Astrocyte derived from human urine-derived cells and method for producing same
Direct induction of astrocytes from human urine-derived cells using SOX9, NFIA, and NFIB genes addresses the limitations of pluripotent stem cell methods, providing efficient and epigenetically relevant astrocytes for neurodegenerative disease research.
Patent Information
- Application Number
- PCT/JP2025/015851
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-30
- Filing Date
- 2025-04-24
- Publication Date
- 2025-11-06
AI Technical Summary
Current methods for inducing astrocytes from human urine-derived cells involve initializing cells into induced pluripotent stem cells, which may reset epigenetic changes associated with aging, making them unsuitable for studying age-related neurodegenerative diseases.
Directly induce human urine-derived cells, particularly CD90-positive cells, using specific genes such as SOX9, NFIA, and NFIB to produce astrocytes without going through the pluripotent stem cell stage, ensuring preservation of epigenetic characteristics.
The method produces astrocytes with functions comparable to primary cultured human astrocytes, suitable for elucidating cranial nerve disease pathology and drug evaluation, in a shorter timeframe and with higher efficiency.
Smart Images

Figure 00000056_0000 
Figure 00000057_0000 
Figure 00000057_0001
Abstract
Description
Astrocytes derived from human urine-derived cells and method for producing the same
[0001] The present disclosure relates to astrocytes derived from human urine-derived cells and methods for producing the same.
[0002] Astrocytes are a type of glial cell that constitutes the central nervous system and support neurotransmission through various functions, such as supplying nutrients to neurons, regulating neurotransmitters, and forming the blood-brain barrier (BBB). Astrocyte dysfunction causes central nervous system disorders and is therefore involved in the development of various cranial nerve disorders, including neurodegenerative and neuroinflammatory diseases.
[0003] Because harvesting astrocytes from the human brain is highly invasive, it is limited to cases such as brain biopsies where the subject's findings are deemed beneficial for diagnosing brain diseases. Therefore, research has been conducted into methods for inducing astrocytes from cells obtained from humans or stem cells prepared therefrom, with the aim of using them instead of primary cultured human astrocytes to elucidate the pathology of cranial nerve diseases and evaluate drugs. For example, Non-Patent Document 1 discloses the direct conversion of human fibroblasts into astrocytes.
[0004] Human urine-derived cells (UDCs) are primary cultured cells derived from the upper urinary tract that can be collected from human urine. Because UDCs are primary cultured cells derived from humans, they have excellent proliferation potential and can be collected from urine, a non-invasively obtainable specimen. Therefore, research is being conducted aimed at inducing UDCs to various cell types and using them as medical and biological tools.
[0005] Regarding the induction of astrocytes from human urine-derived cells, for example, Non-Patent Document 2 discloses that human urine-derived cells were first induced to become induced pluripotent stem cells (iPS cells), and then the induced pluripotent stem cells were differentiated into astrocytes.
[0006] Ella Quist et al., "Transcription factor-based direct conversion of human fibroblasts to functional astrocytes", Stem Cell Reports 17, 1620-1635 (2022).Phil Jun Kang et al., "mRNA-Driven Generation of Transgene-Free Neural Stem Cells from Human Urine-Derived Cells", Cells 8, 1043 (2019).Koby Baranes et al., "Transcription factor combinations that define human astrocyte identity encode significant variation of maturity and function" Glia. 71:1870-1889 (2023).
[0007] The method described in Non-Patent Document 2 involves inducing human urine-derived cells into induced pluripotent stem cells. However, because induction into induced pluripotent stem cells means initializing the cells, there is a possibility that epigenetic changes that occurred over the donor's aging process may be reset. Therefore, while brain diseases such as neurodegenerative diseases are common in elderly people, this method may not be suitable for elucidating the pathology or evaluating drugs for brain diseases caused by epigenetic changes that occur during the aging process.
[0008] There are no known examples of direct reprogramming of human urine-derived cells into astrocytes.
[0009] The present disclosure aims to provide astrocytes derived from human urine-derived cells and a method for producing the same.
[0010] The present inventors have found that human urine-derived cells can be directly induced to transform into astrocytes by introducing a specific gene into the cells. Furthermore, the present inventors have found that among human urine-derived cells, CD90-positive human urine-derived cells are highly efficient at inducing astrocytes when the specific gene is introduced into them.
[0011] The present disclosure relates to, for example, the following: [1] An astrocyte derived from a human urine-derived cell into which at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20 has been introduced. [2] The astrocyte according to [1], wherein the at least one gene includes SOX9, and either NFIA or NFIB. [3] The astrocyte according to [1] or [2], wherein the at least one gene includes SOX9 and NFIB. [4] The astrocyte according to any one of [1] to [3], which is not derived from an induced pluripotent stem cell. [5] The astrocyte according to any one of [1] to [4], wherein the human urine-derived cell is CD90-positive. [6] A method for producing an astrocyte, comprising introducing at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20 into a human urine-derived cell. [7] The method according to [6], wherein the at least one gene includes SOX9, and either NFIA or NFIB. [8] The method according to [6] or [7], wherein the at least one gene comprises SOX9 and NFIB. [9] The method according to any one of [6] to [8], wherein the method does not involve inducing the human urine-derived cells into induced pluripotent stem cells.
[10] The method according to any one of [6] to [9], wherein the human urine-derived cells are CD90-positive.
[11] The method according to any one of [6] to
[10] , further comprising sorting CD90-positive human urine-derived cells, wherein the at least one gene is introduced into the sorted CD90-positive human urine-derived cells.
[12] The method according to any one of [6] to
[11] , further comprising culturing the human urine-derived cells into which the at least one gene has been introduced for no more than 25 days, thereby inducing them into astrocytes.
[13] A method for directly inducing human urine-derived cells into astrocytes, comprising introducing at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20 into human urine-derived cells.
[14] The method according to
[13] , wherein the at least one gene comprises SOX9, and NFIA or NFIB.
[15] The method according to
[13] or
[14] , wherein the at least one gene comprises SOX9 and NFIB.
[16] The method according to any one of
[13] to
[15] , wherein the human urine-derived cells are CD90-positive.
[17] The method according to any one of
[13] to
[16] , further comprising sorting CD90-positive human urine-derived cells, and introducing the at least one gene into the sorted CD90-positive human urine-derived cells.
[18] The method according to any one of
[13] to
[17] , further comprising culturing the human urine-derived cells into which the at least one gene has been introduced for a period of 25 days or less to induce them to become astrocytes.
[19] Use of at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20 in directly inducing human urine-derived cells to become astrocytes.
[20] The use according to
[19] , wherein the at least one gene includes SOX9, and NFIA or NFIB.
[21] The use according to
[19] or
[20] , wherein the at least one gene includes SOX9 and NFIB.
[22] The use according to any one of
[19] to
[21] , wherein the human urine-derived cells are CD90-positive.
[23] Use of at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20, or a vector for introducing said gene, in directly inducing human urine-derived cells to astrocytes.
[24] The use according to
[23] , wherein the at least one gene comprises SOX9, and NFIA or NFIB.
[25] The use according to
[23] or
[24] , wherein the at least one gene comprises SOX9 and NFIB.
[26] The use according to any one of
[23] to
[25] , wherein the human urine-derived cells are CD90-positive.
[27] A kit for directly inducing human urine-derived cells to astrocytes, comprising at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20, or a vector for introducing said gene.
[28] The kit according to
[27] , wherein the at least one gene comprises SOX9, and NFIA or NFIB.
[29] The kit according to
[27] or
[28] , wherein the at least one gene comprises SOX9 and NFIB.
[30] The kit according to any one of
[27] to
[29] , wherein the human urine-derived cells are CD90-positive.
[0012] The present disclosure provides astrocytes directly induced from human urine-derived cells and a method for producing the same. The efficiency of this direct induction is likely to be high when the human urine-derived cells are CD90-positive. Therefore, when the human urine-derived cells are CD90-positive, the quality of the astrocytes induced by this direct induction is likely to be high.
[0013] Astrocytes according to one embodiment of the present disclosure have functions comparable to those of primary cultured human astrocytes. As a result, the astrocytes according to one embodiment of the present disclosure can closely reproduce human astrocytes and can be suitably used to elucidate the pathology of cranial nerve diseases and evaluate drugs.
[0014] According to the production method according to one aspect of the present disclosure, astrocytes can be produced in a shorter time than when the method includes inducing human urine-derived cells into induced pluripotent stem cells.
[0015] 1 shows a vector map of the SOX9 / NFIB transfer vector. (A) In Example 1, the expression levels of SOX9 mRNA before and after culture with the SOX9 / NFIB transfer vector were normalized by the expression level of GAPDH mRNA, and the relative values were calculated by setting the expression level of the control group to 1. (B) In Example 1, the expression levels of NFIB mRNA before and after culture with the SOX9 / NFIB transfer vector were normalized by the expression level of GAPDH mRNA, and the relative values were calculated by setting the expression level of the control group to 1. In Example 2, the expression levels of GFAP mRNA, S100β mRNA, EAAT1 mRNA, EAAT2 mRNA, and AQP4 mRNA in human urine-derived cells (Undiff) and astrocytes (Day 10) derived from human urine-derived cells were normalized by the expression level of GAPDH mRNA, and the relative values were calculated by setting the expression level of the control group to 1. (A) is a fluorescent image of astrocytes derived from human urine-derived cells immunofluorescently stained for GFAP. (B) is a fluorescent image of astrocytes derived from human urine-derived cells immunofluorescently stained for AQP4. These figures show the amount of glutamate uptake in human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes. (A) is a diagram showing the IL6 mRNA expression levels before and after direct induction into astrocytes, normalized by the expression level of GAPDH mRNA, and expressed as relative values relative to the expression level of the control group, which is set to 1. (B) is a diagram showing the CXCL10 mRNA expression levels before and after direct induction into astrocytes, normalized by the expression level of GAPDH mRNA, and expressed as relative values relative to the expression level of the control group, which is set to 1. (A) is a fluorescent image of Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes, 10 seconds after the addition of ATP. (B) shows the fluorescence intensity of each cell in fluorescent images taken 10 seconds after the addition of ATP in Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes.(C) shows the percentage (%) of cells that exhibited calcium oscillations between 10 and 300 seconds after the addition of ATP in Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes. In Example 6, this shows a fluorescent image of cells obtained by performing an induction procedure on CD90-positive or CD90-negative human urine-derived cells immunofluorescently stained for GFAP. In Example 6, this shows the percentage (%) of cells in which fluorescence derived from a GFAP-labeled antibody was detected in a fluorescent image acquired under the same conditions as in Figure 8. In Example 6, this shows the results of Western blotting analysis of the expression levels of GFAP, SOX9, and vinculin in cells obtained by performing an induction procedure on CD90-negative (CD90-) or CD90-positive (CD90+) human urine-derived cells. In Example 6, this shows the results of normalizing the GFAP band intensity in Figure 10 with the vinculin band intensity.
[0016] Hereinafter, embodiments for carrying out the present disclosure will be described, but the present disclosure is not limited to the following embodiments.
[0017] In the present disclosure, when a protein or nucleic acid comprises an amino acid sequence or a nucleotide sequence that has 90% or more sequence identity with a given amino acid sequence or a nucleotide sequence, the protein or nucleic acid may have 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity with the given sequence, and in a preferred embodiment, 95% or more sequence identity, and in a most preferred embodiment, 100% sequence identity.
[0018] In the present disclosure, when a sequence contained in a certain protein or nucleic acid has a mutation (i.e., sequence identity is not 100%) with respect to a predetermined amino acid sequence or nucleotide sequence, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 to 10 consecutive or dispersed residues or 1 to 30 bases. In a preferred embodiment, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 to 3 consecutive or dispersed residues or 1 to 10 bases. In a more preferred embodiment, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 residue or 1 to 3 bases.
[0019] In this disclosure, DNA (gene) encoding a protein refers to DNA from which the protein is biosynthesized through a biosynthetic process that includes transcription, splicing, and translation using that DNA as a template. In this disclosure, "<gene name> protein" refers to a protein encoded by a gene represented by that gene name. In this disclosure, "<gene name> mRNA" refers to an mRNA that encodes a protein encoded by a gene represented by that gene name (i.e., an RNA that gives rise to that protein through translation). In this disclosure, "<gene name> pre-mRNA" refers to an RNA (pre-mRNA) that gives rise to <gene name> mRNA through splicing. In this disclosure, "<gene name>" and "<gene name> gene" refer to DNA (gene) that gives rise to <gene name> mRNA or its coding region through transcription, and transcription and splicing. In this disclosure, "DNA giving mRNA" refers to DNA that serves as a template for producing that mRNA through transcription and splicing in human cells.
[0020] One embodiment of the present disclosure is astrocytes (or astrocyte-like cells) derived from human urine-derived cells into which an astrocyte induction gene has been introduced. In this disclosure, a gene that can induce human urine-derived cells to become astrocytes when introduced into the cells is referred to as an "astrocyte induction gene." Hereinafter, astrocytes according to this embodiment are also referred to as "astrocytes derived from human urine-derived cells."
[0021] Astrocytes are a type of glial cell that constitutes the central nervous system and support neurotransmission through various functions, such as supplying nutrients to neurons, regulating neurotransmitters, and forming the blood-brain barrier (BBB). Astrocytes have a characteristic morphological morphology, often described as "stellate," with multiple processes extending radially from a central cell body. Genetic characteristics of astrocytes include high expression of genes such as GFAP (Glial Fibrillary Acidic Protein), S100B (S100 Calcium Binding Protein B), ALDH1L1 (Aldehyde Dehydrogenase 1 Family Member L1), AQP4 (Aquaporin 4), GLT-1 (Glutamate Transporter 1, also known as EAAT2 and SLC1A2), GLAST (Glutamate Aspartate Transporter, also known as EAAT1 and SLC1A3), KIR4.1 (Potassium Inwardly-Rectifying Channel, Subfamily J, Member 10, also known as KCNJ10), and ATP1B2 (ATPase Na + / K + Transporting Subunit Beta 2). Functional characteristics of astrocytes include high glutamate uptake capacity. Astrocytes have the functional characteristic of increasing the expression levels of CXCL10 (CXC Motif Chemokine Ligand 10), CXCL8 (CXC Motif Chemokine Ligand 8), CCL5 (CC Motif Chemokine Ligand 5), and complement C3 upon exposure to cytokines such as IL-1β (Interleukin 1 Beta), TNFα (Tumor Necrosis Factor Alpha), or complement C1q. Astrocytes also have the functional characteristic of activating calcium signaling upon exposure to ATP (adenosine triphosphate), resulting in an increase in calcium concentration and a temporary increase in calcium concentration (oscillation). Astrocytes also have the functional characteristic of maintaining extracellular potassium concentration.Astrocytes have functional characteristics of a membrane potential of about −50 mV and an input resistance of about 120 MΩ.
[0022] The astrocyte-inducing gene according to the present disclosure is at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20. The four genes SOX9, NFIA, NFIB, and ZBTB20 have been reported in literature such as Non-Patent Document 3 to be able to induce differentiation into astrocytes when introduced into human induced pluripotent stem cells (human iPS cells). The present inventors have found that by introducing these astrocyte-inducing genes into human urine-derived cells, it is possible to directly induce the human urine-derived cells into astrocytes, and more unexpectedly, the resulting astrocytes (astrocytes derived from human urine-derived cells) have functions comparable to those of primary human astrocytes.
[0023] SOX9 (SRY-box 9) is a gene encoding the SOX9 protein, a transcription factor. The Ref. Seq. number of the endogenous human SOX9 protein in the National Institutes of Health (NIH) GenPept is NP_000337.1, and its amino acid sequence is shown in SEQ ID NO: 1. The Ref. Seq. number of the endogenous human SOX9 mRNA in the NIH GenBank is NM_000346.4, and its nucleotide sequence is shown in SEQ ID NO: 2. The region spanning from base 373 to base 1902 in SEQ ID NO: 2 is the coding region, and its nucleotide sequence is shown in SEQ ID NO: 3.
[0024] The SOX9 protein encoded by the SOX9 of the present disclosure is not particularly limited as long as it can bind to the same binding site in the genomic DNA of human urine-derived cells as the endogenous SOX9 protein in humans and function as a transcription factor, and is not limited to endogenous SOX9 proteins. That is, the SOX9 of the present disclosure is not particularly limited as long as it encodes a SOX9 protein that can bind to the same binding site in the genomic DNA of human urine-derived cells as the endogenous SOX9 protein in humans and function as a transcription factor, and is not limited to endogenous SOX9 proteins. In one aspect, SOX9 may be a gene encoding a protein comprising an amino acid sequence that has 90% or more sequence identity with the amino acid sequence of the endogenous SOX9 protein in humans, or may be a gene encoding a protein comprising an amino acid sequence that has 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1, or may be a gene encoding a protein consisting of an amino acid sequence that has 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1. In one embodiment, SOX9 may be DNA that gives rise to mRNA comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence of the coding region of SOX9 mRNA present in humans, or DNA that gives rise to mRNA consisting of a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:3, or DNA that gives rise to mRNA consisting of a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:2.
[0025] NFIA (Nuclear Factor IA) is a gene encoding the NFIA protein, a transcription factor. As of April 2024, four isoforms of NFIA protein (NFIA isoforms 1 to 4) have been reported to exist in humans. Information on each isoform of the NFIA protein, as well as the mRNA encoding it and its coding region, can be obtained as NCBI Reference Sequences (RefSeq) linked to genomic DNA designated by the NIH's National Center for Biotechnology Information (NCBI) as Gene ID 4774, Official symbol "NFIA," and Official Full name "nuclear factor IA," for example, from the NIH website (address: https: / / www.ncbi.nlm.nih.gov / gene / 4774, accessed April 11, 2024). NFIA isoform 1 has the Ref. Seq. number NP_001128145.1 in NIH GenPept, and its amino acid sequence is set forth in SEQ ID NO:4. Furthermore, the mRNA encoding NFIA isoform 1 has a Ref. Seq. number of NM_001134673.4 in the NIH GenBank, its nucleotide sequence is shown in SEQ ID NO: 5, the region spanning from base 232 to base 1761 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 6. NFIA isoform 2 has a Ref. Seq. number of NP_005586.1, and its amino acid sequence is shown in SEQ ID NO: 7. Furthermore, the mRNA encoding NFIA isoform 2 has a Ref. Seq. number of NM_005595.5, its nucleotide sequence is shown in SEQ ID NO: 8, the region spanning from base 232 to base 1728 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 9. NFIA isoform 3 has a Ref. Seq. Its number is NP_001138983.1, and its amino acid sequence is shown in SEQ ID NO:10.Furthermore, the mRNA encoding NFIA isoform 3 has a Ref. Seq. number of NM_001145511.2, its nucleotide sequence is shown in SEQ ID NO: 11, and the region spanning from base 400 to base 1905 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 12. NFIA isoform 4 has a Ref. Seq. number of NP_001138984.1, and its amino acid sequence is shown in SEQ ID NO: 13. Furthermore, the mRNA encoding NFIA isoform 4 has a Ref. Seq. number of NM_001145512.2, its nucleotide sequence is shown in SEQ ID NO: 14, and the region spanning from base 206 to base 1870 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 15.
[0026] The NFIA protein encoded by the NFIA of the present disclosure is not particularly limited as long as it can bind to the same binding site in the genomic DNA of human urine-derived cells as the endogenous NFIA protein in humans and function as a transcription factor, and is not limited to endogenous NFIA proteins. That is, the NFIA of the present disclosure is not particularly limited as long as it encodes an NFIA protein that can bind to the same binding site in the genomic DNA of human urine-derived cells as the endogenous NFIA protein in humans and function as a transcription factor, and is not limited to endogenous NFIA proteins in humans. In one aspect, NFIA may be a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence of endogenous human NFIA protein, or may be a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, 7, 10, or 13, or may be a gene encoding a protein consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, 7, 10, or 13. In one aspect, NFIA may be DNA that gives mRNA containing a base sequence having 90% or more sequence identity with the base sequence of the coding region of NFIA mRNA endogenous to humans, or DNA that gives mRNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 6, 9, 12, or 15, or DNA that gives mRNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 5, 8, 11, or 14.
[0027] NFIB (Nuclear Factor IB) is a gene encoding the NFIB protein, a transcription factor. As of April 2024, 28 isoforms (NFIB isoforms 1-28) of the NFIB protein endogenously present in humans have been reported. Information on each isoform of the NFIB protein, as well as the mRNA encoding it and its coding region, can be obtained as NCBI Reference Sequences (RefSeq) linked to genomic DNA at the National Center for Biotechnology Information (NCBI) of the NIH, with a Gene ID of 4781, an Official Symbol of "NFIB," and an Official Full Name of "nuclear factor I B." These can be obtained, for example, from the NIH website (address: https: / / www.ncbi.nlm.nih.gov / gene / 4781, accessed April 11, 2024). NFIB isoform 1 has the Ref. Seq. number NP_001177666.1, and its amino acid sequence is set forth in SEQ ID NO: 16. The mRNA encoding NFIB isoform 1 has the Ref. Seq. number NM_001190737.2, its nucleotide sequence is shown in SEQ ID NO: 17, and the region spanning from base 631 to base 2115 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 18. The Ref. Seq. number of NFIB isoform 2 is NP_001177667.1, and the amino acid sequence is shown in SEQ ID NO: 19. The mRNA encoding NFIB isoform 2 has the Ref. Seq. number NM_001190738.2, its nucleotide sequence is shown in SEQ ID NO: 20, and the region spanning from base 353 to base 1693 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 21. The Ref. Seq. number of NFIB isoform 3 is NP_001177667.1, and the amino acid sequence is shown in SEQ ID NO: 19. The Ref. Seq. number of NP_001177667.1 is shown in SEQ ID NO: 20, and the region spanning from base 353 to base 1693 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 21 .... The Ref. Seq. number of NP_001177667.1 is shown in SEQ ID NO: Its number is NP_005587.2, and its amino acid sequence is shown in SEQ ID NO:22.The mRNA encoding NFIB isoform 3 has a Ref. Seq. number of NM_005596.3, its nucleotide sequence is shown in SEQ ID NO: 23, and the region spanning from base 536 to base 1798 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 24. The NFIB isoform 4 has a Ref. Seq. number of NP_001269716.1, and its amino acid sequence is shown in SEQ ID NO: 25. The mRNA encoding NFIB isoform 4 has a Ref. Seq. number of NM_001282787.2, its nucleotide sequence is shown in SEQ ID NO: 26, and the region spanning from base 341 to base 1270 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 27. The NFIB isoform 5 has a Ref. Seq. The Ref. Seq. number is NP_001356387.1, and its amino acid sequence is shown in SEQ ID NO: 28. The mRNA encoding NFIB isoform 5 has a Ref. Seq. number of NM_001369458.1, and its nucleotide sequence is shown in SEQ ID NO: 29, with the region spanning from base 36 to base 1814 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 30. The Ref. Seq. number is NP_001356388.1, and its amino acid sequence is shown in SEQ ID NO: 31. The mRNA encoding NFIB isoform 6 has a Ref. Seq. number of NM_001369459.1, and its nucleotide sequence is shown in SEQ ID NO: 32, with the region spanning from base 36 to base 1787 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 33. NFIB isoform 7 has the Ref. Seq. number NP_001356389.1, and its amino acid sequence is shown in SEQ ID NO: 34. The mRNA encoding NFIB isoform 7 has the Ref. Seq. number NM_001369460.1, and its nucleotide sequence is shown in SEQ ID NO: 35. The region spanning from base 430 to base 2130 of the mRNA is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 36.NFIB isoform 8 has the Ref. Seq. number NP_001356390.1, and its amino acid sequence is shown in SEQ ID NO: 37. Furthermore, the mRNA encoding NFIB isoform 8 has the Ref. Seq. number NM_001369461.1, and its nucleotide sequence is shown in SEQ ID NO: 38, with the region spanning from base 631 to base 2316 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 39. NFIB isoform 9 has the Ref. Seq. number NP_001356391.1, and its amino acid sequence is shown in SEQ ID NO: 40. Furthermore, the mRNA encoding NFIB isoform 9 has the Ref. Seq. The Ref. Seq. number is NM_001369462.1, its nucleotide sequence is shown in SEQ ID NO: 41, and the region spanning from base 36 to base 1565 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 42. NFIB isoform 10 has a Ref. Seq. number of NP_001356392.1, and its amino acid sequence is shown in SEQ ID NO: 43. Furthermore, the mRNA encoding NFIB isoform 10 has a Ref. Seq. number of NM_001369463.1, and its nucleotide sequence is shown in SEQ ID NO: 44, and the region spanning from base 430 to base 1914 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 45. NFIB isoform 11 has a Ref. Seq. number of NP_001356393.1, and its amino acid sequence is shown in SEQ ID NO: 46. The mRNA encoding NFIB isoform 11 has the Ref. Seq. number NM_001369464.1, its nucleotide sequence is shown in SEQ ID NO: 47, and the region spanning from base 631 to base 2094 is the coding region, the nucleotide sequence of which is shown in SEQ ID NO: 48. The Ref. Seq. number of NFIB isoform 12 is NP_001356394.1, and its amino acid sequence is shown in SEQ ID NO: 49.Furthermore, the mRNA encoding NFIB isoform 12 has the Ref. Seq. number NM_001369465.1, its nucleotide sequence is shown in SEQ ID NO: 50, the region spanning from base 114 to base 1571 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 51. NFIB isoform 13 has the Ref. Seq. number NP_001356395.1, and its amino acid sequence is shown in SEQ ID NO: 52. Furthermore, the mRNA encoding NFIB isoform 13 has the Ref. Seq. number NM_001369466.1, its nucleotide sequence is shown in SEQ ID NO: 53, the region spanning from base 430 to base 1881 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 54. NFIB isoform 14 has the Ref. Seq. The Ref. Seq. number is NP_001356396.1, and its amino acid sequence is shown in SEQ ID NO: 55. The mRNA encoding NFIB isoform 14 has the Ref. Seq. number NM_001369467.1, and its nucleotide sequence is shown in SEQ ID NO: 56, with the region spanning from base 114 to base 1550 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 57. The Ref. Seq. number is NP_001356397.1, and its amino acid sequence is shown in SEQ ID NO: 58. The mRNA encoding NFIB isoform 15 has the Ref. Seq. The Ref. Seq. number of NFIB isoform 16 is NM_001369468.1, its nucleotide sequence is shown in SEQ ID NO: 59, the region spanning from base 36 to base 1364 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 60. The Ref. Seq. number of NFIB isoform 16 is NP_001356398.1, and its amino acid sequence is shown in SEQ ID NO: 61. The Ref. Seq. number of mRNA encoding NFIB isoform 16 is NM_001369469.1, its nucleotide sequence is shown in SEQ ID NO: 62, the region spanning from base 159 to base 1478 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 63.NFIB isoform 17 has the Ref. Seq. number NP_001356399.1, and its amino acid sequence is shown in SEQ ID NO: 64. Furthermore, the mRNA encoding NFIB isoform 17 has the Ref. Seq. number NM_001369470.1, and its nucleotide sequence is shown in SEQ ID NO: 65, with the region spanning from base 430 to base 1704 being the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 66. NFIB isoform 18 has the Ref. Seq. number NP_001356400.1, and its amino acid sequence is shown in SEQ ID NO: 67. Furthermore, the mRNA encoding NFIB isoform 18 has the Ref. Seq. The NFIB isoform 19 has a Ref. Seq. number of NM_001369471.1, its nucleotide sequence is shown in SEQ ID NO: 68, and the region spanning from base 631 to base 1890 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 69. NFIB isoform 19 has a Ref. Seq. number of NP_001356401.1, and its amino acid sequence is shown in SEQ ID NO: 70. The mRNA encoding NFIB isoform 19 has a Ref. Seq. number of NM_001369472.1, its nucleotide sequence is shown in SEQ ID NO: 71, and the region spanning from base 430 to base 1680 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 72. NFIB isoform 20 has a Ref. Seq. number of NP_001356402.1, and its amino acid sequence is shown in SEQ ID NO: 73. The mRNA encoding NFIB isoform 20 has the Ref. Seq. number NM_001369473.1, its nucleotide sequence is shown in SEQ ID NO: 74, and the region spanning from base 430 to base 1677 is the coding region, the nucleotide sequence of which is shown in SEQ ID NO: 75. The Ref. Seq. number of NFIB isoform 21 is NP_001356403.1, and its amino acid sequence is shown in SEQ ID NO: 76.Furthermore, the mRNA encoding NFIB isoform 21 has the Ref. Seq. number NM_001369474.1, its nucleotide sequence is shown in SEQ ID NO: 77, the region spanning from base 114 to base 1358 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 78. NFIB isoform 22 has the Ref. Seq. number NP_001356404.1, and its amino acid sequence is shown in SEQ ID NO: 79. Furthermore, the mRNA encoding NFIB isoform 22 has the Ref. Seq. number NM_001369475.1, its nucleotide sequence is shown in SEQ ID NO: 80, the region spanning from base 631 to base 1869 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 81. NFIB isoform 23 has the Ref. Seq. The Ref. Seq. number is NP_001356405.1, and its amino acid sequence is shown in SEQ ID NO: 82. The mRNA encoding NFIB isoform 23 has a Ref. Seq. number of NM_001369476.1, and its nucleotide sequence is shown in SEQ ID NO: 83, with the region spanning from base 114 to base 1349 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 84. The Ref. Seq. number of NFIB isoform 24 has a Ref. Seq. number of NP_001356406.1, and its amino acid sequence is shown in SEQ ID NO: 85. The mRNA encoding NFIB isoform 24 has a Ref. Seq. The Ref. Seq. number is NM_001369477.1, its nucleotide sequence is shown in SEQ ID NO: 86, the region spanning from base 631 to base 1836 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 87. NFIB isoform 25 has a Ref. Seq. number of NP_001356407.1, and its amino acid sequence is shown in SEQ ID NO: 88. Furthermore, the mRNA encoding NFIB isoform 25 has a Ref. Seq. number of NM_001369478.1, its nucleotide sequence is shown in SEQ ID NO: 89, the region spanning from base 430 to base 1455 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 90.NFIB isoform 26 has the Ref. Seq. number NP_001356408.1, and its amino acid sequence is shown in SEQ ID NO: 91. Furthermore, the mRNA encoding NFIB isoform 26 has the Ref. Seq. number NM_001369479.1, and its nucleotide sequence is shown in SEQ ID NO: 92, with the region spanning from base 55 to base 981 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 93. NFIB isoform 27 has the Ref. Seq. number NP_001356409.1, and its amino acid sequence is shown in SEQ ID NO: 94. Furthermore, the mRNA encoding NFIB isoform 27 has the Ref. Seq. The Ref. Seq. number of NFIB isoform 28 is NM_001369480.1, its nucleotide sequence is shown in SEQ ID NO: 95, the region spanning from base 55 to base 780 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 96. The Ref. Seq. number of NFIB isoform 28 is NP_001356410.1, and its amino acid sequence is shown in SEQ ID NO: 97. The Ref. Seq. number of mRNA encoding NFIB isoform 28 is NM_001369481.1, its nucleotide sequence is shown in SEQ ID NO: 98, the region spanning from base 631 to base 1233 is the coding region, and the nucleotide sequence of the coding region is shown in SEQ ID NO: 99.
[0028] The NFIB protein encoded by the NFIB according to the present disclosure is not particularly limited as long as it can bind to the genomic DNA of human urine-derived cells at the same binding site as that of NFIB protein endogenous to humans and act as a transcription factor, and is not limited to NFIB protein endogenous to humans. In other words, the NFIB according to the present disclosure is not particularly limited as long as it encodes an NFIB protein that can bind to the genomic DNA of human urine-derived cells at the same binding site as that of NFIB protein endogenous to humans and act as a transcription factor, and is not limited to NFIB endogenous to humans. In one embodiment, NFIB may be a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence of an NFIB protein endogenous to humans, and a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, or 97. It may be a gene encoding a protein consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, or 97, or it may be a gene encoding a protein consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 28.In one embodiment, NFIB may be DNA that gives an mRNA containing a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of the coding region of NFIB mRNA endogenous to humans, or may be DNA that gives an mRNA consisting of a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, or 99, The DNA may be one that gives an mRNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, or 98, or one that gives an mRNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 29 or 30.
[0029] ZBTB20 (zinc finger and BTB domain containing 20) is a gene encoding ZBTB20, a transcription factor containing a zinc finger domain and a BTB / POZ domain. As of April 2024, two isoforms of ZBTB20 (ZBTB20 isoforms 1 and 2) have been reported. Information on each isoform of the ZBTB20 protein, as well as the mRNA encoding it and its coding region, can be obtained as NCBI Reference Sequences (RefSeq) linked to genomic DNA at the National Center for Biotechnology Information (NCBI) of the NIH, with a Gene ID of 26137, an Official symbol of "ZBTB20," and an Official Full name of "zinc finger and BTB domain containing 20." These sequences can be obtained, for example, from the NIH website (address: https: / / www.ncbi.nlm.nih.gov / gene / 26137, accessed April 11, 2024). ZBTB20 isoform 1 is Ref. Seq. The Ref. Seq. number is NP_001157814.1, and its amino acid sequence is shown in SEQ ID NO: 100. The mRNA encoding ZBTB20 isoform 1 has a Ref. Seq. number of NM_001164342.2, and its nucleotide sequence is shown in SEQ ID NO: 101, with the region spanning from base 181 to base 2406 being the coding region, and the nucleotide sequence of the coding region being shown in SEQ ID NO: 102. The Ref. Seq. number of ZBTB20 isoform 2 has a Ref. Seq. number of NP_001157815.1, and its amino acid sequence is shown in SEQ ID NO: 103. The mRNA encoding ZBTB20 isoform 2 has a Ref. Seq. The number is NM_001164343.2, and its base sequence is shown in SEQ ID NO: 104. The region spanning from base 862 to base 2868 is the coding region, and the base sequence of the coding region is shown in SEQ ID NO: 105.
[0030] The ZBTB20 protein encoded by the ZBTB20 of the present disclosure is not particularly limited as long as it can bind to the same binding site in the genomic DNA of human urine-derived cells as the ZBTB20 protein endogenous to humans and act as a transcription factor, and is not limited to ZBTB20 proteins endogenous to humans. In other words, the ZBTB20 of the present disclosure is not particularly limited as long as it encodes a ZBTB20 protein that can bind to the same binding site in the genomic DNA of human urine-derived cells as the ZBTB20 protein endogenous to humans and act as a transcription factor, and is not limited to ZBTB20 endogenous to humans. In one embodiment, ZBTB20 may be a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence of a ZBTB20 protein endogenous to humans, or may be a gene encoding a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 100 or 103, or may be a gene encoding a protein consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 100 or 103. In one embodiment, ZBTB20 may be DNA that gives rise to mRNA comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence of the coding region of ZBTB20 mRNA endogenous to humans, or may be DNA that gives rise to mRNA consisting of a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 102 or 105, or may be DNA that gives rise to mRNA consisting of a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 101 or 104.
[0031] The astrocyte induction gene is at least one gene selected from the group consisting of SOX9, NFIA, NFIB, and ZBTB20, and may be at least two, three, or four genes selected from the group. In one embodiment, the astrocyte induction gene may include at least SOX9. In one embodiment, the astrocyte induction gene may include SOX9 and NFIA or NFIB. In one embodiment, the astrocyte induction gene may include SOX9 and NFIB; SOX9, NFIA, and NFIB; SOX9, NFIA, and ZBTB20; or SOX9 and ZBTB20. In a preferred embodiment, the astrocyte induction gene may include SOX9 and NFIB. In one embodiment, the astrocyte induction gene may be SOX9 and NFIB. In one embodiment, the astrocyte induction gene may not include NFIA or may not include ZBTB20.
[0032] Human urine-derived cells (UDCs) are primary cultured cells derived from the upper urinary tract that can be collected from human urine. Human urine-derived cells are known to be a heterogeneous cell population containing cells of various morphologies and origins, such as renal epithelial cells and urinary tract epithelial cells. The human urine-derived cells of the present disclosure may be, for example, cells obtained by isolating urine collected from a human subject or a culture thereof, or cells obtained by culturing cells obtained by isolating urine collected from a human subject. In this case, the cell isolation method is not particularly limited as long as it can isolate the cells from cell-containing urine or a culture thereof. For example, centrifugation or filtration may be used, with centrifugation being preferred. Human urine-derived cells can be prepared from human urine and therefore can be collected non-invasively.
[0033] Methods for preparing human urine-derived cells are known in the art and are not particularly limited, and can be prepared, for example, by the following method: Urine collected from a human subject is centrifuged to remove the supernatant, and the pellet is mixed with an initial medium (equal volumes of high-glucose DMEM (GE Healthcare, Logan, UT; SH30022.FS) and Ham's F-12 Nutrient Mix (Thermo Fisher Scientific; 11765-054) mixed with REGM SingleQuots (Lonza, Basel, Switzerland; CC-4127), tetracycline-free 10% fetal bovine serum (Clontech; 631106), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) and incubated at approximately 37°C. Subsequently, the cells are cultured in a growth medium (REGM Bullet Kit (Lonza; Equal volumes of tetracycline-free DMEM (Cell Signaling Module CC-3190) and high-glucose DMEM were mixed and cultured in a medium supplemented with 15% tetracycline-free fetal bovine serum, 0.5% Glutamax (Thermo Fisher Scientific; 35050-061), 0.5% non-essential amino acids (Thermo Fisher Scientific; 11140-050), 2.5 ng / mL fibroblast growth factor-basic (bFGF) (Sigma, St Louis, USA; F0291), PDGF-AB (Peprotech, Rocky Hill, NJ; 100-00AB), EGF (Peprotech; AF-100-15), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B. Cells that formed colonies were selected approximately several days to two weeks after the initiation of culture. The cells thus obtained become stable cell lines with similar characteristics even after multiple subcultures.
[0034] Furthermore, a more detailed example of a method for preparing human urine-derived cells is the preparation method described below, which includes the steps of collecting human urine (collection step), concentrating human urine to obtain a human urine concentrate (concentration step), preparing a mixture containing the human urine concentrate, dimethyl sulfoxide, and serum (mixing step), freezing and storing the mixture (freezing and storing step), thawing the frozen mixture (thawing step), separating cells having a diameter of 10 μm or less from a population of cells derived from human urine (separation step), and culturing cells derived from human urine (culture step).
[0035] In the collection step, human urine is collected. For example, human urine can be collected by having a human subject urinate into a bottle made of glass, plastic, or the like, which is capable of collecting and storing liquid components. Alternatively, human urine can be collected by having the human subject urinate into a cup or the like, and then transferring the collected human urine into a bottle. The amount of human urine collected in the collection step is not particularly limited, and may be the entire amount or a portion of the urine excreted by a human in one urination, for example, 25 to 250 mL.
[0036] The bottle (container) used in one embodiment of the collection step has a storage section and a sealing means. The storage section stores human urine collected in the collection step. The sealing means is a means capable of sealing the storage section, and can be, for example, a cap such as a screw cap or a flip-top cap, a zipper, or a seal such as a heat seal, and one example is a screw cap.
[0037] In one embodiment, an antibiotic is contained in the storage portion of the bottle used in the collection step. The antibiotic is contained in the storage portion before human urine is collected in the storage portion. This allows the antibiotic to dissolve in the human urine collected in the bottle immediately after it is stored in the storage portion, thereby preventing bacterial infection of the collected human urine. For example, the antibiotic is at least one antibiotic selected from the group consisting of penicillin antibiotics, cephalosporin antibiotics, macrolide antibiotics, tetracycline antibiotics, and aminoglycoside antibiotics. Examples of antibiotics include penicillin and streptomycin. The amount of antibiotic is, for example, 0.1 μg to 1 kg per bottle (or per 25 to 250 mL of human urine), for example, 20,000 μg. The amount of antibiotic is, for example, 1.0 x 10 Units to 1.0 x 10 8 Units, for example, 2.0 x 10 4 Units.
[0038] In one embodiment, the container of the bottle used in the collection step further contains an antifungal agent in addition to an antibiotic. The antibiotic and antifungal agent are contained in the container before human urine is collected in the container. This allows the antibiotic and antifungal agent to dissolve in the human urine collected in the bottle immediately after it is stored in the container, thereby preventing bacterial and fungal infection of the collected human urine. For example, the antifungal agent is at least one antifungal agent selected from the group consisting of azole antifungal agents, polyene antifungal agents, allylamine antifungal agents, and echinocandin antifungal agents. An example of the antifungal agent is amphotericin B. The amount of the antifungal agent is, for example, 1 ng to 10 g per bottle (or per 25 to 250 mL of human urine), for example, 0.2 μg.
[0039] In one embodiment, the time from when the human urine is urinated by the human subject to when it is stored in the storage section of the bottle during the collection step is, for example, within 3 hours, and may also be within 1 hour, 15 minutes, 5 minutes, 1 minute, or 15 seconds. When the time is within 15 seconds, for example, when the human subject urinates so that the urine is stored in the storage section of the bottle. When the time from when the human subject urinates to when the collected human urine is stored in the storage section of the bottle is within the above-mentioned upper limit, bacterial infection of the collected human urine is suppressed, and the success rate of establishing human urine-derived cells increases.
[0040] In the concentration step, human urine is concentrated to obtain a human urine concentrate. The human urine concentrate obtained in the concentration step is a cell suspension in which the concentration of cellular components contained in human urine is higher than that in human urine. The method for concentrating human urine in the concentration step is a concentration method that does not significantly affect cell viability or proliferation, such as concentration by centrifuging or leaving the urine to stand at a temperature of 4°C to 40°C, followed by removal of the supernatant. In one embodiment of the concentration step, the human urine collected in the collection step is first transferred to multiple conical tubes, each containing up to 50 mL. Next, the conical tubes are centrifuged at 4 to 30°C and 100 to 1,000 × g for 2 to 30 minutes, and the supernatant is then recovered until the volume is 1 to 10 mL. The pelleted cellular components are suspended in the remaining liquid components, and if necessary, diluted with a buffer such as physiological saline, after which a total of 20 to 50 mL of cell suspension is collected in a single conical tube. The conical tube is centrifuged at 100 to 1000 × g for 2 to 30 minutes at 4 to 30°C, and the supernatant is then recovered until the volume reaches 1 to 10 mL, thereby obtaining a human urine concentrate containing the cellular components of the human urine (e.g., 25 to 250 mL) collected in the collection step and about 1 to 10 mL of liquid components.
[0041] In the mixing step, a mixture (composition) containing human urine concentrate, dimethyl sulfoxide, and serum is prepared. The resulting mixture (composition) can be used as a composition for preparing human urine-derived cells. In one embodiment of the mixing step, dimethyl sulfoxide and serum are added to the human urine concentrate obtained in the concentration step. The amount of dimethyl sulfoxide added may be 2.0 to 50% by volume, 2.5 to 30% by volume, 3.0 to 20% by volume, or 3.5 to 10% by volume, and is, for example, 5% by volume, based on the total volume of the mixture. The amount of serum added may be 15 to 80% by volume, 20 to 70% by volume, 25 to 60% by volume, or 30 to 50% by volume based on the total volume of the mixture. The serum is, for example, fetal bovine serum (FBS). Dimethyl sulfoxide and serum may be added, for example, by adding a solution containing them, such as CELLBANKER (registered trademark) 1 (Takara Bio, CB011), in a volume that is 0.01 to 100 times, 0.1 to 10 times, or 0.3 to 3 times the volume of the human urine concentrate, and as an example, in a volume that is 1 time the volume of the human urine concentrate.
[0042] In the cryopreservation step, a composition containing a human urine concentrate, dimethyl sulfoxide, and serum is cryopreserved. The cryopreservation temperature may be any temperature at which the composition freezes, and is, for example, −100°C or higher and −20°C or lower, preferably −100°C or higher and −50°C or lower, and one example is −80°C. The cryopreservation period is not particularly limited, and may be, for example, one week or longer, one month or longer, three months or longer, one year or longer, or two years or longer, and may be 100 years or shorter, 10 years or shorter, 5 years or shorter, 3 years or shorter, or two years or shorter. In one embodiment of the cryopreservation step, the mixture obtained in the mixing step is stored at −80°C for one year or longer. In one embodiment of the cryopreservation step, freezing is preferably performed within 8 hours, and more preferably within 3 hours, of the start of the collection step (i.e., urination by the human subject), from the viewpoint of increasing the success rate of establishment of human urine-derived cells. Furthermore, in one embodiment, freezing in the cryopreservation step is preferably carried out within 1 hour, more preferably within 15 minutes, and even more preferably within 3 minutes after mixing the human urine concentrate and dimethyl sulfoxide in the mixing step, from the viewpoint of increasing the success rate of establishing human urine-derived cells.
[0043] In the thawing step, a frozen mixture (composition) containing human urine concentrate, dimethyl sulfoxide, and serum is thawed. In one embodiment of the thawing step, the frozen mixture obtained in the cryopreservation step is thawed. The thawing method in the thawing step is a thawing method that does not significantly affect cell viability and proliferation, for example, leaving the cells to stand at 25 to 45°C. The thawed product obtained in the thawing step can be used in the fractionation step or culture step described below by diluting it with a medium, or by separating the cells by centrifugation or the like and then resuspending the cells in a medium.
[0044] In the sorting step, cells with a diameter of 10 μm or less are sorted from a population of cells derived from human urine. In one embodiment of the sorting step, a population of cells with a diameter of 10 μm or less is sorted from a population of cells contained in the lysate obtained in the thawing step or a culture product thereof. Cells contained in human urine include not only human urine-derived cells but also other cells (e.g., cells without stem cell properties). Here, a high proportion of human urine-derived cells have a diameter of 10 μm or less. On the other hand, among the cells contained in human urine, a high proportion of cells other than human urine-derived cells (contaminant cells) have a diameter exceeding 10 μm. Therefore, by sorting cells with a diameter of 10 μm or less from a population of cells derived from human urine, the proportion of human urine-derived cells can be increased.
[0045] The method for separating cells having a diameter of 10 μm or less in the separation step is not particularly limited as long as it is a method commonly used by those skilled in the art, and may be, for example, a method using a flow cytometer or a cell sorter. In one embodiment of the separation step, a Cell Sorter SH800 manufactured by Sony Corporation may be used as the flow cytometer to separate a fraction having an FSC (forward scattering) value of 300,000 or less.
[0046] In the culturing step, cells derived from human urine are cultured. In one embodiment, the culturing step is carried out at least after the sorting step, and may also be carried out after the thawing step and before the sorting step. Established human urine-derived cells are finally obtained by the culturing step carried out after the sorting step. The culture conditions, such as the culture medium, culture conditions, and culture period, in the culturing step are not particularly limited as long as they suppress the differentiation of human urine-derived cells into plasma cells, and can be carried out using methods commonly used by those skilled in the art. The culture medium in the culturing step is, for example, an initial medium, a growth medium, or a mixture thereof. The culture period in the culturing step is, for example, 1 to 4 weeks.
[0047] In one aspect, in the culturing step, cells derived from human urine may be cultured in a medium containing an agonist of the Piezo1 (Piezo-type mechanosensitive ion channel component 1) ion channel. The Piezo1 ion channel is a mechanosensitive calcium ion channel. The present inventors have found that culturing cells derived from human urine in a medium containing an agonist of the Piezo1 ion channel increases the proliferation ability of the human urine-derived cells. The Piezo1 ion channel may be, for example, Yoda1. Yoda1 is an agonist of the Piezo1 ion channel with CAS number 448947-81-7 and can be obtained from suppliers such as Sigma-Aldrich (product number SML1558). Culturing in a medium containing Yoda1 increases the proliferation ability of the human urine-derived cells. The concentration of the Piezo1 ion channel agonist to be added to the culture medium may be appropriately determined by those skilled in the art as a concentration that can enhance the proliferation ability of human urine-derived cells, depending on the type of agonist. The concentration of Yoda1 to be added to the culture medium may be, for example, 0.1 μg / mL to 100 μg / mL, and may be 5 μg / mL, for example.
[0048] The human urine-derived cells according to one embodiment of the present disclosure may be CD90-positive. CD90 (Cluster of Differentiation 90), also known as THY1, is a cell surface protein. CD90 is known to be expressed in a wide range of organs in humans, including muscle, brain, and kidney. CD90 is also known as a mesenchymal stem cell marker. When the human urine-derived cells according to one embodiment of the present disclosure are CD90-positive, the efficiency of inducing astrocytes from the human urine-derived cells tends to be high, and the quality (e.g., purity) of the astrocytes tends to be high.
[0049] The expression level of CD90 in human urine-derived cells can be evaluated according to methods commonly used by those skilled in the art when evaluating the expression level of cell surface proteins. Methods for measuring the expression level of CD90 in human urine-derived cells include, for example, immunostaining using a labeled anti-CD90 antibody, Western blotting, and quantitative PCR (q-PCR). From the viewpoint of direct protein detection, immunostaining or Western blotting using a labeled anti-CD90 antibody is preferred. In the case of immunostaining, the label of the anti-CD90 antibody may be, for example, fluorescently labeled, and the level of labeling by the fluorescently labeled anti-CD90 antibody may be evaluated using, for example, a flow cytometer, a microwell plate reader, a fluorometer, or a fluorescence microscope.
[0050] In the present disclosure, CD90-positive human urine-derived cells are human urine-derived cells that significantly express CD90. For example, when the CD90 expression levels of human urine-derived cells that have not been selected using a stem cell marker are expressed as the overlap of two normal distributions, the CD90 expression level may be higher than the upper limit of the 80%, 85%, 90%, 95%, 98%, or 99% confidence interval of the normal distribution with the lower expression level. For example, CD90-positive human urine-derived cells may be human urine-derived cells whose measured value, which is an index of expression level evaluated using an anti-CD90 antibody, is higher than the upper limit of the 80%, 85%, 90%, 95%, 98%, or 99% confidence interval when measured values similarly evaluated using an isotype control of the anti-CD90 antibody are fitted to a normal distribution.
[0051] In one embodiment of the present disclosure, the percentage of CD90-positive cells in the cell population of human urine-derived cells may be, for example, 50% or more, 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100%, and in one embodiment, may be 90% or more.
[0052] Human urine-derived cells having the above-mentioned percentage of CD90-positive cells in a cell population can be prepared, for example, by separating CD90-positive cells from a population of human urine-derived cells. Such separation can be carried out, for example, by flow cytometry, affinity tag purification, or affinity chromatography, and more specifically, by the method described below as the separation step.
[0053] The astrocytes derived from human urine-derived cells according to this embodiment are derived from human urine-derived cells into which an astrocyte induction gene has been introduced. That is, the astrocytes derived from human urine-derived cells according to this embodiment are obtained by inducing human urine-derived cells into which an astrocyte induction gene has been introduced into astrocytes. The induction of astrocytes from human urine-derived cells will be described below, with reference to the method for producing astrocytes derived from human urine-derived cells according to this embodiment.
[0054] In one embodiment, a method for producing astrocytes derived from human urine-derived cells includes a step of introducing an astrocyte induction gene into human urine-derived cells (introduction step), and a step of culturing the human urine-derived cells introduced with the astrocyte induction gene and inducing them into astrocytes (induction step).
[0055] In the introduction step, an astrocyte-inducing gene is introduced into human urine-derived cells. The method for introducing the gene into cells is not particularly limited and may be performed according to methods commonly used by those skilled in the art. Methods for introducing the gene into cells include, for example, methods using viral vectors, electroporation, lipofection, magnetofection, sonoporation, microinjection, and cationic lipid-mediated transfection, and examples thereof include methods using viral vectors or electroporation. These methods for introducing genes into cells may be performed according to methods commonly used by those skilled in the art using equipment and reagents commonly used by those skilled in the art.
[0056] When an astrocyte-inducing gene is introduced into human urine-derived cells using a viral vector, the viral vector can be any vector capable of introducing DNA into cells, including, for example, an adenovirus vector, an adeno-associated virus (AAV) vector, a herpes simplex virus (HSV) vector, a baculovirus vector, or a poxvirus vector. Viral vectors can be designed and obtained according to methods commonly used by those skilled in the art, and can be obtained, for example, by outsourcing synthesis to a contract synthesis company such as VectorBuilder, based on a designed vector map.
[0057] Furthermore, when an astrocyte induction gene is introduced into human urine-derived cells using a viral vector, the vector may further incorporate a selection marker. Such a selection marker confers resistance to a specific antibiotic in the introduced cells, allowing cells that survive when cultured in a medium containing the antibiotic to be selected as cells into which the gene has been introduced. The selection marker is not particularly limited, but may be, for example, an ampicillin resistance gene, a blasticidin resistance gene, a neomycin resistance gene, a prionycin resistance gene, a hygromycin B resistance gene, or a zeocin resistance gene. When a selection marker is incorporated into the vector, the introduction step may include contacting the human urine-derived cells with an antibiotic corresponding to the selection marker after gene introduction. Furthermore, when an astrocyte induction gene is introduced into human urine-derived cells using a viral vector, the vector may further incorporate a sequence (e.g., an IRES (Internal Ribosome Entry Site)) that promotes expression of the astrocyte induction gene.
[0058] On the other hand, when an astrocyte-inducing gene is introduced into human urine-derived cells using a viral vector, selection using antibiotics is not necessary.The production method according to one aspect of this embodiment achieves high efficiency in introducing the astrocyte-inducing gene and inducing astrocytes, making it possible to produce astrocytes derived from human urine-derived cells without selection.
[0059] In the introduction step, genes other than the astrocyte-inducing gene may be further introduced, such as genes encoding proteins that promote differentiation into astrocytes or proteins that enhance the function of the resulting astrocytes.
[0060] When the introduction step is carried out by a method using a viral vector or by lipofection, the period for which the human urine-derived cells are cultured in a medium containing the vector or lipofection may be, for example, 3 hours or more, 12 hours or more, 1 day or more, or 2 days or more, or may be 30 days or less, 14 days or less, 7 days or less, 5 days or less, 3 days or less, or 2 days or less, for example, 3 hours or more and 30 days or less, 12 hours or more and 14 days or more, or 1 day or more and 7 days or less, and as one example, 2 days.
[0061] The conditions for gene introduction in the introduction step can be determined according to methods commonly used by those skilled in the art. For example, the medium and amount introduced in the introduction step can be appropriately determined by those skilled in the art. For example, the culture medium was a mixture of equal volumes of growth medium (REGM Bullet Kit (Lonza; CC-3190) and high-glucose DMEM, supplemented with tetracycline-free 15% fetal bovine serum, 0.5% Glutamax (Thermo Fisher Scientific; 35050-061), 0.5% non-essential amino acids (Thermo Fisher Scientific; 11140-050), 2.5 ng / mL fibroblast growth factor-basic (bFGF) (Sigma, St Louis, USA; F0291), PDGF-AB (Peprotech, Rocky Hill, NJ; 100-00AB), EGF (Peprotech; AF-100-15), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B. REGM Bullet The medium to be introduced may be a commercially available general-purpose basal medium (e.g., DMEM medium, RPMI medium) containing a serum component such as fetal bovine serum (FBS) and / or an antibiotic (penicillin, streptomycin, amphotericin B, etc.), for example. The amount of vector introduced may be, for example, 3 to 300 μg / mL in terms of the vector concentration in the medium, and may be 30 μg / mL, for example.
[0062] In the induction step, human urine-derived cells transfected with an astrocyte induction gene are cultured to induce astrocytes. In one embodiment, the culture period for human urine-derived cells transfected with an astrocyte induction gene may be 25 days or less. The inventors unexpectedly discovered that human urine-derived cells transfected with an astrocyte induction gene are induced to develop into astrocytes in a relatively short period of time. For example, the culture period may be 25 days or less, 20 days or less, 15 days or less, 12 days or less, 10 days or less, or 7 days or less, or 4 days or more, 6 days or more, 8 days or more, or 10 days or more, and these may be freely combined, for example, 6 days or more to 25 days, 8 days or more to 20 days, or 10 days or more to 15 days, such as 10 days. According to one embodiment of the production method, astrocytes can be produced in a shorter period of time than when the method includes inducing human urine-derived cells into induced pluripotent stem cells. In one aspect, the period from the start of the introduction step to the end of the induction step may be within 25 days, within 20 days, within 15 days, within 12 days, within 10 days, or within 7 days, or may be 4 days or more, 6 days or more, 8 days or more, or 10 days or more, and these can be freely combined, for example, 6 days or more and within 25 days, 8 days or more and within 20 days, or 10 days or more and within 15 days, and one example is 12 days.
[0063] The culture conditions other than the culture period in the induction step can be those typically used by those skilled in the art. For example, the medium and culture environment in the induction step can be those typically used by those skilled in the art. For example, the medium may be the growth medium described above, a commercially available general-purpose basal medium (e.g., DMEM medium, RPMI medium) containing serum components such as fetal bovine serum (FBS) and / or antibiotics (penicillin, streptomycin, amphotericin B, etc.), or a medium to which components that may be contained in stem cell differentiation induction have been added, or a differentiation induction medium (1:1 DMEM-F12:Neurobasal, 1% N-2, 1% GlutaMAX, 1% sodium pyruvate, 5 mg / mL N-acetyl-L-cysteine, and 5 mg / mL EGF supplemented with 10 ng / mL CNTF, 10 ng / mL BMP4, and 500 mg / mL dibutyryl cAMP). As a specific example, the medium used in the introduction step may be replaced with the differentiation-inducing medium, and the cells may be further cultured for 3 to 24 days (e.g., 10 days). 2 , 37°C.
[0064] In one aspect, the method for producing astrocytes derived from human urine-derived cells according to one embodiment may further include, prior to the introduction step, sorting CD90-positive human urine-derived cells (sorting step), and introducing an astrocyte-inducing gene into the sorted CD90-positive human urine-derived cells. In this case, the human urine-derived cells are more likely to be induced into astrocytes, which tends to increase the efficiency of producing astrocytes derived from human urine-derived cells.
[0065] The cell sorting method used in the sorting step is not particularly limited as long as it allows for the isolation of CD90-positive human urine-derived cells. Examples of such methods include a method in which human urine-derived cells are contacted with an anti-CD90 antibody labeled with a fluorescent dye, and then cells exhibiting high fluorescence intensity are isolated as CD90-positive human urine-derived cells using a flow cytometer (known as a flow cytometry method). Another method includes a method in which human urine-derived cells are contacted with an anti-CD90 antibody labeled with an affinity tag such as biotin or a His tag, and then contacted with beads, columns, culture dishes, or the like whose surfaces are modified with a molecule that recognizes the affinity tag, such as streptavidin or an anti-His tag antibody, to trap CD90-positive human urine-derived cells on the surface of the beads, columns, culture dishes, or the like, and then biotin, a His tag, or a derivative thereof is added to release the CD90-positive human urine-derived cells from the surface, followed by isolation of the cells (known as an affinity tag purification method or affinity chromatography method). In a preferred embodiment, the method for sorting cells in the sorting step may be a flow cytometry method.
[0066] In these isolation methods, the conditions for contacting human urine-derived cells with a labeled anti-CD90 antibody are not particularly limited and can be those commonly used by those skilled in the art. For example, a commercially available solution of labeled anti-CD90 antibody is diluted approximately 11 to 10,001 times with phosphate buffered saline (PBS) containing 2% fetal bovine serum to prepare a solution, and human urine-derived cells are exposed to the solution and then incubated at ice-cold to room temperature for approximately 1 minute to 6 hours in the dark.
[0067] The present inventors have found that introducing an astrocyte-inducing gene into human urine-derived cells directly induces the cells to become astrocytes. That is, the astrocytes in the human urine-derived cells of one embodiment do not have to be derived from induced pluripotent stem cells. Furthermore, in a preferred embodiment, the production method of one embodiment does not require the induction of human urine-derived cells into induced pluripotent stem cells (iPS cells). This embodiment avoids resetting the epigenetic changes that occurred over the donor's aging process by inducing iPS cells. Therefore, the human urine-derived cells can be advantageously used to elucidate the pathology and evaluate drugs for brain diseases caused by epigenetic changes that occurred later in life in human subjects whose urine was collected during the preparation of the cells. Furthermore, this embodiment allows the induction of human urine-derived cells into astrocytes in a shorter time than via iPS cell induction, thereby enabling low-cost production and enabling rapid acquisition of information, particularly for use in companion diagnostics.
[0068] Astrocytes derived from human urine-derived cells according to this embodiment may have morphological characteristics similar to those of endogenous human astrocytes, such as a central cell body with multiple protrusions extending radially from it.
[0069] Astrocytes derived from human urine-derived cells according to this embodiment may have a gene expression pattern similar to that of endogenous human astrocytes. For example, the amount of mRNA and / or protein (astrocyte marker) corresponding to at least one gene selected from the group consisting of GFAP, S100B, ALDH1L1, AQP4, GLT-1, and GLAST, or all of the genes in the group, may be significantly higher than the amount of such mRNA and / or protein in human urine-derived cells. Furthermore, for example, the amount of mRNA and / or protein corresponding to at least one gene selected from the group consisting of GFAP, S100B, ALDH1L1, AQP4, GLT-1, and GLAST, or all of the genes in the group, may not be significantly or notably different from the amount of such mRNA and / or protein in primary cultured human astrocytes. The amount of such mRNA can be evaluated according to a method commonly used by those skilled in the art, for example, the amount of mRNA extracted from cells can be evaluated by quantitative PCR (qPCR) or a method using a next-generation sequencer according to a method commonly used by those skilled in the art. The amount of such protein can be evaluated according to a method commonly used by those skilled in the art, for example, the amount of protein extracted from cells can be evaluated by ELISA or Western blotting according to a method commonly used by those skilled in the art, or it can also be evaluated by fixing the cells, staining them with an immunoantibody, and measuring the fluorescence intensity using a fluorescence microscope or flow cytometer.
[0070] The astrocytes derived from human urine-derived cells according to this embodiment may have functions comparable to those of endogenous human astrocytes, i.e., the astrocytes derived from human urine-derived cells according to this embodiment may suitably reproduce the functions of endogenous human astrocytes.
[0071] For example, astrocytes derived from human urine-derived cells may have a significantly higher glutamate uptake capacity than human urine-derived cells. Furthermore, for example, astrocytes derived from human urine-derived cells may not have a significantly or significantly different glutamate uptake capacity from primary cultured human astrocytes. For example, the glutamate uptake capacity of astrocytes derived from human urine-derived cells may be 0.3-fold or more, 0.6-fold or more, 0.8-fold or more, or 0.9-fold or more, or 2.0-fold or less, 1.5-fold or less, 1.2-fold or less, or 1.1-fold or less, as compared to the glutamate uptake capacity of primary cultured human astrocytes, and these may be freely combined. The glutamate uptake capacity of such cells may be evaluated, for example, by culturing the cells in a medium containing glutamate and then measuring the degree of decrease (amount or rate of decrease) in the glutamate concentration in the culture supernatant.
[0072] Furthermore, for example, the expression levels of CXCL10, CXCL8, CCL5, and / or complement C3 in astrocytes derived from human urine-derived cells after exposure to IL-1β, TNFα, or complement C1q may be significantly higher than those in human urine-derived cells, but may not be significantly or markedly different from those in primary cultured human astrocytes. For example, the expression levels of CXCL10, CXCL8, CCL5, and / or complement C3 in astrocytes derived from human urine-derived cells after exposure to IL-1β, TNFα, or complement C1q may be 0.3-fold or more, 0.6-fold or more, 0.8-fold or more, or 0.9-fold or more, or 2.0-fold or less, 1.5-fold or less, 1.2-fold or less, or 1.1-fold or less, relative to the expression levels in primary cultured human astrocytes under the same conditions, and these may be freely combined. Expression levels of CXCL10, CXCL8, CCL5 and / or complement C3 can be assessed similarly to the assessment of mRNA and protein levels described above for astrocyte markers.
[0073] Furthermore, for example, astrocytes derived from human urine-derived cells may have a significantly higher calcium concentration and / or calcium oscillation frequency after exposure to ATP than human urine-derived cells, without any significant or noticeable difference from primary cultured human astrocytes. For example, the calcium concentration and / or calcium oscillation frequency of astrocytes derived from human urine-derived cells after exposure to ATP may be at least 0.3-fold, at least 0.6-fold, at least 0.8-fold, or at least 0.9-fold higher than the concentration and / or frequency of primary cultured human astrocytes under the same conditions, or may be at most 2.0-fold, at most 1.5-fold, at most 1.2-fold, or at most 1.1-fold higher, and these may be freely combined. Calcium concentration in cells can be assessed, for example, by labeling with a fluorescent dye (e.g., Fluo4-AM) that reversibly and in real time visualizes cellular calcium concentration and measuring its fluorescence intensity using a fluorescence microscope or the like. Furthermore, the frequency of calcium oscillations can be assessed using the number of transient increases in fluorescence intensity per unit time as an indicator during time-lapse observation.
[0074] Because harvesting astrocytes from the human brain is highly invasive, it is limited to cases such as brain biopsies when the subject's findings are deemed beneficial in diagnosing brain diseases. In contrast, astrocytes derived from human urine-derived cells according to this embodiment can be prepared from human urine, which can be collected non-invasively, and are therefore useful as test cells to replace primary human astrocytes in elucidating the pathology of cranial nerve diseases. Astrocytes derived from human urine-derived cells are also suitable for elucidating the pathology of cranial nerve diseases due to the cost and avoidance of resetting epigenetic changes, as described above.
[0075] Furthermore, because they can be obtained non-invasively and thus mass-produced, astrocytes derived from human urine-derived cells according to this embodiment are useful for evaluating and screening drugs for the treatment and / or prevention of cranial nerve diseases. Astrocytes derived from human urine-derived cells are also suitable for use in evaluating and screening drugs for the treatment and / or prevention of cranial nerve diseases, both in terms of cost and the ability to avoid resetting epigenetic changes, as described above.
[0076] Furthermore, from the viewpoint of non-invasive acquisition, astrocytes derived from human urine-derived cells according to the present embodiment are useful for companion diagnostics in human subjects. For example, by preparing astrocytes derived from human urine-derived cells from urine collected from patients with cranial nerve diseases and evaluating their gene expression, function, etc., it may be possible to obtain indicators for determining treatment strategies. Furthermore, by preparing astrocytes derived from human urine-derived cells from urine collected from healthy individuals and evaluating their gene expression, function, etc., it may be possible to obtain indicators for determining the risk of developing cranial nerve diseases in the future. Because astrocytes derived from human urine-derived cells can be prepared in a short period of time, as described above, they are suitable for companion diagnostics (particularly for patients with cranial nerve diseases).
[0077] The present disclosure will be described in more detail below using examples, but the present disclosure is not limited to the following examples.
[0078] Preparation Example 1: Establishment of Human Urine-Derived Cells Step 1: Urine Collection 20,000 units of penicillin, 20,000 μg of streptomycin (Thermo Fisher Scientific, Waltham, MA; 15140-122), and 0.2 μg of amphotericin B (Sigma, St. Louis, USA; A2942) were added to a sterilized plastic bottle (Corning Incorporated, NY, USA; 430281). Urine was collected by having a human subject urinate into the bottle. In this manner, 25 to 250 mL of urine was collected per bottle.
[0079] [Step 2: Concentration of Urine] The human urine collected in Step 1 was dispensed into multiple 50 mL conical tubes. The tubes were centrifuged at 400 × g for 10 minutes at room temperature, and the supernatant was removed so that only 3 mL remained. 3 mL of washing solution (Ca 2+ and Mg 2+A 50 mL PBS solution containing 1% penicillin / streptomycin (Thermo Fisher Scientific, Waltham, MA; 15140-122) and 0.5 μg / mL amphotericin B (Sigma, St. Louis, USA; A2942) was added. The mixtures from the tubes were pooled into a single 50 mL conical tube. The tubes were centrifuged at 200 × g for 10 minutes at room temperature, and only 3 mL of supernatant was removed.
[0080] [Step 3: Preparation of a mixture for cryopreservation and cryopreservation] A mixture for cryopreservation was obtained by adding 3 mL of CELLBANKER (registered trademark) 1 (Takara Bio, CB011) to the tube after centrifugation in step 2. The obtained mixture for cryopreservation was placed in a deep freezer at −80° C. and stored in a frozen state for one year or more.
[0081] [Step 4: Establishment of human urine-derived cells from the cryopreservation mixture] The cryopreservation mixture frozen in step 3 was left to stand at room temperature until thawed. The thawed cryopreservation mixture was centrifuged at 200 × g for 5 minutes at room temperature, and only 3 mL of the supernatant was removed. Six mL of initial medium (a mixture of equal volumes of high-glucose DMEM (GE Healthcare, Logan, UT; SH30022.FS) and Ham's F-12 Nutrient Mix (Thermo Fisher Scientific; 11765-054) supplemented with REGM SingleQuots (Lonza, Basel, Switzerland; CC-4127), tetracycline-free 10% fetal bovine serum (Clontech; 631106), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) was added to obtain a cell suspension. From the obtained cell suspension, a fraction with an FSC (forward scattering) value of 300,000 or less was collected using a flow cytometer (SONY, Cell Sorter SH800), thereby separating cells with a diameter of 10 μm or less from the cells contained in the cell suspension. The collected fraction was centrifuged to precipitate the cells, and the pellet was resuspended in 9 mL of initial medium to obtain a cell suspension for culture. The obtained cell suspension for culture was added to a gelatin-coated 6-well plate (IWAKI, Shizuoka, Japan; 4810-020) at 1.5 mL per well and incubated at 5% CO 2The cells were cultured in an incubator at 37°C. 1.5 mL of initial medium was added every day, and on the fourth day of culture, 2 mL of growth medium (REGM Bullet Kit (Lonza; CC-3190) was mixed with equal volumes of high-glucose DMEM, supplemented with tetracycline-free 15% fetal bovine serum, 0.5% Glutamax (Thermo Fisher Scientific; 35050-061), 0.5% non-essential amino acids (Thermo Fisher Scientific; 11140-050), 2.5 ng / mL fibroblast growth factor-basic (bFGF) (Sigma, St Louis, USA; F0291), PDGF-AB (Peprotech, Rocky Hill, NJ; 100-00AB), EGF (Peprotech; AF-100-15), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) was added. The medium was replaced with amphotericin B / gentamicin (excluding amphotericin B / gentamicin from the Bullet Kit). The human urine-derived cells formed colonies within a few days to about two weeks after the start of culture. Through the above procedures, human urine-derived cells were established.
[0082] Preparation Example 2: Design and Obtaining of SOX9 / NFIB Transfer Vector An adenovirus vector (SOX9 / NFIB transfer vector) for transferring SOX9 and NFIB into human urine-derived cells was designed, and synthesis was outsourced to VectorBuilder. Figure 1 shows a vector map of the SOX9 / NFIB transfer vector. As shown in Figure 1, the SOX9 / NFIB transfer vector incorporates, as the SOX9 gene, DNA of a sequence (SEQ ID NO: 106) corresponding to the coding region of mRNA encoding human SOX9 protein, and, as the NFIB gene, a sequence (SEQ ID NO: 107) corresponding to the coding region of mRNA encoding human NFIB protein.
[0083] Example 1: Introduction of SOX9 and NFIB into human urine-derived cells The SOX9 / NFIB introduction vector was added to a concentration of 30 μg / mL to the growth medium for culturing the human urine-derived cells prepared in Preparation Example 1. The human urine-derived cells were cultured in the medium for 2 days.
[0084] The gene expression levels of SOX9 and NFIB in human urine-derived cells after 2 days of culture were evaluated by qPCR. Specifically, RNA was extracted from human urine-derived cells after 2 days of culture (Post) or from human urine-derived cells before culture in a medium containing the SOX9 / NFIB transfection vector (Pre) using an RNeasy Plus Kit (QIAGEN 74134) according to the protocol enclosed with the kit. The expression levels of mRNA encoding SOX9, NFIB, or GAPDH proteins were then quantified using commercially available qPCR reagents (GoTaq qPCR Master Mix (Promega) and the primers shown below (Eurofins Genomics)).
[0085] Primers for SOX9 mRNA Forward primer: AGGAAGCTCGCGGACCAGTAC (SEQ ID NO: 108) Reverse primer: GGTGGTCCTTCTTGTGCTGCAC (SEQ ID NO: 109) Primers for NFIB mRNA Forward primer: GGAACCAAGTCCTACAGGAGAC (SEQ ID NO: 110) Reverse primer: GAATCCTGTGGAGATGCAGAGC (SEQ ID NO: 111) Primers for GAPDH mRNA Forward primer: ACCACAGTCCATGCCATCAC (SEQ ID NO: 112) Reverse primer: CCACCACCCTGTTGCTGTAG (SEQ ID NO: 113)
[0086] Figure 2(A) shows the expression levels of SOX9 mRNA before and after incubation with the SOX9 / NFIB introduction vector, normalized by the expression level of GAPDH mRNA, and expressed as relative values with the expression level of the control group set to 1. Figure 2(B) shows the expression levels of NFIB mRNA before and after incubation with the SOX9 / NFIB introduction vector, normalized by the expression level of GAPDH mRNA, and expressed as relative values with the expression level of the control group set to 1. The results in Figures 2(A) and 2(B) are shown as mean ± standard deviation (Mean ± S.D.), and **** indicates a P value of less than 0.0001 in Student's t-test. Figures 2(A) and 2(B) confirmed that SOX9 and NFIB were introduced into human urine-derived cells by incubation with the SOX9 / NFIB introduction vector.
[0087] Example 2: Preparation of astrocytes derived from human urine-derived cells and evaluation of astrocyte marker expression As in Example 1, human urine-derived cells were cultured for 2 days in a growth medium supplemented with the SOX9 / NFIB transfer vector, and then the medium was changed to a differentiation-inducing medium (1:1 DMEM-F12:Neurobasal, 1% N-2, 1% GlutaMAX, 1% sodium pyruvate, 5 mg / mL N-acetyl-L-cysteine, and 5 mg / mL EGF supplemented with 10 ng / mL CNTF, 10 ng / mL BMP4, and 500 μg / mL dibutyryl cAMP; that is, a 1:1 volumetric mixture of DMEM-F12 medium (Thermo Fisher, 11320033) and Neurobasal® medium (Thermo Fisher, 21103049), 1% by volume of N-2, and 500 μg / mL dibutyryl cAMP). The medium was replaced with 10 ng / mL ciliary neurotrophic factor (CNTF, Sigma, C3710), 10 ng / mL bone morphogenetic protein 4 (BMP4, Peprotec, AF-120-05ET), and 500 μg / mL dibutyl-cAMP (Sigma, D0627) supplemented with 10 ng / mL Supplement (Thermo Fisher Scientific, 17502048), 1% by volume sodium pyruvate (Gibco, 11360070), 5 mg / mL N-acetyl-L-cysteine (Sigma, A7250), and 5 mg / mL epidermal growth factor (EGF, Sigma, E4127), and then cultured for an additional 10 days to induce direct reprogramming of human urine-derived cells into astrocytes.
[0088] The expression of astrocyte markers was evaluated for the astrocytes derived from human urine-derived cells prepared in this manner. First, genes were recovered from astrocytes derived from human urine-derived cells or from human urine-derived cells as a control according to the same method as in Example 1. Then, the expression levels of mRNA encoding the astrocyte markers GFAP (Glial Fibrillary Acidic Protein), S100β (S100 Calcium Binding Protein B), EAAT1 (Excitatory Amino Acid Transporter 1, also known as SLC1A3), EAAT2 (Excitatory Amino Acid Transporter 2, also known as SLC1A2), and AQP4 (Aquaporin 4), as well as GAPDH, were quantified using commercially available qPCR reagents (GoTaq qPCR Master Mix (Promega) and the primers with the sequences shown below (Eurofins Genomics)).
[0089] Primer for GFAP mRNA Forward primer: CTGGAGAGGAAGATTGAGTCGC (SEQ ID NO: 114) Reverse primer: ACGTCAAGCTCCACATGGACCT (SEQ ID NO: 115) Primer for S100β mRNA Forward primer: GAAGAAATCCGAACTGAAGGAGC (SEQ ID NO: 116) Reverse primer: TCCTGGAAGTCACATTCGCCGT (SEQ ID NO: 117) Primer for EAAT1 mRNA Forward primer: GGTTGCTGCAAGCACTCATCAC (SEQ ID NO: 118) Reverse primer: CACGCCATTGTTCTCTTCCAGG (SEQ ID NO: 119) Primer for EAAT2 mRNA Forward primer: TGCCAACAGAGGACATCAGCCT (SEQ ID NO: 120) Reverse primer: CAGCTCAGACTTGGAGAGGTGA (SEQ ID NO: 121) Primer for AQP4 mRNA Forward primer: GCCATCATTGGAGCAGGAATCC (SEQ ID NO: 122) Reverse primer: ACTCAACCAGGAGACCATGACC (SEQ ID NO: 123) Primer for GAPDH mRNA Forward primer: ACCACAGTCCATGCCATCAC (SEQ ID NO: 112) Reverse primer: CCACCACCCTGTTGCTGTAG (SEQ ID NO: 113)
[0090] Figure 3 shows the expression levels of GFAP mRNA, S100β mRNA, EAAT1 mRNA, EAAT2 mRNA, and AQP4 mRNA in human urine-derived cells (Undiff) and astrocytes derived from human urine-derived cells (Day 10). The expression levels were normalized by the expression level of GAPDH mRNA and expressed as relative values, with the expression level of the control group set at 1. The results in Figure 3 are shown as mean ± standard deviation (Mean ± S.D.), and *** and *** indicate P values of less than 0.001 and less than 0.0001, respectively, in Student's t-test. Figure 3 shows that the mRNA expression levels of all five astrocyte markers in astrocytes derived from human urine-derived cells were significantly higher than in human urine-derived cells.
[0091] Furthermore, the expression levels of the astrocyte markers GFAP and AQP4 were assessed by immunofluorescence staining. Human urine-derived astrocytes were washed with PBS, fixed with 4% paraformaldehyde, and incubated with 0.1% Triton-X at room temperature for 10 minutes. For GFAP immunofluorescence staining, the primary antibody used was GFAP Polyclonal Antibody (Bioss, bs-0199R), and the secondary antibody was Alexa Fluor 488 goat anti-rabbit IgG (H+L) (1:300, Invitrogen; A32731). For AQP4 immunofluorescence staining, the primary antibody was Anti-Aquaporin 4 (AQP4) (249-323) Antibody (Alomone Labs, AQP-004), and the secondary antibody was Alexa Fluor 546 goat anti-rabbit IgG (H+L) (1:300, Invitrogen; A11035). DAPI was used for nuclear staining. Stained cells were imaged using a fluorescence microscope (BZ-9000 or BZ-X800, KEYENCE, Osaka, Japan), and the images were analyzed using a BZ-X Analyzer (KEYENCE). Figure 4 (A) shows a fluorescent image of astrocytes derived from human urine-derived cells immunofluorescently stained for GFAP. Figure 4(B) shows fluorescent images of astrocytes derived from human urine-derived cells, immunofluorescently stained for AQP4. The scale bars in Figures 4(A) and 4(B) represent 100 μm. The results in Figures 4(A) and 4(B) show that astrocytes derived from human urine-derived cells expressed astrocyte markers not only at the mRNA level but also at the protein level. These results confirmed that human urine-derived cells were indeed induced into astrocytes.
[0092] Furthermore, the fluorescent images in Figures 4(A) and (B) show that the astrocytes derived from human urine-derived cells exhibited a stellate morphology, which is typical of astrocytes. This confirmed that the astrocytes derived from human urine-derived cells were indeed induced into astrocytes, not only based on gene and protein expression but also on cell morphology.
[0093] Example 3: Evaluation of glutamate uptake in astrocytes derived from human urine-derived cells. Astrocytes are known to have a high glutamate uptake capacity. Therefore, glutamate uptake capacity is widely used as an index for evaluating the astrocytic function of cells. Therefore, the glutamate uptake capacity of astrocytes derived from human urine-derived cells was evaluated.
[0094] In this example, the cells tested were human urine-derived astrocytes (UDC-Astrocytes) prepared in the same manner as in Example 2, as well as human urine-derived cells (UDCs) prepared in Preparation Example 1 as a negative control, and commercially available human primary cultured astrocytes (Human Astrocytes, ScienCell, catalog number: 1800) as a positive control.
[0095] 5 × 10 cells on a 24-well plate coated with iMatrix 511 (Nippi) 5 The culture supernatant of cells cultured at a density of 1000 cells / well was removed, and 500 μL of PBS containing 125 μM glutamate (Sigma-Aldrich) was added and incubated for 30 minutes. After incubation, the supernatant PBS was collected, and the concentration of glutamate contained in the PBS (i.e., not taken up by the cells) was measured using a Fluorometric kit (Abcam, ab138883) according to the prescribed protocol, using absorbance measured with a microwell plate reader as an index. The amount of glutamate taken up by the cells was evaluated by subtracting the measured glutamate concentration from the concentration before uptake (125 μM).
[0096] Figure 5 shows the amount of glutamate uptake in human urine-derived cells, astrocytes derived from human urine-derived cells, and primary human astrocytes. The results in Figure 5 are shown as mean ± standard deviation (Mean ± S.D.), with ns and **** indicating P values of 0.05 or greater and less than 0.0001, respectively, in the Student's T-test. The results in Figure 5 demonstrate that astrocytes derived from human urine-derived cells had significantly higher glutamate uptake capacity than human urine-derived cells, demonstrating that the human urine-derived cells were functionally induced into astrocytes.
[0097] Unexpectedly, the amount of glutamate uptake by astrocytes derived from human urine-derived cells was not significantly different from that of primary human astrocytes. This indicates that astrocytes derived from human urine-derived cells have a glutamate uptake capacity comparable to that of primary human astrocytes. These findings demonstrate that astrocytes derived from human urine-derived cells are functionally comparable to primary human astrocytes and effectively recapitulate the functions of primary human astrocytes.
[0098] Example 4: Evaluation of the response of astrocytes derived from human urine-derived cells to TNFα stimulation. Astrocytes are known to respond to the cytokine TNFα (Tumor Necrosis Factor alpha) by increasing the expression levels of the cytokines IL6 (interleukin 6) and CXCL10 (CXC Motif Chemokine Ligand 10). Therefore, the expression levels of IL6 and CXCL10 after exposure to TNFα are widely used as indicators for evaluating the astrocytic function of cells. Therefore, the expression levels of IL6 and CXCL10 after exposure of astrocytes derived from human urine-derived cells to TNFα were evaluated.
[0099] Astrocytes derived from human urine-derived cells (Post) prepared according to the same method as in Example 2, or human urine-derived cells (Pre) as a control, were cultured in a differentiation-inducing medium containing the supernatant. 30 ng / mL TNFα (R&D, 410-MT-025) was added and the cells were incubated for 24 hours. After incubation, genes were recovered from the cells, and the expression levels of mRNA encoding IL6, CXCL10, and GAPDH were quantified using commercially available qPCR reagents (GoTaq qPCR Master Mix (Promega) and the primers with the sequences shown below (Eurofins Genomics)).
[0100] Primers for IL6 mRNA Forward primer: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 124) Reverse primer: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 125) Primers for CXCL10 mRNA Forward primer: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO: 126) Reverse primer: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO: 127) Primers for GAPDH mRNA Forward primer: ACCACAGTCCATGCCATCAC (SEQ ID NO: 112) Reverse primer: CCACCACCCTGTTGCTGTAG (SEQ ID NO: 113)
[0101] Figure 6 (A) shows the IL6 mRNA expression levels before and after direct astrocyte induction, normalized by the GAPDH mRNA expression level, relative to the control group, where the expression level was set to 1. Figure 6 (B) shows the CXCL10 mRNA expression levels before and after direct astrocyte induction, normalized by the GAPDH mRNA expression level, relative to the control group, where the expression level was set to 1. The results in Figures 6 (A) and (B) are shown as mean ± standard deviation (Mean ± S.D.), and **** indicates a P value of less than 0.0001 in Student's t-test. Figures 6 (A) and (B) show that astrocytes derived from human urine-derived cells showed significant increases in IL6 and CXCL10 expression levels after TNFα stimulation. This further demonstrates the functional induction of human urine-derived cells into astrocytes.
[0102] Example 5: Evaluation of ATP-stimulated calcium oscillations in astrocytes derived from human urine-derived cells. It is known that calcium signaling in astrocytes is activated by ATP stimulation, resulting in an increase in calcium concentration and a temporary increase in calcium concentration (oscillation). Therefore, calcium concentration upon ATP stimulation is widely used as an index for evaluating the astrocytic function of cells. Therefore, we evaluated whether ATP stimulation of astrocytes derived from human urine-derived cells would result in an increase in calcium concentration and calcium oscillations.
[0103] As in Example 3, human urine-derived cells, astrocytes derived from human urine-derived cells, and primary human astrocytes were used. 2 μM Fluo4-AM (DOJINDO, F312) was added to the culture medium for these cells seeded in an imaging dish and incubated for 30 minutes. After incubation, the imaging dish was placed under a fluorescence microscope, 100 μM ATP was added to the medium, and time-lapse imaging of the cells was performed. Fluo4-AM is a reagent for imaging intracellular calcium concentrations. Fluo4-AM becomes the cell membrane-impermeable dye Fluo4 within cells. Fluo4 reversibly binds to calcium ions as calcium ion concentrations increase, increasing its fluorescence intensity. However, as calcium ion concentrations decrease, calcium ions are released from the complex, decreasing the fluorescence intensity. This allows for reversible and real-time visualization of intracellular calcium ion concentrations.
[0104] Figure 7 (A) shows fluorescence images of Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes, taken 10 seconds after the addition of ATP. Figure 7 (B) shows the fluorescence intensity of each cell in fluorescence images of Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes, taken 10 seconds after the addition of ATP. Figure 7 (C) shows the percentage (%) of Fluo4-AM-stained human urine-derived cells, astrocytes derived from human urine-derived cells, and primary cultured human astrocytes that exhibited calcium oscillations between 10 and 300 seconds after the addition of ATP. The results in Figures 7(B) and (C) are shown as mean ± standard deviation (Mean ± S.D.), with ns, *, and **** indicating P values of 0.05 or greater, less than 0.05, and less than 0.0001, respectively, in the Student's T-test. The results in Figures 7(A) to 7(C) show that astrocytes derived from human urine-derived cells had significantly higher calcium concentrations and a higher percentage of cells exhibiting calcium oscillations after stimulation with ATP than human urine-derived cells. This further demonstrates the functional induction of human urine-derived cells into astrocytes.
[0105] Unexpectedly, the calcium concentration of astrocytes derived from human urine-derived cells after ATP stimulation was not significantly different from that of primary cultured human astrocytes. Furthermore, the percentage of astrocytes derived from human urine-derived cells that exhibited calcium oscillations after ATP stimulation was not significantly different from that of primary cultured human astrocytes after ATP stimulation. That is, astrocytes derived from human urine-derived cells exhibited calcium ion responses after ATP stimulation comparable to those of primary cultured human astrocytes. These findings further demonstrate that astrocytes derived from human urine-derived cells are functionally comparable to primary cultured human astrocytes and effectively recapitulate primary cultured human astrocytes.
[0106] Example 6: Efficiency of Astrocyte Differentiation Induction in CD90-Positive or -Negative Cells. Human urine-derived cells prepared in Preparation Example 1 were detached from the culture dish by exposure to trypsin-EDTA solution and then suspended in growth medium. The resulting cell suspension was centrifuged at 350 × g for 5 minutes, the supernatant removed, and the cells resuspended in phosphate buffered saline (PBS) containing 2% fetal bovine serum. A solution of fluorescently labeled anti-CD90 antibody (FITC anti-human CD90 (Thy1) Antibody, BioLegend; 328107) was added to the suspension at a volume ratio of 1:200 and incubated on ice in the dark for 30 minutes. The suspension of human urine-derived cells labeled with fluorescently labeled anti-CD90 antibody was centrifuged at 350 × g for 5 minutes, the supernatant removed, and the cells were resuspended in phosphate buffered saline (PBS) containing 2% fetal bovine serum. The cells were then filtered through a 70 μm filter (Falcon). The resulting labeled human urine-derived cells were sorted into CD90-positive and CD90-negative populations using a flow cytometer (SONY FACS SH800S (Sony Biotechnology, San Jose, CA, USA)) based on the fluorescence intensity of the dye (FITC) modified on the anti-CD90 antibody. Data acquired by the flow cytometer were analyzed using Cell Sorter Software (Sony).
[0107] The sorted CD90-negative or CD90-positive human urine-derived cells were subjected to astrocyte induction in the same manner as in Examples 1 and 2. After gene transfer, the cells were cultured for 14 days.
[0108] Cells obtained by induction of CD90-positive or CD90-negative human urine-derived cells were fixed, immunofluorescently stained for GFAP, nuclear stained, and fluorescent images were obtained using the same methods as in Example 2. Figure 8 shows fluorescent images of cells obtained by induction of CD90-positive or CD90-negative human urine-derived cells immunofluorescently stained for GFAP. Figure 9 shows the percentage (%) of cells in which fluorescence derived from GFAP-labeled antibodies was detected in fluorescent images obtained under the same conditions as in Figure 8. The results in Figure 9 are shown as mean ± standard deviation (Mean ± S.D.), and **** indicates a P value of less than 0.0001 in Student's t-test. Figures 8 and 9 show that the percentage of cells in which fluorescence derived from GFAP-labeled antibodies was detected was greater in cells obtained by induction of CD90-positive human urine-derived cells than in cells obtained by induction of CD90-negative human urine-derived cells.
[0109] In addition, GFAP expression levels in CD90-positive or CD90-negative human urine-derived cells were evaluated by Western blotting. Western blotting was performed according to the following protocol. Cells in the induced cell population were lysed using RIPA buffer (Thermo Fisher Scientific; 89900) containing protease inhibitors (Roche, Indianapolis, IN, USA; 04693116001). The supernatant was collected by centrifugation at 14,000 × g for 15 minutes at 4°C. The total protein concentration in the supernatant was measured using a BCA protein assay kit (Thermo Fisher Scientific; 23227), and the supernatant proteins were denatured with NuPAGE® LDS Sample Buffer (Thermo Fisher Scientific; NP0007). Proteins were then run on NuPAGE® Novex Tris-Acetate Gel 3-8% (Invitrogen; EA03785BOX) by SDS-PAGE. Proteins on the gel were transferred to a PVDF membrane (Millipore, Billerica, MA, USA; IPVH304F0). Primary antibodies used were rabbit anti-GFAP antibody (1:200; Bioss, bs-0199R) and rabbit anti-vinculin antibody (1:1000, Abcam; ab91459), and secondary antibodies were anti-rabbit horseradish peroxidase-conjugated secondary antibodies (1:50000, Cell Signaling Technology). After the antibody reaction, the target bands were detected using ECL Prime Western Blotting Detection Reagent (GE Healthcare, UK; RPN2232). Figure 10 shows the results of Western blotting analysis of the expression levels of GFAP, SOX9, and vinculin in cells obtained by inducing CD90-negative (CD90-) or CD90-positive (CD90+) human urine-derived cells.Figure 11 shows the results of normalizing the GFAP band intensity with that of vinculin in Figure 10 . Bands were detected using a ChemiDoc MP imaging system (Bio-Rad, Hercules, CA, USA), and then quantified using Image Lab software (Bio-Rad). The results in Figure 11 are shown as mean ± standard deviation (Mean ± S.D.), and ** indicates a P value of less than 0.01 in Student's t-test. Figures 10 and 11 show that cells derived from CD90-positive human urine-derived cells express higher amounts of GFAP than cells derived from CD90-negative human urine-derived cells.
[0110] The results in Figures 8, 9, 10, and 11 show that CD90-positive human urine-derived cells highly expressed astrocyte markers after induction into astrocytes, demonstrating that CD90-positive human urine-derived cells have a high astrocyte induction efficiency among human urine-derived cells.
Claims
1. Astrocytes derived from human urine-derived cells into which at least one gene selected from the group consisting of SOX9, NFIA, NFIB and ZBTB20 has been introduced.
2. The astrocyte of claim 1, wherein the at least one gene includes SOX9 and NFIA or NFIB.
3. The astrocyte of claim 1, wherein the at least one gene includes SOX9 and NFIB.
4. The astrocyte according to any one of claims 1 to 3, which is not derived from induced pluripotent stem cells.
5. The astrocytes described in any one of claims 1 to 3, wherein the human urine-derived cells are CD90-positive.
6. A method for producing astrocytes, comprising introducing at least one gene selected from the group consisting of SOX9, NFIA, NFIB and ZBTB20 into human urine-derived cells.
7. The method of claim 6, wherein the at least one gene includes SOX9 and NFIA or NFIB.
8. The method of claim 6, wherein the at least one gene comprises SOX9 and NFIB.
9. The method of any one of claims 6 to 8, which does not include inducing the human urine-derived cells into induced pluripotent stem cells.
10. The method of any one of claims 6 to 8, wherein the human urine-derived cells are CD90-positive.
11. The production method according to any one of claims 6 to 8, further comprising sorting CD90-positive human urine-derived cells, wherein the at least one gene is introduced into the sorted CD90-positive human urine-derived cells.
12. The method of any one of claims 6 to 8, further comprising culturing the human urine-derived cells into which the at least one gene has been introduced for a period of 25 days or less to induce the cells to develop into astrocytes.
Citation Information
Patent Citations
Urine-derived progenitor cells and their use
JP2010527605A