Primer and probe for detecting salmonella pullorum, and kit

Abstract

A primer and probe for detecting Salmonella pullorum, and a kit. The primer comprises SP-F and SP-R for detecting the target sequence of the Salmonella pullorum (SP) citE2 gene, and the probe is modified with a fluorescent reporter group and a fluorescent quenching group. By means of providing the primer pair of SP-F and SP-R, which pair specifically binds to the target sequence of the citE2 gene, and combining the primer pair with the probe, whic is used for specific recognition, the accurate and sensitive detection of Salmonella pullorum can be realized.

Description

Primer and probe for detecting salmonella pullorum and kit

[0001] Cross-reference to Related Applications

[0002] This application claims priority to the Chinese patent application No. 202410744062.7, filed on June 11, 2024, and entitled "Primer and probe for detecting salmonella pullorum and kit", the entire content of which is incorporated herein by reference. TECHNICAL FIELD

[0003] The present application relates to the field of biotechnology detection, in particular to a primer and probe for detecting salmonella pullorum and a kit. BACKGROUND

[0004] Salmonella pullorum (SP) is a serotype of bacteria, and its infection will lead to infectious pullorum disease. Salmonella pullorum can infect chickens of all ages, and the mortality rate is highest in 2-3 week-old chicks. Infected adult chickens show clinical symptoms such as decreased egg production, diarrhea, weight loss, reduced fertility and hatching rate of breeding eggs, and long-term asymptomatic carriage of salmonella pullorum. There are mainly two transmission routes of salmonella pullorum: one is horizontal transmission, that is, after invading the intestinal epithelium, it can be excreted with feces to infect other individuals; the other is vertical transmission, salmonella pullorum is taken up by macrophages and dendritic cells and can continue to survive in cells, and then through the translocation of immune cells in the lymphatic system or blood stream, it migrates to the reproductive system, and the pathogen can infect eggs or offspring to start the next infection cycle. As a facultative intracellular pathogen, salmonella pullorum is difficult to be completely eliminated by antibacterial drugs or immune cells and antibodies produced by the immune system during carriage or persistent infection, therefore, the widespread transmission of salmonella pullorum seriously hinders the development of poultry industry.

[0005] Early and rapid detection of salmonella pullorum is the basis for prevention and control and purification of the disease. Currently, biochemical reaction identification, plate agglutination test and ordinary PCR method are usually used to diagnose suspected salmonella pullorum infected samples. The traditional isolation and identification method is complicated and time-consuming, and since salmonella pullorum and salmonella gallinarum belong to the same serogroup, it is often difficult to distinguish using biochemical identification and plate agglutination test. Although plate agglutination test is simple, it lacks sensitivity and is easy to cause misjudgment. The specificity of ordinary PCR method is better than the first two methods, but the sensitivity and accuracy are poor.

[0006] SUMMARY

[0007] Therefore, the technical problem to be solved by the present application is to overcome the defects of poor sensitivity and low accuracy of the existing chicken white diarrhea Salmonella identification method, so as to provide a primer and probe, kit for detecting chicken white diarrhea Salmonella.

[0008] In one aspect, the present application provides a primer and probe for detecting chicken white diarrhea Salmonella, the primer comprising SP-F and SP-R for detecting the target sequence of citE2 gene of Salmonella Pullorum (SP), wherein the sequences of SP-F and SP-R are as follows:

[0009] SP-F: 5'-CCGTCGACATCGCCACCTCCAG-3' (SEQ ID NO: 1),

[0010] SP-R: 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3' (SEQ ID NO: 2);

[0011] The sequence of the probe is as follows:

[0012] 5'-TGCGCAGTGCTGCATGCGGCGCGC-3' (SEQ ID NO: 3),

[0013] Wherein, the probe is modified with a fluorescent reporter group and a fluorescent quenching group.

[0014] In some embodiments, the fluorescent reporter group and the fluorescent quenching group are modified to the 5' end of the probe sequence.

[0015] In some embodiments, the base number of the connecting gene between the fluorescent reporter group and the fluorescent quenching group is 7bp.

[0016] Optionally, the sequence of the connecting gene between the fluorescent reporter group and the fluorescent quenching group is as follows: 5'-TGGCAAT-3'.

[0017] In some embodiments, the fluorescent reporter group comprises at least one of FAM group, CY5 group, JOE group, CY3 group.

[0018] In some embodiments, the fluorescent quenching group comprises at least one of BHQ1 group, BHQ2 group.

[0019] In some embodiments, the 5' end of the connecting group is connected with the fluorescent reporter group, and the 3' end of the connecting group is connected with the fluorescent quenching group.

[0020] In some embodiments, the target sequence of the citE2 gene of the chicken white diarrhea Salmonella is as shown in SEQ ID NO: 4.

[0021] In some embodiments, the 5' end of the probe sequence is connected to a connecting sequence,

[0022] Optionally, the probe sequence is as follows:

[0023] 5'-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3'.

[0024] In another aspect, the present application provides a kit for detecting Salmonella pullorum, comprising the above-mentioned primer and probe.

[0025] In some embodiments, the kit further comprises a reagent system suitable for real-time fluorescent quantitative PCR reaction,

[0026] Optionally, the reagent system of TaqMan qPCR reaction, taking 20 μL as a unit, comprises 8-12 μL of premix, 0.4-0.6 μL of SP-F, 0.4-0.6 μL of SP-R, 0.1-0.4 μL of probe, 0.8-1.2 μL of DNA template, and the rest is nuclease-free water, wherein the molar concentration of SP-F is 8-12 μM, the molar concentration of SP-R is 8-12 μM, and the molar concentration of the probe is 8-12 μM.

[0027] Optionally, the reagent system of TaqMan qPCR reaction, taking 20 μL as a unit, comprises 10 μL of 2x Taq Pro HS premix, 0.5 μL of SP-F, 0.5 μL of SP-R, 0.3 μL of probe, 1 μL of DNA template, and the rest is nuclease-free water, wherein the molar concentration of SP-F is 10 μM, the molar concentration of SP-R is 10 μM, and the molar concentration of the probe is 10 μM.

[0028] In another aspect, the present application provides a method for detecting Salmonella pullorum, comprising the following steps,

[0029] S1, extracting genomic DNA of the sample to be detected as a DNA template;

[0030] S2, performing real-time fluorescence detection on the DNA template by using the above-mentioned primer and probe for detecting Salmonella pullorum or the above-mentioned kit for detecting Salmonella pullorum.

[0031] In some embodiments, the step S1 further comprises constructing a vector containing a citE2 gene target sequence by using the primer SP-F, the primer SP-R and the extracted genomic DNA, and the vector is the DNA template of step S2.

[0032] Optionally, the plasmid of the vector comprises a PUC19 plasmid.

[0033] In some embodiments, the extracted sample genomic DNA in the DNA template has a mass concentration of 30-1500 ng / μL.

[0034] The technical scheme has the following advantages:

[0035] 1. The primer and probe for detecting chicken white diarrhea salmonella provided by the application, the primer comprises SP-F and SP-R for detecting the target sequence of citE2 gene of chicken white diarrhea salmonella (Salmonella Pullorum, SP), wherein the sequences of SP-F and SP-R are as follows: SP-F: 5'-CCGTCGACATCGCCACCTCCAG-3' (SEQ ID NO: 1), SP-R: 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3' (SEQ ID NO: 2); the sequence of the probe is as follows: 5'-TGCGCAGTGCTGCATGCGGCGCGC-3' (SEQ ID NO: 3), wherein the probe is modified with a fluorescent reporter group and a fluorescent quenching group. The primer pair SP-F and SP-R provided by the application can specifically bind to the target sequence of citE2 gene, and the probe can specifically recognize, so that the chicken white diarrhea salmonella can be accurately and sensitively detected.

[0036] 2. The primer and probe for detecting chicken white diarrhea salmonella provided by the application, the fluorescent reporter group and the fluorescent quenching group are modified at the 5' end of the probe sequence. Based on the previous research, it is found that the citE2 gene is conservative in the enteric salmonella serotype, and does not exist in other salmonella serotypes and bacteria, and it is also found that the citE2 gene of chicken white diarrhea salmonella (Salmonella Pullorum, SP) has a fragment deletion compared with other enteric salmonella. Therefore, based on the characteristic that chicken white diarrhea salmonella has a deletion fragment compared with other enteric salmonella citE2 gene, the fluorescent reporter group and the fluorescent quenching group are modified at the 5' end of the probe sequence, so that the chicken white diarrhea salmonella can be specifically recognized. This is because when facing the genomes of other enteric salmonella except chicken white diarrhea salmonella, the probe sequence with fluorescent groups and quenching groups cannot be base complementary to the target sequence due to the deletion of the gene fragment of chicken white diarrhea salmonella in the genomes of other enteric salmonella, so that the probe sequence cannot be cut by DNA polymerase to produce a fluorescent signal in the PCR stage. When facing the genome of chicken white diarrhea salmonella, the probe sequence can be complementary to the target sequence, so that the probe sequence can be cut by DNA polymerase to produce a fluorescent signal, thereby achieving specific recognition of chicken white diarrhea salmonella and other enteric salmonella.

[0037] 3.The primer and probe for detecting Salmonella pullorum or the kit consisting of the primer and probe for detecting Salmonella pullorum provided by the application can provide efficient and reliable technical support for the diagnosis, epidemic monitoring and prevention and control of Salmonella pullorum, and exhibit high application value in livestock and poultry breeding. The detection method is simple in operation, high in detection rate, specificity and sensitivity, can detect Salmonella pullorum from most tissue structures of chickens, and is high in universality. BRIEF DESCRIPTION OF DRAWINGS

[0038] In order to more clearly illustrate the technical solutions in the specific embodiments or prior art of the present application, the drawings needed to be used in the description of the specific embodiments or prior art will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0039] Fig. 1 is a schematic diagram of the principle of specific recognition of the probe for Salmonella pullorum according to the present application;

[0040] Fig. 2 is a standard curve of the Ct value of the genomic DNA of Salmonella pullorum at different dilution concentrations of bacterial liquid in the experimental example 1 of the present application;

[0041] Fig. 3 is a fluorescence quantitative PCR amplification curve of the genomic DNA of Salmonella pullorum at different dilution concentrations of bacterial liquid in the embodiment 1 of the present application;

[0042] Fig. 4 is a standard curve of the Ct value of the plasmid at different copy numbers in the experimental example 2 of the present application;

[0043] Fig. 5 is a fluorescence quantitative PCR amplification curve of the plasmid at different copy numbers in the embodiment 2 of the present application;

[0044] Fig. 6 is a specific detection result diagram of Salmonella pullorum in the experimental example 3 of the present application;

[0045] Fig. 7 is the detection rate and Ct value of Salmonella pullorum in each tissue organ in the experimental example 4 of the present application, wherein Fig. A is the detection rate and Ct value in the ovary, Fig. B is the detection rate and Ct value in the funnel part, Fig. C is the detection rate and Ct value in the enlarged part, Fig. D is the detection rate and Ct value in the isthmus, Fig. E is the detection rate and Ct value in the uterus, Fig. F is the detection rate and Ct value in the vagina, Fig. G is the detection rate and Ct value in the spleen, Fig. H is the detection rate and Ct value in the liver, Fig. I is the detection rate and Ct value in the blood, Fig. J is the detection rate and Ct value in the feces, Fig. K is the detection rate and Ct value in the bile, and Fig. L is the detection rate and Ct value in the egg yolk;

[0046] Fig. 8 is a heat map of the detection rate of Salmonella pullorum in each tissue organ in the embodiment 4 of the present application. DETAILED DESCRIPTION

[0047] The following examples are provided to better enable those skilled in the art to further understand the application, and are not intended to limit the content and scope of the application. The application is not limited to the best mode contemplated, and is intended to encompass any and all products which fall within the scope of the application, either alone or in combination with other features of the prior art. Any product which is the same as or similar to the application derived from the disclosure of the application or from the combination of the application with other prior art features falls within the scope of the application.

[0048] The specific experimental steps or conditions not mentioned in the examples can be performed according to the conventional experimental steps or conditions described in the literature in the art. The reagents or instruments used are not specified by the manufacturer, and are conventional reagent products that can be obtained commercially.

[0049] The inventors used the NCBI BLAST tool to perform sequence alignment of the citE2 gene from Salmonella enterica serovars, other Salmonella subspecies, and other bacteria. The results showed that the citE2 gene is conserved in Salmonella enterica serovars, but does not exist in other Salmonella serovars and bacteria. It was also found that the citE2 gene of chicken pullorum Salmonella (Salmonella Pullorum, SP) has a 76 bp gene fragment deletion compared to other Salmonella enterica serovars, and the deleted gene sequence is shown in SEQ ID NO: 5, specifically: 5'-TGGCGGCATTTGATTACGTGATGGATATGGGCACCAGCCGGGGCGATGGCACCGAGCTGTTCTACGCCCGCTGCGC-3'.

[0050] Subsequently, the inventors confirmed again that the 76 bp fragment deletion in the citE2 gene of the chicken pullorum Salmonella (Salmonella Pullorum, SP) genome is a conservative and specific deletion fragment of chicken pullorum Salmonella by comparing the whole genome sequences of the 299 chicken pullorum Salmonella (Salmonella Pullorum, SP) strains extracted earlier.

[0051] Therefore, according to the gene deletion fragment, specific primers and specific probes are designed by using SnapGene software, which can specifically recognize the conserved region sequence of the citE2 specific gene fragment deletion in the genome of chicken white dysentery Salmonella. The conserved region is the citE2 gene target sequence, which is shown as SEQ ID NO: 4, specifically, 5'-CCGTCGACATCGCCACCTCCAGCCCGCGCATGGTGGCAATTGCGCAGTGCTGCATGCGGCGCGCGTTGCGGGTATTGCCGCCTATGATGTCGTTTGGTCGGATATCAATAATGAAGAAGGCTTCCTGAAGGAAGTGCAGTTGGCGAAAGGG-3', recorded on NCBI, BioProject accession PRJNA689917, and the position range is 1173217-1173367.

[0052] wherein the specific primers include a forward primer SP-F and a reverse primer SP-R,

[0053] The sequence of SP-F is shown as SEQ ID NO: 1,

[0054] specifically 5'-CCGTCGACATCGCCACCTCCAG-3',

[0055] The sequence of SP-R is shown as SEQ ID NO: 2,

[0056] specifically 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3',

[0057] The sequence of the specific probe is shown as SEQ ID NO: 3,

[0058] specifically 5'-TGCGCAGTGCTGCATGCGGCGCGC-3'.

[0059] Meanwhile, in order to distinguish Salmonella pullorum from other enteric Salmonella and achieve specific detection, the application utilizes the characteristic that Salmonella pullorum and other enteric Salmonella citE2 genes have a deletion fragment, modifies a fluorescent reporter group and a fluorescent quenching group to the 5' end of the probe sequence, and realizes specific recognition of Salmonella pullorum. This is because, referring to FIG. 1, when facing the genomes of other enteric Salmonella other than Salmonella pullorum, since the genomes of other enteric Salmonella have the deletion gene fragment of Salmonella pullorum, the DNA connecting the fluorescent group and the quenching group in the probe sequence cannot be base complementary pairing with the target sequence, thereby causing that it cannot be cut by DNA polymerase to produce a fluorescent signal in the PCR stage, while when facing the genome of Salmonella pullorum, the probe sequence can be completely complementary to the target sequence, thereby being able to be cut by DNA polymerase to produce a fluorescent signal, realizing specific recognition of Salmonella pullorum and other enteric Salmonella.

[0060] The primers and probes in the application are synthesized by Hangzhou Shangya Company.

[0061] In the embodiments of the application, Salmonella pullorum (SP), Salmonella Gallinarum, Salmonella Enteritidis, Salmonella Newport, Salmonella Typhimurium, and Salmonella Dublin are referenced from the literature Zhou X, Kang X, Chen J, Song Y, Jia C, Teng L, et al. Genome degradation promotes Salmonella pathoadaptation by remodeling fimbriae-mediated proinflammatory response. National Science Review 2023: nwad228, Escherichia coli (ATCC25922), Staphylococcus aureus (ATCC25923), Listeria monocytogenes (ATCC19114), and Bacillus cereus (ATCC49064) are purchased from the ATCC standard strain library, and the above strains are stored in the laboratory of the Hangzhou Institute for Advanced Study, University of Science and Technology of China.

[0062] The commercialized genomic DNA extraction kit in the embodiments and experimental examples of the present application is purchased from Zhejiang Yiside Biotechnology Co., Ltd., model number DR0301250, 2x Taq Pro HS premix is purchased from Nanjing Nuowezan, model number QN111-01, gel recovery kit is purchased from Zhejiang Yiside Biotechnology Co., Ltd., model number DR0101250, plasmid extraction kit is purchased from Zhejiang Yiside Biotechnology Co., Ltd., model number DR0201250, tissue genomic DNA extraction kit is purchased from Tiangeng Biochemical Technology Co., Ltd., model number DP304, PUC19 plasmid is from the market, and the PUC19 plasmid in the embodiments of the present application is purchased from Shengong Bioengineering (Shanghai) and stored in the laboratory of the Hangzhou Higher Research Institute of the Chinese Academy of Sciences.

[0063] Embodiment 1

[0064] The present embodiment provides a detection method for Salmonella pullorum, and the specific steps and parameters are as follows:

[0065] (1) Extraction of Salmonella pullorum genomic DNA:

[0066] The strain of Salmonella pullorum to be detected is inoculated into sterile LB liquid medium and placed in a shaker at 37°C and 180 rpm for overnight fermentation to obtain a bacterial solution;

[0067] The fermented bacterial solution is centrifuged at 7000 rpm for 15 minutes in a centrifuge at 4°C, the supernatant is discarded, and the bacterial precipitate is used to extract genomic DNA using a commercialized genomic DNA extraction kit (DR0301250, Yiside, China), followed by determination of the genomic DNA concentration using an ultramicro nucleic acid protein spectrophotometer, and storage in a -20°C refrigerator for standby use.

[0068] (2) qPCR detection

[0069] qPCR detection is performed according to the reaction system in Table 1 and the reaction procedure in Table 2, wherein the DNA template in Table 1 is the genomic DNA extracted in step (1), the primer SP-F sequence is as shown in SEQ ID NO: 1, specifically 5'-CCGTCGACATCGCCACCTCCAG-3', the primer SP-R sequence is as shown in SEQ ID NO: 2, specifically 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3', the TaqMan probe sequence is modified with a FAM fluorescent reporter group and a BHQ1 fluorescent quenching group, and the sequence is as follows, specifically

[0070] 5'-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3'.

[0071] Table 1 PCR reaction system

[0072] Table 2 PCR reaction procedure

[0073] Example 2

[0074] The present embodiment provides a detection method of Salmonella pullorum, and the specific steps and parameters are as follows:

[0075] (1) Extraction of Salmonella pullorum genomic DNA:

[0076] Inoculate the strain of Salmonella pullorum to be detected into sterile LB liquid medium, and place it in a shaker at 37°C and 180 rpm for overnight fermentation to obtain a bacterial solution;

[0077] Centrifuge the fermented bacterial solution at 7000 rpm in a centrifuge at 4°C for 15 minutes, discard the supernatant, and extract the genomic DNA from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, Yiside, China). Store it in a -20°C refrigerator for standby use.

[0078] (2) Vector construction

[0079] Using the genomic DNA extracted in step (1) as a template, perform PCR amplification reaction using forward primer SP-F and reverse primer SP-R. The PCR reaction system is 2x Taq Pro HS premix 10 μL, 10 μM SP-F 0.5 μL, 10 μM SP-R 0.5 μL, genomic DNA 1 μL, and nuclease-free water 8 μL. The reaction program is shown in Table 2 in Example 1. The citE2 gene target fragment is obtained after the reaction, wherein the sequence of the citE2 gene target fragment is shown in SEQ ID NO: 4, and the specific sequence is as follows: 5'-CCGTCGACATCGCCACCTCCAGCCCGCGCATGGTGGCAATTGCGCAGTGCTGCATGCGGCGCGCGTTGCGGGTATTGCCGCCTATGATGTCGTTTGGTCGGATATCAATAATGAAGAAGGCTTCCTGAAGGAAGTGCAGTTGGCGAAAGGG-3', wherein the sequence of primer SP-F is shown in SEQ ID NO: 1, and specifically 5'-CCGTCGACATCGCCACCTCCAG-3', and the sequence of SP-R is shown in SEQ ID NO: 2, and specifically 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3'.

[0080] The target fragment was recovered by using a gel recovery kit (DR0101250, Yiside, China), inserted into a PUC19 plasmid vector by using a seamless cloning technique, and then transformed into DH5a competent cells, positive clones were screened and verified by sequencing.

[0081] The plasmid containing the target fragment was extracted by using a plasmid extraction kit (DR0201250, Yiside, China), and was a PUC19-citE2 plasmid. The plasmid concentration was determined by using a ultramicro nucleic acid protein spectrophotometer, and was converted into copy number according to the plasmid molecular weight, and then stored at -20℃ for use.

[0082] (3) qPCR detection

[0083] The extracted genomic DNA was detected by qPCR according to the reaction system in Table 1 and the reaction procedure in Table 2 in Example 1, wherein the DNA template was the plasmid containing the target fragment prepared in step (2), i.e., the PUC19-citE2 plasmid, the TaqMan probe sequence was modified with a FAM fluorescent reporter group and a BHQ1 fluorescent quenching group, and the probe sequence was as follows: 5'-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3', and the primers were the same as those in step (2) of this example.

[0084] Example 3

[0085] This example provides a detection method for Salmonella pullorum, and the specific steps and parameters are as follows:

[0086] (1) Extraction of Salmonella pullorum genomic DNA:

[0087] The strain of Salmonella pullorum to be detected was inoculated into sterile LB liquid medium and fermented overnight at 37℃ and 180 rpm in a shaker to obtain a bacterial solution;

[0088] The fermented bacterial solution was centrifuged at 7000 rpm for 15 minutes in a centrifuge at 4℃, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate by using a commercial genomic DNA extraction kit (DR0301250, Yiside, China). The genomic DNA concentration was determined by using a ultramicro nucleic acid protein spectrophotometer, and was stored at -20℃ for use.

[0089] (2) qPCR detection

[0090] qPCR detection was performed according to the reaction procedure of Table 2 in Example 1, and the reaction system was 2x Taq Pro HS premix 8 μL, 8 μM of SP-F 0.6 μL, 12 μM of SP-R 0.4 μL, DNA template 1.2 μL, nuclease-free water 9.7 μL, and 8 μM of TaqMan probe 0.1 μL, wherein the DNA template was the genomic DNA prepared in step (1), the TaqMan probe was modified with a CY5 fluorescent reporter group and a BHQ1 fluorescent quencher group, and the sequence was as follows: 5'-CY5-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3', and the primers were the same as in step (2) of Example 1.

[0091] Example 4

[0092] This example provides a detection method for Salmonella pullorum, and the specific steps and parameters are as follows:

[0093] (1) Extraction of Salmonella pullorum genomic DNA:

[0094] The strain of Salmonella pullorum to be detected was inoculated into sterile LB liquid medium and fermented overnight at 37°C and 180 rpm in a shaker to obtain a bacterial solution;

[0095] The fermented bacterial solution was centrifuged at 7000 rpm for 15 minutes in a centrifuge at 4°C, and the supernatant was discarded. The genomic DNA was extracted using a commercial genomic DNA extraction kit (DR0301250, Yiside, China), and then the genomic DNA concentration was determined using an ultramicro nucleic acid protein spectrophotometer. The genomic DNA was stored in a -20°C refrigerator for standby use.

[0096] (2) qPCR detection

[0097] qPCR detection was performed according to the reaction procedure of Table 2 in Example 1, and the reaction system was 2x Taq Pro HS premix 10 μL, 12 μM of SP-F 0.4 μL, 8 μM of SP-R 0.6 μL, DNA template 0.8 μL, nuclease-free water 7.8 μL, and 8 μM of TaqMan probe 0.4 μL, wherein the DNA template was the genomic DNA prepared in step (1), the TaqMan probe was modified with a CY3 fluorescent reporter group and a BHQ2 fluorescent quencher group, and the sequence was as follows: 5'-CY3-TGGCAAT-BHQ2-TGCGCAGTGCTGCATGCGGCGCGC-3', and the primers were the same as in step (2) of Example 1.

[0098] Example 5

[0099] This example provides a detection method for Salmonella pullorum, and the specific steps and parameters are as follows:

[0100] (1)Salmonella pullorum genomic DNA extraction:

[0101] The strain of Salmonella pullorum to be detected was inoculated into sterile LB liquid medium and fermented overnight at 37°C and 180 rpm in a shaker to obtain a bacterial solution;

[0102] The fermented bacterial solution was centrifuged at 7000 rpm for 15 minutes in a centrifuge at 4°C, the supernatant was discarded, and the bacterial precipitate was used to extract genomic DNA using a commercial genomic DNA extraction kit (DR0301250, Yiside, China). The genomic DNA was stored in a -20°C refrigerator for standby use.

[0103] (2) Vector construction

[0104] The genomic DNA extracted in step (1) was used as a template for PCR amplification reaction using forward primer SP-F and reverse primer SP-R. The PCR reaction system was 2x Taq Pro HS premix 10 μL, 10 μM SP-F 0.5 μL, 10 μM SP-R 0.5 μL, DNA template 1 μL, and nuclease-free water 8 μL. The reaction program is shown in Table 2 in Example 1. The citE2 gene target fragment was obtained after the reaction, wherein the sequence of the citE2 gene target fragment is shown as SEQ ID NO: 4. The primers are the same as those in step (2) of Example 1.

[0105] The target fragment was recovered using a gel recovery kit (DR0101250, Yiside, China), and the target fragment was inserted into a PUC19 plasmid vector using seamless cloning technology, and then transformed into DH5α competent cells. Positive clones were screened and verified by sequencing.

[0106] The plasmid containing the target fragment was extracted using a plasmid extraction kit (DR0201250, Yiside, China) to obtain a PUC19-citE2 plasmid. The plasmid concentration was determined using an ultramicro nucleic acid protein spectrophotometer, and the copy number was converted according to the plasmid molecular weight, and then stored at -20°C for standby use.

[0107] (3) qPCR detection

[0108] The qPCR detection was carried out according to the reaction procedure of Table 2 in Example 1, wherein the reaction system was 8 μL of 2x Taq Pro HS premix, 0.6 μL of 8 μM SP-F, 0.4 μL of 12 μM SP-R, 1.2 μL of DNA template, 9.5 μL of nuclease-free water, and 0.3 μL of 8 μM TaqMan probe. The DNA template was the plasmid containing the target fragment prepared in step (2) of the present example, i.e., the PUC19-citE2 plasmid. The TaqMan probe was modified with a JOE fluorescent reporter group and a BHQ1 fluorescent quencher group, and the sequence of the probe was as follows: 5'-JOE-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3', and the primers were the same as those in step (2) of Example 1.

[0109] 5'-JOE-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3', and the primers were the same as those in step (2) of Example 1.

[0110] Experimental Example 1

[0111] The fermentation broth obtained in step (1) of Example 1 was diluted step by step, and the OD 600 values and the number of bacteria of each bacterial liquid concentration were determined. The OD 600 values were taken as the horizontal coordinates, and the CFU / μL was taken as the vertical coordinates to obtain an OD 600 -CFU / μL standard curve. According to the OD 600 -CFU / μL standard curve, the bacterial liquid concentration of the fermentation broth obtained in step (1) of Example 1 was adjusted to 4x10 9 CFU / μL, and the bacterial liquid concentration was diluted to 4x10 3 CFU / μL, 4x10 2 CFU / μL, 4x10 1 CFU / μL, and 4x10 0 CFU / μL, respectively, according to the gradient dilution method. The bacterial liquid with different concentrations was centrifuged at 7000 rpm for 15 minutes in a centrifuge at 4°C, the supernatant was discarded, and the bacterial precipitate was used to extract genomic DNA using a commercial genomic DNA extraction kit (DR0301250, Yiside, China). The genomic DNA extracted from the above bacterial liquid fermentation broth was used as the DNA template, and the Ct values of the genomic DNA at different bacterial liquid concentrations were determined according to the detection method of step (2) of Example 1. The detection method of each bacterial liquid concentration was repeated for 3 times.

[0112] The Ct values obtained by qPCR determination were plotted against the standard curve of the Salmonella pullorum genomic DNA, and the results are shown in Figure 2. It can be seen that the amplification efficiency of the detection method for the Salmonella pullorum genomic DNA was 90.55%, and a very strong linear relationship was formed with the concentration of the Salmonella pullorum genomic DNA (the correlation index R 2 = 0.9886).

[0113] The fluorescence quantitative PCR amplification curve of the genomic DNA of different bacterial liquid concentrations was drawn, as shown in Figure 3. The results showed that the detection sensitivity of the detection method of the present application for the genomic DNA of chicken pullorum Salmonella was 4 CFU / μL.

[0114] Experimental Example 2

[0115] The PUC19-citE2 plasmid constructed in step (2) of Example 2 was diluted by gradient dilution to 5×10 0 copies / μL, 5×10 1 copies / μL, 5×10 2 copies / μL, 5×10 3 copies / μL, and 5×10 4 copies / μL of copy number per unit volume, respectively. The diluted PUC19-citE2 plasmid was used as a DNA template, and the Ct value of the DNA template at different copy numbers was determined according to the detection method of step (3) of Example 2. The detection method was repeated 3 times for each copy number.

[0116] The standard curve of the Ct value determined by qPCR and the copy number of the PUC19-citE2 plasmid was drawn, and the results are shown in Figure 4. It can be seen that the amplification efficiency of the detection method for the PUC19-citE2 plasmid was 98.11%, and a very strong linear relationship was formed with the copy number of the PUC19-citE2 plasmid (correlation index R 2 = 0.9975).

[0117] The fluorescence quantitative PCR amplification curve of the PUC19-citE2 plasmid at different copy numbers was drawn, as shown in Figure 5. The test results showed that the detection sensitivity of the detection method of the present application for the PUC19-citE2 plasmid was 5 copies / μL.

[0118] Experimental Example 3

[0119] The detection method of Example 1 was used to extract the genomic DNA of Salmonella Pullorum (SP), Salmonella Gallinarum, Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Dublin, Escherichia coli (ATCC25922), Staphylococcus aureus (ATCC25923), Listeria monocytogenes (ATCC19114) and Bacillus cereus (ATCC49064) respectively, and the genomic DNA of each of the above bacteria was detected by qPCR, and the real-time fluorescence quantitative PCR amplification curves of different strains were obtained, as shown in Figure 6.

[0120] According to the experimental results, the primer and probe of the application only produce a specific amplification curve for Salmonella Pullorum, and do not produce an amplification curve for other Salmonella serotypes and other bacterial genomes, which indicates that the detection method can specifically detect Salmonella Pullorum.

[0121] Experimental Example 4

[0122] (1) Construction of Salmonella Pullorum infection model

[0123] Sixty 180-day-old specific pathogen-free hens were infected by orally inoculating Salmonella Pullorum, and the infection method was oral inoculation of Salmonella Pullorum. The amount of Salmonella Pullorum bacteria inoculated in each hen in this model construction was 10 9 CFU.

[0124] (2) Detection of Salmonella Pullorum

[0125] After infection, 12 tissue samples were collected from 10 infected hens every week for 6 weeks, including feces, liver, spleen, blood, bile, ovary, funnel part, swollen part, isthmus, uterus, vagina and egg yolk.

[0126] The tissue samples were ground in liquid nitrogen, and the tissue genomic DNA was obtained using a tissue genomic DNA extraction kit (DP304, Tiangen, China). The genomic DNA of the tissue samples was used as a DNA template, and the detection method of step (2) of Example 1 was used to detect Salmonella Pullorum in the tissue samples, and the results are shown in Figures 7-8 (where 3.3e-002 represents 0.03333…, and 3 is an infinite cycle).

[0127] The results show that the primers and probes provided by the application can detect chicken white dysentery Salmonella from chicken feces, liver, spleen, blood, bile, ovary, infundibulum, dilatation, isthmus, uterus, vagina, egg yolk, especially the detection rate in liver, spleen, blood, ovary, infundibulum, dilatation, isthmus, uterus, vaginal tissue is greater than 50%, among them, the ovary sample maintains the highest detection rate in all infected weeks, with an average of 80%.

[0128] Obviously, the above examples are only examples for clearly illustrating, but not limitation to the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the embodiments need not and can not be exhausted. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A primer and a probe for detecting Salmonella pullorum, characterized by, The primers comprise SP-F and SP-R for detecting a target sequence of a citE2 gene of Salmonella Pullorum (SP), wherein the sequences of SP-F and SP-R are as follows: SP-F: 5'-CCGTCGACATCGCCACCTCCAG-3' (SEQ ID NO: 1), SP-R: 5'-CCCTTTCGCCAACTGCACTTCCTTCAG-3' (SEQ ID NO: 2). The probe sequence is as follows: 5'-TGCGCAGTGCTGCATGCGGCGCGC-3' (SEQ ID NO: 3), The probe is modified with a fluorescent reporter group and a fluorescent quencher group.

2. The primer and probe for detecting Salmonella pullorum according to claim 1, wherein, The fluorescent reporter group and the fluorescent quencher group are modified at the 5' end of the probe sequence.

3. The primer and probe for detecting Salmonella pullorum according to claim 2, wherein, The number of base pairs of the connecting sequence between the fluorescent reporter group and the fluorescent quencher group is 7 bp.

4. The primer and probe for detecting Salmonella pullorum according to claim 3, wherein, The connecting sequence between the fluorescent reporter group and the fluorescent quencher group is as follows: 5'-TGGCAAT-3'.

5. The primer and probe for detecting Salmonella pullorum according to claim 4, wherein The fluorescent reporter group comprises at least one of a FAM group, a CY5 group, a JOE group, and a CY3 group; and / or, The fluorescent quencher group comprises at least one of a BHQ1 group and a BHQ2 group; and / or, The fluorescent reporter group is connected at the 5' end of the connecting sequence, and the fluorescent quencher group is connected at the 3' end of the connecting sequence.

6. The primer and probe for detecting Salmonella pullorum according to any one of claims 1-5, wherein, The target sequence of the citE2 gene of Salmonella Pullorum is as shown in SEQ ID NO: 4; and / or, The probe sequence is as follows: 5'-FAM-TGGCAAT-BHQ1-TGCGCAGTGCTGCATGCGGCGCGC-3'.

7. A kit for detecting Salmonella pullorum, characterized by comprising the polynucleotide of claim 1 or 2. The kit comprises the primers and the probe for detecting Salmonella Pullorum according to any one of claims 1-6.

8. The kit for detecting Salmonella pullorum according to claim 7, characterized by, The kit further comprises a reagent system suitable for a real-time fluorescent quantitative PCR reaction, The reagent system of the TaqMan qPCR reaction comprises, in 20 μL, 8-12 μL of a premix, 0.4-0.6 μL of SP-F, 0.4-0.6 μL of SP-R, 0.1-0.4 μL of the probe, 0.8-1.2 μL of a DNA template, and the rest is nuclease-free water, wherein the molar concentration of SP-F is 8-12 μM, the molar concentration of SP-R is 8-12 μM, and the molar concentration of the probe is 8-12 μM.

9. A method for detecting Salmonella pullorum, characterized by, The method comprises the following steps: S1, extracting genomic DNA of a sample to be detected as a DNA template; S2, performing real-time fluorescence detection on the DNA template obtained in step S1 by using the primers and the probe for detecting Salmonella Pullorum according to any one of claims 1-6 or the kit for detecting Salmonella Pullorum according to any one of claims 7-8.

10. The detection method according to claim 9, characterized in that, Step S1 further comprises constructing a vector containing a target sequence of a citE2 gene by using the primers SP-F, the primers SP-R, and the extracted genomic DNA, and the vector is the DNA template of step S2; The plasmid of the vector comprises a PUC19 plasmid.

Images