Conjugate for treating repeat expansion disorders
A conjugate of a peptide carrier with a specific sequence RBRRYQFLIRBRXR linked to a therapeutic nucleic acid via a beta-alanine linker addresses the efficacy-toxicity tradeoff of CPPs, achieving effective splicing correction and reduced toxicity for treating DM1.
Patent Information
- Application Number
- PCT/GB2025/050874
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-29
- Filing Date
- 2025-04-24
- Publication Date
- 2025-11-06
AI Technical Summary
Current cell-penetrating peptides (CPPs) used for delivering antisense oligonucleotides to treat genetic diseases like myotonic dystrophy (DM1) face challenges of efficacy versus toxicity, with longer peptides being more toxic and existing CPPs not suitable for human treatments.
A conjugate of a peptide carrier with a specific sequence RBRRYQFLIRBRXR covalently linked to a therapeutic nucleic acid via a beta-alanine linker, designed to effectively penetrate cells and target nucleotide repeat expansions with reduced toxicity.
The conjugate achieves effective delivery and splicing correction in target tissues, reducing toxicity and improving physiological conditions in DM1 models, demonstrating complete splicing correction and normalizing muscle function.
Smart Images

Figure GB2025050874_06112025_PF_FP_ABST
Abstract
Description
CONJUGATE FOR TREATING REPEAT EXPANSION DISORDERSFIELD OF THE INVENTION
[0001] The present invention relates to a conjugate of a specific cell penetrating peptide covalently linked to a therapeutic antisense oligonucleotide having a nucleotide repeat sequence, suitable for treatment of repeat expansion based disorders, in particular myotonic dystrophy (DM1).BACKGROUND
[0002] Nucleic acid therapeutics are genomic medicines with the potential to transform human healthcare. Research has indicated that such therapeutics could have applications across a broad range of disease areas. In particular, the application of antisense oligonucleotide-based methods to modulate mRNA expression has become a desirable means of therapy at the forefront of precision medicine.
[0003] However, therapeutic development of these promising antisense therapeutics has been hampered by insufficient cell penetrance and poor distribution characteristics.
[0004] Therefore there is a strong and urgent need to improve the delivery of antisense oligonucleotides in order to provide a more effective therapy for genetic diseases such as devastating trinucleotide repeat disorders.
[0005] Repeat expansion disorders are genetic diseases characterised by the presence of an abnormally high number of repeats of a specific sequence of nucleotides within genomic DNA, otherwise known as a nucleotide repeat expansion. Trinucleotide repeat expansions are a specific type of microsatellite repeat, often known as microsatellite expansions. Typically, there is a threshold number of repeats that are found in a normal healthy subject, and if this number is exceeded then the disease is pathogenic. The threshold number differs between diseases and affected genes. It is also typical in these diseases that the number of repeats can indicate the severity of the disease. Generally, a higher number of repeats indicates a more severe presentation of the disease. The number of repeats can also be used to predict the age of onset of the diseases, with higher numbers of repeats indicating early onset.
[0006] At present, there are 14 known trinucleotide repeat disorders that affect humans. These disorders can be grouped by several methods, for example by where the trinucleotide repeat is located in the gene, whether it is in a protein coding ORF; in an exon; or in an untranslatedregion. Alternatively, they can be grouped by the sequence of the triplet repeat. In many trinucleotide disorders, the triplet repeat is ‘CAG’ and encodes glutamine, this group of disorders are commonly known as polyglutamine disorders. However, trinucleotide repeats having other sequences are known, and can be grouped as non-polyglutamine repeat disorders.
[0007] One trinucleotide disorder known as a non-polyglutamine repeat disorder is myotonic dystrophy type 1 (DM1). DM1 is caused by a trinucleotide repeat of ‘CTG’ present within the 3’ UTR of the DMPK gene resulting in an RNA gain-of-function disease mechanism. The progressive muscle function impairment and degeneration are a direct consequence of the pathological effects of the CTG repeat expansion (Bigot et al 2009; Vignaud et al 2010). Mutant DMPK transcripts accumulate in affected cell nuclei and as a result sequester nuclear proteins (implicated in splicing regulation e.g. MBNL1) resulting in splicing defects of CLCN1, ATP2A1, BINI, MBNL1 or DMD pre-mRNAs, the most widely used biomarkers of DM1 (Rau et al, 2015). A normal number of repeats for this gene is between 5 and 34 repeats. Above 34 repeats, there may be some symptoms of the disease, and above 50 repeats the disease is pathogenic.
[0008] DM1, and other repeat expansion disorders, typically affect the neuromuscular system and do not currently have any effective treatments.
[0009] Whilst the use of antisense oligonucleotides (ASOs) which can bind to repeat regions and interrupt splicing or translation has been theoretically proposed and shown in vitro, the use of such antisense oligonucleotides as therapeutics has not been possible due to the difficulty of delivering these molecules into affected cells. This is the case for the treatment of a wide variety of genetic diseases, including trinucleotide repeat disorders. The weak muscle efficacy of naked ASOs is evident from numerous pre-clinical studies in DM1 and DMD with 2’OMePS and morpholino phosphorodiamidate (PMO) chemistries and is also evident from a clinical study using constrained ethyl (cEt) AOs in DM1 patients that showed no change in muscle biomarkers (IONIS / BIOGEN, 2017).
[0010] The use of viruses as delivery vehicles has been suggested, however their use is limited due to the immunotoxicity of the viral coat protein and potential oncogenic effects. Alternatively, a range of non-viral delivery vectors have been developed, amongst which peptides have shown the most promise due to their small size, targeting specificity and ability of trans-capillary delivery of large bio-cargoes. Several peptides have been reported for their ability to permeate cells either alone or carrying a bio-cargo.
[0011] For several years, cell-penetrating peptides (CPPs) have been conjugated to single stranded oligonucleotides (in particular charge neutral phosphorodiamidate morpholino oligomers (PMO) and peptide nucleic acids (PNA)) in order to enhance the cell delivery of such therapeutics by effectively carrying them across cell membranes to reach their pre-mRNA target sites in the cell nucleus. It has been shown that PMO therapeutics conjugated to certain arginine- rich CPPs (known as P-PMOs or peptide-PMOs) can enhance dystrophin production in skeletal muscles following systemic administration in the mdx mouse model of DMD.
[0012] In particular, a group of CPPs were developed having two arginine-rich sequences separated by a central short hydrophobic sequence. These peptides were designed to improve serum stability whilst maintaining a relatively high level of exon skipping, initially by attachment to a PNA therapeutic. Further derivatives of these peptides were designed as conjugates with PMOs, which were shown to lead to body-wide skeletal muscle dystrophin production following systemic administration in mice. However, despite these CPPs being efficacious in delivery, their therapeutic application has been restricted by their associated toxicity.
[0013] Alternative cell-penetrating peptides having only a single arginine rich domain such as ReGly have also been produced. These CPPs have been used to produce peptide conjugates with reduced toxicities, but in contrast to the dual arginine-rich domain CPPs, the ReGly conjugates exhibited lower efficacy.
[0014] Accordingly, the currently available CPPs have not yet been demonstrated as suitable for use in human treatments for diseases. They have proven to be either ineffective or too toxic.
[0015] The challenge in the field of cell-penetrating peptide technology has been to de-couple efficacy and toxicity. Work on CPPs so far has suggested that longer peptides with high numbers of arginine residues are key to cell penetration capability, with much evidence teaching towards increasing the number of Arginine residues. However research has shown that there is a tradeoff with toxicity, whereby simply increasing the total number of arginine residues increases toxicity. Research efforts in the field to date have not focused on the positioning of arginine residues within the peptide, nor the overall structure of the CPP.
[0016] Furthermore, almost all development of CPPs has been in the context of treating DMD. There has been a lack of research into the use of such carrier peptides in other neuromuscular diseases having different causes and different pathologies. Patients having DM1 still present an unmet need with no effective treatment. The currently available CPPs have not yet been demonstrated as suitable for use in conjugates with nucleic acid therapeutics for treatment ofgenetic disorders, especially not diseases resulting from a different pathology such as repeat expansion disorders.
[0017] The present inventors have now identified, synthesised and tested conjugates comprising an improved carrier peptide having a particular sequence, covalently linked to a therapeutic nucleic acid for the treatment of a repeat expansion disorder which addresses at least this problem.DETAILED DESCRIPTION
[0018] According to a first aspect of the present invention there is provided a conjugate comprising: a peptide carrier covalently linked via a linker to a therapeutic molecule; wherein the peptide carrier has a total length of 40 amino acids or less and comprises the following sequence: RBRRYQFLIRBRXR (DEL01) (SEQ ID NO: 1); wherein the linker comprises betaalanine (B); and wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of nucleotide repeats.
[0019] In one embodiment of the first aspect, the nucleic acid comprises a plurality of nucleotide repeats, wherein the repeating sequence is least 3 nucleotides in length. In one embodiment of the first aspect, the nucleic acid comprises a plurality of trinucleotide repeats. In one embodiment the trinucleotide repeat is selected from GTC, CAG, GCC, GGC, CTT, and CCG repeats.
[0020] In one embodiment of the first aspect, the nucleic acid comprises or consists of a plurality of CAG repeats.
[0021] In one embodiment of the first aspect, the nucleic acid comprises or consists of between 5-20 nucleotide repeats, optionally between 5-10 nucleotide repeats, optionally 7 nucleotide repeats.
[0022] In one embodiment of the first aspect, the nucleic acid comprises or consists of 7 CAG repeats.
[0023] In one embodiment of the first aspect, the nucleic acid is an antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (for example in the use of CRISPR / Cas9 technology), short interfering RNA, micro RNA, and antagomiRNA. In one embodiment, the nucleic acid is an antisense oligonucleotide.
[0024] In one embodiment of the first aspect, the nucleic acid is an antisense oligonucleotide consisting of 7 CAG repeats.
[0025] In one embodiment of the first aspect, the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide (PMO).
[0026] In one embodiment of the first aspect, the nucleic acid binds to a nucleotide repeat expansion, optionally a trinucleotide repeat expansion, which may optionally be present in a non-coding sequence of RNA.
[0027] In one embodiment of the first aspect, the peptide carrier consists of the following sequence: RBRRYQFLIRBRXR (DEL01) (SEQ ID NO: 1).
[0028] In one embodiment of the first aspect, the linker consists of a beta-alanine residue (B).
[0029] According to a second aspect of the present invention there is provided a pharmaceutical composition comprising the conjugate of the first aspect.
[0030] According to a third aspect of the present invention, there is provided a conjugate according to the first aspect, or a pharmaceutical composition according to the second aspect, for use as a medicament.
[0031] In an alternative third aspect, there is provided a method of preventing or treating of a disease in a subject, the method comprising: administering an effective amount of the conjugate according to the first aspect, or the pharmaceutical composition according to the second aspect to the subject.
[0032] According to a fourth aspect of the present invention, there is provided a conjugate according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the prevention or treatment of an repeat expansion disorder.
[0033] In an alternative fourth aspect, there is provided a method of preventing or treating of a repeat expansion disorder in a subject, (or a method of treatment of a subject having a repeat expansion disorder), the method comprising: administering an effective amount of the conjugate according to the first aspect, or the pharmaceutical composition according to the second aspect to the subject.
[0034] In one embodiment of the fourth aspect, the repeat expansion disorder is a trinucleotide repeat disorder, which may optionally be selected from a polyglutamine disease or a non- polyglutamine disease.
[0035] In one embodiment of the fourth aspect, the trinucleotide repeat disorder is selected from: DRPLA (Dentatorubropallidoluysian atrophy), HD (Huntingdon’s disease), HDL2 (Huntingdon disease like syndrome 2), SBMA (spinal and bulbar muscular atrophy), SCA1(spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado-Jospeh disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 7), SCA17 (spinocerebellar ataxia type 17), HDL2 (Huntingdon disease like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X temor / ataxia syndrome), FRAXE (Fragile XE mental retardation), FRDA (Friedrich’s ataxia), DM1 (Myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8), and SCA12 (spinocerebellar ataxia type 12).
[0036] In one embodiment of the fourth aspect, the trinucleotide repeat disorder is myotonic dystrophy type 1 (DM1).
[0037] The present invention is based on the finding that the attachment of a particular peptide carrier to a nucleic acid which is suitable for preventing and treating repeat expansion disorders, allows the nucleic acid to effectively penetrate target cells and bind to target nucleotide repeat expansions present in genes of affected subjects. This activity reduces the levels of repeat expansion transcripts and / or proteins present in a cell, and thereby blocks their pathological interaction with the splicing machinery of the cell, normalising splicing and improving the physiological condition of said subjects.
[0038] Advantageously, the peptide carrier described herein has a specific sequence which seems to increase the ability of the therapeutic nucleic acid to resist degradation, penetrate target tissues such as skeletal muscle and heart, and reach the target nucleotide expansions to provide therapy. In addition, the conjugates of the invention formed using this peptide, have much lower toxicity than conjugates formed with other known peptide carriers discussed above. Therefore, the conjugate provides a means for effective delivery of a nucleic acid therapy for repeat expansion disorders whilst remaining non-toxic to the subject.
[0039] In the presented data herein, the conjugate of the invention maintains good levels of efficacy and delivery to key target tissues that are affected by trinucleotide disorders such as the gastrocnemius and quadriceps skeletal muscles. Furthermore, the conjugate demonstrates an improvement in efficacy compared with previously available carrier peptides when used in the same conjugate for treating DM1 disease pathology. The conjugates of the invention targets mutant CUG expanded-DMPK transcripts to prevent the formation of nuclear foci and thereby prevent the detrimental sequestration of MBNL1 splicing factor by the nuclear RNA foci, and consequently mitigate MBNL1 functional loss which is responsible for splicing defects in multiple genes and muscle dysfunction.
[0040] This is demonstrated herein by splicing correction of genes after administration of a conjugate of the invention, which genes are typically misspliced in DM1 due to the reduced availability of MBNL1 sequestered by the trinucleotide repeat expansion transcripts. Specifically, the conjugate demonstrated herein shows complete splicing correction when comparing to untreated cells / subjects, two weeks after four injections using a low 7.5mg / kg dose. This is further demonstrated by an improvement in the physiological condition of trinucleotide disorders, as is shown herein in DM1 models where myotonia in mice was normalised and corrected to the point of complete recovery for at least 3 months after a single injection of the conjugate described herein.
[0041] Surprisingly, the inventors have found that the specific peptide used in the conjugate delivers the therapeutic molecule effectively into the nuclear compartment, and into the nuclear aggregates of DMPK transcripts at sufficient concentration to allow a favourable stoichiometric interaction with the CUG mutation.
[0042] At the same time, the conjugate of the invention acts effectively in vivo with reduced clinical signs following systemic injection and lower toxicity as observed through measurement of biochemical markers. Crucially, the present conjugate shows a surprisingly reduced toxicity following similar systemic injection into mice when compared with previous carrier peptides in the same conjugate. As is demonstrated herein, the present conjugate causes no significant increase in toxicity markers compared to saline even at doses that are more than 5-fold the therapeutically relevant dose, and maintains cell viability whilst conjugates using prior peptide carriers show significant cell mortality. When the conjugate is administered to mice, the mice have a quick recovery time of around 30-45 minutes which is much faster than after administration of conjugates formed with previously available peptides.
[0043] Accordingly, the conjugate of the invention offers a much improved suitability for use as a safe and effective therapy for repeat expansion disorders in humans, especially for DM1, providing an avenue for treatment.
[0044] Further features and embodiments of the invention will now be described in the following headed sections. Unless explicitly noted otherwise, any feature may be combined with the above aspects, or with other features herein, in any compatible combination. Individual features are not limited to any particular embodiment. The section headings used herein are for organisational purposes only and are not to be construed as limiting the subject matter described.
[0045] References to a ‘peptide carrier’ throughout denote a peptide which is suitable to transport a molecule which is conjugated thereto into cells i.e. a cell-penetrating peptides. The terms ‘cell penetrating peptide’ and ‘peptide carrier’ and ‘peptide’ may used interchangeably throughout.
[0046] References to ‘X’ throughout denote any form of the artificial, synthetically produced amino acid 6-aminohexanoic acid.
[0047] References to ‘B’ throughout denote the natural but non-genetically encoded amino acid beta-alanine.
[0048] References to other capital letters throughout denote the relevant genetically encoded amino acid residue in accordance with the accepted alphabetic amino acid code.
[0049] References to an ‘artificial’ amino acid or residue herein denotes any amino acid that does not occur in nature and includes synthetic amino acids, modified amino acids (such as those modified with sugars), non-natural amino acids, man-made amino acids, spacers, and non-peptide bonded spacers. For the avoidance of doubt, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. For the avoidance of doubt, beta-alanine (B) and hydroxyproline (Hyp) occur in nature and therefore are not artificial amino acids in the context of the present invention but are natural amino acids. Artificial amino acids may include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3 -carboxylic acid (TIC), 1- (amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine-carboxylic acid (Az), 11- aminoundecanoic acid.
[0050] Peptide Carrier
[0051] The present invention relates to conjugates comprising a specific peptide carrier sequence for use in transporting therapeutic nucleic acids formed of nucleotide repeats in the treatment of medical conditions.
[0052] Suitably the peptide carrier comprises the sequence RBRRYQFLIRBRXR (DEL01) (SEQ ID NO: 1).
[0053] Suitably wherein the ‘X’ residues are 6-aminohexanoic acid.
[0054] Suitably the peptide carrier comprises a structure of two arginine rich domains surrounding a hydrophobic domain. Suitably the two arginine rich domains flank a central hydrophobic domain. Suitably the two arginine rich domains are cationic.
[0055] Suitably the first arginine rich domain comprises or consists of the sequence RBRR (SEQ ID NO: 16). Suitably the second arginine rich domain comprises or consists of the sequence RBRXR (SEQ ID NO:2). Suitably the hydrophobic domain comprises or consists of the sequence YQFLI (SEQ ID NO: 15).
[0056] Optionally the peptide carrier may comprise additional amino acid sequences, suitably at the N terminus or C terminus of the sequence RBRRYQFLIRBRXR (SEQ ID NO: 1). Suitably each additional amino acid sequence may comprise between 1 and 25 amino acids. Optionally the additional amino acid sequences may comprise a total of between 1 and 25 amino acids. For example, the peptide carrier may comprise an additional N terminal sequence of between 1 and 25 amino acids, and / or an additional C terminal sequence of between 1 and 25 amino acids. Suitably to a total not exceeding 25 amino acids in length. Suitably the optional additional amino acid sequence may provide additional functions to the peptide carrier, or may improve the characteristics of the peptide carrier.
[0057] The peptide carrier of the present invention is defined as having a total length of 40 amino acid residues or less. The peptide may therefore be regarded as an ‘oligopeptide’. Suitably, the peptide has a total length of between 3-30 amino acid residues, suitably of between 5-25 amino acid residues, of between 10-25 amino acid residues, of between 13-23 amino acid residues, of between 15-20 amino acid residues. Suitably, the peptide has a total length of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 amino acid residues.
[0058] The peptide of the present invention may comprise a total of 10 or fewer arginine residues. By total it is meant the sum of the number of arginine residues present in the entire peptide. Suitably, the peptide may comprise 9 or fewer, 8 or fewer, 7 or fewer arginine residues, suitably 6 or fewer arginine residues.
[0059] The peptide of the present invention may comprise a total of at least 3 arginine residues. Suitably, the peptide may comprise 3 or more arginine residues, suitably 4 or more arginine residues, suitably 5 or more arginine residues, suitably 6 or more arginine residues.
[0060] Optionally the peptide carrier may comprise one or more modifications, suitably modifications to one or more of the amino acids in the sequence RBRRYQFLIRBRXR (SEQ ID NO: 1). Suitable amino acid modifications may include: N-glycosylated, N-guanidinium, N- acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, N- methylsulfonylated, Carboxy-, Thioacid-, Aminooxy-, Hydrazino-, thioester-, azide, strained alkyne, strained alkene, aldehyde-, thiol or haloacetyl-group. Optionally the modification maybe located at the N or C terminus of the peptide carrier, and / or on a side chain of an amino acid. In one embodiment, the peptide carrier comprises acetylation, suitably N-terminal acetylation.
[0061] Advantageously, the C-terminal or N-terminal modification may provide a means for linkage of the peptide to the therapeutic molecule. Accordingly, the C-terminal modification or the N-terminal modification may comprise the linker and vice versa. Suitably, the C-terminal modification or the N-terminal modification may consist of the linker or vice versa. Suitable linkers are described herein elsewhere. Suitably, the peptide carrier comprises a C-terminal carboxyl group. Suitably, the C-terminal carboxyl group is provided by a glycine, beta-alanine, glutamic acid, or gamma-Aminobutyric acid residue. In one embodiment, the C terminal carboxyl group is provided by a beta-alanine (B) residue. Suitably, the C terminal residue is a linker. Suitably, the C terminal residue is a linker.
[0062] In one embodiment, the peptide carrier consists of the sequence RBRRYQFLIRBRXR (DEL01) (SEQ ID NO: 1).
[0063] Suitably the peptide is capable of penetrating cells. The peptide may therefore be regarded as a cell-penetrating peptide.
[0064] Suitably, the peptide is for attachment to a therapeutic molecule. Suitably, the peptide is for transporting a therapeutic molecule into a target cell. Suitably, the peptide is for delivering a therapeutic molecule into a target cell. The peptide is therefore regarded peptide carrier.
[0065] Suitably, the peptide carrier is capable of penetrating into cells and tissues, suitably into the nucleus of cells. Suitably into muscle tissues.
[0066] Linker
[0067] The present invention relates to conjugates comprising a specific peptide carrier sequence linked to a therapeutic molecule via a linker.
[0068] Suitably the peptide carrier is covalently linked to the therapeutic molecule via the linker. Suitably, the peptide carrier is covalently linked to the therapeutic molecule at the C- terminus or N-terminus. Suitably, the peptide carrier is covalently linked to the therapeutic molecule at the C-terminus.
[0069] Suitably the linker is present between the peptide and the therapeutic molecule. Suitably the linker is a separate group to the peptide and the therapeutic molecule.
[0070] In one embodiment, the conjugate comprises the peptide carrier covalently linked via a linker to a therapeutic molecule.
[0071] In one embodiment, the conjugate comprises the following structure:[peptide] - [linker] -[therapeutic molecule]
[0072] In one embodiment, the conjugate consists of the following structure:[peptide] - [linker] -[therapeutic molecule]
[0073] Suitably, the linker is selected from any of the following sequences: G, C, BC, XC, GC, B, GB, XB, X, GX, BX, or amino-polyethyleneglycolcarboxylate.
[0074] Suitably the linker is between 1-5 amino acids in length. Sutiably the linker is 1 amino acid.
[0075] In one embodiment, the linker comprises one or more beta-alanine residues. In one embodiment, the linker consists of a beta-alanine residue (B).
[0076] In one embodiment, therefore the conjugate comprises:RBRRYQFLIRBRXR-B (SEQ ID NO: 3)
[0077] In one embodiment, therefore the conjugate comprises: Ac-RBRRYQFLIRBRXR-B (SEQ ID NO: 4)
[0078] In one embodiment, therefore the conjugate comprises the following structure: RBRRYQFLIRBRXR-B -[therapeutic molecule], suitably which may be according to SEQ ID NO: 5.
[0079] In one embodiment, therefore the conjugate comprises the following structure: Ac-RBRRYQFLIRBRXR-B-[therapeutic molecule], suitably which may be according to SEQ ID NO: 6. wherein ‘Ac’ is Acetyl. Suitably indicates a covalent bond.
[0080] Therapeutic Molecule
[0081] The peptide carrier is covalently linked to a therapeutic molecule in order to provide a conjugate of the invention, wherein the therapeutic molecule is a nucleic acid comprising a plurality of nucleotide repeats.
[0082] Suitably the nucleic acid may be selected from: an antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (for example in the use of CRISPR / Cas9 technology), short interfering RNA, micro RNA, and antagomiRNA.
[0083] Suitably, the nucleic acid is an antisense oligonucleotide. Suitably, the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide (PMO).
[0084] Alternatively the antisense oligonucleotide may be a modified PMO or any other chargeneutral antisense oligonucleotide such as a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a chemically modified PNA such as a gamma-PNA (Bahai, Nat. Comm. 2016), oligonucleotide phosphoramidate (where the non-bridging oxygen of the phosphate is substituted by an amine or alkylamine such as those described in WO2016028187A1, or any other partially or fully charge-neutralized oligonucleotide.
[0085] Suitably the therapeutic molecule has a molecular weight of less than 15,000 Da, suitably less than 13,000 Da or suitably less than 10,000 Da.
[0086] Suitably, the nucleic acid consists of a plurality of nucleotide repeats.
[0087] Suitably the nucleic acid comprises any length of nucleotide repeat. Suitably the nucleic acid may comprise any tandem repeat. Suitably the nucleic acid may comprise a plurality of nucleotide repeats, wherein the repeating sequence is at least three nucleotides in length. Suitably the nucleic acid may comprise a plurality of nucleotide repeats, wherein the repeating sequence is between 3 and 10 nucleotides in length. Suitably the nucleic acid may comprise a trinucleotide repeat, a tetranucleotide repeat, a pentanucleotide repeat, a hexanucleotide repeat, a heptanucleotide repeat, an octanucleotide repat, a nonanucleotide repat, or a decanucleotide repeat.
[0088] Suitably the nucleic acid comprises a plurality of trinucleotide repeats. Suitably which may be selected from: GTC, CAG, GCC, GGC, CTT, and CCG repeats. Suitably the nucleic acid consists of a plurality of trinucleotide repeats selected from: GTC, CAG, GCC, GGC, CTT, and CCG repeats.
[0089] Suitably the nucleic acid comprises CAG repeats. Suitably the nucleic acid consists of CAG repeats.
[0090] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising CAG repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of CAG repeats.
[0091] Suitably the nucleic acid comprises, or consists of, a plurality of nucleotide repeats. Suitably the nucleic acid comprises, or consists of at least 2 nucleotide repeats. Suitably the nucleic acid comprises, or consists of, between 5-50 nucleotide repeats. Suitably the nucleic acidcomprises, or consists of, between 5-40 nucleotide repeats. Suitably the nucleic acid comprises, or consists of, between 5-30 nucleotide repeats. Suitably the nucleic acid comprises, or consists of, between 5-20 nucleotide repeats. Suitably the nucleic acid comprises, or consists of, between 5-10 nucleotide repeats. Suitably the nucleic acid comprises, or consists of, 7 nucleotide repeats. Suitably, in one embodiment, the nucleic acid comprises or consists of, any previously listed number of trinucleotide repeats.
[0092] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising 7 CAG repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of 7 CAG repeats. Suitably, in such an embodiment, the nucleic acid is an antisense oligonucleotide consisting of [CAG]? (SEQ ID NO: 7).
[0093] Suitably the nucleic acid is complementary to a microsatellite region, suitably to a repeat expansion, suitably to a repeat expansion which is complementary to the nucleotide repeat of the nucleic acid. Suitably the nucleic acid is complementary to a trinucleotide repeat expansion. Suitably, the nucleic acid binds to a complementary microsatellite region, suitably to a complementary region of repeat expansion, suitably to a complementary region of trinucleotide repeat expansion.
[0094] Suitably, the nucleic acid targets and binds to microsatellite regions. Suitably the microsatellite regions comprise repeat expansions, suitably they comprise nucleotide repeat expansions.
[0095] Suitably the microsatellite regions are present in DNA or RNA. Suitably the microsatellite regions are present in RNA.
[0096] Suitably the microsatellite regions may be present in coding or non-coding sequences. Suitably the microsatellite regions are present in non-coding sequences such as the 3’ or 5’ UTRs. Suitably the microsatellite regions are present in the 3’ UTR.
[0097] Suitably, the nucleic acid may be formed of a nucleotide repeat that binds to a complementary nucleotide repeat expansion. Suitably, the nucleic acid may be formed of a nucleotide repeat that binds to a complementary nucleotide repeat expansion in RNA. Suitably, the nucleic acid may be formed of a nucleotide repeat that binds to a complementary nucleotide repeat expansion in a non-coding sequence of RNA. Suitably, the nucleic acid may be formed of a nucleotide repeat that binds to a complementary nucleotide repeat expansion in an untranslated region of RNA.
[0098] In one embodiment, the nucleic acid may be formed of a trinucleotide repeat that binds to a complementary trinucleotide repeat expansion in the 3’UTR of RNA.
[0099] Optionally, a lysine residue (K) may be added to one or both ends of the nucleic acid (such as a PMO or PNA) before attachment to the peptide carrier, to improve water solubility.
[0100] Conjugate
[0101] In preferred embodiments, the conjugate according to the invention comprises or consists of: peptide carrier RBRRYQFLIRBRXR (DEL01) (SEQ ID NO: 1) covalently linked via a beta-alanine linker to an antisense oligonucleotide consisting of seven CAG repeats.
[0102] Suitably wherein the conjugate comprises or consist of the following structure:RBRRYQFLIRBRXR-B-CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 5, SEQ ID NO: 17)
[0103] Suitably wherein the above conjugate may be acetylated at the N-terminus.
[0104] Suitably wherein the conjugate comprises or consist of the following structure:
[0105] Ac-RBRRYQFLIRBRXR-B-CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO:6, SEQ ID NO: 17)
[0106] Repeat Expansion Disorder
[0107] The conjugate of the present invention is for use as a medicament, optionally for use in the prevention or treatment of repeat expansion disorders.
[0108] Suitably a repeat expansion disorder is a genetic disorder caused by a nucleotide repeat expansion, which may otherwise be known as a repeat expansion, or tandem repeat, suitably present in a microsatellite region of the genome.
[0109] Suitably the nucleotide repeat expansion is present in a gene.
[0110] In some cases the repeat expansion disorder may be a tetranucleotide repeat disorder. For example the tetranucleotide repeat may be within the CNBP gene, and may be formed of a CCTG repeat. In such cases the repeat expansion disorder may be myotonic dystrophy 2 (DM2).
[0111] In some cases the repeat expansion disorder may be a pentanucleotide repeat disorder. For example the pentanucleotide repeat may be within the ATXN10 gene, and may be formed of a ATTCT repeat. In such cases the repeat expansion disorder may be spinocerebellar ataxia type 10. Alternatively, the pentanucleotide repeat may be within the BEAN1 gene, and may be formed of a TGGAA repeat. In such cases the repeat expansion disorder may be spinocerebellar ataxia type 31.
[0112] In some cases the repeat expansion disorder may be a hexanucleotide repeat disorder. For example the hexanucleotide repeat may be within the NOP56 gene, and may be formed of a GGCCTG repeat. In such cases the repeat expansion disorder may be spinocerebellar ataxia type 36. Alternatively, the hexanucleotide repeat may be within the C9orf72 gene, and may be formed of a GGGGCC repeat. In such cases the repeat expansion disorder may be amyotrophic lateral sclerosis (ALS) or Frontotemporal Dementia.
[0113] Suitably the conjugate of the present invention may be for use in the prevention or treatment of any of the above listed repeat expansion disorders. Suitably in such cases, the nucleic acid comprises a plurality of nucleotide repeats which are complementary to the repeat identified above which causes the relevant disorder. Suitable therapeutic nucleic acids which can target and bind to said repeat expansions may be designed using known techniques by the skilled person.
[0114] In one embodiment, the repeat expansion disorder is a trinucleotide repeat disorder, caused by a trinucleotide repeat expansion, otherwise known as a triplet repeat expansion.
[0115] Suitably the trinucleotide repeat expansion is present in a gene selected from: ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMRI, AFF2, FXN, DMPK, SCA8, JPH3, and PPP2R2B.
[0116] Suitably the trinucleotide repeat expansion is present in the AR, SCA8 or DMPK gene.
[0117] In one embodiment, the trinucleotide repeat expansion is present in the DMPK gene.
[0118] Suitably the trinucleotide repeat expansion is formed of repeats selected from: CAG, CTG, CGG, CCG, GAA, TTC and GGC.
[0119] Suitably the trinucleotide repeat expansion is formed of CAG or CTG repeats.
[0120] In one embodiment, the trinucleotide repeat expansion is formed of CTG repeats.
[0121] Typically repeat expansion disorders result from the presence of a particular nucleotide repeat expansion found in a particular gene. Typically the number of repeats that are present in the gene is higher than the number of repeats present in the same gene in a normal healthy subject.
[0122] Suitably, the trinucleotide repeat expansion is a CAG repeat in a gene selected from: ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3, and TBP.
[0123] Suitably trinucleotide repeat disorders resulting from CAG repeats are termed ‘polyglutamine diseases’. Suitably therefore, the trinucleotide repeat disorder may be a polyglutamine disorder. Suitably the polyglutamine disorder may be selected from: DRPLA (Dentatorubropallidoluysian atrophy), HD (Huntingdon’s disease), HDL2 (Huntingdon diseaselike syndrome 2), SBMA (spinal and bulbar muscular atrophy), SCA1 (spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado- Jospeh disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 7), and SCA17 (spinocerebellar ataxia type 17).
[0124] Suitably the trinucleotide repeat expansion is a CGG repeat in a gene selected from: FMRI.
[0125] Suitably the trinucleotide repeat expansion is a CCG repeat in a gene selected from: AFF2.
[0126] Suitably the trinucleotide repeat expansion is a GAA repeat in a gene selected from FXN.
[0127] Suitably the trinucleotide repeat expansion is a CTG repeat in a gene selected from DMPK, and ATXN8.
[0128] Suitably the trinucleotide repeat expansion is a GTC repeat in a gene selected from JPH3.
[0129] Suitably trinucleotide repeat disorders resulting from trinucleotide repeats other than CAG repeats are termed ‘non-polyglutamine diseases’. Suitably therefore, the trinucleotide repeat disorder may be a non-polyglutamine disorder. Suitably the non-polyglutamine disorder may be selected from: HDL2 (Huntingdon disease like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X temor / ataxia syndrome), FRAXE (Fragile XE mental retardation), FRDA (Friedrich’s ataxia), DM1 (Myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8), and SCA12 (spinocerebellar ataxia type 12).
[0130] Suitably the repeat expansion disorder results from an increase in the number of nucleotide repeats compared to a healthy subject. Suitably, an increase in the number of nucleotide repeats in a gene compared to the same gene in healthy subject. Suitably the number of nucleotide repeats in the nucleotide repeat expansion is increased compared to the number of nucleotide repeats in a normal healthy subject.
[0131] Suitably the number of repeats in the nucleotide repeat expansion is at least 1.5x the number of repeats in a normal healthy subject. Suitably the number of repeats in the nucleotide repeat expansion is at least 2x, 3x, 4x, 5, 6x, 7x, 8x, 9x, lOx, 15x, 20x, 25x, 30x, 35x, 40x, 45x, or 50x the number of repeats in a normal healthy subject.
[0132] Suitably the repeat expansion disorder results from an increase in the number of repeats in a nucleotide repeat expansion of at least 1 ,5x the number of repeats in a normal healthy subject.
[0133] Suitably the repeat expansion disorder results from an increase in the number of repeats in a nucleotide repeat expansion of at least 2x, 3x, 4x, 5, 6x, 7x, 8x, 9x, lOx, 15x, 20x, 25x, 30x, 35x, 40x, 45x, or 50x the number of repeats in a normal healthy subject.
[0134] Suitably the number of repeats in the nucleotide repeat expansion is between 1.5x to 15x the number of repeats in a normal healthy subject.
[0135] Suitably the repeat expansion disorder results from a nucleotide repeat expansion comprising between 1.5x to 15x the number of repeats present in a normal healthy subject.
[0136] Suitably, the number of repeats in the nucleotide expansion is more than 50, more than 75, more than 100, more than 125, more than 150, more than 175, more than 200, more than 225, more than 250.
[0137] Suitably the repeat expansion disorder results from a nucleotide repeat expansion comprising more than 50, more than 75, more than 100, more than 125, more than 150, more than 175, more than 200, more than 225, more than 250 repeats.
[0138] Suitably, the number of repeats in the nucleotide expansion is more than 50.
[0139] Suitably the repeat expansion disorder results from a nucleotide repeat expansion comprising more than 50 repeats. Suitably a trinucleotide repeat expansion comprising more than 50 repeats.
[0140] Suitably, the number of repeats in the nucleotide expansion is between 50 and 250. Sutiably wherein the nucleotide expansion is a trinucleotide expansion.
[0141] Suitably the repeat expansion disorder results from a nucleotide repeat expansion comprising between 50 and 250 repeats. Suitably a trinucleotide repeat expansion comprising between 50 and 250 repeats.
[0142] Suitably, the repeat expansion disorder is a trinucleotide repeat disorder, and suitably is a non-polyglutamine disorder.
[0143] Suitably, the repeat expansion disorder is s trinucleotide repeat disorder and is suitably myotonic dystrophy (DM1).
[0144] In one embodiment, when the trinucleotide repeat disorder is DM1, the number of repeats in the trinucleotide expansion is more than 50. In one embodiment, when the trinucleotide repeat disorder is DM1 , the number of CTG repeats in the trinucleotide expansion is more than 50. In one embodiment, when the trinucleotide repeat disorder is DM1, the number of CTG repeats in the trinucleotide expansion of the DMPK gene is more than 50.
[0145] Prevention or Treatment of a Repeat Expansion Disorder
[0146] As described herein, the conjugate of the invention may be used as a medicament for the prevention or treatment of a disease, optionally a repeat expansion disorder. In one embodiment, the disorder is a trinucleotide repeat disorder. The medicament may be in the form of a pharmaceutical composition as defined above.
[0147] Specific mechanisms of how the nucleic acid formed of nucleotide repeats may act to treat a repeat expansion disorder will be different depending on the repeat expansion disorder in question. Suitably the nucleic acid binds to the nucleotide repeat expansion, in the gene or in the transcript. Suitably the nucleic acid reduces the level of transcripts comprising a nucleotide repeat expansion. Suitably the nucleic acid prevents the pathological effects of the nucleotide repeat expansion, and hence the repeat expansion disorder. Whilst this is demonstrated herein in relation to trinucleotide repat disorders, the conjugate of the invention is expected to be useful for the treatment of other repeat expansion disorders, the same technical teaching applies to other repeat expansion disorders identified herein.
[0148] Suitably, therefore the conjugate improves the physiological condition of subjects.
[0149] For example, the therapeutic nucleic acid of the conjugate may be operable to correct splicing defects resulting from a repeat expansion disorder. Suitably the therapeutic nucleic acid of the conjugate may be operable to normalise splicing in a subject with a repeat expansion disorder.
[0150] Suitably, the therapeutic nucleic acid of the conjugate is operable to bind a transcript of the DMPK gene. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind repeat expansions present in a transcript of the DMPK gene. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind CUG repeat expansions present in a transcript of the DMPK gene.
[0151] Suitably, therefore the conjugate reduces the levels of DMPK transcripts. Suitably, therefore the conjugate reduces the levels of DMPK transcripts having repeat expansions. Suitably, therefore the conjugate reduces the levels of DMPK transcripts having CUG repeat expansions.
[0152] Suitably, therefore the conjugate reduces the number nuclear foci. Suitably the conjugate prevents nuclear foci interacting with the splicing machinery of a cell. Suitably the conjugate prevents nuclear foci interacting with MBNL1. Suitably the conjugate prevents nuclear foci sequestering MBNL1.
[0153] Suitably these effects are for use in the prevention or treatment of myotonic dystrophy (DM1).
[0154] Suitably the conjugate decreases myotonia in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100% when compared to healthy subjects. Suitably the conjugate decreases myotonia in a subject with DM1 by at least 50%. Suitably the conjugate decreases myotonia in a subject with DM1 by between 50-100%.
[0155] Suitably the conjugate reduces nuclear foci in myoblasts in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%. Suitably the conjugate reduces nuclear foci in myoblasts in a subject with DM1 by at least 50%. Suitably the conjugate reduces nuclear foci in myoblasts in a subject with DM1 by between 50-90%.
[0156] Suitably the conjugate corrects cardiac conduction in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably the conjugate improves cardiac conduction in a subject with DM1 by at least 10%. Suitably the conjugate improves cardiac conductivity in a subject with DM1 by between 10-50%.
[0157] Suitably the conjugate improves motor function in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably the conjugate improves motor function in a subject with DM1 by at least 10%. %. Suitably the conjugate improves motor function in a subject with DM1 by between 10-50%.
[0158] Suitably the conjugate improves muscle force relative to weight in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably the conjugate improves muscle force relative to weight in a subject with DM1 by at least 10%. Suitably the conjugate improves muscle force relative to weight in a subject with DM1 by between 10-50%.
[0159] Suitably, the subject to be treated may be any animal or human. Suitably, the subject may be a non-human mammal. Suitably the subject may be male or female.
[0160] Suitably, the patient or subject to be treated may be any age. Suitably the patient or subject to be treated is aged between 0-40 years, suitably 0-30, suitably 0-25, suitably 0-20 years of age.
[0161] Suitably, the conjugate is for administration to a subject systemically for example by intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous oral or nasal routes.
[0162] In one embodiment, the conjugate is for administration to a subject intravenously.
[0163] In one embodiment, the conjugate is for administration to a subject intravenously by injection.
[0164] Suitably, the conjugate is for administration to a subject in a "therapeutically effective amount", by which it is meant that the amount is sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease being treated. Decisions on dosage are within the responsibility of general practitioners and other medical doctors. Examples of the techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
[0165] Exemplary doses may be between O.Olmg / kg and 50mg / kg, 0.05mg / kg and 40mg / kg, O. lmg / kg and 30mg / kg, 0.5mg / kg and 18mg / kg, Img / kg and 16mg / kg, 2mg / kg and 15mg / kg, 5mg / kg and lOmg / kg, lOmg / kg and 20mg / kg, 12mg / kg and 18mg / kg, 13mg / kg and 17mg / kg.
[0166] Suitably, after administration of the conjugate of the present invention, one or more markers of toxicity are significantly reduced compared to conjugates using currently available peptide carriers.
[0167] Suitable markers of toxicity may be markers of nephrotoxicity.
[0168] Suitable markers of toxicity include serum KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase levels.
[0169] Suitable further markers of toxicity include urine sodium, potassium, chloride, urea, creatinine, calcium, phosphorous, glucose, uric acid, magnesium and protein levels.
[0170] Suitably the level of at least one of KIM-1, NGAL, and BUN is reduced after administration of the conjugate of the present invention when compared to conjugates using currently available peptide carriers.
[0171] Suitably the levels of each of KIM-1, NGAL, and BUN are reduced after administration of the conjugates of the present invention when compared to conjugates using currently available peptide carriers.
[0172] Suitably, the levels of the or each marker / s is significantly reduced when compared to conjugates using currently available peptide carriers.
[0173] Suitably the levels of the or each marker / s is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% after administration of the conjugates of the present invention when compared to conjugates using currently available peptide carriers.
[0174] Advantageously, the toxicity of the conjugates is significantly reduced compared to prior peptides and conjugates. In particular, KIM-1 and NGAL-1 are markers of toxicity and these are significantly reduced by up to 120 times compared to conjugates using currently available peptide carriers.
[0175] Suitably, the long term toxicity of the conjugate is negligible. Suitably there are no long term toxic effects of the conjugate.
[0176] Suitably the conjugate has no significant effects on gene expression in the subject, beyond the intended effect on the target trinucleotide repeat expansion. Suitably the conjugate has no negative effects on gene expression in the subject.
[0177] Suitably, after administration of the conjugate of the present invention, cell viability is significantly improved compared to conjugates using currently available peptide carriers.
[0178] Suitably, after administration of the conjugate of the present invention, myoblast and hepatocyte viability is significantly improved compared to conjugates using currently available peptide carriers. Suitably, after administration of the conjugate of the present invention, myoblast and hepatocyte viability is increased by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates using currently available peptide carriers.
[0179] Suitably, after administration of the conjugate of the present invention, cell viability is significantly improved compared to conjugates using currently available peptide carriers.
[0180] Suitably, after administration of the conjugate of the present invention, recovery time is decreased by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates using currently available peptide carriers.
[0181] Suitably, after administration of the conjugate of the present invention, recovery time is less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, or less than 5 minutes. Suitably, after administration of the conjugate of the present invention, there is no recovery time.
[0182] Suitably any reference hereinabove to treatment with the conjugate of the invention, or to resulting effects of treatment with the conjugate of the invention, may equally be applied to a pharmaceutical composition comprising the conjugate of the invention.
[0183] Pharmaceutical Composition and Administration
[0184] The conjugate of the invention may formulated into a pharmaceutical composition as noted above.
[0185] Suitably, the pharmaceutical composition may further comprise one or more pharmaceutically acceptable components such as one or more diluents, adjuvants or carriers.
[0186] Suitable pharmaceutically acceptable diluents, adjuvants and carriers are well known in the art.
[0187] As used herein, the phrase "pharmaceutically acceptable" refers to those ligands, materials, formulations, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0188] The phrase "pharmaceutically acceptable carrier", as used herein, refers to a pharmaceutically acceptable material, formulation or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the conjugate from one organ or portion of the body, to another organ or portion of the body. Each peptide must be "acceptable" in the sense of being compatible with the other components of the composition e.g. the peptide and therapeutic molecule, and not injurious to the individual.
[0189] Lyophilized compositions, which may be reconstituted and administered, are also within the scope of the present composition.
[0190] Pharmaceutically acceptable carriers may be, for example, excipients, vehicles, diluents, and combinations thereof. For example, where the compositions are to be administered orally, they may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections, drop infusion preparations, or suppositories. These compositions can be prepared by conventional means, and, if desired, the active compound (i.e. conjugate) may be mixed with any conventional additive, such as an excipient, a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, or combinations thereof.
[0191] It should be understood that the pharmaceutical compositions of the present disclosure can further include additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like for alleviating, mediating, preventing, and treating the diseases, disorders, and conditions described herein under medical use.
[0192] Nucleic Acids and Hosts 1
[0193] A peptide carrier of the invention may be produced by any standard protein synthesis method, for example chemical synthesis, semi-chemical synthesis or through the use of expression systems.
[0194] Accordingly, the present invention also relates to the nucleotide sequences comprising or consisting of the DNA coding for the conjugate of the invention, expression systems e.g. vectors comprising said sequences accompanied by the necessary sequences for expression and control of expression, and host cells and host organisms transformed by said expression systems.
[0195] Accordingly, a nucleic acid encoding a peptide carrier, or a conjugate, according to the present invention is also provided.
[0196] Suitably, the nucleic acids may be provided in isolated or purified form.
[0197] An expression vector comprising a nucleic acid encoding a peptide carrier, or a conjugate, according to the present invention is also provided.
[0198] Suitably, the vector is a plasmid.
[0199] Suitably the vector comprises one or more regulatory sequences, e.g. promoter, operably linked to a nucleic acid encoding a peptide according to the present invention. Suitably, the expression vector is capable of expressing the peptide when transfected into a suitable cell, e.g. mammalian, bacterial or fungal cell.
[0200] A host cell comprising the nucleic acid or expression vector of the invention is also provided.
[0201] Expression vectors may be selected depending on the host cell into which the nucleic acids of the invention may be inserted. Such transformation of the host cell involves conventional techniques such as those taught in Sambrook et al [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA], Selection of suitable vectors is within the skills of the person knowledgeable in the field. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.
[0202] The peptides or conjugates produced may be isolated and purified from the host cell by any suitable method e.g. precipitation or chromatographic separation e.g. affinity chromatography.
[0203] Suitable vectors, hosts and recombinant techniques are well known in the art.
[0204] In this specification the term "operably linked" may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such away as to place the expression of a nucleotide coding sequence under the control of the regulatory sequence, as such, the regulatory sequence is capable of effecting transcription of a nucleotide coding sequence which forms part or all of the selected nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired peptide.FIGURES
[0205] The invention will now be described with reference to the following figures in which:
[0206] FIG. 1 shows that the conjugate of the invention DEL01-PMOCAG7 corrects missplicing of MBNL1 exon 5 in DM1 muscle cells. Four-day-differentiated immortalized DM1 myoblasts (2600 CTG repeats) were analyzed 48 hours after treatment. Data are expressed as mean ± SEM. ***P < 0.001 ; ****p < 0.0001 by 1-way ANOVA with Newman-Keuls post hoc test (B and F) or Mann- Whitney test (C and D). NS, not significant.
[0207] FIG. 2 shows that myotonia is corrected to wild type levels in HSA-LR mice after two injections at 7.5mg / kg of the conjugate of the invention DEL01-PMOCAG7 (one injection every two weeks, n=5, IV, tail vein, 8-12 weeks age). This conjugate is also able to induce a clinically relevant reduction in myotonia of 30% when dosed at 5mg / kg repeated 4 times.
[0208] FIG. 3 shows that the conjugate of the invention DEL01-PMOCAG7 corrects missplicing of Mbnll exon 5 (A) and Clcnl exon 7 (B) in gastrocnemius and quadriceps 8-12 week old HSA-LR mice to wild type levels after one IV administration at 30mg / kg or 4 administrations at a dose of 7.5 mg / kg and sacrificed two weeks after treatment. NT WT, Non treated wild type FVB / N; Psi, percent spliced in; mean ± SEM; n=4; * p<0.05 t-test.
[0209] FIG. 4 shows optimal delivery to critically affected tissues in DM1 in 8-12 week-old HSA-LR mice following a single IV administration at 30 mg / kg with the conjugate of the invention DEL01-PMOCAG7. The conjugate achieved higher concentrations than the comparative R6Gly-PMOCAG7 at 30mg / kg or 3 injections of naked PMO at 200mg / kg. In all cases, tissues were collected two weeks after the last administration.
[0210] FIG. 5 shows the effect of the conjugate of the invention DEL01-PMOCAG7 on the kidney toxicity marker Kimi in urine of 8-12-week-old HSA-LR mice. Kim levels were measured by ELISA in urine collected 2 days and 7 days after final intravenous (IV) administration. Kimi levels relative to creatinine after treatments with DEL01-PMOCAG7 were within the range obtained in saline-injected animals and significantly lower than the Kimi levels induced 2 days after treatment with the comparative Peptide PMO Pip6a-PMOCAG7 (>20); mean ± SEM, n=4; *p<0.05, t-test.EXAMPLES
[0211] Example 1: Synthesis of PPMO
[0212] 9-Fluroenylmethoxy carbonyl (Fmoc) protected L-amino acids, benzotriazole- 1-yl- oxytrispyrrolidino-phosphonium (PyBOP), and the preloaded Fmoc-Ala-Wang resin (0.46 mmol / g) were obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade dimethylformamide (DMF) and diethyl ether were obtained from Merck (Hohenbrunn, Germany). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma- Aldrich unless otherwise stated. MALDI-TOF mass spectrometry was carried out using a Shimadzu MALDI-8020. A stock solution of 10 mg / mL of a-cyano-4-hydroxycinnamic acid or sinapinic acid in 50% acetonitrile in water was used as matrix. Error bars are + / - 0.1 %.
[0213] Peptide chains were elongated on a 0.1 mmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry following manufacturer’s recommendations. Coupling condition utilised PyBOP and DIEA (5 and 10 equivalents of 0.25 M and 1 M respectively) while Fmoc removal used 20 % piperidine in DMF). Once synthesis was complete, the resin was washed with DMF (3 x 5 mL) and the N-terminus of the solid phase bound peptide was acetylated with acetic anhydride in the presence of DIEA at room temperature for 30 min. After acetylation of the N-terminus, the peptide resin was washed with DMF (3 x 5 mL) and DCM (3 x 5 mL). After drying the peptidyl resin, the peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIS) (95:2.5:2.5, 10 mL / g) for 1 h at room temperature followed by the typical diethyl ether precipitation, analysis of the crude peptide via HPLC andMALDI-TOF. Peptides were purified by 1260 Infinity II preparative HPLC Agilent system on an RP-C18 column (21.2 x 250 mm, Phenomenex) using a linear gradient (5 to 50 over 30 min) of 0.1 %TFA / CH3CN in 0.1 %TFA / H2O with a flow rate of 15 mL / min.
[0214] PMOs were obtained from Gene Tools, LLC and the conjugation occurred via amide bond formation between the 3’ end into the C-terminal of the peptide. A 21-mer PMO antisense sequence (CAGCAGCAGCAGCAGCAGCAG) (SEQ ID NO: 7) was used. The peptide was conjugated to the 3’-end of the PMO through its C-terminal carboxyl group. This was achieved using 2.5-fold equivalents of PyBOP in NMP respectively in the presence of 2.5 equiv of DIEA over peptide. PMO were dissolved in DMSO (10 mM) while all other reactants were dissolved in NMP (100 mM peptide and 300 mM of PyBOP in NMP). The conjugation reaction mixture was incubated at 40 °C and the reaction was monitored by RP-HPLC upon completion (1 h) followed by quenching the reaction by hydrazide hydrate (50 uL per 2 umol of PMO) for 15 min. This solution was purified by ion exchange chromatography using a converted AKTA Pure FPLC system and prepacked Resource S, GE Healthcare. A linear gradient of solvent B (25 mM sodium phosphate buffer, pH 7.0, 20 % CH3CN, 1 M sodium chloride solution) in solvent A (25 mM sodium phosphate buffer, pH 7.0, 20 % CH3CN) was used to elute the conjugate from the column at a flow rate of 6 mL / min. Only the pure fractions were combined and desalted immediately. The removal of excess salts from the peptide-PMO conjugate was afforded using an Amicon ultra-15 3K centrifugal filter device. After lyophilisation, the conjugate was analysed and characterised by MALDI-TOF and RP-HPLC. The conjugates were dissolved in sterile water and filtered through a 0.22 pm cellulose acetate membrane before use. The concentration of the conjugates was determined by the molar absorption of the conjugates at 265 nm in 0.1 N HCI solution. Average yield was around 20-40% calculated from PMO starting materials.
[0215] Example 2: Efficacy Evaluation of DEL01-PMOCAG7All animal procedures were carried out in accordance to procedures authorised by the UK Home Office. 8 - 10- week-old HSA-LR mice (FVB / N-Tg(HSA*LR)20bCath / J) were treated with PMO conjugates or 0.9 % saline via intravenous tail-vein administration. Tissues were harvested 14 d postfinal administration.Patient derived WT and DM1 myoblasts were cultured in skeletal muscle growth medium (C-23060, PromoCell) and 50 ug / ml streptomycin (Invitrogen, USA), in humidified 5% (v / v) CO2 at 37 °C. Media was changed every 2-3 days until 90 % confluency was reached. To differentiate medium waschanged to skeletal muscle differentiation medium (C-23061, PromoCell) and cultured for 5-8 days with media changes on alternate days. Upon completion of differentiation to myotubes, cells were transfected with peptide- ASOs and control treatments in skeletal muscle differentiation media. 48 h post-transfection RNA was collected and processed for splicing analysis.RNA was extracted from cell pellets or 15 - 25 mg of tissue using Maxwell® SimplyTissue (Promega, USA) RNA concentration of each sample was measured using Nanodrop (Thermo Fisher, UK). 1 ug of RNA in a 20 ul reaction volume was used to synthesise cDNA with the High-Capacity cDNA Reverse Transcription Kit (Invitrogen, UK). Synthesised cDNA was diluted to a final concentration of 10 ng / ul. PCR reactions were performed on cDNA synthesised from cells and murine skeletal muscles using primer sets of MBNL1 and of Mbnll and Clcnl, respectively (Table 1). For each reaction, 80 of sample cDNA was added to PCR Dream Taq polymerase mastermix (Thermo Fisher Scientific), made according to the manufacturer’s instructions. PCR reactions conditions: 2 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at the annealing temperatures specified in Table 1 , 1 min at 72 °C. PCR products were diluted with 6X gel loading dye (New England Biolabs, USA) and separated on a 2 % (w / v), 0.5 ug / ul ethidium bromide agarose gel with 1 x TAE buffer at 120 V for 50 min. HyperLadder™ lOObp (Meridian Bioscience, USA) was used as a reference. The gel was visualised using a UV gel-imaging system. Fiji (ImageJ) was used to perform a sliding paraboloid background subtraction on each image and to quantify the density of bands obtained on the gel. These densities were used to calculate % exon inclusion.Table 1: Primers, annealing temperatures and expected bands for RT-PCR splicing analysis
[0216] Example 3: Toxicology Screening of DEL01-PMOCAG7All animal procedures were carried out in accordance to procedures authorised by the UK Home Office. 8 - 10- week-old HSA-LR mice (FVB / N-Tg(HSA*LR)20bCath / J) were treated with PMO conjugates or 0.9 % saline via intravenous tail-vein administration. Urine was collected 2 and 7 d post final administration and stored at -80 °C. KIM-1 levels in urine were analysed using the Mouse TIM- 1 / KIM-l / HAVCR Quantikine EEISA Kit (R&D SystemsTM, USA) and normalised to urinary creatinine levels during data analysis. Urinary creatinine levels were analysed using the clinical chemistry analyser at MRC Harwell, UK.
[0217] Example 4: Biodistribution study of DEL01-PMOCAG7All animal procedures were carried out in accordance to procedures authorised by the UK Home Office. 8 - 10- week-old HSA-LR mice (FVB / N-Tg(HSA*LR)20bCath / J) were treated with PMO conjugates or 0.9 % saline via intravenous tail-vein administration. Tissues were harvested 14 d postfinal administration.30 - 80 mg of tissue was homogenised in 10 ul / mg of tissues of RIPA buffer (Thermo Fisher Scientific, USA) using Precellys®24 Tissue Homogenizer and Homogenisation tubes (Precellys, France). Homogenates were centrifuged at 12,000 x g for 3 min and the supernatant incubated at 55 °C overnight. Samples were centrifuged at 13,000 x g for 15 min and supernatants stored at -80 °C. ELISAs were conducted as previously described (Burki et al. (2015) DOI: 10.1089 / nat.2014.0528)using a phosphorothioate probe, double-labelled with digoxigenin and biotin, for the detection of CAG7 PMO. A standard curve was generated for each PMO conjugate used and saline controls included to normalise for the background fluorescence of each tissue. Probe Sequence: 5’-Biotin- CCAGCATTATGAAAGTGAATCTTAC-Digoxigenm-3' (SEQ ID NO: 14).
[0218] Example 5: Histopathology Study of DEL01-PMOCAG7 in mouse liver and kidney The core aim of this study was a meticulous histopathological examination of murine liver and kidney samples, both male and female, amounting to a total of 38 samples. The 38 tissue samples were first fixed with formalin, trimmed, and then processed to paraffin wax. After embedding, 5pm sections from each block were obtained and then laid on SnowCoat microscope slides. These sections underwent staining with Haematoxylin and Eosin, and samples were examined for any damage to the liver and kidneys. Samples comprised HSA-LR mice administered ERAI .1-CAG7 (ERA1.1 is the same peptide as DEL01 as used herein) at different dosages (30mg / kg and 40mg / kg) or a saline solution as a control. Male and female mice samples were taken into consideration for both liver and kidney assessments. The histopathological assessment brought forward several findings. These were categorized into minimal, mild, moderate, or marked grades, with a further classification into focal, multifocal, or diffuse. A crucial observation was that some samples remained unremarkable, indicating no detectable abnormalities. The findings for individual animals were detailed, with some noteworthy observations for both control and ERAl. l-CAG7-administered animals. However, these findings resonated with the typical spontaneous background findings one would anticipate in mice of the studied strain and age. Conclusively, this comprehensive study determined that the ERAI. 1-CAG7 administration, even at dosages as high as 40 mg / kg, did not reveal structural abnormalities pointing towards the onset of hepatotoxicity or nephrotoxicity, at least at the studied time-point (two weeks after administration).
[0219] Table 2 shows the results of a detailed histopathological examination of liver and kidney tissues from HSA-LR mice, including both male and female subjects, treated with varying doses of the compound DEL01-PMOCAG7. Despite administering up to 40 mg / kg of the compound, the study found no evidence of structural damage indicative of hepatotoxicity or nephrotoxicity. The observed changes were consistent with those typically found in the spontaneous background of the mouse strain used, suggesting that DEL01-PMOCAG7 is safe and does not cause organ toxicity at the doses and durations studied.
[0220] Table 2: Results of a detailed histopathological examination of liver and kidney tissues from HSA-LR miceGrade: 1, minimal; 2, mild, 3, moderate, 4, marked, with a distribution of focal, multifocal, or diffuse Distribution: f, focal; m, multifocal; d, diffuse “-“denoted that no abnormalities were documented.SEQUENCESPeptide DelOlRBRRYQFLIRBRXR (SEQ ID NO: 1)Arginine-Rich DomainRBRXR (SEQ ID NO: 2)Peptide DelOl + linkerRBRRYQFLIRBRXR-B (SEQ ID NO: 3)Acetylated Peptide DelOl + linkerAc-RBRRYQFLIRBRXR-B (SEQ ID NO: 4)ConjugateRBRRYQFLIRBRXR-B-CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO:5, SEQ ID NO: 17)Acetylated conjugateAc-RBRRYQFLIRBRXR-B-CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 6, SEQ ID NO: 17)CAG? PMO nucleic acidCAGCAGCAGCAGCAGCAGCAG (SEQ ID NOY)Mbnll Mouse Forward PrimerGCTGCCCAATACCAGGTCAAC (SEQ ID NO: 8)Mbnll Mouse Reverse PrimerTGGTGGGAGAAATGCTGTATGC (SEQ ID NO: 9)Clcnl Forward PrimerTTCACATCGCCAGCATCTGTGC (SEQ ID NO: 10)Clcnl Reverse PrimerCACGGAACACAAAGGCACTGAATGT (SEQ ID NO: 11)MBNL1 Human Forward PrimerGCTGCCCAATACCAGGTCAAC (SEQ ID NO: 12)MBNL1 Human Reverse PrimerTGGTGGGAGAAATGCTGTATGC (SEQ ID NO: 13)ProbeBiotin-CCAGCATTATGAAAGTGAATCTTAC-Digoxigemn (SEQ ID NO: 14)Hydrophobic domainYQFLI (SEQ ID NO: 15)Arginine-Rich DomainRBRR (SEQ ID NO: 16).
Claims
CLAIMS1. A conjugate comprising: a peptide carrier covalently linked via a linker to a therapeutic molecule; wherein the peptide carrier has a total length of 40 amino acids or less and comprises the following sequence: RBRRYQFLIRBRXR (DEL01) (SEQ ID NO:1); wherein the linker comprises beta-alanine (B); and wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of nucleotide repeats.
2. The conjugate of claim 1, wherein the nucleic acid comprises a plurality of trinucleotide repeats.
3. The conjugate of claim 2, wherein the trinucleotide repeats are selected from GTC, CAG, GCC, GGC, CTT, and CCG repeats.
4. The conjugate of any one of claims 1-3, wherein the nucleic acid comprises or consists of a plurality of CAG repeats.
5. The conjugate of any one of claims 1 to 4, wherein the nucleic acid comprises or consists of between 5-20 trinucleotide repeats, optionally between 5-10 trinucleotide repeats, optionally7 trinucleotide repeats.
6. The conjugate of any one of claims 1 to 5, wherein the nucleic acid comprises or consists of 7 CAG repeats.
7. The conjugate of any one of claims 1 to 6, wherein the nucleic acid is an antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (for example in the use of CRISPR / Cas9 technology), short interfering RNA, micro RNA, and antagomiRNA..
8. The conjugate of any one of claims 1 to 7, wherein the nucleic acid is an antisense oligonucleotide.
9. The conjugate of any one of claims 1 to 8, wherein the nucleic acid is an antisense oligonucleotide consisting of 7 CAG repeats.
10. The conjugate of claim 7, 8, or 9, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide (PMO).
11. The conjugate of any one of claims 1 to 10, wherein the nucleic acid binds to a nucleotide repeat expansion, optionally to a trinucleotide repeat expansion, optionally which is present in a non-coding sequence of RNA.
12. The conjugate of any one of claims 1-11, wherein the peptide carrier consists of the following sequence: RBRRYQFLIRBRXR (DEL01) (SEQ ID NO:1).
13. The conjugate of any one of claims 1-12, wherein the linker consists of a beta-alanine (B) residue.
14. A pharmaceutical composition comprising the conjugate of any one of claims 1-1315. A conjugate according to any one of claims 1-13, or a pharmaceutical composition according to claim 14, for use as a medicament.
16. A conjugate according to any one of claims 1-13, or a pharmaceutical composition according to claim 14, for use in the prevention or treatment of a repeat expansion disorder.
17. The conjugate or the pharmaceutical composition for use according to claim 16, wherein the repeat expansion disorder is a trinucleotide repeat disorder, optionally selected from a polyglutamine disease or a non-polyglutamine disease.
18. The conjugate or the pharmaceutical composition for use according to claim 17, wherein the trinucleotide repeat disorder is selected from: DRPLA (Dentatorubropallidoluysian atrophy), HD (Huntingdon’s disease), HDL2 (Huntingdon disease like syndrome 2), SBMA (spinal and bulbar muscular atrophy), SCA1 (spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado-Jospeh disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 7), SCA17 (spinocerebellar ataxia type 17), HDL2 (Huntingdon disease like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X tremor / ataxia syndrome), FRAXE (Fragile XE mental retardation), FRDA (Friedrich’s ataxia), DM1 (Myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8), and SCA12 (spinocerebellar ataxia type 12).
19. The conjugate or the pharmaceutical composition for use according to any one of claims 17 or 18, wherein the trinucleotide repeat disorder is myotonic dystrophy type 1 (DM1).
Citation Information
Patent Citations
Modified oligonucleotides and methods for their synthesis
WO2016028187A1
Cell-penetrating peptide conjugates and methods of their use
WO2022171972A1
Modified amino acids and uses thereof
WO2023247968A2