Pharmaceutical composition for preventing or treating degenerative brain diseases comprising induced pluripotent stem cell-derived mitochondria

Abstract

One aspect relates to a composition for preventing or treating degenerative brain diseases comprising induced pluripotent stem cell-derived mitochondria. According to one aspect, the mitochondria derived from induced pluripotent stem cells were confirmed to exhibit excellent effects in removing reactive oxygen species and in reducing expression of inflammatory cytokines, thereby providing anti-inflammatory effects superior to those of mitochondria derived from other cells. When the mitochondria are treated to damaged nerve cells, recovery and regeneration effects can be confirmed on nerve cells, and as a result of administering the mitochondria to elderly mice, it was also confirmed that the mitochondria have an anti-aging effect. Accordingly, the pharmaceutical composition comprising induced pluripotent stem cell-derived mitochondria according to one aspect of the present invention can be applied in various fields for the prevention or treatment of degenerative brain diseases, particularly bone diseases caused by aging or beta amyloid aggregation.

Description

Pharmaceutical composition for preventing or treating degenerative brain diseases containing mitochondria derived from induced pluripotent stem cells

[0001] The present invention relates to a pharmaceutical composition for preventing or treating degenerative brain diseases, comprising mitochondria derived from induced pluripotent stem cells.

[0002]

[0003] Alzheimer's disease is a degenerative brain disease that is the leading cause of dementia. It is a disease that gradually presents with memory problems in the early stages and later affects cognitive function and judgment, ultimately making daily life impossible. The most notable features found in the patient's brain tissue are neurotic plaques and neurofibrillary tangles, and overall brain atrophy is confirmed as nerve cells are destroyed.

[0004] The cause of Alzheimer's disease remains unclear, but the leading hypothesis is that it develops when the APP protein is cleaved by a specific enzyme, resulting in excessive deposition of beta-amyloid, a protein that causes toxicity in neurons. However, other causes are also believed to be involved, including hyperphosphorylation of the tau protein, which plays a crucial role in maintaining the brain cell framework, oxidative stress, or neuronal damage due to inflammation.

[0005] Mitochondria are organelles that play a central role in cellular respiration. They are known to synthesize ATP, the cellular energy source, by consuming oxygen along with pyruvate, a byproduct of glycolysis. Therefore, if mitochondrial function is abnormal, ATP synthesis cannot proceed properly, causing cellular damage and even cell death. Therefore, among various organs in the body, organs such as the brain, nerves, and muscles, which consume large amounts of energy, are particularly vulnerable to mitochondrial dysfunction.

[0006] There are research results that show that the deposition of beta-amyloid in nerve cells also affects the function of mitochondria, and when beta-amyloid is deposited in cells, the function of the VDAC channel in mitochondria becomes abnormal, resulting in an increase in Ca in mitochondria. 2+ It is known that problems occur in maintaining flux. In addition, there are research results showing that it directly affects the activity of Complex I, II, and IV, which are enzymes involved in oxidative phosphorylation inside mitochondria. Therefore, mitochondrial dysfunction due to various mechanisms results in the consumption of oxygen through abnormal cellular respiration, which generates ROS, and this ultimately leads to the destruction of the cell.

[0007]

[0008] One aspect is to provide a pharmaceutical composition for preventing or treating a degenerative brain disease, comprising mitochondria derived from induced pluripotent stem cells (iPSCs).

[0009] Another aspect is to provide a health functional food for preventing or improving degenerative brain diseases containing mitochondria derived from induced pluripotent stem cells (iPSC).

[0010] Another aspect provides a method for preventing or treating a degenerative brain disease, comprising administering mitochondria derived from induced pluripotent stem cells (iPSCs) to a subject in need thereof.

[0011] Another aspect provides the use of induced pluripotent stem cells (iPSC)-derived mitochondria for the manufacture of drugs for the prevention or treatment of degenerative brain diseases.

[0012]

[0013] One aspect provides a pharmaceutical composition for preventing or treating a degenerative brain disease, comprising mitochondria derived from induced pluripotent stem cells (iPSCs).

[0014] The above term "stem cell" refers to an undifferentiated cell that has the ability to self-replicate and differentiate into two or more different types of cells.

[0015] The above "induced pluripotent stem cells (iPSC)" refers to cells that are induced to have pluripotent differentiation capacity through an artificial dedifferentiation process from differentiated cells, and are also called induced stem cells. The artificial dedifferentiation process is performed by using viral-mediated or non-viral vectors using retrovirus, lentivirus, and Sendai virus, non-viral-mediated introduction of differentiation factors using proteins and cell extracts, etc., or includes the dedifferentiation process using stem cell extracts, compounds, etc. Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically, they show a similar cell shape, have similar gene and protein expression patterns, have pluripotency in vitro and in vivo, form teratomas, form chimera mice when inserted into a mouse blastocyst, and are capable of germline transmission of genes.

[0016] Induced pluripotent stem cells include induced pluripotent stem cells derived from any species, such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rats, or rabbits, but specifically, they may be induced pluripotent stem cells derived from humans.

[0017] The somatic cells before the above-mentioned induced pluripotent stem cells are dedifferentiated may be somatic cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, amniotic fluid, or placenta. Specifically, the somatic cells may be at least one selected from the group consisting of peripheral blood mononuclear cells (PBMCs), fibroblasts, hepatocytes, adipocytes, epithelial cells, epidermal cells, chondrocytes, muscle cells, cardiac muscle cells, melanocytes, neural cells, glial cells, astrocytes, monocytes, and macrophages, and more specifically, may be peripheral blood mononuclear cells (PBMCs).

[0018] The above-mentioned induced pluripotent stem cells can express at least one selected from the group consisting of NANOG, OCT4, SOX2, LIN28, KLF5, TRA-1-60 and SSEA4, and specifically, can express all of NANOG, OCT4, SOX2, LIN28, KLF5, TRA-1-60 and SSEA4.

[0019] The above-mentioned induced pluripotent stem cells may not express one or more selected from the group consisting of PAX6, BRACHYURY, SOX17 and CD34, and specifically may not express all of PAX6, BRACHYURY, SOX17 and CD34.

[0020] In one reference example, the expression of five genes, NANOG, OCT4, SOX2, LIN28, and KLF5, to determine whether peripheral blood mononuclear cell-derived induced pluripotent stem cells have stem cell characteristics, and the expression of three genes, PAX6, BRACHYURY, and SOX17, to determine whether peripheral blood mononuclear cell-derived induced pluripotent stem cells have germ layer cell characteristics, were analyzed using real-time PCR. As a result of the analysis, it was confirmed that peripheral blood mononuclear cell-derived induced pluripotent stem cells expressed NANOG, OCT4, SOX2, LIN28, and KLF5 at high levels, and that PAX6, BRACHYURY, and SOX17 were hardly expressed. In other words, it was confirmed that the stem cell characteristics were fully maintained by expressing pluripotency markers without differentiating into three germ layer cells. In addition, protein analysis results showed that the cells did not express CD34 protein, a marker of PBMC, at all, and that more than 95% of the cells expressed TRA-1-60, NANOG, SSEA4, and OCT4, which are pluripotent markers. In other words, it was confirmed that the characteristics of induced pluripotent stem cells were fully maintained, not the characteristics of PBMC, the source cell of induced pluripotent stem cells (see Reference Example 1-1).

[0021] In another reference example, AP staining (Alkaline Phosphatase Staining) was performed to confirm the pluripotency of induced pluripotent stem cells derived from peripheral blood mononuclear cells, and differentiation experiments into three germ layers were performed. As a result of the experiment, it was confirmed that all cell populations had stem cell potential, and after differentiation into three germ layer cells, it was confirmed that genes corresponding to markers of endoderm, mesoderm, and ectoderm cells, SOX16, BRACHYURI, and PAX6, were expressed, confirming that there was no abnormality in the differentiation potential of the induced pluripotent stem cells (see Reference Example 1-2).

[0022] The aforementioned "mitochondrion" is an essential organelle for the survival of all eukaryotic cells, involved in the synthesis and regulation of adenosine triphosphate (ATP) as an energy source. Various functions within cells are regulated by mitochondria, including cell signaling, the cell cycle, cell differentiation, and cell growth, as well as the control of apoptosis. Mitochondria constantly communicate with surrounding cellular organelles and actively change their shape. During this process, they can self-fiss into smaller mitochondria or generate mitochondrial-derived vesicles (MDVs).

[0023] The above mitochondria may be isolated from a mammal, including a human, and may be isolated from cells of excess tissues, such as fat, of a mammal, including a human. For example, the mitochondria may be isolated from one or more cells selected from the group consisting of somatic cells, germ cells, and stem cells, and specifically, the stem cells may be one or more cells selected from the group consisting of induced pluripotent stem cells, mesenchymal stem cells, adult stem cells, embryonic stem cells, bone marrow stem cells, neural stem cells, limbal stem cells, and tissue-derived stem cells, and more specifically, may be derived from induced pluripotent stem cells (iPSCs).

[0024] The above "degenerative brain disease" is used to comprehensively describe all diseases related to degenerative changes in the brain, and in particular, all diseases (brain diseases) that can be caused by factors such as aggregation of beta-amyloid in one or more selected from the group consisting of the brain and brain nerve cells.

[0025] In one specific example, the degenerative brain disease is dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, mild cognitive impairment, cerebral amyloid angiopathy, Down syndrome, amyloid stroke, systemic amyloid disease, Dutch amyloidosis, Niemann-Pick disease, senile dementia, amyotrophic lateral sclerosis, spinocerebellar atrophy, Tourette's syndrome, Friedrich's ataxia, Machado-Joseph's disease, Lewy body dementia, dystonia, progressive supranuclear palsy, and frontotemporal dementia. (Frontotemporal Dementia), and specifically, it may be at least one selected from the group consisting of dementia, Alzheimer's disease, Parkinson's disease, mild cognitive impairment, cerebral amyloid angiopathy, systemic amyloid disease, and Dutch-type amyloidosis, and more specifically, it may be at least one selected from the group consisting of dementia and Alzheimer's disease, but any disease caused by aggregation of beta-amyloid may be the target.

[0026] In one specific example, the degenerative brain disease may be caused by aging or inflammation, and more specifically, may be caused by the aggregation of beta amyloid.

[0027] The above "beta-amyloid" is a peptide molecule containing approximately 36-43 amino acids, and is known to be involved in the development of Alzheimer's disease as a major component of amyloid plaques expressed in the brains of Alzheimer's patients. The above beta-amyloid peptide molecule may be obtained by cleaving amyloid precursor protein (APP; UniProtKB P05067) with beta secretase and gamma secretase. Beta-amyloid peptide molecules aggregate to form neurotoxic oligomers, causing degenerative brain diseases.

[0028] The above term “prevention” may mean any act of inhibiting or delaying a degenerative brain disease in an individual by administering a pharmaceutical composition according to one aspect.

[0029] The above term “treatment” may mean any act of improving or beneficially changing the symptoms of a degenerative brain disease in an individual by administering a pharmaceutical composition according to one aspect.

[0030] The above term “administration” means introducing a given substance into an individual in an appropriate manner.

[0031] In one specific example, the induced pluripotent stem cell-derived mitochondria may have a higher oxygen consumption rate (OCR) compared to mitochondria derived from cells other than the induced pluripotent stem cells.

[0032] The above term "Oxygen Consumption Rate (OCR) is an indicator of mitochondrial respiration (oxidative phosphorylation), and is used to determine whether mitochondrial function is damaged and whether metabolic function is improved.

[0033] The term "oxidative phosphorylation" refers to the regenerative ATP production process occurring in the mitochondrial inner membrane, requiring maintenance of membrane potential via the electron transport chain. It is known that oxidative phosphorylation capacity declines with aging in cells and tissues due to decreased mitochondrial biogenesis, functional impairment and deficiencies of oxidative phosphorylation complex proteins, and a decrease in mitochondrial membrane potential.

[0034] In one embodiment, an experiment was performed to compare the oxygen consumption rates of mitochondria derived from induced pluripotent stem cells and mitochondria derived from umbilical cord-derived mesenchymal stem cells, and as a result, it was confirmed that mitochondria derived from induced pluripotent stem cells have a higher level of oxygen consumption rate compared to mitochondria derived from umbilical cord-derived mesenchymal stem cells, indicating that mitochondria derived from induced pluripotent stem cells have superior function (see Example 1-1).

[0035] In one specific example, the mitochondria may have one or more effects selected from the group consisting of an active oxygen scavenging effect and an anti-inflammatory effect.

[0036] In another embodiment, experiments were conducted to confirm the reactive oxygen species reduction and anti-inflammatory effects of induced pluripotent stem cell-derived mitochondria. As a result, it was confirmed that induced pluripotent stem cell-derived mitochondria showed superior reactive oxygen species removal effects compared to umbilical cord-derived mesenchymal stem cell-derived mitochondria and human fetal kidney cell-derived mitochondria in terms of reactive oxygen species reduction effects, and also showed excellent cell death reduction effects. In terms of anti-inflammatory effects, it was confirmed that induced pluripotent stem cell-derived mitochondria had the best anti-inflammatory effects, such as alleviating the level of TNF-α expression, compared to umbilical cord-derived mesenchymal stem cell-derived mitochondria, human fetal kidney cells, platelet cells, human monocytes, and natural killer cells (see Examples 1-2 and 1-3).

[0037] In one specific example, the mitochondria may exhibit a neuronal restorative effect.

[0038] The above-mentioned nerve cells can express one or more selected from the group consisting of PAX6, TUJ1, TBR1, FOXG1, MAP and SATB2, and specifically can express all of PAX6, TUJ1, TBR1, FOXG1, MAP and SATB2.

[0039] In one specific example, the mitochondria can increase the expression of one or more selected from the group consisting of MAP2 and TUJ1.

[0040] The above "MAP2 (microtubule-associated protein 2)" is a protein specifically expressed mainly in the dendrites of nerve cells and is known to be an important factor in the growth of dendrites. The above "TUJ1 (class III beta-tubulin)" is known as an indicator substance of nerve cells in the central and peripheral nervous systems from the early stage of nerve cell differentiation. In other words, if it is confirmed that one or more selected from the group consisting of MAP2 and TUJ1 are expressed in a damaged nerve cell, it can be judged that the morphology and function of an intact nerve cell have been restored.

[0041] In another example, to confirm the neuronal recovery ability of induced pluripotent stem cell-derived mitochondria, the recovery of damaged neurons was observed. As a result of the observation, it was confirmed that after treatment with i-MT, the dendrites of damaged cells were restored and connected again, and apoptotic bodies were reduced. In addition, as a result of checking for cytotoxicity, it was confirmed that cell viability was restored in a concentration-dependent manner, but when treated with 10 μg, cell viability was confirmed to decrease. In addition, as a result of confirming the level of expression of neuronal-specific markers through fluorescent staining, it was confirmed that the expression of MAP2 and TUJ1 was increased (see Example 2-1).

[0042] In another example, it was confirmed whether metabolic activity according to cellular respiration was also restored according to the neuronal recovery ability of mitochondria derived from induced pluripotent stem cells. As a result of checking the oxygen consumption rate and extracellular acidity rate using a real-time metabolic meter, it was confirmed that when i-MT was treated, the metabolic amount inside the cell also increased as cell damage was recovered. Similarly, it was confirmed that when high concentrations of mitochondria were treated, recovery was slowed due to toxicity. In addition, as a result of measuring the amount of ATP synthesized as a result of cellular respiration and metabolism, it was confirmed that the amount of ATP, which had decreased as the cell was damaged, increased (see Example 2-2).

[0043] In another example, a multi-electrode assay was used to determine whether treatment with induced pluripotent stem cell-derived mitochondria restored the function of damaged neurons. Immediately after i-MT treatment, electrical signals in neurons were measured, revealing cell recovery at all concentrations. A particularly rapid increase in electrical signals was observed in the group treated with high concentrations of mitochondria. Furthermore, electrical activity measured approximately 54 hours later showed a significant increase in the degree of recovery in a mitochondrial concentration-dependent manner (see Example 2-3).

[0044] In another example, an in vivo animal experiment was conducted to determine whether treatment with induced pluripotent stem cell-derived mitochondria restored cognitive function. The results showed that mice administered i-MT exhibited a tendency for maze tracking paths and times to be shortened, indicating a recovery in cognitive function (see Example 2-4).

[0045] In one specific example, the mitochondria can alleviate the degree of deposition of beta-amyloid.

[0046] In another example, Thioflavin-S staining was performed to confirm the effect of mitochondria derived from induced pluripotent stem cells on improving beta-amyloid deposition. As a result, it was confirmed that the number of beta-amyloid was reduced in each region of the cerebral cortex, thalamus, and hippocampus responsible for cognitive function of the brain as i-MT was administered. In particular, it was confirmed that a significant reduction effect was observed in all concentrations of mitochondrial experimental groups in the cerebral cortex region (see Example 2-5).

[0047] In one specific example, the mitochondria can reduce the expression of one or more selected from the group consisting of TNF-α, β-galactosidase, p16, p21, and gH2AX.

[0048] In one specific example, the mitochondria can increase one or more selected from the group consisting of blood red blood cell concentration, blood hemoglobin concentration, blood hematocrit, and blood HDL concentration.

[0049] The above "hemoglobin count" refers to the level of hemoglobin, a protein containing iron in red blood cells. If the hemoglobin level is low, the supply of oxygen to the body may not be smooth, which may cause metabolic diseases or inflammation in the body.

[0050] The above "Hematocrit (HCT)" measures the proportion of red blood cells in the blood, which is expressed as a percentage or fraction of red blood cells in the blood.

[0051] In one specific example, the mitochondria can reduce at least one selected from the group consisting of the ratio of the number of monocytes to the number of total white blood cells and the ratio of the number of basophils to the number of total white blood cells.

[0052] The above "monocyte" is a type of white blood cell that performs phagocytosis on foreign substances within tissues and is a cell that increases in number during chronic infection. The above "basophil" is a type of white blood cell that reacts to allergic reactions and antigens and is a cell that secretes histamine, which dilates blood vessels in the inflamed area. Both monocytes and basophils are cells that increase in number due to an inflammatory response, and a decrease in the number of monocytes and basophils compared to the total white blood cell count indicates that the inflammatory response has been alleviated.

[0053] In one specific example, the mitochondria can reduce one or more selected from the group consisting of mean platelet volume (MPV) and blood urea nitrogen (BUN).

[0054] The above "mean platelet volume (MPV)" is an indicator of the average platelet volume, representing the average platelet size. It is used to identify functional differences based on platelet size and is utilized in the diagnosis and monitoring of platelet diseases.

[0055] The above "blood urea nitrogen (BUN) level" refers to the concentration of urea nitrogen in the blood. Since most of the urea produced in the body is eliminated by the kidneys, checking the blood urea nitrogen level can be used to determine whether the kidneys are functioning properly.

[0056] In another example, blood cell analysis and the expression of aging-related markers were analyzed to confirm the anti-aging effect of induced pluripotent stem cell-derived mitochondria (i-MT). The results of the red blood cell analysis showed that in the case of old mice treated with i-MT, the blood red blood cell concentration, blood hemoglobin concentration, and hematocrit were restored to levels similar to those of young mice. This result indicates that i-MT treatment can have not only an anti-aging effect but also anemia-improving effect in old mice. The results of the white blood cell analysis showed that in the case of old mice treated with i-MT, the percentage of monocytes and basophils among the total white blood cells was significantly reduced, indicating that i-MT has an anti-inflammatory effect caused by aging in old mice. As a result of platelet analysis, it was confirmed that the average platelet volume was significantly reduced in aged mice treated with i-MT, which indicates that i-MT has an effect of alleviating the risk of thrombosis formation due to aging in aged mice (see Example 3-2).

[0057] As a result of examining the expression levels of aging-related markers such as HDL, blood urea nitrogen concentration, p16, p21, and gH2AX by treating with i-MT, it was confirmed that the level of HDL gradually increased when treated with i-MT. In the case of blood urea nitrogen concentration, it was confirmed that the concentration in old mice decreased to the same level as in young mice when administered with i-MT. In the case of p16, p21, and gH2AX, it was confirmed that the expression levels were significantly reduced in old mice administered with i-MT (see Example 3-3).

[0058] In one specific example, the pharmaceutical composition for preventing or treating a degenerative brain disease may contain one or more active ingredients that exhibit the same or similar function or that exhibit a function that assists the induced pluripotent stem cell-derived mitochondria as the active ingredient.

[0059] In one specific example, the pharmaceutical composition may further include a composition for preventing or treating a degenerative brain disease other than the induced pluripotent stem cell-derived mitochondria.

[0060] The above pharmaceutical composition may be provided mixed with another composition for preventing or treating a degenerative brain disease, and the other composition for preventing or treating a degenerative brain disease may be a conventionally known composition or a newly developed composition.

[0061] When the above pharmaceutical composition further includes a composition for preventing or treating another degenerative brain disease, it is important to mix the composition in an amount that can achieve the maximum effect with the minimum amount without causing side effects, and this can be easily determined by a person skilled in the art.

[0062] When the pharmaceutical composition further comprises another composition for preventing or treating a degenerative brain disease, a synergistic effect may be exhibited in which the anti-inflammatory effect is more prominent than when the pharmaceutical composition for preventing or treating a degenerative brain disease containing mitochondria derived from induced pluripotent stem cells is included as an active ingredient.

[0063] Furthermore, in one specific embodiment, the pharmaceutical composition may be administered alone or in combination with another composition for the prevention or treatment of a degenerative brain disease. Specifically, the pharmaceutical composition may be administered in combination with a known composition having a preventive or therapeutic effect on a degenerative brain disease, and may be administered simultaneously, separately, or sequentially, and may be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be readily determined by those skilled in the art.

[0064] When the above pharmaceutical composition is administered in combination with another pharmaceutical composition, a synergistic effect may be achieved in which the anti-inflammatory effect is more pronounced than when the above pharmaceutical composition is administered alone.

[0065] In one specific embodiment, the pharmaceutical composition may further comprise a suitable carrier, excipient or diluent commonly used in the manufacture of pharmaceutical compositions.

[0066] The above pharmaceutical composition may have any one dosage form selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories, and may be in various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing one or more compounds with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0067] The above pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to prevent or treat a degenerative brain disease at a reasonable benefit / risk ratio applicable to medical use, and the effective dosage level may be determined based on factors including the type and severity of the individual, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0068] At this time, the content of the effective ingredient included in the pharmaceutical composition may include 0.0001 wt% to 10 wt%, specifically 0.001 wt% to 1 wt%, based on the total weight of the composition.

[0069] In one specific example, the effective administration dose of the induced pluripotent stem cell-derived mitochondria may be 100 μg / kg to 550 μg / kg, specifically 110 μg / kg to 520 μg / kg, and more specifically 125 μg / kg to 500 μg / kg.

[0070] The above pharmaceutical composition may be administered orally or parenterally, and when administered parenterally, the method of injection may be selected from external application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intraarterial injection, intramedullary injection, intracardiac injection, intrathecal injection, percutaneous injection, intranasal injection, intraenteric injection, local injection, sublingual injection, rectal injection, or intrathoracic injection.

[0071] Another aspect provides a health functional food for preventing or improving degenerative brain diseases containing mitochondria derived from induced pluripotent stem cells.

[0072] The above terms “stem cell”, “induced pluripotent stem cell”, “mitochondria”, “degenerative brain disease” and “prevention” may be within the scope described above.

[0073] The term "improvement" above may refer to any action that at least reduces a parameter related to the condition being treated, such as the severity of symptoms. In this case, the health functional food may be used before or after the onset of the disease, or concurrently with or separately from a treatment agent, to prevent or improve degenerative brain diseases.

[0074] The term "health functional food" above encompasses health functional foods, health foods, and health supplements. "Health food" refers to foods that have a more active health maintenance or promotion effect than regular foods, while "health supplement food" refers to foods intended for health supplement purposes.

[0075] The above health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further comprising one or more of a carrier, diluent, excipient, and additive. Foods to which compounds according to one aspect may be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, and health functional foods.

[0076] Specific examples of the carrier, excipient, diluent and additive may include at least one selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil.

[0077] In the above health functional food, the active ingredient can be added directly to the food or used in combination with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of the active ingredient mixed can be appropriately determined depending on the intended use (prevention or improvement). Generally, when manufacturing a food or beverage, the health functional food can be added in an amount of about 15% by weight or less, more specifically about 10% by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

[0078] The above health functional food may contain other ingredients as essential ingredients in addition to the effective ingredient. For example, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. Examples of the above-mentioned natural carbohydrates may include conventional sugars such as monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as dextrin, cyclodextrin, etc.; and sugar alcohols, such as xylitol, sorbitol, erythritol, etc. In addition to the above-mentioned flavoring agents, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The proportion of the above-mentioned natural carbohydrates may be appropriately determined by a person skilled in the art.

[0079] In addition to the above, health functional foods according to the aspect may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used independently or in combination, and the ratio of these additives may also be appropriately selected by those skilled in the art.

[0080] In one specific example, the health functional food may further include a health functional food for preventing or improving other degenerative brain diseases in addition to the induced pluripotent stem cell-derived mitochondria.

[0081] The above health functional food may be provided mixed with a health functional food known in the past for preventing or improving degenerative brain diseases or a newly developed composition for preventing or improving degenerative brain diseases.

[0082] If the above health functional food further includes a health functional food for the prevention or improvement of other degenerative brain diseases, it is important to mix the amount that can achieve the maximum effect with the minimum amount without causing side effects, and this can be easily determined by a person skilled in the art.

[0083] When the above health functional food further includes a health functional food for preventing or improving another degenerative brain disease, a synergistic effect may be produced in which the effect of preventing or improving the degenerative brain disease is more significant than when the health functional food for preventing or improving the degenerative brain disease, which includes the induced pluripotent stem cell mitochondria, is included as an active ingredient.

[0084] Furthermore, in one specific example, the health functional food may be consumed alone or in combination with other health functional foods for the prevention or improvement of degenerative brain diseases. That is, the health functional food may be consumed in combination with a known health functional food having a preventive or improving effect on degenerative brain diseases or a newly developed composition for the prevention or improvement of degenerative brain diseases, and may be consumed simultaneously, separately, or sequentially, and may be consumed singly or in multiple doses. It is important to take all of the above factors into consideration and consume an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0085] When the above health functional food is administered in combination with other health functional foods, a synergistic effect may be produced in which the effect of preventing or improving degenerative brain diseases becomes more significant than when the above health functional food is administered alone.

[0086] Another aspect provides a method for preventing or treating a degenerative brain disease, comprising administering mitochondria derived from induced pluripotent stem cells to a subject in need thereof.

[0087] Another aspect provides the use of induced pluripotent stem cell-derived mitochondria for the manufacture of drugs for the prevention or treatment of degenerative brain diseases.

[0088]

[0089] According to one aspect, it was confirmed that mitochondria derived from induced pluripotent stem cells have excellent anti-inflammatory effects due to the effect of removing reactive oxygen species and reducing the expression of inflammatory cytokines compared to mitochondria derived from other cells. When the mitochondria were administered to damaged nerve cells, the recovery and regeneration effects of the nerve cells were confirmed, and when the mitochondria were administered to old mice, it was confirmed that they also have an anti-aging effect. Therefore, a pharmaceutical composition containing mitochondria derived from induced pluripotent stem cells according to one aspect can be utilized in various fields for preventing or treating degenerative brain diseases, particularly degenerative brain diseases caused by aging or beta-amyloid aggregation.

[0090]

[0091] Figures 1a to 1c are diagrams showing the results of analyzing the expression level at the transcription stage for NANOG, OCT4, SOX2, LIN28, KLF5, PAX6, BRACHYURY, and SOX17 genes to confirm whether the characteristics of induced pluripotent stem cells are maintained.

[0092] Figures 2 and 3 are diagrams showing the results of protein expression confirmed through flow cytometry to confirm whether the characteristics of induced pluripotent stem cells are maintained.

[0093] Figure 4 is a diagram showing the results of AP staining of induced pluripotent stem cells.

[0094] Figure 5 is a diagram showing the results of performing fluorescent staining after differentiating induced pluripotent stem cells.

[0095] Figure 6 is a schematic diagram showing the process of creating a nerve cell damage model.

[0096] Figure 7 is a diagram showing the results of confirming the level of gene expression at the transcription stage to confirm whether neural cell differentiation has occurred.

[0097] Figure 8 is a diagram showing the results of fluorescent staining to analyze the level of specific gene and protein expression in each differentiation process during the differentiation of induced pluripotent stem cells into cerebral cortical neurons.

[0098] Figure 9 is a diagram showing the results of a cytotoxicity test of mitochondria derived from induced pluripotent stem cells.

[0099] Figure 10 is a diagram showing the results of a comparative analysis of the oxygen consumption rates of mitochondria derived from induced pluripotent stem cells and mitochondria derived from mesenchymal stem cells.

[0100] Figure 11 is a diagram showing the effect of reducing reactive oxygen species and cell death of mitochondria derived from various cells.

[0101] Figure 12 is a diagram showing the results of an experiment to confirm the anti-inflammatory effect of mitochondria obtained from various cells.

[0102] Figure 13 is a diagram showing the results of morphological recovery of neural cells by treatment with mitochondria derived from induced pluripotent stem cells.

[0103] Figure 14 is a diagram showing cell survival rate according to treatment concentration of induced pluripotent stem cell-derived mitochondria.

[0104] Figure 15 is a diagram showing the results of fluorescent staining of MAP2 and TUJ1, which are neuron-specific markers, and the recovery of neurons by treating mitochondria derived from induced pluripotent stem cells.

[0105] Figures 16a and 16b are diagrams showing the results of analysis of mitochondrial oxygen consumption rate and extracellular acidity rate according to treatment of induced pluripotent stem cell-derived mitochondria.

[0106] Figure 17 is a diagram showing the results of measuring cellular respiration in real time to confirm whether the cellular activity of damaged nerve cells has been restored.

[0107] Figures 18 to 20f are diagrams showing the degree of functional recovery of nerve cells as a result of treatment with induced pluripotent stem cell-derived mitochondria, expressed as electrical signals.

[0108] Figures 21 and 22 are diagrams showing the degree of cognitive recovery when mitochondria derived from induced pluripotent stem cells were administered through an animal model.

[0109] Figures 23a to 23e are diagrams showing changes in the degree of beta-amyloid deposition in the brain tissue of an Alzheimer's model mouse.

[0110] Figure 24 is a schematic diagram illustrating a method for producing an animal model to confirm the anti-aging effect of mitochondria derived from induced pluripotent stem cells.

[0111] Figures 25 to 27 are diagrams showing the results of blood cell analysis performed on mouse blood to analyze the anti-aging effect of i-MT.

[0112] Figures 28 to 33b are diagrams showing the results of hematological marker analysis performed on mouse serum to analyze the anti-aging effect of i-MT.

[0113]

[0114] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0115]

[0116] Manufacturing Example - Isolation of Mitochondria from Various Cell Lines

[0117] Manufacturing Example 1. Manufacturing of mitochondria derived from induced pluripotent stem cells

[0118] Mitochondria were isolated from induced pluripotent stem cells (iPSCs) derived from peripheral blood mononuclear cells (PBMCs).

[0119] For induced pluripotent stem cells, the Essential 8 culture medium (Gibco, A1517001) was replaced daily and cultured for a total of 5 days. After culture, cells were obtained by treating with 0.25% (v / v) Trypsin-EDTA (TE, Gibco). The obtained cells were washed with DPBS and then resuspended in cell freezing solution (250 mM sucrose, 20 mM HEPES, 2 mM EGTA, pH 7.4) at a density of 4 × 10 7 cells / ㎖ concentration. Each frozen cell line was completely thawed at room temperature for mitochondria isolation, and then physically disrupted and homogenized using a pressurized method, followed by a first centrifugation at 2,000 × g for 10 minutes. The supernatant was obtained and centrifuged a second time at 12,000 × g for 15 minutes at 4°C. After centrifugation, the supernatant was obtained and centrifuged a third time at 12,000 × g for 15 minutes at 4°C. Then, the supernatant was removed, and the pellet was recovered and resuspended in a homogenization buffer. The suspension was centrifuged at 20,000 × g for 10 minutes to obtain a pellet. The pellet was resuspended in a suspending agent (20 mM tris, 195 mM trehalose, 66.6 mM glycine, pH 7.4) and centrifuged at 20,000 × g for 5 minutes to obtain a pellet. The isolated mitochondria were suspended in the suspending agent, quantified for protein using the BCA method, and used in the following experiments.

[0120] As a result, 4 X 10 7 235.4 μg of mitochondria were obtained from the iPSC cells of the dog. The mass of the obtained mitochondria is shown in Table 1 below.

[0121]

[0122] Manufacturing Example 2. Manufacturing of mitochondria derived from umbilical cord-derived mesenchymal stem cells

[0123] Mitochondria were isolated from umbilical cord-derived mesenchymal stem cells (UC-MSCs).

[0124] For mesenchymal stem cells, the method was the same as in Manufacturing Example 1, except that they were cultured for 5 days in Minimal Essential Medium alpha modification (Hyclone, SH30265.02) containing 10% FBS and 10 μg bGFG.

[0125] As a result, 4 X 10 7 110.7 μg of mitochondria were obtained from the MSC cells. The mass of the obtained mitochondria is shown in Table 1 below.

[0126]

[0127] Manufacturing Example 3. Manufacturing of mitochondria derived from human fetal kidney cells

[0128] Mitochondria were isolated from human fetal kidney cells (HEK293).

[0129] HEK293 was prepared in the same manner as in Preparation Example 1, except that it was cultured for 3 days in DMEM (Hyclone, SH30243.01) containing 10% FBS.

[0130] The three cell lines above were cultured for 2 to 5 days, respectively.

[0131] As a result, 4 X 10 7 130.9 μg of mitochondria were obtained from HEK293 cells. The mass of the obtained mitochondria is shown in Table 1 below.

[0132]

[0133] iPSC-MTMSC-MTHEK293-MT cell number 4 x 10 7 4 x 10 7 4 x 10 7 Concentration 235.448 ㎍ / mL 110.7 ㎍ / mL 130.9 ㎍ / mL

[0134]

[0135] Manufacturing Example 4. Manufacturing of mitochondria derived from peripheral blood mononuclear cells

[0136] Mitochondria were isolated from peripheral blood mononuclear cells (PBMC). The specific manufacturing method was the same as that of Manufacturing Example 1 above.

[0137]

[0138] Manufacturing Example 5. Manufacturing of platelet-derived mitochondria

[0139] Mitochondria were isolated from platelets. The specific manufacturing method was the same as that of Manufacturing Example 1 above.

[0140]

[0141] Manufacturing Example 6. Manufacturing of human monocyte-derived mitochondria

[0142] Mitochondria were isolated from human monocyte cells (THP-1). The specific manufacturing method was the same as that of Manufacturing Example 1 above.

[0143]

[0144] Manufacturing Example 7. Manufacturing of mitochondria derived from natural killer cells

[0145] Mitochondria were isolated from human natural killer cells (NK92-mi). The specific manufacturing method was the same as that of Manufacturing Example 1 above.

[0146]

[0147] Reference Example 1. Confirmation of the characteristics of induced pluripotent stem cells derived from peripheral blood mononuclear cells.

[0148] Reference Example 1-1. Verification of stem cell characteristics through confirmation of expression markers of induced pluripotent stem cells (iPSCs) derived from peripheral blood mononuclear cells.

[0149] In order to verify the stem cell characteristics of the PBMC-derived induced pluripotent stem cells (iPSCs) used in the above manufacturing example, the expression levels of genes and proteins were analyzed at the transcription and translation stages, respectively.

[0150] To confirm whether the characteristics of induced pluripotent stem cells were maintained, the expression of five genes, NANOG, OCT4, SOX2, LIN28, and KLF5, and PAX6, BRACHYURY, and SOX17, were analyzed to confirm the characteristics of three germ layer cells. Real-time PCR was performed to analyze the expression level at the transcriptional stage, and the expression level at the translational stage was analyzed using a flow cytometer.

[0151] TRIzol (TRI Reagent) in induced pluripotent stem cells ® ) to isolate total RNA, and then REVERTAID 1 ST cDNA was synthesized using a cDNA synthesis kit. Using this as a template, real-time PCR was performed to analyze the expression level of each gene. The primer sets used for analysis are shown in Table 2.

[0152]

[0153] GenesDirectionSequenceSEQ ID NONANOGForwardGATTTGTGGGCCTGAAGAAA1ReverseCAGATCCATGGAGGAAGGAA2OCT4ForwardACCCCTGGTGCCGTGAA3ReverseGGCT GAATACCTTCCCAAATA4SOX2ForwardATGGGTTCGGTGGTCAAGTC5ReverseCTGATCATGTCCCGGAGGTC6LIN28ForwardGTTCGGCTTCCTGTCCAT7ReverseCTGCCTCACCCT CCTTCA8KLF4ForwardTTCCCATCTCAAGGCACAC9ReverseGGTCGCATTTTTGGCACT10PAX6ForwardGTGTCCAACGGATGTGTGAG11ReverseCTAGCCAGGTTGCGAAGAAC12 BRACHYURYForwardAATTGGTCCAGCCTTGGAAT13ReverseCGTTGCTCACAGACCACA14SOX17ForwardCGCACGGAATTTGAACAGTA15ReverseGGATCAGGGACCTGTCACAC16

[0154] As a result of the analysis, as can be confirmed in Figures 1a to 1c, the induced pluripotent stem cells expressed NANOG, OCT4, SOX2, LIN28, and KLF5, which are pluripotent markers, at high levels, and PAX6, BRACHYURY, and SOX17, which are markers for 3 germ layer cells, were hardly expressed, indicating that the induced pluripotent stem cells maintained their characteristics.

[0155] To analyze protein expression at the translation stage, induced pluripotent stem cells were fixed with 4% paraformaldehyde, stained with antibodies listed in Table 3 below, and analyzed using an Attune NxT (Invitrogen) flow cytometer.

[0156]

[0157] MarkerscompanyCat#ConjugationAPC Mouse Anti-Human CD34BD555824APCAPC Mouse IgG2a, κ Isotype ControlBD555576APCBV421 Mouse Anti-Human TRA-1-60BD562711BV421BV421 Mouse IgM, κ Isotype ControlBD562704BV421PE Mouse anti-human NanogBD560483PEPE Mouse IgG1, κ Isotype ControlBD555749PEPerCP-Cy™5.5 MouseAnti-SSEA-4BD561565Cy5.5PerCP-Cy™5.5 Mouse IgG1 κ Isotype ControlBD550795Cy5.5OCT3 / 4 Rat anti-Human, Mouse, PER&DIC1759P-100PEPE Mouse IgG1, κ Isotype ControlBD555749PE

[0158] As a result of the analysis, as can be confirmed in Figure 2, there were no cells expressing CD34, a marker for PBMC, the source cells of iPSCs, and it was confirmed that more than 95% of cells expressed pluripotency markers, TRA-1-60, NANOG, SSEA4, and OCT4. Therefore, it was confirmed that the induced pluripotent stem cells used in the experiment exhibited the characteristics of intact induced pluripotent stem cells, not the source cells, PBMC.

[0159]

[0160] Reference Example 1-2. Confirmation of pluripotency of induced pluripotent stem cells (iPSCs) derived from peripheral blood mononuclear cells.

[0161] To confirm the pluripotent capacity of induced pluripotent stem cells, AP staining (Alkaline Phosphatase Staining) was performed and differentiation experiments into the three germ layers were conducted.

[0162] First, for AP staining analysis, 1.0 x 10 5Cells were seeded per well in 6-well plates and cultured in Essential 8 (Gibco, #A1517001) medium for 5 days. Afterwards, the cells were washed with DPBS and AP staining was performed using the Alkaline Phosphate Detection Kit (Sigma, SCR004).

[0163] For differentiation experiments into the three germ layers, the STEMdiff Trilineage Differentiation Kit (STEMCELL technology, 05230) was used. For ectoderm and endoderm differentiation experiments, 2.0 x 10 cell lines were cultured. 5 cells / well and 1.0 x 10 for mesoderm differentiation experiments. 5 Cells were seeded at 10 μm / well and spread on a 24-well plate with 10 μm of Y-27632 and 1 μg / mL of iMatrix-511MG (Nippi, MX892012), respectively. Differentiation was performed for a week for ectoderm differentiation experiments and for a total of 4 days for mesoderm and endoderm differentiation experiments, with the differentiation medium for each cell changed daily. Real-time qPCR was then performed to analyze gene expression at the transcriptional stage. TRIzol (TRI Reagent ® ) to isolate total RNA and REVERTAID 1 STcDNA was synthesized using a cDNA synthesis kit, using the primers mentioned above. For fluorescent staining, cells were fixed by adding 4% paraformaldehyde, and then stained with primary antibodies PAX6 (SantaCruz, sc-81649, 1:100), BRACHYURY (R&D, AF2085, 1:100), SOX17 (R&D, AF1924, 1:100) and Alexa Fluor 488 (Invitrogen, A10680, 1:200) or Alexa Fluor 594 (Invitrogen, A11037, 1:200)-conjugated secondary antibodies. Images were then taken using a Cytation 5 (BioTek) fluorescence imaging system.

[0164] As a result of the analysis, as can be confirmed in Fig. 3, there were no cells expressing CD34, a marker of PBMC, the source cell of induced pluripotent stem cells, and it was confirmed that more than 95% of cells expressed TRA-1-60, NANOG, SSEA4, and OCT4, which are pluripotent markers. In addition, the results of AP staining of the cells cross-verified that all cell populations had stem cell potential (Fig. 4), and after differentiation into three germ layer cells and observation by fluorescent staining of each marker, it was confirmed that markers of endoderm, mesoderm, and ectoderm cells were expressed, confirming that there was no abnormality in the differentiation potential of the induced pluripotent stem cells (Fig. 5).

[0165]

[0166] Reference Example 2. Preparation of a nerve cell damage model

[0167] Reference Example 2-1. Production of nerve cells

[0168] Prior to preparing a neuronal damage model to confirm the efficacy of the mitochondria obtained in the above manufacturing example, neurons were prepared.

[0169] Cortical neurons were produced by inducing differentiation of induced pluripotent stem cells according to the order shown in Fig. 6. First, 10 μm Y-27632 was added to a T25 flask, and then 5.0 x 10 induced pluripotent stem cells were added. 6 Cells were plated. After 2 days, 11 mL of NIM medium containing 10 μm of SB-431542 and 1 μm of Dorsomorphin was added and replaced daily. After 10 days, cells were detached using Accutase and 1.1 x 10 were plated in a T25 flask coated with Laminin-521. 7 Cells were plated. From the next day, 11 mL of NIM medium was replaced every other day, and 20 ng / mL bFGF was treated for two days. Subculture was performed in the same manner as above on the 17th day, and two days after that, the NIM medium was replaced every other day. The same process was performed on the 24th and 29th days, and morphological changes of the neurons were observed. Maturation of the neurons continued, and fully mature cortical neurons were formed after the 35th day.

[0170] To determine the differentiation pattern at each differentiation stage, real-time PCR was performed using the same method as in Reference Example 1-1 above to analyze the level of mRNA expression at the transcription stage, and fluorescent staining was performed to analyze the level of protein expression at the translation stage. The primers and antibodies used at this time are as shown in Tables 4 and 5 below.

[0171]

[0172] GenesDirectionSequenceSEQ ID NO:OCT4ForwardACCCCTGGTGCCGTGAA17ReverseGGCTGAATACCTTCCCAAATA18SOX2ForwardATGGGTTCGGTGGTCAAGTC19ReverseCTGATC ATGTCCCGGAGGTC20PAX6ForwardGTGTTCCAACGGATGTGTGAG21ReverseCTAGCCAGGTTGCGAAGAAC22TUJ1ForwardTCAGCGTCTACTACAACGAGGC23ReverseGCCTGAAGAGATG TCCAAAGGC24TBR1ForwardTCACTGGAGGTTTCAAGGAGGC25ReverseTTTCTTGGCGCATCCAGTGAGC26FOXG1ForwardAGGAGGGCGAGAAGAAGAAC27ReverseTCACGAAGCACTTG TTGAGG28MAP2ForwardGGAGACAGAGATGAGAATTCC29ReverseGAATTGGCTCTGACCTGGT30SATB2ForwardGGAGTCGAGGCATCACCACA31ReverseGGCACAACTGTCTTCAGCCG32

[0173] MarkerscompanyCat#hostFOXG1InvitrogenPA5-26794RabbitPROX1InvitrogenPA5-85552RabbitTBR1abcamab31940Ra bbitTUJ1GeneTexGTX631836MouseKI67abcamab92742RabbitPAX6SantaCruzsc-81649MouseSATB2abcamab92446Rabbit

[0174] As can be seen in Figure 7, the mRNA analysis results showed that the expression of pluripotency markers OCT4 and SOX2 was significantly reduced as differentiation began, and the expression of PAX6, an early differentiation marker, and TUJ1, TBR1, FOXG1, MAP2, and SATB2, which are specifically expressed in neural cells, showed a tendency to gradually increase.

[0175] As shown in Figure 8, protein analysis results confirmed that as differentiation progressed, the expression of Ki67, a cell proliferation marker, decreased, and the expression of proteins such as TUJ1 and SATB2, which are neuron-specific markers, increased. In other words, changes in these expression markers indicate that induced pluripotent stem cells have completely differentiated into neuron cells.

[0176]

[0177] Reference Example 2-2. Preparation of a nerve cell damage model

[0178] In order to prepare a neural cell damage model for evaluating the efficacy of i-MT of Manufacturing Example 1, the neural cells prepared in Reference Example 2-1 were treated with hydrogen peroxide and beta amyloid to induce neural cell damage.

[0179] First, to select the appropriate concentration of hydrogen peroxide solution, 7.0 x 10 neurons were seeded in a 96-well plate coated with Laminin-521. 4 Cells / well were applied. After maintaining this for 5 days, H2O2 was dose gradient treated for 24 hours, and the viability of cells was measured through CCK analysis (Dojindo, CK04). In the case of cells treated with hydrogen peroxide, it was confirmed that overall damage occurred in the cells compared to normal cells, and as can be confirmed in Figure 9, it was confirmed that an appropriate level of damage occurred at a concentration of 200 μm.

[0180] Furthermore, to mimic Alzheimer's disease, a neurodegenerative disease, the neurons treated with hydrogen peroxide were further treated with beta-amyloid to create a final damage model. As a result, we confirmed a gradual decrease in the expression of the neuron-specific marker MAP2, indicating that a complete neuronal damage model induced by beta-amyloid had been created.

[0181] Afterwards, to confirm the neuronal recovery and anti-aging effects of i-MT, an efficacy evaluation was conducted using the above-mentioned neuronal damage model.

[0182]

[0183] Example 1. Characterization of mitochondria isolated from various cells.

[0184] Example 1-1. Comparative analysis of mitochondrial oxygen consumption rates.

[0185] In order to confirm the function of i-MT of Manufacturing Example 1 and MSC-MT of Manufacturing Example 2, the oxygen consumption rate, which is the main function of mitochondria, was analyzed using XF 96 Extracellular Flux Analyzer (Seahorse bioscience).

[0186] 2 x 10 in XF 96-well cell culture plates (Seahorse Bioscience) 4After culturing the cells for 24 hours, the medium was replaced with bicarbonate-free DMEM. After 1 hour, the cells were sequentially treated with 1 μm of oligomycin, 0.3 μm of FCCP, and 0.1 μm of rotenone, and the changing oxygen consumption was measured. From the oxygen consumption rate results, the basal (basal OCR-Rotenone OCR), ATP-linked (Basal OCR-oliomycine OCR), proton leak (Basal OCR-ATP linked), and maximal capacity (FCCP OCR-Rotenone OCR) were calculated. The data were expressed as O2pmol per minute and corrected for the cell number. As shown in Fig. 10, the oxygen consumption rate of i-MT was higher than that of MSC-MT, indicating that i-MT has a superior oxidative phosphorylation ability than MSC-MT. Oxidative phosphorylation is a complex ATP production process that occurs in the inner mitochondrial membrane and requires maintenance of membrane potential through the electron transport chain. In cells and tissues with degenerative brain diseases and aging, oxidative phosphorylation capacity is reduced due to decreased mitochondrial biogenesis, functional damage and deficiency of oxidative phosphorylation complex proteins, and decreased mitochondrial membrane potential. Therefore, i-MT (Preparation Example 1), which possesses a high oxidative phosphorylation capacity, has a higher therapeutic potential than MSC-MT (Preparation Example 2).

[0187]

[0188] Example 1-2. Comparative analysis of the effects of mitochondrial oxygen scavenging and cell death reduction.

[0189] In order to confirm the active oxygen scavenging effect of the mitochondria manufactured in the above manufacturing examples 1 to 3, the active oxygen scavenging effect and cell death reduction effect analysis were performed on cells treated with rotenone.

[0190] 4 x 10 in a 96-well black plate 3 SH-SY5Y (human neuroblastoma) cells cultured in a 0.1 μm concentration of rotenone were treated for 24 hours, washed with DPBS, and then treated with 8 μg of iPSC-MT, MSC-MT, and HEK293-MT together with the culture medium for 24 hours. After staining with 1 μg of CM-H2DCFDA, a reactive oxygen measuring reagent, for 1 hour, the antioxidant capacity was measured using a fluorescence analyzer, and the cell viability was measured using WST-8 with an absorbance analyzer.

[0191] As can be seen in Fig. 11, the experimental results showed that i-MT had the best ability to remove reactive oxygen species increased by rotenone, and that i-MT also had the greatest effect in reducing cell death caused by rotenone. Therefore, it was confirmed that i-MT (Preparation Example 1) was the best in both the reactive oxygen species removal effect and the cell death reduction effect.

[0192]

[0193] Example 1-3. Comparative Analysis of the Anti-Inflammatory Effects of Mitochondria

[0194] In order to compare the anti-inflammatory effect of the mitochondria prepared in the above manufacturing examples 1 to 7, the inflammation-relieving effect of various cell-derived mitochondria on human monocyte cells induced with inflammation by LPS was compared and analyzed.

[0195] 4 × 10 in RPMI 1640 medium containing 1% FBS (Fetal Bovine Serum). 5Human mononuclear erythrocytes (THP-1) were cultured. After 16 to 24 hours of THP-1 cell culture, 8 μg of mitochondria isolated from peripheral blood mononuclear cells (PBMC), platelets, human mononuclear cells (THP-1), and natural killer cells (NK92-mi) in addition to iPSCs, MSCs, and HEK293 cells were treated with the same method as in the above preparation example. After 30 minutes of treatment, the anti-inflammatory effect of mitochondria was measured in cells that were treated with 2 μg of lipopolysaccharide (LPS) to induce inflammation. The anti-inflammatory effect was measured by measuring the amount of TNF-α, an inflammatory cytokine present in the culture medium using an ELISA kit.

[0196] As can be seen in Fig. 12, the experimental results showed that the expression level of TNF-α was significantly reduced in the i-MT-treated group. Therefore, it was confirmed that i-MT (Preparation Example 1) had the best anti-inflammatory efficacy compared to other cell-derived mitochondria (Preparation Examples 2 to 7).

[0197]

[0198] Example 2. Confirmation of the neuronal recovery and regenerative capacity of induced pluripotent stem cell-derived mitochondria (i-MT).

[0199] Example 2-1. Morphological recovery and cytotoxicity of neural cells treated with induced pluripotent stem cell-derived mitochondria (i-MT)

[0200] The i-MT of Manufacturing Example 1 was added to the nerve cell damage model manufactured in the above Reference Example 2-2 at a concentration (1 μg / 1 x 10 5 cells, 2.5 μg / 1 x 10 5 cells, 5 μg / 1 x 10 5 cells, 10 μg / 1 x 10 5The cells were treated separately, and the degree of recovery of nerve cells and cytotoxicity according to concentration were confirmed.

[0201] As can be seen in Figure 13, when observing through holotomography 72 hours after i-MT treatment, the damaged dendrites of the nerve cells were restored and reconnected, and it was confirmed that the apoptotic bodies generated when cells were damaged were reduced.

[0202] The cytotoxicity of i-MT was observed according to its concentration through CCK assay. As a result of the observation, as can be seen in Figure 14, it was confirmed that cell viability was recovered in a concentration-dependent manner, but the highest was at 10 ㎍ / 1 x 10 5 When i-MT was treated on cells, the survival rate decreased due to toxicity. This was at 10 ㎍ / 1 x 10 5 This means that when i-MTs are processed beyond the cells, cytotoxicity may be induced.

[0203] In addition, fluorescent staining was performed to analyze the expression levels of neuronal-specific markers MAP2 and TUJ1 according to i-MT treatment. As a control group, donepezil, a drug previously administered to alleviate symptoms of Alzheimer's patients, was treated, and donepezil was treated at a concentration of 10 μm for 24 hours in a neuronal damage model. As a result, as shown in Fig. 15, it was confirmed that the expression levels of MAP2 and TUJ1 were restored as the i-MT treatment concentration increased. On the other hand, in the case of the control group treated with donepezil, the effect of recovering damaged neurons could not be confirmed, which proves once again that the drug only alleviates simple symptoms due to its nature, and indicates that i-MT (Preparation Example 1) has an excellent neuronal recovery effect.

[0204]

[0205] Example 2-2. Confirmation of Restoration of Metabolic Activity in Neurons by Treatment with Induced Pluripotent Stem Cell-Derived Mitochondria (i-MT)

[0206] As the neurons were morphologically restored, the metabolic activity according to cellular respiration was also restored, and oxygen consumption rate (OCR) and extracellular acidification rates (ECAR) were observed using a real-time metabolic meter (Seahorse, XFe24) (Fig. 16a and Fig. 16b).

[0207] The i-MT of Manufacturing Example 1 was added to the nerve cell damage model manufactured in the above Reference Example 2-2 at a concentration (1 μg / 1 x 10 5 cells, 2.5 μg / 1 x 10 5 cells, 5 μg / 1 x 10 5 cells, 10 μg / 1 x 10 5 (cells) were treated separately, and it was confirmed that metabolism inside the cells also increased as i-MT was treated. However, as confirmed in Example 4 above, 10 ㎍ / 1 x 10 5 When the mitochondria of the cells were treated, it was confirmed that recovery was slow due to its toxicity.

[0208] In addition, the amount of ATP synthesized as a result of cellular respiration and metabolism within the cell was confirmed, and as shown in Fig. 17, it was confirmed that the amount of synthesized ATP, which had decreased by treatment with i-MT (Preparation Example 1), increased again. This indicates that cellular respiration function was reactivated when healthy mitochondria were injected back into damaged nerve cells containing abnormal mitochondria.

[0209]

[0210] Example 2-3. Confirmation of functional recovery of neural cells by treatment with induced pluripotent stem cell-derived mitochondria (i-MT).

[0211] We used a multi-electrode assay (MEA) to confirm whether the function of the nerve cells themselves was also restored as the damaged nerve cells were restored to healthy cells.

[0212] The i-MT of Manufacturing Example 1 was added to the nerve cell damage model manufactured in the above Reference Example 2-2 at a concentration (1 μg / 1 x 10 5 cells, 2.5 μg / 1 x 10 5 cells, 5 μg / 1 x 10 5 cells, 10 μg / 1 x 10 5 As a control group, donepezil, a drug that is currently administered to alleviate symptoms in Alzheimer's patients, was administered. Donepezil was treated at a concentration of 10 μm for 24 hours in a neuronal damage model. When the electrical signals of neurons were measured immediately after i-MT treatment, a tendency for cells to recover was confirmed at all concentrations, and in particular, 10 μg / 1 x 10 5 In the experimental group where the mitochondria of the cells were treated, rapid electrical signals were observed. Conversely, in the group treated with donepezil, no neuronal activity was observed. This confirms that donepezil merely alleviates symptoms, while i-MT has a restorative effect on damaged neurons.

[0213] In addition, as a result of measuring 54 hours after treating with i-MT (Manufacturing Example 1), it was confirmed that the degree of electrical activity significantly recovered depending on the concentration of mitochondria, and as a result of checking through a graph tracking the results for 66 hours, it was confirmed that the nerve cells gradually recovered immediately after treating mitochondria in both the number and speed of electrical spikes (Figs. 18 to 20f).

[0214]

[0215] Example 2-4. Confirmation of the in vivo cognitive function recovery effect by administration of induced pluripotent stem cell-derived mitochondria (i-MT).

[0216] Through animal experiments, we confirmed whether cognitive function was restored when mitochondria were treated in vivo using the Barnes Maze experiment.

[0217] The mice used in this experiment were TG mice purchased from Jackson Laboratory. After raising them to 20 weeks of age, a primary behavioral assessment was conducted to primarily assess whether the disease had been induced. As a result of checking the follow-up data, it was confirmed that cognitive function was impaired in the 5 x FAD Alzheimer's model mouse compared to the wild-type B6SJL mice.

[0218] i-MT of Manufacturing Example 1 was injected intranasally so that it could easily pass through the BBB via the olfactory bulb of the mouse. The experimental group of mice was administered i-MT at doses of 2.5 μg, 5 μg, and 10 μg, respectively, and the control group of mice was administered donepezil at a dose of 1 mg / kg twice per week for a total of 3 weeks. One week after the last administration of each drug, a behavioral evaluation was conducted to evaluate the degree of improvement in cognitive and functional impairment. As a result, a tendency for the tracking path and time to be shortened was observed in the mice administered i-MT (Manufacturing Example 1), which can be judged to be that the cognitive function of the mice was recovering (Figs. 21 and 22).

[0219]

[0220] Example 2-5. Confirmation of the effect of improving the degree of beta-amyloid deposition by administering induced pluripotent stem cell-derived mitochondria (i-MT).

[0221] Next, in order to confirm whether there is a direct effect on improving beta-amyloid deposition, which is known to be a major cause of Alzheimer's dementia, the mice used in Example 5 were sacrificed and the degree of beta-amyloid deposition in brain tissue was confirmed through Thioflavin-S staining.

[0222] The degree of beta-amyloid deposition was confirmed in each region of the cerebral cortex, thalamus, and hippocampus, which are responsible for cognitive function in the brain tissue, and as a result of the confirmation, it was confirmed that the number of deposited beta-amyloid decreased in all three regions as i-MT was administered. In particular, in the cerebral cortex region, it was confirmed that the degree of beta-amyloid deposition was significantly reduced in the experimental group regardless of the dose of i-MT (Preparation Example 1) administered (Figs. 23a to 23e).

[0223]

[0224] Example 3. Comparative analysis of the anti-aging effects of induced pluripotent stem cell-derived mitochondria (i-MT).

[0225] Example 3-1. Preparation of blood and serum samples

[0226] To prepare a sample to confirm the anti-aging effect of i-MT manufactured in the above Manufacturing Example 1, a total of 50 mice were prepared (Korea Research Institute of Bioscience and Biotechnology). The mice used were 40 20-month-old female C57BL / 6 mice and 10 2-month-old young mice. The mice were fed food and water ad libitum in a room with a constant room temperature, and the indoor lighting was turned on / off in a 12 / 12-hour cycle.

[0227] i-MT was injected intravenously into the tail vein of aged mice at doses of 2.5 μg, 5.0 μg, and 10.0 μg, respectively, and the intravenous injections were administered once a week for a total of three times. All mice were sacrificed 4 weeks after the first i-MT administration. On the day of sacrifice, blood was collected from all mice through orbital bleeding, and serum was separated. Serum was obtained by leaving the blood of the collected mice to coagulate at room temperature for approximately 30 minutes, centrifuging them at 2,000 g for 10 minutes at 4°C, and isolating only the supernatant (Fig. 24). Thereafter, the blood and serum of the aged mice obtained above were compared and analyzed with the blood and serum of young mice.

[0228]

[0229] Example 3-2. Analysis of blood cells in mice administered with induced pluripotent stem cell-derived mitochondria (i-MT).

[0230] Example 3-2-1. Red blood cell analysis results

[0231] The blood obtained in Example 3-1 above was subjected to automatic blood cell analysis using the Hemavet 950 equipment from Drew Scientific.

[0232] Red blood cell analysis results showed that the blood red blood cell concentration and blood hemoglobin concentration decreased sharply in old mice compared to young mice, but recovered to the trend of young mice in the group treated with 10.0 μg of i-MT.

[0233] Additionally, hematocrit (HCT) decreased sharply in old mice compared to young mice, but increased to a level that was not statistically different after i-MT administration. The results of increasing blood red blood cell concentration and blood hemoglobin level by i-MT administration indicate that i-MT (Preparation Example 1) also has an anemia-improving effect in old mice (Fig. 25). All data were analyzed for all groups with n=10.

[0234]

[0235] Example 3-2-2. White blood cell analysis

[0236] The number of white blood cells was compared and analyzed by immune cell type in old mice compared to young mice. The cell number ratio (%) of each cell type compared to the total white blood cell number of monocytes (MO), neutrophils (NE), eosinophils (EO), and basophils (BA) showed a tendency to significantly increase in old mice compared to young mice. As a result of i-MT treatment, a statistically significant decrease was confirmed in the 10 ㎍ treatment group for monocytes, and in the 2.5 ㎍ and 10 ㎍ treatment groups for basophils.

[0237] Through this, it was confirmed that the i-MT (Preparation Example 1) treatment in aged mice had a cell number reduction effect of monocytes and basophils, and that this had an inflammation reduction effect (Fig. 26).

[0238]

[0239] Example 3-2-3. Platelet Analysis

[0240] Platelet analysis results showed that the mean platelet volume (MPV) increased in old mice compared to young mice, but was significantly reduced in the groups administered i-MT at 2.5 ㎍ and 10 ㎍. An increase in MPV levels clinically increases the risk of thrombosis and increases the risk of developing cardiovascular disease, myocardial infarction, and stroke, which means that i-MT (Preparation Example 1) has the effect of reducing the risk of the above diseases due to aging (Fig. 27).

[0241]

[0242] Example 3-3. Analysis of hematological markers in the blood of mice administered with induced pluripotent stem cell-derived mitochondria (i-MT).

[0243] Example 3-3-1. Liver tissue analysis

[0244] The separated serum of the mouse obtained in Example 3-1 was analyzed for hematological markers related to the liver using Fujifilm's DRI-CHEM NX500 equipment.

[0245] Analysis results showed that there was no significant difference in HDL (high-density lipoprotein) levels, known as a positive substance in the body, between young and old mice. However, administration of i-MT (Preparation Example 1) resulted in a gradual increase in these levels (Figure 28). HDL transports cholesterol to the liver, improving liver function. It also has anti-inflammatory and antioxidant effects, alleviating liver damage and inflammation and preventing liver fibrosis. It also reduces oxidative stress and maintains vascular health, thus delaying aging. Therefore, increased HDL levels indicate liver health and anti-aging effects.

[0246]

[0247] Example 3-3-2. Kidney tissue analysis

[0248] Next, we analyzed hematological markers related to renal function. Blood urea nitrogen (BUN) concentrations were statistically significantly increased in aged mice compared to young mice, and when i-MT was administered, the 10 μg dose group showed a decrease to the level of young mice (Fig. 29). In other words, the improved renal function following i-MT (Preparation Example 1) administration was confirmed.

[0249]

[0250] Example 3-3-3. Analysis of aging markers

[0251] To confirm the anti-aging effect of i-MT of Manufacturing Example 1 in vivo, the expression level of markers related to cellular aging, DNA damage, and cell cycle regulation (p16, p21, gH2AX) in aged mice was examined. Since i-MT was expected to have a major effect on the liver, which collects a large amount of blood among internal organs, among intravenous organs, an analysis of aging markers on liver tissue sections was performed. Each liver tissue was observed with n=5 per group, and H&E analysis and β-galactosidase aging staining were performed.

[0252] β-Galactosidase protein is known to be an aging protein that increases in lysosomes with age. Staining results showed that the expression level of β-galactosidase increased in aged mice compared to young mice, and that i-MT administration tended to decrease the degree of β-galactosidase deposition. In other words, as the degree of β-galactosidase staining decreased, it was confirmed that i-MT (Preparation Example 1) administration had a positive anti-aging effect (Fig. 30).

[0253] For p16 analysis, IFA fluorescence staining analysis was performed using a p16 antibody (abcam, ab211542). The experimental results showed that p16 tended to increase in old mice compared to young mice, and that its expression level tended to decrease when i-MT was treated. In particular, a statistically significant decrease was confirmed in the group treated with 2.5 μg of i-MT (Preparation Example 1) (Figs. 31a and 31b).

[0254] IFA fluorescence staining analysis was also performed using the p21 antibody (abcam, ab188224). The results showed that p21 expression tended to increase in aged mice compared to young mice, and that its expression level tended to decrease when treated with i-MT. In particular, a statistically significant reduction was observed in the group treated with 5.0 μg of i-MT (Preparation Example 1) in aged mice (Figures 32a and 32b).

[0255] IFA fluorescence staining analysis was performed using the gH2AX antibody (abcam, ab11174), a DNA damage marker. The experimental results showed that the gH2AX marker tended to increase in old mice compared to young mice, and its expression level tended to decrease when i-MT was treated. In particular, a statistically significant reduction effect was confirmed in the groups administered 5.0 μg and 10 μg of i-MT (Preparation Example 1) (Figs. 33a and 33b).

[0256] All data were calculated and statistically analyzed based on quantitative intensity values ​​using each Image J of n=5, and all statistical analyses were conducted using Mann Whitney Two-tailed t-test analysis.

Claims

1. A pharmaceutical composition for preventing or treating degenerative brain diseases, comprising mitochondria derived from induced pluripotent stem cells.

2. A composition according to claim 1, wherein the induced pluripotent stem cell is derived from one or more cells selected from the group consisting of peripheral blood mononuclear cells, fibroblasts, hepatocytes, adipocytes, epithelial cells, epidermal cells, chondrocytes, muscle cells, cardiac muscle cells, melanocytes, neural cells, glial cells, astroglial cells, monocytes, and macrophages.

3. A composition according to claim 1, wherein the degenerative brain disease is a degenerative brain disease caused by aging or inflammation.

4. A composition according to claim 1, wherein the degenerative brain disease is caused by aggregation of beta-amyloid protein.

5. A pharmaceutical composition according to claim 1, wherein the degenerative brain disease is at least one selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, mild cognitive impairment, cerebral amyloid angiopathy, amyloid stroke, senile dementia, and amyotrophic lateral sclerosis.

6. A composition according to claim 1, wherein the mitochondria alleviate the degree of beta-amyloid aggregation.

7. A composition according to claim 1, wherein the mitochondria increase the expression of at least one selected from the group consisting of MAP2 (microtubule-associated protein 2) and TUJ1 (class III beta-tubulin).

8. A composition according to claim 1, wherein the mitochondria reduce the expression of at least one selected from the group consisting of TNF-α, β-galactosidase, p16, p21, and gH2AX.

9. A composition according to claim 1, wherein the mitochondria increases at least one selected from the group consisting of blood red blood cell concentration, blood hemoglobin concentration, hematocrit, and blood HDL concentration.

10. A composition according to claim 1, wherein the mitochondria reduce at least one selected from the group consisting of the ratio of the number of monocytes to the total number of white blood cells and the ratio of the number of basophils to the total number of white blood cells.

11. A composition according to claim 1, wherein the mitochondria reduce at least one selected from the group consisting of average platelet volume fraction and blood urea nitrogen concentration.

12. Health functional food for preventing or improving degenerative brain diseases containing mitochondria derived from induced pluripotent stem cells.

Images