ability, as well as morphological changes consistent with neuronal differentiation, such as de novo neurite extension and an enrichment in TUBB3 expression (AF488 / green). Nuclei (Hoechst 33342 / blue) were stained for reference.
[0136] FIG. 11 A: Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. SK-N- BE(2)C, KELLY, NGP, CHP-212 and SH-SY5Y neuroblastoma cells expressing LINE-1 targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the CHK1 inhibitor (CHKli), MK8776 (500 nM). Co-treatment with a CHKli potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA in all cell lines when targeting LINE-1 (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0137] FIG. 1 IB: Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. SK-N- BE(2)C, KELLY, NGP, CHP-212 and SH-SY5Y neuroblastoma cells expressing MYCN targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the CHK1 inhibitor (CHKli), MK8776 (500 nM). Co-treatment with a CHKli potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA in all cell lines when targeting MYCN in MFCA-amplified cell lines (SK-N-BE(2)C, KELLY, NGP, and CHP-212) (n = 3). Only a modest reduction in cell viability was observed when targeting MYCN in the MYCN non-amplified cell line (SH-SY5Y; n = 3), likely due to the non-specific toxicity of the CHKli. Data are presented as mean ± s.d. normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0138] FIG. 11C: Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. BT474 ductal carcinoma cells expressing LINE-1 or ERBB2 (HER2) targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the CHK1 inhibitor (CHKli), MK8776 (500 nM). Cotreatment with a CHKli potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA when targeting LINE-1 or ERBB2 (HER2) (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, p < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0139] FIG. 1 ID: Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. NCLH716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the CHK1 inhibitor (CHKli), MK8776 (500 nM). Co-treatment with a CHKli potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA when targeting LINE-1 or MYC (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0140] FIG. 1 IE: Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. NCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the CHK1 inhibitor (CHKli), MK8776 (500 nM). Co-treatment with a CHKli potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA when targeting LINE-1 or MYC (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing A A l'S I targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0141] FIG. 1 IF: Cellular toxicity of Cas9D10Ais augmented by an ATR inhibitor (ATRi) at low concentrations of Cas9D10A- mRNA. SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing LINE-1 targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). Co-treatment with an ATRi potentiated cell-killing across all cell lines when applying low concentrations of Cas9D10A- mRNA and targeting LINE-1 (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AA l'Sl sgRNA expressing cells as a baseline control.
[0142] FIG. 11G: Exemplary data showing that cellular toxicity of Cas9D10Ais augmented by an ATR inhibitor. SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing MYCN targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). Co-treatment with an ATRi potentiated cellkilling and significantly improved the efficacy of Cas9D10Aat lesser concentrations when targeting MYCN in .WFCA-amplified cell lines (SK-N-BE(2)C and NGP; n = 3). Only a modest reduction in cell viability was observed when targeting MYCN in the MYCN non-amplified cell line (SH-SY5Y; n = 3), likely due to the non-specific toxicity of the ATRi.
[0143] FIG. 11H: Cellular toxicity of Cas9D10Ais augmented by an ATR inhibitor (ATRi) at low concentrations of Cas9D10A- mRNA. BT474 ductal carcinoma cells expressing LINE-1 or ERBB2 (HER2) targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). Co-treatment with an ATRi potentiated cell-killing when applying low concentrations of Cas9D10A- mRNA and targeting LINE-1 or ERBB2 (HER2; n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing dd VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0144] FIG. I ll: Cellular toxicity of Cas9D10Ais augmented by an ATR inhibitor at low concentrations of Cas9D10A- mRNA in NCI-H716 colorectal adenocarcinoma cells expressing LINE-1 targeting sgRNA, but not MYC targeting sgRNA. NCI-H716 cells were treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). Co-treatment with an ATRi modestly improved Cas9D10A- mediated cell-killing when applying low concentrations of Cas9D10A- mRNA and targeting LINE-1 (n = 3). No significant improvement in efficacy was observed when targeting MYC at low concentrations of Cas9D10A- mRNA. Data are presented as mean ± s.d. normalized relative to viability of cells expressing AAVS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0145] FIG. 11J: Cellular toxicity of Cas9D10Ais not appreciably affected in combination with an ATR inhibitor in NCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA. NCI-H2170 cells were treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). No substantial improvement in efficacy was observed when targeting LINE-1 ox MYC at low concentrations of Cas9D10A- mRNA (n = 3). Data are presented as mean ± s.d. normalized relative to viability of cells expressing AA VS1 targeting sgRNA treated with Cas9D10A. Data were analyzed using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, p < 0.0001 using AAVS1 sgRNA expressing cells as a baseline control.
[0146] FIG. 12A: Co-amplification of oncogenes in cancer. Neuroblastoma cell line IMR-32 harbors both MYCN and ALK gene amplifications. Average MYCN and ALK genome copy number in IMR-32 cells determined by qPCR (n = 3). Data are presented as mean ± s.e.m and normalized to HFF cells as a baseline control.D10A
[0147] FIG. 12B: Cellular toxicity of Cas9D10Ain A / Ft A'-amplified neuroblastoma cells is augmented by multiplex targeting. Targeting of LINE-1, MYCN, ALK, or MYCN and ALK in IMR-32 cells (2 x 105) with Cas9D10Ademonstrates a dose-dependent cytotoxic effect. Multiplex targeting of MYCN and ALK increases Cas9D10A-mediated cell-killing relative to targeting MYCN ox ALK individually. Data were analyzed using a two-way ANOVA with a Tukey’s multiple comparison test; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001. Data is presented as mean ± s.d. and normalized relative to viability of cells expressing AA IrSl targeting sgRNA treated with Cas9D10A.
[0148] FIG. 12C: Enhancement of Cas9D10A- mediated cell-killing efficacy is dependent on the increase in target site copy number and independent of gene function. No additional cellular toxicity is observed for multiplex targeting of an amplified (MYCN or ALK) locus with a nonamplified (AAVSl) locus in IMR-32 cells with Cas9D10A-mRNA (15 nM). Data were analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001. Data is presented as mean ± s.d. and normalized relative to viability of cells expressing AAVSl targeting sgRNA treated with Cas9D10A.
[0149] FIG. 12D: Multiplex targeting of non-amplified loci in SH-SY5Y cells with Cas9D10A- mRNA (30 nM) resulted in similar rates of cell viability to targeting individual loci. Cells were assessed for changes in cell viability at 3-days post-treatment with Cas9D10A-mRNA (n = 3). Data is presented as mean ± s.d. and normalized relative to viability of cells expressing AAVSl targeting sgRNA treated with Cas9D10A.
[0150] FIG. 13 A: Cas9D10A-mediated cell-killing demonstrates negligible non-specific toxicity in post-mitotic cells. Representative images of neuronally differentiated SK-N-BE(2)C cells stained with crystal violet (grayscale) at 3-days post-transfection when targeting LINE-1 or AAVSl with either Cas9WTor Cas9D10A-mRNA. Neuronally differentiated SK-N-BE(2)C cells display high sensitivity to Cas9WT-mediated DSBs at both target sites.
[0151] FIG. 13B: Presentation of data corresponding to FIG. 13A. Cell confluency was used as a metric to assess cellular toxicity in neuronally differentiated SK-N-BE(2)C cells when targeting LINE-1 or AAVSl with Cas9WTor Cas9D10A. Neuronally differentiated SK-N-BE(2)C cells display high sensitivity to Cas9WT-mediated DSBs at both target sites. No significant cellular toxicity was observed when targeting LINE-1 (P > 0.05) ox AA VS1 with Cas9D10A. Data were analyzed by multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001 using untreated cells as a baseline control.
[0152] FIG. 13C: Cas9D10A-mediated cell-killing demonstrates negligible non-specific toxicity in hematopoietic stem and progenitor cells (HSPCs; CD34+). Impact on cell viability of hematopoietic stem and progenitor cells (HSPCs; CD34+) post-treatment with Cas9WTor Cas9D10A-mRNA (30 nM) and a synthetic sgRNA (30 pM) targeting MYCN or AAVS1. Changes in cell viability assessed at 3-days post-treatment with Cas9WTor Cas9D10Arelative to mRNA only (GFP - mRNA), sgRNA only (1 : 1, sgMYCN-1 + sgAAVSl), or electroporation only (mock) controls (n = 3). Data are presented as mean ± s.d. normalized to mock-treated (electroporation only) cells.
[0153] FIG. 13D: Target site editing rates in surviving HSPCs at 3-days post-treatment with Cas9WTor Cas9D10Atargeting MYCN or AAVS I determined by Sanger sequencing (n = 3). Cas9WTdisplayed appreciably editing activity within the AAVS1 target site, but only produced modest rates of editing within the MYCN locus. Importantly, Cas9D10Aediting activity at the MYCN locus in HSPCs was below the limit of detection by Sanger sequencing. When targeting the MYCN locus, these observations suggest the mutagenic potential of Cas9D10Ais minimal compared to Cas9WT.
[0154] FIG. 13E: Supporting data corresponding to the data in FIG. 13A demonstrating (left) cell viability and (right) target site editing rate in MYCN non-amplified SH-SY5Y cells expressing MYCN or AAVS1 targeting sgRNA at 3-days post-treatment with Cas9WT- mRNA (30 nM) as a control (n = 3). An assessment of Cas9WT- mediated genome editing with the MYCN or AAVS1 loci in MYCN non-amplified neuroblastoma cells, SH-SY5Y, resulted in similar editing activity and viability as observed in HSPCs (FIG. 13C).
[0155] FIG. 14A: A flow diagram demonstrating an endogenous feedback loop in MYCN- amplified neuroblastoma. MDM2 negatively regulates p53, while also mediating MYCN mRNA stability through interactions with the MYCN 3’UTR. Stabilization of the MYCN transcript enhances the translational efficiency of MYCN mRNA, which positively regulates p53. Positive regulation of p53 by MYCN increases MDM2 expression. Exploitation this mechanism may confer specificity for the translation of Cas9D10A- mRNA to occur only in neuroblastoma cells efficiently, which typically overexpress MDM2.
[0156] FIG. 14B: Delivery of MYCN 3’UTR modified Cas9D10A- mRNA appears stable in / WFCA -amplified neuroblastoma cells. A human codon optimized Gaussia luciferase (hGluc) mRNA transcript containing the mt-RNRl 3’UTR (-) or a. MYCN 3’UTR (+) was delivered to both SK-N-BE(2)C(neuroblastoma) and HEK293T (non-neuroblastoma) cells. Luminescence intensity as a marker of expression levels measured after 24 hours and normalized to non-treated HEK293T cells (n = 3).
[0157] FIG. 14C: Replacing the mt-RNRl 3’UTR (generic) with a MYCN 3’UTR did not reduce the efficacy of Cas9D10AmRNA-mediated cell killing in SK-N-BE(2)C cells expressing either LINE-1 or MYCN targeting sgRNA (n = 3).
[0158] FIG. 15 A: A schematic of the Cas9D10A- mRNA for therapeutic delivery. Demonstrates a Cas9D10A- mRNA construct and sgRNA encapsulated by a lipid nanoparticle (LNP). Alternatively, Cas9D10A- mRNA and sgRNA may be encapsulated separately (not diagramed).
[0159] FIG. 15B: Intratumoral delivery of Cas9D10A- mRNA - LNPs promotes tumor stasis in NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice engrafted subcutaneously with MYCN - amplified, SK-N-BE(2)C neuroblastoma cells expressing MYCN or AAVS1 targeting sgRNA (n = 9 mice total (5M / 4F); n = 3 mice per condition). Cas9D10A- mRNA - LNP treatment was initiated once mice achieved an average tumor volume of -100 mm3. Mice were injected 3 times with Cas9D10A- mRNA (3 mg / kg) encapsulated in an ionizable LNP carrier (DLin-MC3-DMA) or a vehicle only control (IX PBS; lOU / mL heparin; 12% sucrose (w / v); pH = 7.4) with 48-hour intervals between injections starting at time (T) = 0 - days post-treatment. Horizontal dotted line (black) represents the maximum tumor volume threshold. Vertical dotted line (black) represents the final injection T = 5-days post-treatment.
[0160] FIG. 15C : Representative bioluminescent image of orthotopically xenografted NOD.Cg- Prkdcscid I12rgtmlWjl / SzJ (NSG) in vivo at 12-days post-engraftment with ATECV-amplified, SK-N-BE(2)C cells. Mice are engrafted within the renal capsule with SK-N-BE(2)C cells modified to express the bioluminescent protein, firefly luciferase (FLuc), and fluorescent protein, mCherry, as a stable transgene (SK-N-BE(2)C-M2AF). FIG. 15D: Representative bioluminescent image of organs isolated from orthotopically xenografted NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) at 16-days post-engraftment with ALFCA-amplified, SK-N-BE(2)C-M2AF cells (n = 10 mice total (10M); n = 5 mice per condition). Mice received two injections of Gaussia Luciferase (GLuc) - mRNA (3 mg / kg) encapsulated in an ionizable LNP carrier (DLin-MC3-DMA) or a vehicle control (IX PBS; lOU / mL heparin; 12% sucrose (w / v); pH = 7.4). LNPs were administered intravenously (IV) with a 48-hour interval between injections. Observations indicate potent tumoral uptake of GLuc - mRNA - LNPs when delivered systemically.
[0161] FIG. 15E: Representative flow cytometry histograms of SK-N-BE(2)C-M2AF cells isolated from orthotopically xenografted NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) at 13-days post-engraftment with / WFCN-amplified, SK-N-BE(2)C-M2AF cells (n = 5 mice total (5M); n = 3 test; n = 2 control). Mice received a single injection of GFP - mRNA (3 mg / kg) encapsulated in an ionizable LNP carrier (DLin-MC3-DMA) or a vehicle control (IX PBS; lOU / mL heparin; 12% sucrose (w / v); pH = 7.4). Injections were administered intravenously (IV). SK-N-BE(2)C- M2AF cells were isolated 24-hours post-injection from the primary tumor by generating a single cell suspension to assess cell-specific uptake in mCherry marked tumor cells following a single administration of GFP - mRNA - LNPs.
[0162] FIG. 15F: A schematic of surface-modified LNP carriers to augment tissue-specific uptake of Cas9D10A- mRNA and sgRNA. Enrichment of tissue-specific uptake through the conjugation of monoclonal antibodies or antibody fragments such as single-chain variable fragments (scFv) targeting tumor-specific antigens (TSA) or tumor-associated antigens (TAA) on the cell surface. Examples include surface markers disialoganglioside (GD2) or CD44 in adrenergic or mesenchymal neuroblastoma cells, respectively.
[0163] FIG. 15G: Representative immunocytochemistry flow cytometric analysis of SK-N- BE(2)C (GD2 +) and HEK293T (GD2 -) cells incubated with Dinutuximab, an anti-GD2 monoclonal antibody (mAb), an anti-GD2 scFv (chl4.18), or an isotype control to assess cellsurface binding activity (n = 3). SK-N-BE(2)C cells displayed a -238 and -109 - fold enrichment in bound anti-GD2 mAb and anti-GD2 scFv, respectively. HEK293T cells displayed a -33 and 12 - fold enrichment in bound anti-GD2 mAb and anti-GD2 scFv, respectively. These observations implicate GD2 as a strong ligand to potentially increase the uptake of LNPs in neuroblastoma tumors.
[0164] FIG. 15H: A schematic of full-length immunoglobulin G (IgG) and single-chain variable fragment (scFv) for comparison. Single-chain variable fragments may be produced in eukaryotic systems and secreted by means of a signal peptide (SP), or by prokaryotic systems and isolated by various chromatographic methods for protein purification utilizing the physical properties of the protein or protein tags. Full-length IgG antibodies may be chemically modified with N- succinimidyl S-acetylthioacetate (SATA) to convert the primary amine functional group of lysine residues within the crystallizable fragment (Fc) region to thiols. Single-chain variable fragments containing a free C-terminal cysteine may be reduced to produce a free thiol. Both IgG and scFv proteins may be subsequently conjugated to maleimide functional groups through a thiol -Michael addition (See, FIG. 151).
[0165] FIG. 151: A schematic demonstrating the chemical process of IgG SATA-modification and subsequent conjugation to maleimide functionalized LNPs. Single-chain variable fragments containing a free C-terminal cysteine residue do not require SATA-modification and when reduced can be directly conjugated to maleimide functional groups.
[0166] FIG. 15 J: Representative dynamic light scattering (DLS) data of unconjugated (red), mAb-conjugated (green), or scFv-conjugated (blue) ionizable LNP carriers (DLin-MC3-DMA). Full-length IgG antibodies have an average diameter of ~10 nanometers (nm). Single-chain variable fragments have an average diameter of ~5 nm, where the vast majority (~3 - 4 nm) is due to the long flexible linker. As demonstrated, conjugation can be confirmed by DLS as the average particle diameter increases correspondingly to the addition of either an IgG or scFv.
[0167] FIG. 16 presents an exemplary sequence of an hHBa 5’UTR - SpyCas9D10A- AES- mtRNRl 3’UTR mRNA construct (SEQ ID NO: 9).
[0168] FIG. 17 presents an exemplary sequence of an hHBa 5’UTR - SpyCas9II840A- AES- mtRNRl 3’ UTR mRNA construct (SEQ ID NO: 10).
[0169] FIG. 18 presents an exemplary sequence of an hHBa 5’UTR - SpyCas9D10A-MYCN 3’UTR mRNA construct (SEQ ID NO: 11).
[0170] FIG. 19 presents an exemplary sequence of an MYCN 5’ UTR - SpyCas9D10A-MYCN 3’UTR mRNA construct (SEQ ID NO: 12). FIG. 20 presents an exemplary sequence of an hHBa 5’UTR - dSpyCas9D10A / H840A- AES-mtRNRl 3’UTR mRNA construct (SEQ ID NO: 13).
[0171] FIG. 21 presents an exemplary sequence of an hHBa 5’ UTR - dSpyCas9D10A / H840A- MYCN 3’UTR mRNA construct (SEQ ID NO: 14).
[0172] FIG. 22 presents an exemplary sequence of an MYCN 5’UTR - dSpyCas9D10A / H840A- MYCN 3’UTR mRNA construct (SEQ ID NO: 15).
[0173] FIG. 23 presents an exemplary sequence of a 3xNLS-SpyCas9D10Afusion protein (SEQ ID NO: 16).
[0174] FIG. 24 presents an exemplary sequence of a 3xNLS-SpyCas9H840Afusion protein (SEQ ID NO: 17).
[0175] FIG. 25 presents an exemplary sequence of a 3xNLS-dSpyCas9D10A / H840Afusion protein (SEQ ID NO: 18).
[0176] FIG. 26 presents an exemplary sequence of an anti-GD2 single-chain variable fragment (SEQ ID NO: 19).
[0177] Detailed Description Of The Invention
[0178] The present invention is related to the field of cancer therapy. In particular, the selective targeting of cancer cells comprising a region of gene amplification. Cas9 nickases programmed to introduce single strand breaks within the gene amplification region wherein the single stranded breaks are converted into a lethal number of double strand breaks that promote cancer cell death. Cas9 nickase activity targeted to a non-amplified gene region does not result in a lethal number of DSBs in healthy, non-cancer cells. The present invention provides a method of treating any cancer cell by programming a Cas9 nickase to a target sequence within a region of gene amplification.
[0179] I. Selective Depletion Of Cancer Cells By Cas9 Nickases
[0180] In one embodiment, the present invention contemplates that CRISPR-Cas9 nickases can be employed for the selective depletion of cancer cells by means of targeting cancer-specific genomic amplifications. As such, it is believed that this technology may serve as a means of discriminating between cancerous cells harboring gene amplifications and normal cells, thus minimizing the non-specific toxicity associated with conventional chemoradiotherapies. A. Overview
[0181] For example, the data presented herein demonstrates that in specific genomic targets tested within the MYCN locus the exact position of a nick within the amplified locus did not appreciably impact the toxicity of the nickase suggesting that a vast array of potential target sites can be used to promote cell death. One advantage of nickase-mediated cell killing relative to nuclease-based systems is a low indel rate at the target site for a nickase. This advantage minimizes the opportunity for sequence - alteration - mediated resistance that is observed with nuclease-based systems. In addition, Cas9 nickase therapy avoids unwanted DNA repair outcomes seen with Cas9 nuclease therapy that results in large deletions at a DSB in normal cells.
[0182] The present data shows differential cell killing efficacy between a Cas9D10Anickase and a Cas9H840Anickase but the reasons for this are currently unclear. Although it is not necessary to understand the mechanisms of an invention, it is believed that this observed difference in cellkilling potential between these two nickase variants may be due to a discrepancy in activity between the RuvC and HNH cleavage domains. Such a hypothesis is consistent with dual nickase editing assessments of each variant indicating that Cas9D10Ahas a higher activity than Cas9H840A. Gopalappa et al., “Paired D10A Cas9 nickases are sometimes more efficient than individual nucleases for gene disruption” Nucleic Acids Research 46(12):e71 (2018). Consequently, the poorer efficacy of Cas9H840Aas compared to Cas9D10Ato promote cell death could also indicate differences between how nicks within target and non-target strands are recognized by the DNA damage repair pathway.
[0183] The data presented herein suggest that cellular toxicity of the Cas9D10Anickase treatment of genomes comprising amplified loci may be caused by a replication-dependent formation of single-ended double strand breaks (seDSBs). These seDSBs result from Cas9 nickase targeting of high gene copy number genomic loci as measured by a neutral comet assay and the presence of elevated levels of the histone, y-H2AX. Currently, it is unclear whether the number of seDSBs formed by a Cas9D10Anickase is more closely correlated with copy number, proliferation rate, or a combination thereof. Both factors likely play roles in cell killing. B. Cancer Cell Culture Efficacy
[0184] Among A / FCA-amplified cell lines, CHP-212 cells were the least sensitive to Cas9D10Atargeting aATFCAlocus. In addition, there are many other factors (e.g., p53 status, DNA repair factor inactivation, etc.) that may also influence the effectiveness of cell killing. Thus, it is possible that a copy number threshold may exist for Cas9 nickase targeted cell killing.
[0185] Successful killing of the BTB474 cell line harboring ~50 copies of ERBB2 suggests that this copy number threshold is modest. These data also indicate that cell lines with either chromosomal amplifications (e g, SK-N-BE(2)C cells) or extrachromosomal DNA (ecDNA; e.g, CHP-212 cells) can be effectively targeted using Cas9 nickases. The population of ecDNAs within a given cell can be heterogeneous and vary in copy number, which may make the potency of nickase more variable across the population of cells. However, it is possible that multiplexing specific genomic targets can achieve even greater potency for Cas9 nickase-mediated cell killing.
[0186] In addition, Cas9D10Anickase therapy can be used in combination with existing cytotoxic agents, such as CHKli, to improve cell death promotion or to increase the sensitivity of cells to more conventional therapeutics. Replication stress pathways triggered by Cas9 nickases targeting high gene copy number sites may provide targets for other combination therapies that enhance cell death by inhibiting cellular checkpoints that restrain DNA replication or DNA resection.
[0187] A / TCA-amplified neuroblastoma cells have exemplified the use of CRISPR / Cas-based cancer therapeutics that target gene amplification. For example, MYC family members are amplified in 28% of cancers. The MYCN data presented herein strongly suggest other cancer types comprising gene amplified loci are also amenable to Cas9 nickase-based therapy.
[0188] Previous reports suggest using Cas9 nucleases to generate DSBs within sequencedivergent repetitive sequences within the non-coding genome to promote cancer cell death. Tan et al., “Targeting the non-coding genome and temozolomide signature enables CRISPR-mediated glioma oncolysis” Cell Rep 42(11): 113339 (2023). However, targeting extensively amplified loci with this RuvC mutant Cas9D10Anickase provides superior advantages by exploiting genomic vulnerabilities in a cell-type and amplification-dependent manner. Given the flexibility and broad targeting scope of CRISPR / Cas systems, it is believed that Cas9D10Anickase-mediated cell killing may successfully treat all cancers harboring extensive gene amplifications with negligible concern for non-specific toxicity or acquired resistance.
[0189] II. Cancer
[0190] A. Gene Amplification
[0191] Gene amplification serves as an oncogenic driver during tumorigenesis and is a hallmark of many cancers. Gene amplifications may manifest as extrachromosomal circular DNA (ecDNA), homogenously staining regions (HSR), or both. Extrachromosomal circular DNA are large megabase structures (>1 Mb) containing complete genes and regulatory regions. Homogenously staining regions are focal gene amplifications within the chromosome(s) and typically range in length from hundreds of kilobases to a few megabases. See, FIG. 1A.
[0192] Gene amplification is a copy number increase of a restricted region of a chromosome arm. It is prevalent in some tumors and is associated with overexpression of the amplified gene(s). Amplified DNA can be organized as extrachromosomal elements, as repeated units at a single locus or scattered throughout the genome. Common chromosomal fragile sites, defects in DNA replication or telomere dysfunction might promote amplification. Some regions of amplification are complex, yet elements of the pattern are reproduced in different tumor types. A genetic basis for amplification is suggested by its relative frequency in some tumor subtypes, and its occurrence in "early" preneoplastic lesions. Clinically, amplification has prognostic and diagnostic usefulness, and is a mechanism of acquired drug resistance. Albertson et al., “Gene amplification in cancer” Trends Genet 22(8):447-455 (2006).
[0193] Gene amplification was recognized as a physiological process during the development of Drosophila melanogaster . Mammalian cells use this mechanism to overexpress particular genes for survival under stress, such as during exposure to cytotoxic drugs. One well-known example is the amplification of the dihydrofolate reductase gene observed in methotrexate-resistant cells. Four models have been proposed for the generation of amplifications: extra-replication and recombination, the breakage-fusion-bridge cycle, double rolling-circle replication, and replication fork stalling and template switching. Gene amplification is a typical genetic alteration in cancer, and historically many oncogenes have been identified in the amplified regions. In this regard, cancer-associated genes may reside within these amplified regions. Recent comprehensive approaches have further revealed that co-amplified genes also contribute to tumorigenesis in concert with known oncogenes in the same amplicons. Considering that cancer develops through the alteration of multiple genes, gene amplification is an effective acceleration machinery to promote tumorigenesis. Matsui et al., “Gene amplification: mechanisms and involvement in cancer” Biomol Concepts 4(6):567-582 (2013).
[0194] Gene amplification refers to a genomic change that results in an increased dosage of the gene(s) affected. Amplification represents one molecular pathway through which the oncogenic potential of proto-oncogenes is activated during tumorigenesis. The architecture of amplified genomic structures is simple in some tumor types, involving in the vast majority of cases only one gene, such as MYCN in neuroblastomas. On the other hand, it can be complex and discontinuous, involving several syntenic co-amplified genes, such as in the 11 q 13 amplification in breast cancer, although in many of these cases there may be a single target gene. The presence of different nonsyntenic amplified genes raises the possibility that cells of certain tumors are susceptible to independent amplification events. In general, the amplified genes do not undergo additional damage by mutations. The data indicate that it is the enhanced level of a wild-type protein that contributes to tumorigenesis. Schwab et al., “Amplification of oncogenes in human cancer cells” Bioessays 20(6):473-479 (1998).
[0195] B. Neuroblastoma: Clinical Overview
[0196] Neuroblastomas, tumors of the sympathetic nervous system, account for 7-10% of the cancers of childhood. Genetic studies have shown that neuroblastomas are very heterogeneous; no single genetic change common to all neuroblastomas has yet been identified. One genetic aberration found frequently in this tumor is MYCN gene amplification. Recently, a new subset of tumors showing MYCN gain, small increases in gene number arising from unbalanced translocation, were reported. A survey of 200 primary tumors for MYCN copy number was performed with fluorescence in situ hybridization to determine whether gain precedes amplification or is an independent event.
[0197] The data showed that: i) 152 of 200 (76%) were MYCN single-copy tumors; ii) 48 of 200 (24%) tumors harbored MYCN abnormalities; iii) 36 of the 48 (75%) had MYCN amplification; and iv) 12 (25%) had MYCN gain. Among the 36 with MYCN amplified gene, four also showed gain. In three tumors exhibiting simultaneous gain and amplification, these two events were detected in neighboring cells. In the fourth case, only MYCN gain was detected in metastatic neuroblasts in the bone marrow, but both MYCN amplification and gain in the primary tumor. These four cases suggest that there may be several different mechanisms leading to increase in MYCN copy number. Valent et al., “Alternative pathways (N MYCN gene copy number increase in primary neuroblastoma tumors” Cancer Genet Cytogenet 153(1): 10-15 (2004).
[0198] Neuroblastoma is an aggressive pediatric malignancy accounting for approximately 15% of childhood cancer mortality. Smith et al., “High-Risk Neuroblastoma Treatment Review” Children 5(9): 114 (2018). As an embryonal tumor, neuroblastomas are reasoned to manifest through the malignant transformation of neural-crest derived precursor cells within the developing peripheral nervous system. Maris, “Recent Advances in Neuroblastoma” N Engl J Med. 362(23): 2202-2211 (2010). As such, neuroblastoma is the most common cancer to occur within the first year of life with an average age of 18-months at the time of diagnosis. Ries et al. “Cancer Incidence and Survival among Children and Adolescents: United States SEER Program 1975-1995” National Cancer Institute, SEER Program, Bethesda, MD seer.ims.nci.nih.gov (1999); and London et al., “Evidence for an Age Cutoff Greater Than 365 Days for Neuroblastoma Risk Group Stratification in the Children’s Oncology Group” JCO 23(27):6459- 6465 (2005).
[0199] Due to a complex genetic landscape, clinical presentations of neuroblastoma are variable which lead to a risk-based stratification scheme - low, intermediate, and high. Presently, both low and intermediate-risk groups maintain excellent prognoses with an overall survival rate of >90%. Strother et al., “Outcome After Surgery Alone or With Restricted Use of Chemotherapy for Patients With Low-Risk Neuroblastoma: Results of Children’s Oncology Group Study P9641” JCO 30(15): 1842-1848 (2012); and lehara et al., “Successful treatment of infants with localized neuroblastoma based on their MYCN status” Int J Clin Oncol. 18(3):389— 395 (2013).
[0200] In stark contrast, however, high-risk neuroblastoma maintains a poor outlook despite recent advancements in cancer therapeutics with an overall survival rate of ~60%. High-risk neuroblastomas are highly metastatic, with the majority of individuals presenting with disseminated disease at diagnosis. Liu et al., “Metastasis pattern and prognosis in children with neuroblastoma” World J Surg One. 21(1): 130 (2023). Typical sites of metastasis include, but are not limited to, the bone marrow, liver, and regional lymph nodes with relapse or progression at these sites drastically enhancing neuroblastoma-related mortality. London et al., “Historical time to disease progression and progression-free survival in patients with recurrent / refractory neuroblastoma treated in the modem era on Children’s Oncology Group early-phase trials” Cancer 123 (24): 4914-4923 (2017). The aggressive behavior demonstrated by high-risk neuroblastoma can be ascribed to segmental chromosomal aberrations, such as amplification of the MYCN oncogene, which occurs in -20% of neuroblastomas. MYCN amplifications are highly heterogenous ranging anywhere from -10 to >1000 copies depending on the site and stage of disease. Because MYCN amplification status is grossly associated with clinical outcome, it is commonly used as a prognostic biomarker. Gundem et al., “Clonal evolution during metastatic spread in high-risk neuroblastoma” Nat Genet. 55(6): 1022-1033 (2023): and Seeger et al., “Association of Multiple Copies of the N- MYC Oncogene with Rapid Progression of Neuroblastomas” N Engl J Med. 313(18): 1111-1116 (1985).
[0201] High-risk neuroblastomas typically respond to conventional therapeutic modalities including, but not limited to, dose-intensive chemotherapy, surgery, radiotherapy, myeloablative chemotherapy with subsequent hematopoietic stem-cell rescue, and anti-GD2 immunotherapy. Nonetheless, it has been reported that this intensive therapeutic regimen is frequently proven insufficient with relapse occurring in -50% of survivors with no curative salvage therapy currently available. Unfortunately, for those who remain in remission, the vast majority experience significant treatment-associated morbidity, secondary malignancy, impaired growth and development, hearing loss, and infertility among others. Maris, “Recent Advances in Neuroblastoma” N Engl J Med 362(23): 2202-2211 (2010); Matthay et al., “Neuroblastoma” Nat Rev Dis Primers 2(1): 16078 (2016); Cohen et al., “Late effects in children treated with intensive multimodal therapy for high-risk neuroblastoma: High incidence of endocrine and growth problems” Bone Marrow Transplant 49(4) pp. 502-508 (2014); Gurney et al., “Hearing Loss, Quality of Life, and Academic Problems in Long-term Neuroblastoma Survivors: A Report From the Children’s Oncology Group” Pediatrics 120(5):el229-el236 (2007); and Applebaum et al., “Second malignancies in patients with neuroblastoma: The effects of risk-based therapy” Pediatric Blood & Cancer 62(1): 128-133 (2015). The modest efficacy and detrimental side effects associated with conventional chemoradiotherapies in the context of high-risk neuroblastoma constitutes both an urgent and unmet medical need for novel therapeutic interventions. Given their therapeutic potential, CRISPR-based genome editing systems have become an increasingly popular platform for the development of novel therapeutics. Zhao et al., “Prime editing: advances and therapeutic applications” Trends in Biotechnology 41(8): 1000-1012 (2023).
[0202] III. Cytotoxicity Of Single Stranded DNA Breaks
[0203] As described herein, CRISPR-Cas9 nickases can be employed to selectively induce cancer cell death by means of targeting genome amplifications and repeat elements. Cas9 nickases generate targeted single-strand breaks (SSBs) in DNA. Jinek et al., “A programmable dual-RNA- guided DNA endonuclease in adaptive bacterial immunity” Science 337(6096):816-821(2012). Generally, SSBs are rapidly repaired in cells that are not actively proliferating and are usually largely innocuous. In actively dividing cells (i.e. cancer cells), however, SSBs can be either transistory or persistent and prove to be highly cytotoxic through their conversion into doublestrand breaks (DSBs) during DNA replication. Transient single-strand breaks (SSBs) are largely innocuous and quickly repaired in cells that are not actively dividing. In contrast, persistent SSBs at high copy number loci within the genome in actively dividing cells (such as cancer cells) have a devastating effect through their conversion into highly cytotoxic single-ended doublestrand breaks (seDSBs). See, FIG. IB; and Caldecott K.W., “Causes and consequences of DNA single-strand breaks” Trends Biochem Sci. S0968-0004(23)00285-2 (2023).
[0204] In one embodiment, the present invention contemplates a method comprising targeting a Cas9 nickase to a rapidly dividing cell comprising genomic amplifications and / or repeat elements. Although it is not necessary to understand the mechanism of an invention, it is believed that the resulting SSBs confers a potent cell killing power in a manner specific to cells harboring amplified genomes (e.g., cancer cells) and not normal genomes (e.g., healthy or noncancer cells). Thus, described herein are the aspects of this CRISPR-Cas9 nickase-based technology that provides approaches to selectively kill cancer cells.
[0205] In one embodiment, the present invention contemplates using a Cas9D10Anickase which, unlike conventional chemotherapies, confers a potent cell killing power through the generation of DNA damage in a highly specific manner. For example, this system targets a Cas9D10Anickase to: i) a target site within a genomic amplification region wherein there are multiple copies within the genome and / or on extrachromosomal DNAs; or ii) a target site within a repetitive gene sequence including, but not limited to, a repetitive LINE sequence, a repetitive short interspersed nuclear element (SINE) sequence, a repetitive human endogenous retrovirus (HERV) sequence. The sequence-specific targeting capability of a Cas9D10Anickase generates DNA nicks (e.g., single strand breaks; SSBs) which are cytotoxic in replicating cells when there are large numbers of target sites (as in amplified genomic regions).
[0206] As such, a Cas9D10Anickase-based system selectively kills cancer cells by targeting gene amplifications that are present within the cancer cells (e.g. MYCN amplifications in neuroblastoma cells). . Cas9D10A is directed to the target site by way of a guide RNA, generating persistent SSBs. During DNA replication, the various SSBs are converted into a lethal number of single-ended DSBs facilitating genomic collapse and cell death. See, FIG. ID.
[0207] Because of DNA repair mechanisms, the data show that Cas9D10Adoes not create a sufficient number of SSBs in the target sequence of healthy cells that contain a normal copy number to create a cytotoxic state. In contrast, high copy number loci are susceptible to Cas9 nickase therapy, as seen by a comparison of the average MYCN genome copy number across various neuroblastoma cell lines normalized to non-cancerous, human foreskin fibroblast (HFF) cells. See, FIG. IE. A high average MYCN genome copy number is seen in: i) the small cell lung cancer cell line, NCI-H69, and HFF cells. See, FIG. IF. A high average ERBB2 (HER2) genome copy number is seen in the breast cancer cell line, BT-474, and HFF cells. CHP-212, the cell line with a modest degree of MYCN amplification is only compromised at the higher Cas9 nickase doses. Cellular toxicity of Cas9D10A nickase is also observed for a HER2- amplified breast cancer cell line, BT474, which contains ~50 copies of ERBB2 (HER2) in the presence of the HER2 #1 sgRNA. Kaushik Tiwari et al., “Direct targeting of amplified gene loci for proapoptotic anticancer therapy” Nat Biotechnol 40:325-334 (2022); See, FIG. 1G. A high average MYC genome copy number is seen in the non-small cell lung cancer cell line, NCL H2170, colorectal cancer cell line, NCI-H716, and HFF cells. See, FIG. 1H. In view of present conventional chemotherapies, embodiments of the presently disclosed invention encompass unpredictable and superior advantages over other cancer therapies that are otherwise broadly cytotoxic in both cancer and non-cancer cells.
[0208] In one embodiment, aMYCN 3’ UTR may enhance neuroblastoma-specific expression of Cas9D10A. In one embodiment, an LNP delivery platform conjugated with targeting antibodies provide cell-specific delivery. In one embodiment, anti-GD2 antibodies target neuroblastoma cells. Such additional cell targeting specificity further reduces genome editing activity in normal, bystander, tissues. In addition, tumor-specific targeting of the Cas9D10Anickase could allow the targeting of repetitive elements (e.g. LINE, SINE or HERV) within the genome to achieve cellular toxicity, which would permit targeting of cancer broadly without necessitating substantial gene amplifications.
[0209] IV. Treatment Of Cancer with a Cas9 Nickase Complex
[0210] The presently disclosed Cas9 nickase complex is simple, both in use and construction. Its high flexibility permits programming to be effective at targeting different genomic sites having different number of gene amplifications. For example, different sgRNAs can program the Cas9 nickase to target alternative sequences within the amplified loci for repeat dosing to compensate for cancer resistance through mutation of its original target site. As such, embodiments of the presently disclosed invention are contemplated as anti-cancer treatment options that can be customized within the context of personalized medicine.
[0211] CRISPR-based nuclease systems, such as Cas9 or Casl2a, have been reported to be utilized for genomic manipulations such as gene inactivation through mutagenic double-strand break (DSB) repair or the precise alteration of DNA sequence by harnessing the homology directed repair pathway for DSB repair in the context of an exogenously delivered donor DNA sequence installment of base conversions, insertions, or deletions. Such manipulations are achieved through the employment of various Cas nucleases, such as Cas9, that are directed to a desired genomic locus by means of a guide RNA. Anzalone et al., “Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors” Nat BiotechnoL 38(7): 824-844 (2020). Once at the target site, a double-strand break (DSB) is generated which may be subsequently repaired through endogenous DNA repair pathways such as error-prone non- homologous end joining (NHEJ) or precise homology directed repair (HDR). While nuclease- based genome editing systems show promise for some therapeutic applications, DSBs can produce unintended consequences such as large deletions, chromosomal truncations, translocations, or chromothripsis among other complex genomic rearrangements that may limit some therapeutic applications. Kosicki et al., “Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements” Nat Biotechnol. 36(8): 765-771 (2018).
[0212] Alternatively, Cas9 nickases, which are catalytically inactivated at either of the two cleavage domains (e.g., HNH or RuvC), have been implemented for the targeted generation of single-strand breaks (SSBs). Jinek et al., “A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity” Science 337(6096):816-821 (2012). Singlestrand breaks are largely innocuous in post-mitotic cells, but SSBs in the context of DNA replication within proliferating cells can have a detrimental effect when large numbers of SSBs are present. Smith et al., “Enabling large-scale genome editing at repetitive elements by reducing DNA nicking” Nucleic Acids Research 48(9): 5183-5195 (2020); and Lodrini et al., “Using droplet digital PCR to analyze MYCN mAALK copy number in plasma from patients with neuroblastoma” Oncoiargei 8(49): 85234— 85251 (2017).
[0213] In actively dividing cells, the conversion of SSBs into potentially toxic single ended DSBs (seDSB) during DNA replication imposes replication stress and ultimately fork collapse and cell death if not adequately repaired. In the context of seDSBs, cells suppress nonhom ologous end joining (NHEJ) to permit DNA resection and homology-dependent repair for replication fork recovery. In addition, ATR and CHK1 signaling restrains new origin licensing until the replication stress can be resolved to avoid overloading the DNA repair factors present within the nucleus.
[0214] Here, it is demonstrated that targeting highly amplified regions within the genome, such as MYCN in neuroblastoma cells with an RuvC mutant such as SpyCas9D10Anickase exploits genomic vulnerabilities that induce cell death in a genotype dependent manner. Genotoxicity conferred by Cas9D10Ais believed to be dependent on the persistent generation of targeted SSBs within an amplified genomic locus which are subsequently converted to seDSBs during DNA replication. Thus, only actively dividing cells containing highly amplified genomic loci are exposed to a high level of genotoxicity. A level of cytotoxicity specificity unattainable by conventional chemoradiotherapies.
[0215] A. Cas9 Nickase Treatment of Gene-Amplification Related Cancers
[0216] A series of neuroblastoma cell lines containing between 2 - 550 MYCN gene copies, and the breast cancer cell line, BT-474, containing -50 ERBB2 (HER2) gene copies were assessed for cellular toxicity resulting from SpyCas9D10Anickase treatment. For example, piggyBac- integrated sgRNA expression cassettes were used to generate stable sgRNA expressing cell lines. See, FIG. II. Transfection efficiency and longevity of mRNA-expressed Cas9 protein was assessed over a seven (7) day period in the target cell lines of SK-N-BE(2)C, NGP, SH-SY5Y, BT-474, and NCI-H2170 cells. See, FIG. 1J.
[0217] Representative sgRNAs were constructed that targeted three target sites (LINE-1, MYCN#\ and HER2#1). See, Tables 1 & 2.
[0218] Table 1. Exemplary Cas9 Nickase Single Guide RNA (sgRNA) Sequences
[0219] Table 2. Exemplary Cas9 Nickase Target Sites
[0220] The LINE-1 sgRNA targets a common sequence within open reading frame 2 (ORF2) of the Long Interspersed Nuclear Element (LINE-1) coding sequence, which is an endogenous transposable element exceeding >1000 copies in all human cell lines. Smith et al. “Enabling large-scale genome editing at repetitive elements by reducing DNA nicking” Nucleic Acids Research 48:5183-5195 (2020). The MYCN # 1 sgRNA targets the MYCN proto-oncogene (MYCN) locus -700 bp downstream of the 3’UTR. From what is known, this sgRNA does not target a coding sequence, or an important regulatory element, for the MYCN gene. The HER2 #1 sgRNA targets a membrane tyrosine kinase gene (ERBB2) locus. From what is known, this sgRNA does not target an ERBB2 gene coding sequence or regulatory element. The AA VS1 sgRNA targets within the Protein Phosphatase 1 Regulatory Subunit 12C (PPP 1R12C) gene - a safe harbor locus that is not amplified. Papapetrou et al., “Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy” Mol Ther. 24(4):678-684 (2016).
[0221] For each neuroblastoma cell line, different guide RNAs targeting LINE-1, MYCN or AAVS1 were expressed from a U6 promoter as a stable transgene. All cells (-2 x IO5per condition) were electroporated with a titrated dose of SpyCas9D10Anickase mRNA (7.5, 15, and 30 nM). The cells were assessed for changes in cell viability following 3 days of incubation using the AAVS1 sgRNA as a control for normalization of survival, which otherwise demonstrated no perturbation in cell viability relative to an untreated control.
[0222] SpyCas9D10Anickase targeting LINE-1 elements was toxic to all of the cell lines, as would be expected given the large number of targetable sites within the genome. See, FIG. 2A. SpyCas9D10Anickase targeting a non-genic region neighboring MYCN was highly toxic in the ATTG / V-amplified neuroblastoma cells (SK-N-BE(2)C, Kelly, NGP and CHP-212), which are rapidly depleted in a dose-dependent manner, while neuroblastoma cells with a normal MYCN copy number (SH-SY5Y) and non-neuroblastoma cells (HEK293T) are not significantly affected. See, FIG. 2B. N-MYC protein expression levels from SK-N-BE(2)C or NGP cells expressing MYCN or AAVSl sgRNA were determined at 24-hours post-treatment with Cas9D10A. N-MYC expression remained comparable across all conditions. Outcomes indicate that N-MYC expression is not compromised when targeting Cas9D10Ato a non-genic sequence downstream of the MYCN 3’UTR supporting the notion that loss of cell viability is not due a loss of N-MYC expression. See, FIG. 2C. MYCN expression analysis by qRT-PCR demonstrates a modest reduction in MYCN transcript copy number in SK-N-BE(2)C or NGP AEFCA-amplified neuroblastoma cells up to 72-hours post-treatment with Cas9D10A-mRNA (30 nM) when targeting LINE-1 ox MYCN. See, FIG. 2D.
[0223] MCM7, a direct transcriptional target of the N-MYC transcription factor, functions to maintain genomic stability during S-phase of the cell cycle. MCM7 expression analysis by qRT- PCR was used as a means of assessing N-MYC activity. MCM7 expression analysis demonstrates an increase mMCM7 expression in SK-N-BE(2)C or NGP ,'V / FC / V-amplified neuroblastoma cells up to 72-hours post-treatment with Cas9D10A-mRNA (30 nM) when targeting LINE-1 or MYCN. See, FIG. 2E.
[0224] These data show that Cas9D10Anickase selectively targets and induce cytotoxicity in different types of cancer cells containing gene amplifications despite having different oncogenic profiles. Cells with normal copy numbers of these same genes are resistant to Cas9D10Anickase- mediated cytotoxicity.
[0225] B. Flexible Targeting of Amplified Genomic Loci
[0226] In one embodiment, the present invention contemplates a method comprising cleaving a DNA strand with a Cas9D10Anickase and a plurality of sgRNAs, wherein each of the plurality of sgRNAs is targeted to a different specific genomic target within the same amplified genomic loci (e g., an MYCN amplified genomic loci). A / ECV-amplified SK-N-BE(2)C and NGP cell lines were modified to provide stable expression of different MYCN sgRNAs differentially targeted to: i) a specific genomic target within the coding sequence (sgMYCN-2); ii) a specific genomic target within intron 1 (sgMYCN-3); and iii) a specific genomic target within the 3’-UTR (sgMYCN-4). These data showed no substantial position-specific variation in efficacy in either cell line. These observations suggest that cytotoxicity conferred by Cas9D10Ais largely dependent on the number of specific genomic targets and not the positions of the specific genomic targets an amplified genomic region. These data show that Cas9D10Atargeting of MYCN to produce cell death may be implemented at a large number of potential genomic target sites. See, FIG. 2F.
[0227] Further, the cell killing potential of Cas9D10Awas determined in the absence of constitutive sgRNA expression, as a means of assessing its potential for possible therapeutic application. As such, Cas9D10A- mRNA and synthetic sgMYCN-1 were co-delivered to unmodified SK-N-BE(2)C, NGP, and SH-SY5Y cells and assessed for changes in cell viability 3 days post-treatment. Notably, a substantial reduction in cell viability was observed, but to a more modest degree than in the sgRNA expressing cell lines. See, FIG. 2G. These data suggest that the co-delivery of a Cas9D10Anickase and sgRNA is highly efficacious supporting its utility as a therapeutic context.
[0228] These data demonstrate that multiple different sgRNAs may be administered separately to target a single amplified genomic locus (e.g., an amplified MYCN locus) to achieve similar levels of cell killing. See, Table 3.
[0229] In one embodiment, delivering of Cas9D10Anickase and synthetic sgRNA comprises electroporation.
[0230] B. Ortholog Variations in Cas9 Nickase Efficacy
[0231] Cas9 is generally believed to harbor at least two nuclease domains, HNH and RuvC. Different Cas9 nickases can be generated depending on the nuclease domain that is inactivated. For example, DNA cleavage by the HNH domain occurs within a target strand that is usually complementary to the strand encoding a guide RNA and can be inactivated through an H840A mutation. DNA cleavage by the RuvC domain occurs within a non-target strand that is usually not complementary to the strand encoding a guide RNA and can be inactivated through a D10A mutation. See, FIG. 3 A; Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity” Science 337(6096):816-821 (2012); Cong et al., “Multiplex genome engineering using CRISPR / Cas systems” Science 2013 Feb 15;339(6121) (2013); and Gasiunas et al., “Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria” Proc Natl Acad Sci U SA. 109(39):E2579-586 (2012).
[0232] SK-N-BE(2C) A / FGV-amplified neuroblastoma cells were treated with either a Cas9D10Anickase or a Cas9H840Anickase programmed with LINE-1 ox MYCN sgRNAs. Cells were monitored for changes in cell viability over a 3-day time period. The data shows that cell killing was more efficacious with the Cas9D10Anickase than the Cas9H840Anickase for cell killing. See, FIG. 3B - 3D. Furthermore, nickase activity using a catalytically “dead” Cas9D10A / H840Avariant harboring both HNH and RuvC inactivating mutations was also observed to have minimal activity (data not shown). These data suggest that Cas9D10Anickase-mediated SSBs play a role in cancer therapy cytotoxic effects and that Cas9 nickase efficacy may determine its cytotoxic potential.
[0233] C. Replication Stress
[0234] The presence of DNA damage in SpyCas9DI0Anickase treated cells was assessed by both ALKaXme single cell electrophoresis and neutral single cell electrophoresis (e.g. comet assay). Three (3) days following electroporation with Cas9D10AmRNA in cell lines expressing either LINE-1, MYCN, OY AAVSI targeting sgRNAs: i) both single strand DNA breaks (SSBs) and double strand DNA breaks (DSBs) were resolved under AZXaline conditions (pH > 13); and ii) DSBs only were resolved under neutral conditions. The data showed that DNA damage was: i) significantly elevated in all cell lines when targeting LINE-L, ii) significantly elevated in only A / FCA-amplified cell lines (e.g., SK-N-BE(2)C, KELLY, NGP, & CHP-212) when targeting the MYCN locus. MYCN targeting did not cause excessive DNA damage in SH-SY5Y. neuroblastoma line or HEK293T cells lacking MYCN amplification. See, FIG. 4A - D.
[0235] Further evidence of replication stress congruent with fork-stalling as a means to delay cell cycle progression and mitigate fork breakage within S-phase was shown by ATR-mediated phosphorylation of RPA2 (pS33) and CHK1 (pS345) which are reported to stabilize stalled replication forks and inhibit origin firing, respectively. See, FIG. 4E; Friedel et al., “ATR / Mecl : coordinating fork stability and repair,” Current Opinion in Cell Biology 21(2):237-244 (2009); Sorensen et al., “Safeguarding genome integrity: the checkpoint kinases ATR, CHK1 and WEE1 restrain CDK activity during normal DNA replication” Nucleic Acids Research 40(2):477-486 (2012); and Toledo et al., “ATR Prohibits Replication Catastrophe by Preventing Global Exhaustion of RPA” Cell 155(5): 1088-1103 (2013). Cell cycle progression accompanied by the enrichment of DSBs, as evident by elevated levels of the canonical biomarker y-H2AX and the large tail moment in neutral comet assay, is consistent with the generation of seDSBs during replication. See, FIG. 4A - E; Kuo et al., “Gamma-H2AX - a novel biomarker for DNA doublestrand breaks” In Vivo 22(3): 305-309 (2008).
[0236] Repair of seDSB utilizes DNA resection to drive HDR-based repair and restart of stalled or collapsed replication forks. Excessive DNA resection can produce global RPA exhaustion leading to unprotected single-stranded DNA (ssDNA) within the genome during continued DNA replication leading to replication catastrophe. Phosphorylation of EXO 1 (pS746), an inactivating modification to prevent excessive DNA resection, is promoted by the ATR-CHK1 and CMKK2- AMPK pathways in the context of replication stress. Li et al., “Ca2+-Stimulated AMPK- Dependent Phosphorylation of Exol Protects Stressed Replication Forks from Aberrant Resection” Molecular Cell lA(6y. 1123-1137 (2019). The increase in EXO1 (pS746) in the presence of LINE-1 or MYCN targeting Cas9D10Ain SK-N-BE(2)C cells further supports the generation of single-ended DSB formation within the genome in the context of a heavy cellular load of SSBs. See, FIG. 4E.
[0237] Given the high efficiency of Cas9D10Aacross various MYCN target sites, the local mutagenic profile at the target site was assessed, as inactivation of the target site might prevent further Cas9D10A-mediated nicking. As such, DNA was isolated from surviving SK-N-BE(2)C, NGP, and SH-SY5Y sgMYCN-1 expressing cells 3 days post-treatment with Cas9D10Aand assessed for sequence-alterations by Amplicon-Seq. The data showed that the local mutagenic footprint of Cas9D10Awas low (3.3, 0.29, and 0.01%, respectively). See, FIG. 4F & 4G. These indel data suggests that concerns for target site depletion post-treatment with Cas9D10Ais negligible, likely permitting the repeated use of a sgRNA in repeated treatments to promote cell death within a tumor population.
[0238] These data are consistent with catastrophic replication events due to the conversion of large numbers of SSBs to single-ended DSBs upon encountering a replication fork. Thus, these data indicated that Cas9D10Anickase generates substantial numbers of DSBs that induce replication stress and cell death as a function of the number of nicks generated within the genome due to target locus amplification.
[0239] Flow cytometric cell cycle analysis of AfFCTV-amplified SK-N-BE(2)C cells treated with Cas9D10Atargeting either LINE-1 or MYCN revealed a substantial stalling of cell cycle progression in S-phase (e.g., 40.3 and 36.7%, respectively) after 24 hours. Stalling in S-phase appeared to be a transient state in response to Cas9D10A-mediated nicking at LINE-1 ox MYCN, as evident by the progression into, and subsequent arrest of SK-N-BE(2)C cells in G2 -phase of the cell cycle at days 2 and 3 post-treatment, with a failure to repopulate Gl. Stalling in S-phase appeared to be a transient state in response to Cas9(D10A)-mediated nicking al LINE- 1 or MYCN, as evident by the progression into, and subsequent arrest of SK-N-BE(2)C cells in G2- phase of the cell cycle at days 2 and 3 post-treatment, with a failure to repopulate Gl. See, FIG. 5A.
[0240] Further evidence of replication stress congruent with fork-stalling as a means to delay cell cycle progression and mitigate fork breakage within S-phase include the stark elevation of reactive oxygen species (ROS) and ATR-mediated phosphorylation of RPA2 (pS33) and CHK1 (pS345). ROS-elevation is reasoned to mediate replication slowdown to inhibit replication fork progression in the presence of DNA damage. Whereas the ATR-mediated activation of RPA and CHK1 serves to stabilize stalled replication forks and inhibit new origin firing, respectively. Involved in a self-amplifying feedback loop, elevated levels of Ca2+beget elevated ROS which in turn stimulates the release of more Ca2+. As such, it is reasonable to assume that the overloading of Ca2+and ROS are likely working complimentarily with Cas9(D10A), further propagating DNA damage. Replication stress was demonstrated by an elevation of cytosolic calcium (Ca2+) after 24 hours.
[0241] Elevation of intracellular calcium (Ca2+) is reported to be an indicator of replication stress in response to the accumulation SSBs that turn into single ended DSBs during replication. Li et al., “Ca2+-Stimulated AMPK-Dependent Phosphorylation ofExol Protects Stressed Replication Forks from Aberrant Resection” Mol Cell. 74(6): 1123-1137 (2019). Assessment of intracellular Ca2+flux relative to untreated cells was carried out over a 72-hour time period following electroporation with Cas9D10Aprogrammed with LINE-1, MYCN or AAVS1 targeting sgRNAs. Intracellular calcium levels in ATFtA-amplified SK-N-BE(2)C neuroblastoma cells increased rapidly when the sgRNA targeted LINE-1 or MYCNVtuX only modest shifts from basal levels were observed when the sgRNA targeted to the AAVS1 single copy control site. Conversely, SH- SY5Y neuroblastoma cells lacking A / FCA-amplificati on only displayed elevated intracellular calcium levels when Cas9D10Anickase sgRNA was programmed to a LINE-1 amplification and not when targeting MYCN or an AAVS1 single copy control site. See, FIG. 5B.
[0242] Replication Protein A (RPA) overexpression can insulate cells from the catastrophic impacts of replication stress. RPA exhaustion was evaluated as a contributor to cytotoxicity in Cas9D10Anickase treated cells. SK-N-BE(2)C-sgRNA expressing cells were modified to overexpress human RPA1, RPA2, and RPA3 from a synthetic CAG promoter as a stable transgene. Overexpression of RPA increased survival in Cas9D10Atreated SK-N-BE(2)C cells targeting either LINE-1 and MYCN (4.65, and 4.00-fold increase, respectively) but remained insufficient to completely abolish the observed cellular toxicity. These results suggest the degree of DNA damage induced by Cas9D10Awithin highly amplified loci overwhelms the DNA repair resources during DNA replication resulting in cell death. RPA overexpression was observed to fortified cells from the catastrophic effect of replication stress using a / vggjBac-integrated RPA expression cassette in SK-N-BE(2)C cells expressing LINE-1 or MYCN sgRNA. See. FIG. 5C.
[0243] Excessive DNA resection by EX01 propagates genomic instability and toxicity by interfering with DNA repair. Phosphorylation of EX01 (pS746) by the ATR-CHK1 or CMKK2- AMPK axes modulates EX01 activity in response to replication stress and serves to protect DNA ends exposed by DSBs from EX01 - mediated resection. The impact of EXO 1 downregulation on cell viability was assessed in SK-N-BE(2)C, or SK-N-BE(2)C-RPA(123) cells expressing LINE-1 or MYCN targeting sgRNA treated with Cas9D10A, Cas9ul0A+ siRNA, or siRNA only. Independently, the downregulation of EXO 1 and the upregulation of RPA attenuated Cas9D10A- induced toxicity, supporting the notion of EXO 1 hyper-resection and RPA depletion following Cas9D10A- mediated DNA damage. See, FIG. 5D.
[0244] DNA2 is partially redundant with EX01 for DNA resection during S-phase DNA damage repair. Down-regulation of EX01, but not DNA2, attenuated Cas9D10A- mediated toxicity. For example, SK-N-BE(2)C cells expressing LINE-1 or MYCN targeting sgRNA were transfected with an siRNA targeting EX01, DNA2, or a non-targeting control, recovered for 24 hours, and then treated with Cas9D10A-mRNA (30 nM). Changes in cell viability were assessed at 3-days post-treatment with Cas9D10A. See, FIG. 5E.
[0245] Downregulation of EXO 1 reduces Cas9D10A-induced toxicity in / WFCA'-amplified neuroblastoma cells. Proliferation of A FCA-amplified sgRNA expressing SK-N-BE(2)C cells transfected with siRNA targeting EXO1, DNA2, or non-targeting control for 24 hours prior to the delivery of Cas9D10A- mRNA (30 nM) was assessed by quantitative image-based cytometry (QIBC) assisted cell counting at 1-, 2-, and 3-days post-treatment with Cas9D10Atargeting LINE- 1, MYCN, or AAVS 1 (n = 3). See, FIG. 5F.
[0246] A flow cytometric cell cycle analysis was performed on SK-N-BE(2)C cells transfected with siRNA targeting EXO1, DNA2, or a non-targeting control without Cas9D10Adelivery at 1-, 2-, and 3-days post-transfection (n = 3). In the absence of Cas9D10A, cells treated with siEXOl displayed appreciable stalling in S-phase of the cell cycle after 48-hours. See, FIGs. 5D - 5F. Conceivably, the increase observed in cell viability in SK-N-BE(2)C cells treated with Cas9D10Atargeting LINE-1 or MYCN may be due to slower rates of cell proliferation or a decrease in extensive 5’ DNA resection due to the reduction of EXO1 activity. FIG. 5G.
[0247] Downregulation of EXO 1, but not DNA2 alters DNA repair outcomes for Cas9D10A- mediated editing in AYFCA-amplified neuroblastoma cells. Amplicon-sequencing of the sgMYCN-1 target site from genomic DNA isolated from surviving SK-N-BE(2)C cells transfected with a EXO1 or DNA2 - targeting siRNA for 24 hours prior to the delivery of Cas9D10A- mRNA (30 nM) at 3-days post-treatment with Cas9D10A. Editing outcomes suggest that the downregulation of EXO 1 activity alters DNA repair outcomes of Cas9D10A-mediated, replication-dependent DSBs as evident by the increased sequence modifications at the sgMYCN- 1 target site. See, FIG. 5H.
[0248] Allele-frequency table corresponding to editing outcomes presented in FIG. 5H regarding post-treatment of SK-N-BE(2)C EXO1 knockdown cells with Cas9D10A- mRNA targeting MYCN. See FIGs. 51 & 51.
[0249] D. Cell Death Pathway
[0250] The vast majority of primary neuroblastomas express wild type (WT) p53, with less than ~2% harboring a p53 inactivating mutation. In neuroblastoma, A KCY-driven tumorigenesis is contingent upon inhibition of p53-mediated apoptosis through upregulation of MDM2 expression. To evaluate the role of core apoptosis factors in cell death resulting from Cas9D10Anickase treatment, two p53-WT neuroblastoma cell lines: i) MYCN non-amplified SH-SY5Y; and ii) ALFCA-amplified NGP were screened for caspase 3 activation as a marker of intrinsic apoptosis. Hosoi et al., “Low frequency of the p53 gene mutations in neuroblastoma” Cancer 73(12)3087-3093 (1994); Vogan et al., “Absence of p53 gene mutations in primary neuroblastomas” Cancer Res 53(21): 5269-5273 (1993); and Slack et al., “The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in neuroblastoma” Proc. Natl. Acad. Sci. U.S.A., 102(3):731-736 (2005).
[0251] Caspase 3 cleavage was evaluated in both cell lines 3 days after treatment with Cas9D10Atargeting various loci. As a positive control for caspase 3 activation, SH-SY5Y cells were coincubated with staurosporine (STS; 1 pM), an ATP-competitive kinase inhibitor reported to induce caspase activation in SH-SY5Y cells, for 3 hours prior to harvest. Mookherjee et al. “Mitochondrial -targeted active Akt protects SH-SY5Y neuroblastoma cells from staurosporine- induced apoptotic cell death” J Cell Biochem 102(1): 196-210 (2007). STS-treated SH-SY5Y cells demonstrated robust caspase 3 activation, whereas no obvious caspase 3 activation was detected in either cell line when targeting LINE-1, MYCN, or AAES1 with Cas9D10A. See, FIG. 6A. These data suggest that Cas9D10A-induced cell death may not be mediated by a canonical p53 -dependent, caspase-mediated apoptosis.
[0252] Further investigation of the cell death pathway was elucidated in the p53 -deficient, highly ATFCA-amplified neuroblastoma cell line, SK-N-BE(2)C. Cleavage of poly [ADP-ribose] polymerase 1 (PARP1) is a common occurrence observed across various cell death pathways with distinct cleavage patterns associated with each pathway, and as such PARP1 cleavage was used to provide insight into the potential cell death pathway that is responsive to Cas9D10Atreatment. Chaitanya et al. “P ARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration” Cell Commun Signal 8(1):31 (2010).
[0253] The data presented herein demonstrates that AYFCA-amplified neuroblastoma cell lines, SK-N-BE(2)C (p53-deficient) and NGP (p53-WT) expressing LINE-1 or MYCN targeting sgRNA exhibit no appreciable change in Cas9D10A- mediated cell-killing efficacy when supplemented with a caspase-3 inhibitor, Z-DEVD-FMK (18 pM), at 3-days post-treatment with Cas9D10A- mRNA and no appreciable difference in the efficacy of Cas9D10A- mediated cell-killing was observed. See, FIG. 6B. Further, these cell lines also exhibited no appreciable change in Cas9D10A- mediated cell-killing efficacy when supplemented with pifithirin-oc (PFToc), a presumed inhibitor of p53 activity and apoptosis. Similar to caspase-3 inhibition, no appreciable difference in the efficacy of Cas9D10A- mediated cell-killing was observed. See, FIG. 6C.
[0254] Cas9D10Atargeting of LINE-1 and A / ECYin SK-N-BE(2)C cells presented substantially more PARP1 cleavage relative to targeting AAVSl. See, FIG. 6D. However, the signature PARP1 cleavage fragments that would be indicative of caspase 3 / 7 activation (e.g., 89 & 24-kD) were not observed, rather various cleavage fragments diagnostic for calpain cleavage with further proteolysis by cathepsin proteases that range from 40 - 70-kD which are consistent with necrotic cell death. McGinnis et al., “Procaspase-3 and Poly(ADP)ribose Polymerase (PARP) Are Calpain Substrates” Biochemical and Biophysical Research Communications 263(1): 94-99 (1999); and Gobeil et al., “Characterization of the necrotic cleavage of poly(ADP-ribose) polymerase (P ARP-1): implication of lysosomal proteases” Cell Death Differ. 8(6):588-594 (2001). Calpains are a family of Ca2+- activated cysteine proteases - consequently, these data are consistent with the observed elevation in cytosolic Ca2+upon Cas9D10Atreatment. See, FIG. 5B & 6F; Huang et al., “The calpain family and human disease” Trends Mol Med 7(8): 355-362 (2001).
[0255] Aside from calpain activation, Ca2+influx is known to elicit PARP1 hyperactivation subsequent to DNA damage. Virag et al., “Inhibition of poly(ADP-ribose) synthetase (PARS) and protection against peroxynitrite-induced cytotoxicity by zinc chelation” Br J Pharmacol 126(3):769-777 (1999). PARP1 hyperactivation is marked by the enrichment of poly-ADP ribosylation (PARylation) of endogenous proteins, as well as the depletion of intracellular ATP and NAD+ pools. Murata et al., “NAD+ consumption by PARP1 in response to DNA damage triggers metabolic shift critical for damaged cell survival” Mol Biol Cell. 30(20): 2584-2597 (2019); and Wang et al., “Calpain activation is not required for AIF translocation in PARP-1- dependent cell death (parthanatos)” J Neurochem. 110(2): 687-696 (2009). As such, a stark elevation in PARylation was observed in SK-N-BE(2)C cells treated with Cas9D10Atargeting LINE-1 anAMYCN, consistent with PARP1 hyperactivation. See, FIG. 6D. Depletion of ATP and NAD+ levels were also observed across multiple cell lines (SK-N-BE(2)C, NGP, and SH- SY5Y), further supporting the notion of a conserved necrotic cell death process. See, FIG. 6E. Ca2+and ROS are key factors governing both the induction and execution of necrotic cell death. See, FIGs. 5B, 6A and 6D - F; Ragu et al., “A noncanonical response to replication stress protects genome stability through ROS production, in an adaptive manner” Cell Death Differ. 30(5): 1349-1365 (2023); Andrs et al., “Excessive reactive oxygen species induce transcriptiondependent replication stress” Nat Commun. 14(1): 1791 (2023); Somyajit et al., “Redox-sensitive alteration of replisome architecture safeguards genome integrity” Science 358(6364):797-802 (2017); Friedel et al., “ATR / Mecl : coordinating fork stability and repair” Current Opinion in Cell Biology 21(2):237-244 (2009); Sorensen et al., “Safeguarding genome integrity: the checkpoint kinases ATR, CHK1 and WEE1 restrain CDK activity during normal DNA replication” Nucleic Acids Research 40(2): 477-486 (2012); Toledo et al., “ATR Prohibits Replication Catastrophe by Preventing Global Exhaustion of RPA” Cell 155(5): 1088-1103 (2013); Gbrlach et al., “Calcium and ROS: A mutual interplay” Redox Biol 6:260-271 (2015); Festjens et al., “Necrosis, a well-orchestrated form of cell demise: Signalling cascades, important mediators and concomitant immune response” Biochimica et Biophysica Acta (BBA) - Bioenergetics 1757(9-10): 1371-1387 (2006); and Yan et al., “Cross-talk between calcium and reactive oxygen species signaling” Acta Pharmacol 'ogica Sinica 27 (7): 821-826 (2006).
[0256] Furthermore, supplementation of Cas9D10Atreatment with the PARP1 inhibitor (PARPi) rucaparib (10 pM) significantly attenuated ATP and NAD+ depletion and promoted cell survival in the presence of Cas9D10Ain SK-N-BE(2)C, NGP, and SH-SY5Y cells. See, FIG. 7A & 7B. Cell proliferation was only modestly affected by Rucaparib treatment in the absence of Cas9D10A, suggesting that increased survival is due to a reduction in PARPI activity and not a reduction in the rate of proliferation.
[0257] Given the protective effects of PARP inhibition in the presence of Cas9D10A, calpain inhibition was assessed in regard to cell survival. As such, SK-N-BE(2)C, NGP, and SH-SY5Y cells treated with Cas9D10Atargeting LINE-1, MYCN or AAVS1 were supplemented with calpastatin (CAST; 20 nM) an endogenous calpain inhibitor. CAST supplementation in the presence of Cas9D10Asignificantly promoted cell survival. See, FIG. 8A & 8B. CAST supplementation in the absence of Cas9D10Ahad no impact on cell proliferation. These results are consistent with both intracellular Ca2+levels and calpain activity playing roles in promoting Cas9D10A-mediated cell death. Rucaparib also suppressed cell death in a variety of different ATFCA-amplified neuroblastoma lines challenged with LINE- 1 or MYCN - sgRNA programmed Cas9D10Anickase. See, FIG. 7A & 7B. Similarly, rucaparib attenuates cellular toxicity of Cas9D10Anickase programmed with a LINE-1 or ERBB2 (HER2) targeting sgRNA in a ERBB2 (HER2)-amplified breast cancer cell line (e.g., BT474). See, FIG. 7C. The attenuation of cell death by rucaparib in the context of nickase challenge may be due in some cell lines to a modest reduction in cell growth rates, which could reduce the rate of single ended DSB formation from Cas9D10Ainduced nicks. SK-N-BE(2)C and NGP cells, however, only showed modest reductions in growth rate suggesting that PARP inhibition is protective by blocking metabolic depletion of ATP and NAD+. See, FIG. 6E.
[0258] Co-treatment of NCI-H716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA with or without a PARP inhibitor, (e.g., rucaparib) reduced cell-killing efficacy of Cas9D10A. See. FIG. 7D. Co-treatment of NCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA with Cas9D10A- mRNA with or without a PARP inhibitor (e.g., rucaparib) reduced cell-killing efficacy of Cas9D10A. See, FIG. 7E.
[0259] Supplementation of Cas9D10Awith two PARP inhibitors (e.g., rucaparib and olaparib) that have different allosteric effects on PARP 1 -induced DNA lesions were not observed to attenuate Cas9D10A- mediated DNA damage in SK-N-BE(2)C cells expressing either LINE-1 or MYCN targeting sgRNA. See, FIG. 7F. In contrast, comparable inhibition of Cas9D10A- mediated cellkilling was observed in A / ECA-amplified neuroblastoma cells, SK-N-BE(2)C and NGP when targeting LINE-1 (See, FIG. 7G) or MYCN (See, FIG, 7H). These observations suggest that the reduced efficacy of Cas9ul0A- mediated cell-killing when combined with a PARP inhibitor is due to a reduction in PARP1 catalytic activity. See, FIG. 6E. These observations are consistent with the extensive Cas9D10A-mediated DNA damage occurring during DNA replication leading to PARP1 hyperactivation followed by necrotic cell death.
[0260] The effects of low-dose PARP inhibitors were evaluated on cell cycle progression in ATFCA-amplified SK-N-BE(2)C cells. A flow cytometric cell cycle analysis was performed with rucaparib (10 pM) or olaparib (10 pM) in the absence of Cas9D10Aand monitored for aberrations in cell cycle progression at 1-, 2-, and 3-days. Only a modest increase in the fraction of cells in the G2 / M phase of the cell cycle was observed after 24-hours of incubation with either rucaparib or olaparib relative to an untreated control. See. FIG. 71.
[0261] Treatment of a variety of different A / FCA-amplified neuroblastoma lines challenged with a Cas9D10Anickase with an sgRNA programmed to a LINE-1 amplification or an MYCN amplification in the presence of calpastatin suppresses cell death. See, FIG. 8A & 8B. Calpastatin (CAST) is a potent inhibitor of calpain protease activity. Calpains are intracellular proteases that can be activated by high levels of intracellular calcium leading to cell death. Murata et al., (2019); and Chaitanya et al., (2010).
[0262] Similarly, the cellular toxicity of Cas9D10Anickase programmed with a LINE-1 or ERBB2 (HER2) targeting sgRNA in the ERBB2 (HER2)-amplified breast cancer cell line, BT474, is attenuated by calpastatin. See, FIG. 8C. The attenuation of cell death by calpastatin in the context of Cas9D10Anickase challenge is not due to a reduction in cell growth rates, which could reduce the rate of single ended DSB formation from Cas9D10Ainduced nicks.
[0263] Co-treatment with Cas9D10A- mRNA with or without a calpain inhibitor (e.g., calpastatin) reduced cell-killing efficacy with either: i) NCI-H716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA (See, FIG 8D); and ii) NCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA (See, FIG. 8E).
[0264] E. Micronuclei Formation
[0265] It has been reported that micronuclei formation may be contingent on the premature mitotic entry of cells harboring extensive DNA damage. Kalsbeek et al., “G2 / M-Phase Checkpoint Adaptation and Micronuclei Formation as Mechanisms That Contribute to Genomic Instability in Human Cells” IntJMol Sci. 18(11): 2344 (2017). In order to determine whether the observed loss in viability and subsequent cell death was not only dependent on DNA replication - but also cell division - SK-N-BE(2)C, NGP, and SH-SY5Y cells were supplemented with alisertib (0.5 pM), an aurora kinase (AURKA) inhibitor (AURKAi), which promotes mitotic arrest in the presence of Cas9D10Atargeting LINE-1, MYCN, and AAVS1. AURKAi significantly attenuated the cytotoxic effects conferred by Cas9D10A-mediated DNA damage. See, FIG. 9A & 9B. These data suggest that execution of necrotic cell death for Cas9D10Atreated cells may occur subsequent to mitotic catastrophe, perhaps facilitated by checkpoint adaptation permitting mitotic entry in the presence of irreparable DNA damage. Swift et al., “Genotoxic anti-cancer agents and their relationship to DNA damage, mitosis, and checkpoint adaptation in proliferating cancer cells” Int J Mol Sci 15(3): 3403-3431 (2014): Syljuasen, “Checkpoint adaptation in human cells” Oncogene 26(40):5833-5839 (2007); and Kubara et al., “Human cells enter mitosis with damaged DNA after treatment with pharmacological concentrations of genotoxic agents” Biochem J. 446(3):373-381 (2012).
[0266] The degree of DNA damage produced by Cas9D10Atargeting amplified loci was assessed by measuring at least one indicator of large-scale genomic damage - micronuclei formation. Micronuclei formation is believed to be associated with unresolved DNA breaks during mitosis that results in mis segregation of chromosomes or acentric fragments of chromosomes.
[0267] Flow cytometric analysis of surviving SK-N-BE(2)C cells 3 days post-treatment with Cas9D10Atargeting LINE-1 or MYCN revealed a substantial increase in cells harboring micronuclei (4.89 and 4.64-fold, respectively). This increase in micronuclei formation upon Cas9D10Atargeting an amplified locus was readily apparent from the staining of nuclei 3 days post-treatment. Surviving / V / FGV-amplified neuroblastoma cells demonstrated an enrichment in micronuclei formation as shown by a flow cytometric analysis of nuclei and micronuclei for SK- N-BE(2)C cells expressing LINE-1, MYCN, or AA VS1 targeting sgRNA with Cas9D10A- mRNA. See, FIG. 10A. On the other hand, AAVS1 targeted cells showed only a modest increase (~1.26- fold) relative to a mock-untreated control. See, FIG. 10B.
[0268] These data are visualized in representative images of Hoechst 33342 stained nuclei and micronuclei (MN) isolated from ATFGV-amplified, SK-N-BE(2)C neuroblastoma cells expressing LINE-1, MYCN, or AAVS1 targeting sgRNA with Cas9D10A- mRNA. See, FIG. 10C.
[0269] Additionally, surviving MYCN targeted SK-N-BE(2)C and NGP cells demonstrated a 24.6% and 17.2% reduction in MYCN genome copy number, respectively. It is not known, however, whether this is a direct result of Cas9D10Atreatment or the result of increased survival of cells within the population harboring a lower MYCN copy number. See, FIG. 10D.
[0270] V. Neuronal Differentiation Of Cas9 Nickase-Resistant Cell Populations
[0271] In one embodiment, the present invention contemplates that Cas9D10Ademonstrates robust cell-killing efficiency across a variety of neuroblastoma cell lines, however, a small population of cells manage to survive and these surviving cell populations failed to proliferate robustly.
[0272] Upon closer investigation, however, it was observed that these surviving cell populations began to display morphological changes, such as neurite extension, which has been reported to be consistent with neuronal differentiation. Sidell et al., “Effects of retinoic acid (RA) on the growth and phenotypic expression of several human neuroblastoma cell lines” Experimental Cell Research 148(1): 21-30 (1983); and Reynolds et al., “Retinoid therapy of high-risk neuroblastoma” Cancer Letters 197(1-2): 185-192 (2003). Cell differentiation induced by DNA damage or mediated by DDR has previously been reported to occur in stem cells. Given the sternness retained within neuroblastomas these surviving cell population may ostensibly undergo differentiation subsequent to Cas9D10A- induced DNA damage. Vitale et al., “DNA Damage in Stem Cells” Molecular Cell 66(3): 306-319 (2017); Sherman et al., “Regulation of cell differentiation by the DNA damage response” Trends Cell Biol 21(5): 312-319 (2011); and Sjakste et al., “DNA damage and repair in differentiation of stem cells and cells of connective cell lineages: A trigger or a complication?” Eur J Histochem 65(2):3236 (2021).
[0273] SK-N-BE(2)C cells are capable of differentiation when treated with retinoic acid. Zimmerman et al., “Retinoic acid rewires the adrenergic core regulatory circuitry of childhood neuroblastoma” Sci. Adv., 7(43): eabe0834 (2021). Thus, as a positive control for differentiation, SK-N-BE(2)C cells were co-incubated with all-trans-retinoic acid (ATRA; lOpM). Consistent with neuronal differentiation, SK-N-BE(2)C cells treated with MYCN targeting Cas9D10Adisplayed an elevation in TUBB3 expression (~6.2-fold) and decrease in Ki-67 (~2.9-fold), whereas no appreciable differences were observed when targeting AAVS1.
[0274] To test this, a ATTCA-amplified SK-N-BE(2)C cell line was treated with Cas9ul0A- mRNA (30 nM) targeting MYCN and AAESL Cells were assessed by immunocytochemistry for canonical biomarkers of neuronal differentiation, such as the elevation of class III P-tubulin (TUBB3) and a reduction in the Ki-67 proliferation marker at 5-days post-treatment.. Walton et al., “Characteristics of stem cells from human neuroblastoma cell lines and in tumors” Neoplasia 6(6): 838-845 (2004); and Kamijo et al., “Role of sternness-related molecules in neuroblastoma” Pediatr Res 71(2-4): 511-515 (2012). Surviving ATFCV-amplified neuroblastoma cells demonstrated markers of neuronal differentiation. SK-N-BE(2)C cells expressing MYCN or A A VS1 targeting sgRNA treated with Cas9D10A- mRNA (30 nM) demonstrated an enrichment in the neuronal marker, Class III betatubulin (TUBB3), whereas A A VS1 targeted SK-N-BE(2)C cells demonstrated no appreciable enrichment in TUBB3 relative to an untreated control. See, FIG. 10E.
[0275] Surviving MKCA-amplified neuroblastoma cells demonstrated markers of reduced proliferation. SK-N-BE(2)C cells expressing MYCN or AAVS1 targeting sgRNA treated with Cas9D10A- mRNA demonstrated a significant reduction in the proliferation marker, Ki-67, whereas AA VS J targeted SK-N-BE(2)C cells demonstrated no appreciable reduction in Ki-67 expression relative to an untreated control. See, FIG. 10F.
[0276] An immunocytochemical analysis of SK-N-BE(2)C cells expressing MYCN or AAVS1 targeting sgRNA treated with Cas9D10A- mRNA demonstrated an impaired proliferation ability, as well as morphological changes consistent with neuronal differentiation, such as de novo neurite extension and an enrichment in TUBB3 expression. See, FIG. 10G.
[0277] These results suggests that some cells exit the cell cycle post-treatment with Cas9D10Awhen targeting amplified loci - inhibiting further proliferation.
[0278] VI. Cas9D10ANickase CHK1 And ATR Inhibitor Combinations
[0279] Although it is not necessary to understand the mechanism of an invention, it is believed that because of the flexibility and broad targeting scope of CRISPR-Cas systems cancer cells treated with Cas9D10Anickases will not develop acquired resistance, which might be a result of target sequence alteration. In the event there is a loss of access to the original target site due to sequence alteration, the sgRNA can be easily and readily exchanged for a different target sequence within the amplified genomic locus.
[0280] In addition, sgRNA multiplexing, resulting in the simultaneous SSB cleavage of more than one target site, can be used to increase the number of nicks that are generated within a cancer cell by targeting the same or different amplified genomic loci.
[0281] In one embodiment, a Cas9D10AmRNA and one or more sgRNAs can be encapsulated in a LNP delivery vehicle to provide systemic administration. Such a formulation is advantageous as it provides a simple, cost-effective design that is feasible, noninvasive, and transient in nature. It is believed that a Cas9D10Anickase and amplification region loci-specific sgRNAs provide efficacious therapy for primary cancer cells as well as chemotherapy resistant cancer cells that comprise gene amplifications.
[0282] Specifically, genotype selective Cas9D10A- mediated cell killing was evaluated in combination with other known anti-cancer agents to augment cancer cell sensitivity. The ATR- CHK1 DNA-damage response axis has been reported to play a role in restraining DNA replication in the context of replication stress by halting new origin firing and restricting EXO1 DNA resection activity. Li et al., “Ca2+-Stimulated AMPK-Dependent Phosphorylation of Exol Protects Stressed Replication Forks from Aberrant Resection” Molecular Cell 74(6): 1123-1137 (2019); and Toledo et al., “ATR Prohibits Replication Catastrophe by Preventing Global Exhaustion of RP A” Cell 155(5): 1088-1103 (2013).
[0283] ATR and CHK1 inhibitors have been developed as anti-cancer agents and are commonly employed to potentiate the effectiveness of cytotoxic chemotherapeutics. Although it is not necessary to understand the mechanism of an invention it is believed that the inhibition of ATR or CHK1 would yield a cellular environment more permissive to the accumulation of Cas9D10A- induced DNA damage during S-phase through continued origin firing and G2 / M checkpoint escape, aberrantly allowing for mitotic entry with unrepaired seDBSs. Middleton et al., “Phase 1 study of the ATR inhibitor berzosertib (formerly M6620, VX-970) combined with gemcitabine ± cisplatin in patients with advanced solid tumours” Br J Cancer 125(4):510- 519 (2021); Burris et al., “A phase I study of ATR inhibitor gartisertib (M4344) as a single agent and in combination with carboplatin in patients with advanced solid tumours” Br J Cancer (2024); Qiu et al., “ATR / CHK1 inhibitors and cancer therapy” Radiother Oncol 126(3): 450-464 (2018); and Russell et al., “Combination therapy targeting the Chkl and Weel kinases shows therapeutic efficacy in neuroblastoma” Cancer Res 73(2):776-784 (2013).
[0284] A. CHK1 Inhibitors
[0285] CHK1 inhibitors (CHKli) have been reported as cancer therapeutics for their ability to potentiate cytotoxic chemotherapies. Qiu et al., “ATR / CHK1 inhibitors and cancer therapy” Radiother Oncol. 126(3):450-464 (2018); and Russell et al., “Combination therapy targeting the Chkl and Weel kinases shows therapeutic efficacy in neuroblastoma” Cancer Res. 73(2):776- 784 (2013). Inhibition of CHK1 bypasses DNA damage checkpoints, foregoes cell cycle arrest, and continues replication origin firing to create a cellular environment permissive to the accumulation of Cas9D10A-induced DNA damage to an irreparable extent.
[0286] The data shown herein demonstrates that co-treatment of neuroblastoma cell lines with a combination of CHKli and Cas9D10Anickase programmed with a LINE-1 sgRNA potentiated cell death in all neuroblastoma cell lines. See, FIG. 11 A. In contrast, Cas9D10Anickase programmed with aMYCN sgRNA in combination with a CHKli potentiated cell death specifically in ATTGV-amplified neuroblastoma cells. Notably, the SH-SY5Y neuroblastoma cells, which lackAYFCA-amplification, the CHKli had only a modest cytotoxic effect. See, FIG. 1 IB. Similarly, the cellular toxicity of Cas9D10Anickase programmed with a LINE-1 or ERBB2 (HER2) sgRNA in aERBB2 (HER2)-amplified breast cancer cell line (e.g., BT474) is enhanced by CHKli. See, FIG. 11C. The enhancement of cell death by CHKli in the context of nickase challenge occurs despite a modest reduction in cell growth rates, which is not surprising given the CHKli general toxicity to cancer cells.
[0287] Cellular toxicity of Cas9D10Ais augmented by a CHK1 inhibitor. NCI-H716 colorectal adenocarcinoma cells expressing LINE-1 or MYC targeting sgRNA treated with Cas9D10A- mRNA with the CHK1 inhibitor (CHKli; e.g., MK8776) potentiated cell-killing across all tested concentrations of Cas9D10A- mRNA when targeting LINE-1 or MYC. See, FIG. 11D. Similarly, NCI-H2170 squamous cell carcinoma cells expressing LINE-1 or MYC targeting sgRNA treated with Cas9D10A- mRNA with MK8776 also potentiated cell-killing across all tested concentrations when targeting LINE-1 ox MYC. See. FIG. 1 IE.
[0288] These data show that a Cas9D10Anickase in combination with chemotherapy potentiators such as CHK1 inhibitors (CHKli) significantly enhances cell killing efficiency. When used in combination, otherwise sub-optimal doses of either Cas9D10Aor CHKli prove highly effective. These findings imply the potential for Cas9D10Anickase to further, or potentially re-sensitize cancer cells to conventional chemotherapeutics.
[0289] B. CHK1 / ATR Inhibitor Combinations
[0290] Cas9D10Atreatment was supplemented with a sub-lethal concentration of an ataxia telangiectasia mutated and Rad3 -related kinase (ATR) inhibitor (ATRi) (e.g., berzosertib, M6620, VX-970, VE-822; 20 nM), or the Checkpoint Kinase 1 (CHK1) inhibitor (CHKli), (e.g., MK8776) at 500 nM and assessed changes in cell viability 3-days post-treatment. Russell et al., “Combination therapy targeting the Chkl and Weel kinases shows therapeutic efficacy in neuroblastoma” Cancer Res 73(2):776-784 (2013); and Guzi et al., “Targeting the replication checkpoint using SCH 900776, a potent and functionally selective CHK1 inhibitor identified via high content screening” Mol Cancer Ther. 10(4):591-602 (2011).
[0291] The data shows that a combination of Cas9D10Awith an ATRi: i) potentiated cell killing across all cell lines when targeting LINE-1; and ii) significantly improved efficacy when targeting MYCN within .MTOV-arnplified cell lines when using lesser concentrations of Cas9D10A- mRNA.
[0292] Cellular toxicity of Cas9D10Ais augmented by an ATR inhibitor (ATRi) at low concentrations of Cas9D10A- mRNA. SK-N-BE(2)C, NGP, and SH-SY5Y cells expressing LINE-1 targeting sgRNA treated with Cas9D10A- mRNA (7.5 - 30 nM) with or without the ATR inhibitor (ATRi), berzosertib (M6620, VX-970, VE-822; 20 nM). Co-treatment with an ATRi potentiated cell-killing across all cell lines when applying low concentrations of Cas9D10A- mRNA when targeting: i) LINE-1 (See, FIG. (1 IF); and ii) MYCN (See, FIG. 11G).
[0293] In sum, a combination of Cas9D10Awith a CHKli demonstrated superior potentiation of cell killing at the higher concentrations. A modest reduction in cell viability was observed within the MYCN non-amplified SH-SY5Y cell line in the presence of ATRi or CHKli. These data suggest that ATRi and / or CHKli may permit treatment with reduced concentrations of Cas9D10Ato potentiate cell killing.
[0294] VII. Multiplex Targeting of Co-Amplified Oncogenes
[0295] Many cancers have their underlying basis in having co-amplified oncogenes. For example, the neuroblastoma cell line IMR-32 harbors both MYCN and ALK gene amplifications. The average MYCN an ALK genome copy number in IMR-32 cells is shown. See, FIG. 12A. In one embodiment, the present invention contemplates a method comprising inducing cellular toxicity of Cas9D10Ain A / TC / V-amplified neuroblastoma cells by multiplex targeting. The data shown herein demonstrates that simultaneous targeting of LINE-1 , MYCN, ALK, o MYCN and ALK in IMR-32 cells (e.g., 2 x 105) with Cas9D10Ademonstrates a dose-dependent cytotoxic effect. Multiplex targeting of MYCN and ALK increased Cas9D10A-mediated cell-killing relative to targeting MYCN ox ALK individually. See, FIG. 12B. Further studies shown that enhancement of Cas9D10A- mediated cell-killing efficacy is dependent on an increase in target site copy number that is independent of gene function. The data show that no additional cellular toxicity is observed for multiplex targeting of an amplified (MYCN or ALK) locus with a non-amplified (AAVSL) locus in IMR-32 cells with Cas9D10A- mRNA. See, FIG. 12C. Multiplex targeting of non-amplified loci in SH-SY5Y cells with Cas9D10A-mRNA resulted in similar rates of cell viability to targeting individual loci. See, FIG. 12D.
[0296] VIII. Cellular Specificity Of Cas9 Nickase-Mediated Cell-Killing
[0297] Cas9D10A-mediated cell-killing demonstrated negligible non-specific toxicity in postmitotic cells. Neuronally differentiated SK-N-BE(2)C cells were targeted to LINE-1 or AAVS1 with either Cas9WTor Cas9D10A-mRNA. The data show that the neuronally differentiated SK-N- BE(2)C cells displayed a high sensitivity to Cas9WT-mediated DSBs at both target sites. FIG. 13 A. These data was evaluated using cell confluency as a metric to assess cellular toxicity in neuronally differentiated SK-N-BE(2)C cells when targeting LINE-1 or AAVS1 with Cas9WTor Cas9D10A. This analysis also showed that neuronally differentiated SK-N-BE(2)C cells display high sensitivity to Cas9WT-mediated DSBs at both target sites. No significant cellular toxicity was observed when targeting LINE-1 (P > 0.05) or AAVS1 with Cas9D10A. See, FIG. 13B.
[0298] Hematopoietic stem and progenitor cells (HSPCs; CD34+) also showed negligible nonspecific toxicity to Cas9D10A-mediated cell-killing as measured by cell viability in comparison to CS9WT. FIG. 13C. Target site editing rates in surviving HSPCs displayed appreciably editing activity within the AAVS1 target site, but only produced modest rates of editing within the MYCN locus. Notably, Cas9D10Aediting activity at the MYCN locus in HSPCs was below the limit of detection by Sanger sequencing. When targeting the MYCN locus, these observations suggest the mutagenic potential of Cas9D10Ais minimal compared to Cas9WT. See, FIG. 13D. Similar data was observed in MYCN non-amplified SH-SY5Y cells expressing MYCN orAAVSl targeting sgRNA regarding cell viability (left) and target site editing rate (right) as was reported in FIG. 13A and FIG. 13C. See, FIG. 13E. IX. MYCN 3'UTR MDM2 Stabilization
[0299] It has been reported that the vast majority of primary neuroblastomas (-98%) express wild type p53 protein, but an E3 ubiquitin ligase (e.g., MDM2) in ATFGV-amplified neuroblastoma is often overexpressed which degrades the p53 protein and reduces its activity. Slack et al., “The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in neuroblastoma” Proc NatlAcadSci USA. 18; 102(3):731-736 (2005). Interestingly, MDM2 overexpression also appears to play a role in MYCN expression through direct stabilization of MYCN mRNA by binding within its 3’UTR. Gu et al., “MDM2 regulates MYCN mRNA stabilization and translation in human neuroblastoma cells’ Oncogene 15;31(11): 1342-1353 (2012).
[0300] Although it is not necessary to understand the mechanism of an invention, it is believed that the MYCN 3’UTR could be incorporated into a Cas9 nickase mRNA to enhance tumor specific targeting by destabilizing the Cas9 nickase mRNA in cells without high MDM2 levels (e.g., healthy and / or non-cancer cells). Indeed, a human codon optimized Gaussia luciferase (hGluc) mRNA transcript incorporating &MYCN 3’UTR delivered to both SK-N-BE(2)C (neuroblastoma) and HEK293T (non-neuroblastoma) cells was selectively expressed in the neuroblastoma cell line but not the non-neuroblastoma cell line. In contrast, an hGluc mRNA incorporating an AES - mtRNRl 3’UTR was robustly expressed in both the neuroblastoma cell line and non-neuroblastoma cell line.
[0301] Replacing the AES-mtRNRl 3’UTR with &MYCN 3’UTR did not reduce the efficacy of SK-N-BE(2)C cell killing by a Cas9D10Anickase mRNA delivery when targeting either LINE-1 or MYCN.
[0302] Although it is not necessary to understand the mechanism of an invention, it is believed that there is an endogenous feedback loop in A7FGV-amplified neuroblastoma. For example, MDM2 negatively regulates p53, while also mediating MYCN mRNA stability through interactions with the MYCN 3’UTR. This stabilization of the MYCN transcript enhances the translational efficiency ol MYCN mRNA, which positively regulates p53 which increases MDM2 expression. It is further believed that exploitation of this mechanism may confer specificity for the translation of Cas9D10A- mRNA to occur only in neuroblastoma cells efficiently, which typically overexpress MDM2. See, FIG. 14A. The data presented herein demonstrates that delivery of MYCN 3’UTR modified Cas9D10A- mRNA appears stable in A7FCA -amplified neuroblastoma cells using a human codon optimized Gaussia luciferase (hGluc) mRNA transcript containing the mt-RNRl 3’UTR (-) or a MYCN 3’UTR (+)delivered to both SK-N-BE(2)C(neuroblastoma) and HEK293T (non-neuroblastoma) cells. See, FIG. 14B. Notably, replacing the mt-RNRl 3’-UTR (generic) with a MYCN 3’UTR did not reduce the efficacy of Cas9D10AmRNA-mediated cell killing in SK-N-BE(2)C cells expressing either LINE-1 ox MYCN targeting sgRNA. See, FIG. 14C.
[0303] These data show that the MYCN 3 ’UTR may provide a regulatory feature to selectively target cancer cells with high levels of MDM2. Although it is not necessary to understand the mechanism of an invention, it is believed that an interaction between the MYCN 3’UTR and MDM2 selectively stabilizes the mRNA allowing robust translation of the encoded gene product.
[0304] In one embodiment, the RNA construct comprises a modified Cas9D10A- mRNA transcript incorporating a MYCN 3’ UTR. MYCN mRNA is reportedly unstable and rapidly degraded unless protected by MDM2 or HuD, both highly expressed in ALFCA-amplified neuroblastoma. Although it is not necessary to understand the mechanism of an invention, it is believed that the MYCN 3’UTR increases tumor specificity of the construct by minimizing Cas9 nickase expression outside of neuroblastoma cells.
[0305] In one embodiment, the RNA construct comprises a Cas9D10A- mRNA and an sgRNA encapsulated by a lipid nanoparticle (LNP). In one embodiment, the LNP further comprises anti- GD2 antibodies. Disialoganglioside (GD2) is a tumor specific antigen highly expressed on the surface of neuroblastomas, which is frequently targeted by the immunotherapy Dinutuximab. Theruvath et al., “Anti-GD2 synergizes with CD47 blockade to mediate tumor eradication” Nat Med 28:333-344 (2022). Although it is not necessary to understand the mechanism of an invention, it is believed that GD2 antibodies promote tumor-specific uptake and provide metastasis targeting. In some embodiments, the LNP formulation contains various other polymer types including but not limited to, DSPE-PEG-maleimide for the conjugation of antibodies to confer greater tissue specificity and tumor uptake.
[0306] In one embodiment, the RNA construct comprises a Cas9D10A- mRNA and an sgRNA encapsulated by a lipid nanoparticle (LNP). In one embodiment, the LNP further comprises an anti-GD2 scFV. Disialoganglioside (GD2) is a tumor specific antigen highly expressed on the surface of neuroblastomas, which is frequently targeted by the immunotherapy Dinutuximab. Kholodenko et al., “Multimerization through Pegylation Improves Pharmacokinetic Properties of scFv Fragments of GD2-Specific Antibodies”, Molecules 24(21):3835 (2019); mdpi.com / journal / molecules. Although it is not necessary to understand the mechanism of an invention, it is believed that GD2 antibodies promote tumor-specific uptake and provide metastasis targeting. In some embodiments, the LNP formulation contains various other polymer types including but not limited to, DSPE-PEG-maleimide for the conjugation of antibodies to confer greater tissue specificity and tumor uptake.
[0307] As such, anti-GD2 monoclonal antibody immunotherapy (Dinutuximab) is a standard therapeutic modality in high-risk neuroblastoma. Maris, J.M., “Recent advances in neuroblastoma” NEJM 362:2202-2211 (2010). In one embodiment, the present invention contemplates the attachment of anti-GD2 antibodies to the LNP surface to: 1) enhance tumor specific uptake; and 2) enhance acquisition and uptake in distant metastases as present in latestage disease. Tibbetts et al., “Anti-disialoganglioside antibody internalization by neuroblastoma cells as a mechanism of immunotherapy resistance” Cancer Immunol Immunother . 71(1): 153- 164 (2022). Conjugation of anti-GD2 antibodies to the LNP surface is achieved by maleimide / thiol chemistry. Dammes et al., “Conformation-sensitive targeting of lipid nanoparticles for RNA therapeutics” Nat. Nanotechnol. 16: 1030-1038 (2021). Use of anti-GD2 to enhance neuroblastoma targeting has shown promise in other therapeutic modalities such as chimeric antigen receptor (CAR) -T cells. Del Bufalo et al., “Precision Medicine Team-IRCCS Ospedale Pediatrico Bambino Gesu. GD2-CART01 for Relapsed or Refractory High-Risk Neuroblastoma” NEJM 388(14): 1284-1295 (2023).
[0308] X. Clinical Applications
[0309] A. In Vivo Therapeutics
[0310] In one embodiment, the present invention contemplates a method for treating a cancer with a Cas9D10Anickase. In one embodiment, the method comprises a Cas9D10A- mRNA construct encoding an sgRNA (e.g., crRNA and tracrRNA) for therapeutic delivery. In one embodiment, the Cas9D10A- mRNA construct is encapsulated by a lipid nanoparticle (LNP). See, FIG. 15 A. Alternatively, Cas9D10A- mRNA and sgRNA may be encapsulated separately. The data presented herein demonstrates an intratumoral delivery of an LNP comprising an Cas9D10A- mRNA construct that promotes tumor stasis in NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice engrafted subcutaneously with MYCN - amplified, SK-N-BE(2)C neuroblastoma cells expressing MYCN or AAVSl targeting sgRNA. See FIG. 15B. Bioluminescent imaging verified the in vivo engraftment of orthotopic tumor xenografts on NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) with ALFCA-amplified, SK-N-BE(2)C cells. Mice are engrafted within the renal capsule with SK-N-BE(2)C cells modified to express the bioluminescent protein, firefly luciferase (FLuc), and fluorescent protein, mCherry, as a stable transgene (SK-N-BE(2)C-M2AF). See FIG. 15C. Other imaging of organs isolated from these engrafted mice validated a potent tumoral uptake of GLuc - mRNA - LNPs when delivered systemically. See, FIG. 15D. A flow cytometry analysis was performed of SK-N-BE(2)C- M2AF cells isolated from orthotopically xenografted NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) to assess cell-specific uptake in mCherry marked tumor cells following a single administration of GFP - mRNA - LNPs. See, FIG. 15E.
[0311] B. Targeted Construct Delivery Platforms
[0312] In one embodiment, the present invention contemplates a delivery platform comprising a Cas9D10A-mRNA encoding an sgRNA (e.g., crRNA and tracrRNA). In one embodiment, the delivery platform is an LNP. In one embodiment, the LNP comprises conjugated targeting agents to augment tissue-specific uptake of Cas9D10A- mRNA and sgRNA. In one embodiment, the targeting agents include, but are not limited to, monoclonal antibodies, antibody fragments, single-chain variable fragments (scFv), tumor-specific antigens (TSA), tumor-associated antigens (TAA) and surface markers such as disialoganglioside (GD2) or CD44. See, FIG. 15F.
[0313] The data presented herein shows an immunocytochemistry flow cytometric analysis of SK-N-BE(2)C (GD2+) and HEK293T (GD2 ) cells incubated with Dinutuximab, an anti-GD2 monoclonal antibody (mAb), an anti-GD2 scFv (chl4. 18), or an isotype control to assess cellsurface binding activity. SK-N-BE(2)C cells. The results demonstrated a -238 and -109 - fold enrichment in bound anti-GD2 mAb and anti-GD2 scFv, respectively. HEK293T cells demonstrated an -33 and 12 - fold enrichment in bound anti-GD2 mAb and anti-GD2 scFv, respectively. These observations implicate GD2 as a strong ligand to potentially increase the uptake of LNPs in neuroblastoma tumors. See. FIG. 15G. Single-chain variable fragments may be produced in eukaryotic systems and secreted by means of a signal peptide (SP), or by prokaryotic systems and isolated by various chromatographic methods for protein purification utilizing the physical properties of the protein or protein tags. Full-length IgG antibodies may be chemically modified with N-succinimidyl S- acetyl thioacetate (SATA) to convert the primary amine functional group of lysine residues within the crystallizable fragment (Fc) region to thiols. See, FIG. 15H.
[0314] IgG SATA-modifications and subsequent conjugation to maleimide functionalized LNPs were created using chemical processing. For example, single-chain variable fragments containing a free C-terminal cysteine residue do not require SATA-modification and when reduced can be directly conjugated to maleimide functional groups. Single-chain variable fragments containing a free C-terminal cysteine may be reduced to produce a free thiol. Both IgG and scFv proteins may be subsequently conjugated to maleimide functional groups through a thiol -Michael addition. See, FIG. 151.
[0315] Dynamic light scattering (DLS) data is presented herein showing unconjugated (red), mAb-conjugated (green), or scFv-conjugated (blue) ionizable LNP carriers (DLin-MC3-DMA). The data show that full-length IgG antibodies have an average diameter of ~10 nanometers (nm), single-chain variable fragments have an average diameter of ~5 nm, while fragments comprising long flexible linker have an average diameter of ~3 - 4 nm. As demonstrated, conjugation can be confirmed by DLS as the average particle diameter increases correspondingly to the addition of either an IgG or scFv. See, FIG. 15 J.
[0316] XI. Cas9D10ATherapeutic Constructs
[0317] In one embodiment, the present invention contemplates a nucleic acid construct encoding a codon-optimized Cas9D10A-sgRNA (e.g., crRNA and tracrRNA) molecule comprising an open reading frame. In one embodiment, the open reading frame is depleted of unnecessary uridine bases. Although it is not necessary to understand the mechanism of an invention it is believed that open reading frame uridine base depletion reduces the stimulation of innate immune sensors. In one embodiment, the open reading frame comprises necessary uridine bases which have been replaced with a modified nucleobase (e.g., N1 -methylpseudouridine (mlT)). Although it is not necessary to understand the mechanism of an invention it is believed that an exogenous mRNA chemical modification reduces its immunogenicity. See, FIGs: 16 -24.
[0318] In one embodiment, the RNA construct comprises a standard Cas9D10A- mRNA transcript containing a 5’ and 3’ untranslated region (UTR) derived from human hemoglobin alpha (hHBa) and amino-terminal enhancer of split (AES) in combination with mitochondrially encoded 12S rRNA (mt-RNRl) motifs, respectively. These UTRs are commonly utilized together for their ability to augment the expression of proteins encoded by synthetic mRNA.
[0319] Experimental
[0320] Example I
[0321] Mammalian Cell Culture
[0322] All mammalian cell cultures were maintained at 37°C, 5% CO2.
[0323] SK-N-BE(2)C, NGP, CHP-212, and SH-SY5Y neuroblastoma cell lines were grown and maintained in Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12, GlutaMAX™ supplement (DMEM / F12, GlutaMAX™ supplement; Gibco, #10565018), supplemented with 10% fetal bovine serum (FBS; R&D Systems, #S12450H) and 1% penicillin-streptomycin (PS; 10,000 U / mL; Gibco, #15140122).
[0324] KELLY neuroblastoma cells were grown and maintained in RPMI 1640, IX with L- glutamine (Coming, #10-040-CV), supplemented with 15% FBS (R&D Systems, #S12450H) and 1% PS (10,000 U / mL; Gibco, #15140122). BT474 breast cancer cells were grown and maintained in RPMI 1640, IX with L-glutamine (Coming, #10-040-CV), supplemented with 10% FBS (R&D Systems, #S12450H) and 1% PS (10,000 U / mL; Gibco, #15140122).
[0325] HEK293T human embryonic kidney cells were grown and maintained in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, #11965092) supplemented with 10% FBS (R&D Systems, #S12450H) and 1% PS (10,000 U / mL; Gibco, #15140122).
[0326] Neuroblastoma sgRNA expression cell lines were grown and maintained in the same media as previously described, further supplemented with Geneticin™ (1 mg / mL) (G418 Sulfate; 50 mg / mL; Gibco, #10131027). HEK293T sgRNA expression cell lines and SK-N-BE(2)C RPA overexpressing cell lines were grown and maintained in the same media as previously described, further supplemented with blasticidin S HC1 (10 pg / mL) (Gibco, #A1113903).
[0327] All cell lines were grown and maintained in 25cm2(Celltreat, #229331) or 75cm2 (Celltreat, #229341) tissue culture flasks. All cell lines were tested for mycoplasma contamination at regular intervals.
[0328] Example II Expression Vectors
[0329] Cas9 nickase in vitro transcription vectors contain T7 RNA polymerase promoter for the production of synthetic Cas9D10Aor Cas9H840AmRNA. Additional elements include a 5’UTR derived from human hemoglobin alpha (hHBa), Kozack sequence, and 3’UTR derived from amino-terminal enhancer of split (AES) and mitochondrially encoded 12S rRNA (mt-RNRl) motifs and poly-A150. Truong et al., “Lipid nanoparticle-targeted mRNA therapy as a treatment for the inherited metabolic liver disorder arginase deficiency” Proc Natl Acad Sci USA 116(42):21150-21159 (2019);
[0330] Holcik et al., “Four highly stable eukaryotic mRNAs assemble 3’ untranslated region RNA- protein complexes sharing cis and trans components” Proc Natl Acad Sci USA 94(6):2410- 2414 (1997); and Chen et al., “Engineering circular RNA for enhanced protein production” Nat Biotechnol '41(2):262-272 (2023).
[0331] Additionally, all coding sequences were codon optimized to deplete the reading frame of any unnecessary uridine bases to reduce the stimulation of innate immune sensors, with all necessary uridine bases being replaced with the modified nucleobase N1 -methylpseudouridine (mlT) during mRNA production. Kariko et al., “Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA” Immunity 23(2): 165-175 (2005).
[0332] Guide RNA expression donor vectors contained a G418 sulfate selection marker (NeoR / KanR), or a blasticidin selection marker under the transcriptional control of a murine phosphoglycerate kinase (mPGK) promoter, and the desired sgRNA sequence under the transcriptional control of a U6 promoter. The expression cassette was placed between piggyBac left and right inverted terminal repeats (ITRs) to facilitate integration by piggyBac transposition. The RPA1, RPA2, and RPA3 expression donor vector was derived from pl ld-tRPA(123) (Addgene, #102613). Henricksen et al., “Recombinant replication protein A: expression, complex formation, and functional characterization” J Biol Chem 269(15): 11121-11132 (1994).
[0333] Vectors were placed into a piggyBac donor backbone containing a blasticidin selection marker under the transcriptional control of an EFloc promoter. RPA was expressed under the transcriptional control of a CAG promoter and separated by 2A self-cleavable peptide linkers, RPA 1 -T2 A-RP A2-P2 A-RP A3.
[0334] Expression of the RPA transgene verified by Western blot.
[0335] Example III Cloning Of sgRNAs
[0336] Oligonucleotides to construct sgRNA inserts were ordered from GENEWIZ (Azenta Life Sciences, Inc., USA). Vector backbone was digested overnight with BbsI-HF (New England Biolabs, #R539L) and supplemented with Quick CIP (New England Biolabs, #M0525L) to prevent recircularization. Forward and reverse oligonucleotides corresponding to each sgRNA were resuspended to a concentration of 20 pM then mixed; 5 pL forward oligo, 5pL reverse oligo, 5 pL T4 polynucleotide kinase reaction buffer (lOx; New England Biolabs, #B0201S), and 35 pL ddEEO. Mixture was incubated at 95°C for 4 minutes and left to cool to room temperature. After cooling, ATP (10 mM) and T4 polynucleotide kinase (T4 PNK, New England Biolabs, #M0201L) were added directly to the mixture and incubated at 37°C for 30 minutes. Annealed oligos (2 pL) and digested backbone (20 ng) were then ligated overnight at 16°C with T4 DNA ligase, and used to transform NEB Stable (New England Biolabs, #C3040) cells under ampicillin selection (Thermo Scientific, #163807-06). Successful insertion of sgRNA sequences verified by Sanger sequencing at GENEWIZ (Azenta Life Sciences, Inc., USA).
[0337] Example TV Transfection: sgRNA and RPA(123) Expressing Cell Lines
[0338] Neuroblastoma cell lines and BT474 (~1 x TO6) cells were transfected with 0.5 pg of Super PiggyBac transposase expression vector (System Biosciences, PB210PA-1) and 2 pg of sgRNA donor vector corresponding to either: using Lipofectamine 3000 (Invitrogen, L3000001) and incubated for 6 hours before replacing the media.
[0339] Cells were allowed to recover for 3 days prior to initiating antibiotic selection. Cells were placed under antibiotic selection for 3 - 5 days and then allowed to recover for 3 days without antibiotic selection to facilitate outgrowth and dilution of unincorporated donor vector prior to initiating an additional round antibiotic selection.
[0340] Method used for the generation of SK-N-BE(2)C-RPA(123) was identical to that described for the sgRNA transgenes but employed an alternate selection marker to allow the selection of cells harboring both sgRNA and RPA(123) expression cassettes.
[0341] Example V In Vitro Transcription (IVT) of Cas9D10Aand Cas9H840AmRNA
[0342] Cas9 nickase IVT vectors were digested overnight with Esp3I (New England Biolabs, R0734L) to ensure complete linearization of the DNA template. Linearized template was subsequently purified using a DNA clean & concentrator - 5 spin-column (Zymo Research, D4013) and eluted with nuclease-free H2O (NF- H2O). Individual IVT reactions (20 pL) were carried out with 1 pg of linearized template using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, #E2040S), exchanging UTP with Nl-methylpseudouridine-5’- triphosphate (100 mM; TriLink, #N- 1081-5) and further supplementing the reaction with CleanCap Reagent AG (3’ OMe) (4mM; TriLink, #N-7413), RNasin Plus ribonuclease inhibitor (40 U; Promega, #N2615), and yeast inorganic pyrophosphatase (New England Biolabs, M2403S). Reaction mixture was incubated at 37°C for 2 hours before increasing the reaction volume to 50 pL with NF- H2O and treating the mixture with DNase I (New England Biolabs, &M0303L) at 37°C for 15 minutes to remove residual DNA template. The final IVT product was purified using the Monarch RNA Clean-up Kit (500 pg; New England Biolabs, #T2057L) according to the manufacturer’s instructions. Typical yields obtained from the method described were in excess of 100 pg per reaction, as quantified by a NanoDrop UV / Vis spectrophotometer (Thermo Scientific, &ND-0NE-W).
[0343] IVT products were assessed by denaturing 1 pg of IVT-produced mRNA in RNA loading dye (2X; New England Biolabs, &B0363S) for 10 minutes at 70°C and running the product on a non-denaturing agarose gel (1%). Verified mRNA product was subsequently aliquoted at a concentration of 1 pg / pl and stored at -80°C for downstream applications.
[0344] Example VI Electroporation: Cas9 Nickase mRNA Delivery
[0345] Cas9 nickase mRNAs was delivered by electroporation to each of the cell lines by Neon™ Transfection System 10 pL kit (Invitrogen, &MPK1096). Electroporation parameters were determined empirically for each cell line; i) SK-N-BE(2)C and SH-SY5Y- 1300V pulse voltage, 20 pulse width, 3 pulses; ii) KELLY, NGP, and CHP-212 - 1650V pulse voltage, 10 ms pulse width, 3 pulses; iii) HEK293T cells with a 1200V pulse voltage, 20 ms pulse width, 2 pulses; and iv) BT474 with a 1450V pulse voltage, 20 ms pulse width, 2 pulses.
[0346] All cells (2 x 105 per condition) were early to mid-passage ranging from passage number 5 - 10 and demonstrated >90% viability at the time of electroporation as determined by trypan blue exclusion (Gibco, #15250061) using a TC20 automated cell counter (BioRad, #1450102).
[0347] Cas9 nickase mRNA was prepared in resuspension buffer R supplemented with RNasin Plus (40 U, Promega, #N2615) at the desired concentration in which to resuspend the cells for electroporation. Co-delivery of Cas9D10AmRNA and synthetic sgRNA (300 pmols) (Integrated DNA Technologies, Inc., USA) was carried out in the same manner as described herein. Example VII
[0348] Cell Viability And Proliferation Assays
[0349] Changes in cell viability and cytotoxicity were assessed using the RealTime-Glo™ MT Cell Viability Assay (Promega, #G9713), a non-lytic ATP-independent bioluminescent assay that measures the reduction potential of cells. Given the semi-adherent nature of many of the neuroblastoma cell lines there was minimal manipulation of cells post-electroporation.
[0350] Cell viability was determined in an end-point manner at 3 days post-treatment with either of the Cas9 nickase mRNAs by measuring the relative luminescence units (RLUs) using a GloMax™ Explorer Multimode Microplate Reader (Promega, #GM3500). Changes in cell viability were normalized to / 1 / 1 ES7 targeted cells as no significant difference in viability was observed between AAVS1 and mock-treated controls.
[0351] Cell proliferation was monitored at 24, 48, and 72 hours post-treatment with Cas9 nickase mRNA or in the presence of MK8776 (MedChemExpress, #HY-15532), rucaparib (MedChemExpress, #HY-10617A), calpastatin (Millipore Sigma, #208902), or alisertib (MedChemExpress, #HY- 10971) by QIBC using the Celigo Image Cytometer (Nexcelcom Bioscience, USA) to measure the cell population following staining cell with Hoecsht 33342 (1 pg / mL; Invitrogen, #H1399) at 37°C for 30 minutes.
[0352] Example VIII Comet Assay
[0353] Single cell gel electrophoresis was carried out on SK-N-BE(2)C, KELLY, NGP, CHP- 212, SH-SY5Y, and HEK293T cells expressing different sgRNAs 48 hours post-electroporation with Cas9D10A(30 nM) using the Comet Assay Electrophoresis Kit (R&D Systems, #4250-050- ESK) according to the manufacturer’s instructions.
[0354] Cells were stained with Hoecsht 33342 (1 pg / mL; Invitrogen, #H1399) for 1 hour at room temperature. Cells were visualized and imaged using the EVOS™ FL Imaging System (Invitrogen, #AMF4300, LED, Ex: 357 / 44 Em: 447 / 60, 4 / 10 PH, Sony ICX285AQ color CCD, 2 / 3 in 1360 x 1024, 1.4 Megapixels). Cells used for analysis were imaged at 10X magnification, representative cell images taken at 20X magnification. Tail moments were quantified using an ImageJ (NIH) Comet Assay macro (developed by Herbert M. Geller, NIH, 1997, and further modified by Robert Bagnell, 201 1, Department of Pathology and Laboratory Medicine, UNC- CH).
[0355] Example IX
[0356] Cell Cycle Analysis
[0357] SK-N-BE(2)C cells (2 x IO3cells per condition) expressing the LINE-1, MYCN ox A AV SI targeting sgRNA were electroporated with Cas9D10AmRNA (30 nM) and collected at 1-, 2-, and 3-days post-treatment to assess changes in cell cycle progression. Harvested cells were fixed in 95% ethanol overnight at 4°C, washed twice with PBS (IX), and resuspended in propidium iodide (Thermo Scientific, &J66764-MC) and RNase A (Invitrogen, #AM2271) solution.
[0358] Cells were stained at 37°C for 30 minutes and subsequently analyzed using the MACSQuant™ Analyzer 10 Flow Cytometer (Miltenyi Biotec), and the resulting cell populations were characterized using FlowJo analysis software.
[0359] Example X Metabolism Assays
[0360] SK-N-BE(2)C, NGP, and SH-SY5Y cells (2 x 105) expressing the LINE-1, MYCN or AAVS1 targeting sgRNA were electroporated with Cas9D10AmRNA (30 nM) and monitored for changes in intracellular calcium flux at 1-, 2-, and 3-days post treatment using the calcium indicator dye, Fluo-4 AM (Invitrogen, #F14201). Fluo-4 AM was reconstituted in DMSO and added to cells at a final concentration of 3 pM in PBS (IX) and incubated at room temperature for 1 hour prior to analysis. lonomycin calcium salt (3 pM; Thermo Scientific, #J62448-MCR) was included as a positive control for the elevation of intracellular calcium and averaged across each cell line. Mean integrated fluorescence intensities were acquired by QIBC using the Celigo Image Cytometer (Nexcelcom Bioscience, USA). Reactive oxgen species (ROS) accumulation was monitored at 1-, 2-, and 3-days post treatment using the Total Reactive Oxygen Species (ROS) Assay Kit, 520 nm (Invitrogen, #88-5930-74) according to the manufacturer’s instructions. Mean integrated fluorescence intensities were acquired by QIBC using the Celigo Image Cytometer (Nexcelcom Bioscience, USA). Changes in total cellular ATP was assessed at 3-days post-treatment with Cas9D10Ausing CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7572) according to the manufacturer’s instructions. Changes in NAD+was assessed at 3 -days post-treatment with Cas9D10Ausing NAD / NADH-Glo™ (Promega, #G9072). Changes in ATP or NAD+were determined by measuring the relative luminescence units (RLUs) using a GloMax® Explorer Multimode Microplate Reader (Promega, #GM3500).
[0361] Example XI Western Blotting
[0362] SK-N-BE(2)C, NGP, and SH-SY5Y cells (~2 x 106) expressing the desired sgRNA were electroporated with Cas9D10AmRNA (30 nM) for protein extraction 3-days post-treatment. Cells washed twice with ice-cold PBS (IX) and lysed with RIPA buffer (Thermo Scientific, #89900) containing Halt™ Protease and Phosphatase Inhibitor (Thermo Scientific, #78440) on ice for 30 minutes.
[0363] Lysates were centrifuged at >15,000 g for 30 minutes at 4°C to pellet cell debris and collect the supernatant. Protein concentration was measured by bicinchoninic acid (BCA) assay (Thermo Scientific, #23225). SDS-PAGE gel electrophoresis was carried out using 10 - 20% tricine gels (Invitrogen, #EC6625BOX) in tricine SDS running buffer (IX; Invitrogen, #LC1675) at 130V constant voltage for 1.5 hours at room temperature. Gels were transferred to PVDF membranes using the iBlot™ Dry Blotting System, and subsequently blocked for 1 hour at room temperature in SuperBlock™ Blocking Buffer (0.05% Tween-20; Thermo Scientific, #37535) before overnight primary antibody incubation at 4°C.
[0364] Primary antibodies used include; N-Myc monoclonal antibody (NCM-II 100; 1 :500, Invitrogen, #MA1-17O); PARP1 polyclonal antibody (1 : 1000, Invitrogen, #PA5-34803); phosphor-RIPK 1 (Ser166) polyclonal antibody (1 :2000, Proteintech, #28252-l-AP); Poly ADP- ribose antibody, clone 10H (1 : 1000, Millipore Sigma, #MABC547); Caspase 3 polyclonal antibody (1 : 1000, Invitrogen, #PA5-77887); phospho-EXOl(Ser746) (1 : 1000, Millipore Sigma, #ABE1066); phospho-yH2AX (Serl39) polyclonal antibody (1 : 10,000, Bethyl Laboratories, #A300-081A); phosphor-CHK 1 (Ser345) polyclonal antibody (1 : 1000, Invitrogen, #PA5- 34625); phosphor-RPA32 (Ser33) polyclonal antibody (1 : 1000, Invitrogen, #PA5-39809); RPA2 monoclonal antibody (9H8) (1 :500, Invitrogen, #MA1-26418); 0-actin polyclonal antibody (1:5000, Proteintech, #20536-l-AP). Blots were washed 3 - 5 times in TBST prior to secondary antibody incubation for 1 .5 hours at room temperature with either anti-rabbit IgG, HRP- conjugated antibody (1 :5000, Cell Signaling Technology, #7074) or anti-mouse IgG, HRP- conjugated antibody (1 :5000, R&D Systems, #HAF007).
[0365] Blots were incubated in ECL substrate (Thermo Scientific, #32106) for 1 - 2 minutes before visualization using ChemiDoc™ Touch Imaging System (BioRad). Staurosporine (1 pM; MedChemExpress, #HY-15141) used as a positive control for caspase 3 activation in SH-SY5Y cells.
[0366] Example XII Micronuclei Detection Assay
[0367] Surviving SK-N-BE(2)C cells expressing the designed sgRNAs were harvested 3 days following electroporation with Cas9D10AmRNA (30 nM) and washed twice in PBS (IX) to remove dead cells and debris before being stained with Hoecsht 33342 (1 pg / mL; Invitrogen, #H1399) for 30 minutes at room temperature. Cells were pelleted at 1,000 x g and resuspended in Nuclei Prep Buffer (New England Biolabs, #T3052) containing RNase A (Invitrogen, #AM2271) and incubated at room temperature for 5 minutes. Nuclei Prep Buffer is an incomplete lysis buffer disrupting the cell membrane while leaving nuclei intact. SK-N-BE(2)C nuclei from each condition were analyzed using the the MACSQuant™ Analyzer 10 Flow Cytometer (Miltenyi Biotec), and further characterized using FlowJo analysis software.
[0368] Example XIII Gene Copy Number Variance Assay
[0369] Genomic DNA was extracted from each of the cell lines using the DNeasy Blood & Tissue Kit (Qiagen, #69504). DNA concentration was obtained using the Qubit™ dsDNA quantitation high-sensitivity kit (Invitrogen, #Q32851).
[0370] MYCN genome copy number variance was determined by performing a TaqMan copy number variance real-time qPCR assay using the QuantStudio3 (Applied Biosystems, USA) according to the manufacturer’s instructions using RNaseP as an internal control. MYCN was amplified using the followng primers: forward (5’ - ACTCTGTCCCTTAAGGAGCAACC - 3’); and reverse (5’ - CCAACCAGGATTGTACAGGTGC - 3’).
[0371] Average MYCN copy number between neuroblastoma cell lines was determined by comparative Ct normalized to a MYCN-non amplified control.
[0372] Example IVX Indel Analysis
[0373] Genomic DNA was extracted from each of the cell lines using the DNeasy Blood & Tissue Kit (Qiagen, #69504) 3 days post-treatment with Cas9D10AmRNA. DNA concentration was obtained using the Qubit™ dsDNA quantitation high-sensitivity kit (Invitrogen, #Q32851).
[0374] The sgMYCN-1 target site was amplified using the following primers: forward (5’ - GTAGAGCATAGTTTGTCTCC - 3’); and reverse (5’ - CTATCTCCTTAACACACAAG- 3’).
[0375] Amplicon-Seq was performed GENEWIZ (Azenta Life Science, Inc., USA). Raw data was analyzed using the CRISPResso2 deep sequencing analysis webtool.
[0376] Example XV Immunocytochemi stry
[0377] Surviving SK-N-BE(2)C cells expressing the designed sgRNAs electroporated with Cas9D10A- mRNA (30 nM) or incubated with ATRA (10 pM; MedChemExpress, # HY- 14649) were assessed at 5-days post-treatment. Cells were fixed with ice-cold methanol (100%) for 15 minutes at 4°C, washed briefly with PBS (IX), and permeabilized with PBST (0.5%) for 5 minutes at room temperature. Following permeabilization, cells were washed briefly with PBS (IX) and blocked with SuperBlock™ Blocking Buffer (0.05% Tween-20; Thermo Scientific, #37535) for 30 minutes at room temperature. Primary antibody incubation performed overnight at 4°C. Primary antibody was removed by washing 3x with PBS (IX). Secondary antibody incubation performed for 1 hour at room temperature. TUBB3 was probed with beta-3 tubulin polyclonal antibody (1 :50; Invitrogen, #PA5-25655) and goat anti-rabbit IgG (H+L) AF488 (1:250; Invitrogen, #A32731). Ki-67 was probed with Ki-67 recombinant monoclonal antibody (1:200; Invitrogen, #MA5-14520) and goat anti-rabbit IgG (H+L) AF594 (1 :250; Invitrogen, #A11012). Expression analysis of TUBB3 and Ki-67 was achieved by QIBC using the Celigo Image Cytometer (Nexcelcom Bioscience, USA). Representative images were taken using the EVOS™ FL Imaging System (Invitrogen, #AMF4300, LED, Ex: 357 / 44 Em: 447 / 60, Ex: 482 / 25 Em: 524 / 24, 4 / 10 PH, Sony ICX285AQ color CCD, 2 / 3 in 1360 x 1024, 1.4 Megapixels). Image processing conducted with Fiji (ImageJ).
[0378] Example XVI
[0379] Quantification And Statistical Analysis
[0380] All statistical analyses were carried out using GraphPad Prism software. Quantitative data, apart from where individual values are demonstrated, represent the mean ± standard deviation. Comparative statistical analyses were conduction using multiple unpaired t-tests; ns, P > 0.05; *, P < 0.05; ** P < 0.01; ***, P < 0.001; ****, P < 0.0001.
Claims
ClaimsWe claim:
1. A method, comprising: a) providing: i) a Cas9 nickase or a messenger ribonucleic acid (mRNA) construct encoding a Cas9 nickase; ii) a cancer cell comprising amplified genomic loci; iii) a specific genomic target comprising a deoxyribonucleic acid (DNA) strand located within each of said amplified genomic loci; and iv) a single guide ribonucleic acid (sgRNA) complementary to at least a portion of said DNA strand; b) cleaving said target DNA strand with said Cas9 nickase; and c) replicating said cleaved DNA strand that results in death of said cancer cell.
2. The method of Claim 1, wherein said cleaving results in a single stranded break (SSB).
3. The method of Claim 1, wherein said replicating converts said SSB into a double stranded break (DSB).
4. The method of Claim 1, wherein said amplified genomic loci comprises a plurality of first genes.
5. The method of Claim 4, wherein said amplified genomic loci further comprises a plurality of second genes.
6. The method of Claim 4, wherein the number of said plurality of first genes range between 5 - 2000 gene copies.
7. The method of Claim 5, wherein the number of said plurality of second genes range between 5 - 2000 gene copies.
8. The method of Claim 4, wherein said plurality of first genes are selected from the group consisting of an MYCN gene, am ALK gene, a MYC gene and an ERBB2 (HERZ) gene.
9. The method of Claim 5, wherein said plurality of second genes are selected from the group consisting of an MYCN gene, an ALK gene, a MYC gene and an ERBB2 (HER2) gene.
10. The method of Claim 1, wherein said method further comprises administering said Cas9 nickase or said mRNA construct and said sgRNA to said cancer cell.
11. The method of Claim 10, wherein said administering is selected from the group consisting of systemic, intravenous and intratumoral.
12. The method of Claim 10, wherein said administering comprises a lipid nanoparticle encapsulating at least one of a component selected from the group consisting of said Cas9 nickase, said mRNA construct and said sgRNA.
13. The method of Claim 1, wherein said method further comprises expressing said encoded Cas9 nickase in said cancer cell.
14. The method of Claim 1, wherein said method further comprises contacting said Cas9 nickase or said expressed Cas9 nickase and said sgRNA with said DNA strand.
15. The method of Claim 10, wherein said method further comprises providing a patient exhibiting at least one cancer symptom.
16. The method of Claim 15, wherein said administering results in a reduction of said at least one cancer symptom.
17. The method of Claim 12, wherein said lipid nanoparticle comprises a component selected from the group consisting of DLin-MC3-DMA, DSPC, cholesterol, PEG-DMG, DSPE- PEG, and DSPE-PEG-Maleimide.
18. The method of Claim 12, wherein said lipid nanoparticle comprises a targeting agent.
19. The method of Claim 18, wherein said targeting agent is attached to the surface of said lipid nanoparticle.
20. The method of Claim 18, wherein said targeting agent is a cancer targeting agent.
21. The method of Claim 20, wherein said cancer targeting agent comprises a disialoganglioside (GD2) antibody or a GD2 scFv.
22. The method of Claim 1, wherein said mRNA construct further comprises a 3' untranslated region (3' UTR).
23. The method of Claim 1, wherein said mRNA construct further comprises a 5' UTR.
24. The method of Claim 1, wherein said mRNA construct further comprises a 3' UTR and a 5' UTR.
25. The method of Claim 19, wherein said 3' UTR encodes a motif selected from the group consisting of a human hemoglobin alpha (hHBa) motif, an amino-terminal enhancer of split (AES) motif and a mitochondrially encoded 12S rRNA (mt-RNRl) motif.
26. The method of Claim 20, wherein said 5' UTR encodes a motif selected from the group consisting of a human hemoglobin alpha (hHBa) motif, an amino-terminal enhancer of split (AES) motif and a mitochondrially encoded 12S rRNA (mt-RNRl) motif.
27. The method of Claim 1, wherein said mRNA construct further comprises an MYCN 3' UTR.
28. The method of Claim 1, wherein said mRNA construct further comprises an MYCN 5' UTR.
29. The method of Claim 24, wherein said 5' UTR and said 3' UTR comprises an MYCN.
30. The method of Claim 24, wherein said mRNA construct further comprises a hHBa 5’UTR.
31. The method of Claim 1, wherein said Cas9 nickase is an SpyCas9D10Anickase.
32. The method of Claim 1, wherein said Cas9 nickase is an SpyCas9H840Anickase.
33. The method of Claim 1, wherein said Cas9 is a catalytically inactivated SpyCas9D10A / H840A.
34. The method of Claim 1, wherein said mRNA construct is human codon optimized.
35. The method of Claim 1, wherein said mRNA construct further comprises at least one Nl- methylpseudouridine (mlT).
36. The method of Claim 1, wherein said mRNA construct further comprises a Kozak sequence.
37. The method of Claim 1 , wherein said mRNA construct further comprises a poly-A tail with a length ranging between 20 - 152 adenine (A) nucleotides.