Pharmaceutical composition for preventing or treating sepsis comprising mir-223 inhibitor

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating sepsis, comprising an miR-223 gene expression inhibitor. The pharmaceutical composition comprising an miR-223 gene expression inhibitor, according to the present invention, inhibits cell death, and thus has the effect of preventing or treating sepsis.

Description

Pharmaceutical composition for preventing or treating sepsis comprising a MIR-223 inhibitor

[0001] The present invention relates to a pharmaceutical composition for preventing or treating sepsis comprising a miR-223 inhibitor.

[0002] Sepsis is a disease that can lead to death because inflammation causes cell death, and cell death worsens organ failure, which can lead to death. When sepsis is accompanied by low blood pressure, it is called septic shock, and the mortality rate is higher than that of sepsis. Sepsis is caused by various infections in organs, such as pneumonia, pyelonephritis, meningitis, cellulitis, infective endocarditis, peritonitis, bedsores, cholecystitis, and cholangitis. When these infections occur, the causative microorganisms can invade the bloodstream, or the inflammatory response and inflammatory substances in the organ can progress to sepsis. Microorganisms known to cause sepsis include Streptococcus, Staphylococcus aureus, Escherichia coli, Streptococcus pneumoniae, and Pseudomonas aeruginosa.

[0003] There is no specific diagnostic method for sepsis. Therefore, a comprehensive assessment must be made based on the patient's body temperature, pulse rate, respiratory rate, blood pressure, and white blood cell and lactate levels in blood tests. It is crucial to diagnose the presence of an infection that could be the cause of sepsis. Treatment of sepsis involves maintaining the patient's blood pressure appropriately through massive fluid administration and vasopressors, and prompt administration of broad-spectrum antibiotics. However, despite appropriate treatment, the mortality rate of sepsis remains extremely high, exceeding 20%. As of 2020, the sepsis mortality rate was 11.9 per 100,000 people, a 1% increase from the previous year. Therefore, to reduce the mortality rate of sepsis, methods for prevention and early diagnosis must be found, and the development of new treatments is urgently needed.

[0004] One aspect of the present invention provides a pharmaceutical composition for preventing or treating sepsis comprising a miR-223 inhibitor.

[0005] Another aspect of the present invention provides a method for screening a sepsis treatment agent, comprising the steps of treating a cell with a candidate substance; measuring the level of miR-223 expression in the cell treated with the candidate substance; and selecting a candidate substance that reduces the measured level of miR-223 expression compared to an untreated control.

[0006] One aspect of the present invention provides a pharmaceutical composition for preventing or treating sepsis comprising a miR-223 inhibitor.

[0007] According to one specific example, the miR-223 inhibitor may include at least one selected from the group consisting of an antisense nucleotide, siRNA (small interfering RNA), and shRNA (short hairpin RNA) for a polynucleotide constituting the miR-223 gene.

[0008] According to one specific example, the miR-223 inhibitor may inhibit cell death.

[0009] According to one specific example, the miR-223 inhibitor may reduce p38 and TGF-β gene or protein expression.

[0010] Another aspect of the present invention provides a method for screening a sepsis treatment agent, comprising the steps of treating a cell with a candidate substance; measuring the level of miR-223 expression in the cell treated with the candidate substance; and selecting a candidate substance that reduces the measured level of miR-223 expression compared to an untreated control.

[0011] According to the pharmaceutical composition comprising the miR-223 inhibitor of the present invention, it has the effect of preventing or treating sepsis by inhibiting cell death.

[0012] Figure 1 shows receiver operating characteristic curves (ROC) curves showing the area under the curve of exosomal miR-223 for predicting 28-day mortality in (A) the derivation cohort and (B) the validation cohort.

[0013] Figure 2 is a graph of 90-day mortality using Kaplan-Meier survival estimation according to exosomal miR-223 levels in (A) the derivation cohort and (B) the validation cohort.

[0014] Figure 3 shows the results of GO (Gene ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis for exosomal miR-223, including (A) KEGG pathway for differential expression of miR-223-derived genes, (B) GO analysis of biological processes, (C) GO analysis of molecular functions, and (D) GO analysis of cellular components.

[0015] Figure 4 is a graph showing the efficiency of transfection of each miRNA of the miR-223 mimic control group (mimic-control), miR-223 mimic group (mimic), miR-223 inhibitor control group (inhibitor), and miR-223 inhibitor group (inhibitor) in (A) THP-1, (B) HUVEC, and (C) Jurkat T cells.

[0016] Figure 5 is a diagram showing the viability of THP-1, HUVEC, and Jurkat T cells after (A) miR-223 mimic transfection and (B) miR-223 inhibitor transfection using colony formation assay and CCK8 assay.

[0017] Figure 6 shows data quantifying TGF-β levels by qPCR after infection of (A) THP-1, (B) HUVEC, and (C) Jurkat T cells with miR-223 mimic control, miR-223 mimic, miR-223 inhibitor control, and miR-223 inhibitor.

[0018] Figure 7 shows the quantitative data of downstream factors (ERK, JNK, and p38) of the TGF-β pathway by qPCR after infecting THP-1, HUVEC, and Jurkat T cells with miR-223 mimic control, miR-223 mimic, miR-223 inhibitor control, and miR-223 inhibitor.

[0019] Figure 8 shows data analyzed by Western blot of the TGF-β signal pathway in (A) THP-1, (B) HUVEC, and (C) Jurkat T cells.

[0020] Figure 9 shows data analyzed by Western blot of ERK, JNK, and p38, which are downstream effectors of the TGF-β pathway, in (A) THP-1, (B) HUVEC, and (C) Jurkat T cells.

[0021]

[0022] One aspect is to provide a pharmaceutical composition for preventing or treating sepsis comprising a miR-223 inhibitor.

[0023] The above miR-223 refers to MicroRNA-223, which regulates the expression levels of other genes and was first identified as a regulator of bone marrow cell differentiation. miR-223 is the most highly expressed miRNA in plasma exosomes, and a recent meta-analysis found that miR-223 serves as a biomarker for sepsis. The exosomes are vesicles composed of lipid bilayers, and may transport intracellular biomolecules such as proteins, bioactive lipids, and RNA to perform functional roles in mediating cell-to-cell communication and cell-mediated immunity.

[0024] The above microRNA (miRNA) is a small non-coding RNA consisting of 20 to 25 nucleotides, and may be a substance that plays an important role in the post-transcriptional regulation of gene expression by binding to mRNA.

[0025] The above miR-223 inhibitor may inhibit the expression of miR-223 and may inhibit the production of miR-223 exosomes.

[0026] In one specific example, the miR-223 inhibitor may include at least one selected from the group consisting of an antisense nucleotide, a small interfering RNA (siRNA), and a short hairpin RNA (shRNA) for a polynucleotide constituting the miR-223 gene. For example, the miR-223 inhibitor may be performed using a mature miRNA of SEQ ID NO: 6.

[0027] The above antisense nucleotides, as defined by Watson-Crick base pairing, bind (hybridize) to complementary base sequences in DNA, immature mRNA, or mature mRNA, thereby disrupting the flow of genetic information from DNA to protein. Furthermore, because the antisense nucleotides are long chains of monomer units, they can be easily synthesized against a target RNA sequence.

[0028] The above siRNA refers to a short double-stranded RNA that can induce RNA interference through the cleavage of a specific mRNA. In addition, the siRNA is not limited to a double-stranded RNA portion where RNAs are paired completely, and may also include a portion that does not pair due to a mismatch (corresponding bases are not complementary), a bulge (there is no corresponding base in one chain), etc. The siRNA terminal structure can be either a blunt end or a protruding end as long as it can suppress the expression of a target gene through the RNA interference effect, and the sticky end structure can be either a 3' end protruding structure or a 5' end protruding structure.

[0029] The above shRNA refers to an RNA sequence that forms a rigid hairpin turn, which can be used to silence gene expression through RNA interference. Furthermore, the shRNA can be delivered into cells using a vector for cell introduction, and such vectors are always passed on to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is degraded into siRNA by intracellular mechanisms and binds to an RNA-induced silencing complex, which then binds to and degrades mRNA corresponding to the siRNA.

[0030] In one specific example, the miR-223 inhibitor may inhibit cell death.

[0031] In one embodiment, it was confirmed that cell viability increased when treated with the miR-223 inhibitor.

[0032] In one specific example, the miR-223 inhibitor may reduce p38 and TGF-β gene or protein expression.

[0033] In one embodiment, when the miR-223 inhibitor was treated to cells, it was confirmed that the expression of p38 and TGF-β genes or proteins in the cells was reduced compared to the control group.

[0034] The above 'prevention' means any act of inhibiting the onset of sepsis by using a composition containing a miR-223 inhibitor.

[0035] The above 'treatment' means any act of improving sepsis symptoms by using a composition containing a miR-223 inhibitor.

[0036] In the present invention, the pharmaceutical composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions, respectively, according to conventional methods. Specifically, when formulating, it may be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, and capsules. Such solid preparations may be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin, with a composition including the miR-223 gene expression inhibitor or a pharmaceutically acceptable salt thereof. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrosol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0037] The appropriate dosage of the composition of the present invention varies depending on the patient's condition and weight, the degree of the disease, the form of the drug, and the time, but can be appropriately selected by a person skilled in the art.

[0038]

[0039] Another aspect of the present invention provides a method for screening a sepsis treatment agent, comprising the steps of treating a cell with a candidate substance; measuring the level of miR-223 expression in the cell treated with the candidate substance; and selecting a candidate substance that reduces the measured level of miR-223 expression compared to an untreated control.

[0040] The above cells may be cells expressing miR-223. For example, they may be cells transfected with miR-223 transcripts into THP-1, HUVEC, and Jurkat T cells.

[0041] The above miR-223 expression level may be the expression level of a transcript transcribed or translated from the miR-223 gene, and a protein or fragment thereof translated therefrom. The transcript may include mRNA, non-coding RNA, or their complementary DNA (cDNA). The fragment may be a part of the protein and may be an immunogenic polypeptide.

[0042] The term "expression level" refers to the amount of a protein or transcript. The expression level may be a relative ratio of the protein or transcript. For example, a decrease in the expression level may indicate a decrease in the amount of the protein or transcript compared to a negative control.

[0043] The expression level of the above miR-223 may be performed by one or more methods selected from the group consisting of reverse transcription polymerase chain reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Realtime RT-PCR), RNase protection assay (RPA), Northern blotting, DNA chip, Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (Fluorescence Activated Cell Sorter, FACS), and protein chip.

[0044] Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0045]

[0046] Experimental Example 1: Study design, recruitment, and clinical data collection for the derivation and validation cohorts.

[0047] A derivation cohort was initiated in April 2014 to establish a human sample repository and develop novel biomarkers for severity variants. Patients in the derivation cohort were critically ill patients aged ≥18 years enrolled in an intensive care unit (ICU). Patients were excluded if they had (a) cognitive impairment, (b) inability to give informed consent (or lack of a legal representative), (c) end-of-life decisions or were admitted for convenience of care, or (d) hemoglobin levels <8 g / dL or persistent bleeding on admission.

[0048] The validation cohort consisted of critically ill patients aged 18 years or older enrolled in the intensive care unit of a different hospital from the derivation cohort. The validation cohort excluded patients with (a) cognitive impairment, (b) inability to provide informed consent (or lack of a legal representative), (c) uncontrolled hematologic malignancy, or (d) terminal solid tumors. Informed consent, including details regarding the study objectives, clinical data attainment, blood samples, and future reporting of collected data, was obtained from all study participants or their legal representatives. This study was approved by the institutional review boards of Samsung Medical Center (2012-12-033) and Asan Medical Center (2011-0001). Patients admitted to the intensive care unit were enrolled, and comprehensive clinical information, including baseline demographics and disease severity scores, laboratory data, and related outcomes, collected during the first 24 hours after admission to the intensive care unit were recorded.

[0049]

[0050] Experimental Example 2: Isolation and Quantification of Exosomal MiR-223

[0051] 2-1. Plasma separation

[0052] All samples were obtained by collecting whole blood in EDTA (ethylenediaminetetraacetic acid) tubes. After blood collection, the samples were spun at 480×g for 10 min at 4°C. Multiple plasma fractions were separated from each study participant's sample and frozen at -80°C until further analysis.

[0053]

[0054] 2-2. Exosome isolation and characterization

[0055] Plasma was thawed on ice and centrifuged at 1,500 × g for 15 min at 4 °C. Prior to exosome isolation and RNA purification, plasma samples were prefiltered using a 0.8 µm syringe filter, followed by additional centrifugation to remove residual cellular material. To isolate exosomes, 250 μL of filtered plasma was added to ExoQuick reagent (System Biosciences, Palo Alto, CA, USA) and incubated at 4 °C for 30 min. The ExoQuick / plasma mixture was centrifuged at 1,500 × g for 30 min, the supernatant was removed, and the EV pellet was centrifuged at 1,500 × g for 5 min to remove any residual ExoQuick solution. The EV pellet was resuspended in 200 μL of PBS, and the precipitated exosomes were used immediately.

[0056] To characterize plasma exosomes specific to various cell types, isolated exosomes were resuspended in phosphate-buffered saline containing 1% heat-inactive fetal bovine serum (FACS buffer) and incubated at 37°C for 15 minutes. Exosomes were then incubated with exosomal biomarker (CD63) and primary antibodies (CD235a, CD3, CD11B, CD4L). Exosomes were then washed twice with cold FACS buffer and stained with 0.25 μg of FITC-conjugated secondary antibody for 30 minutes at 4°C. After three washes with FACS buffer, flow cytometric data were acquired using a FACS Canto flow cytometer equipped with FACS Diva v8.0 software (BD Biosciences) and analyzed using FlowJo v10.0.5 (Tree Star, Asland, OR). During analysis, the number of exosomes was proportional to the number of fluorescently labeled exosomes. Furthermore, the concentration and size distribution of isolated exosomes were measured by nanoparticle tracking analysis (NTA) using a Nanosight NS300 (NanoSigh Ltd, Amebury, UK). Protein quantification of plasma-derived exosome preparations was performed using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, MA, USA).

[0057]

[0058] 2-3. Purification of total exosomal RNA from plasma exosomes

[0059] Exosomal RNA was extracted from plasma exosomes using the exoRNeasy Midi Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer's instructions. Briefly, filtered exosomes were washed and centrifuged using XBP and XWP buffers. Before RNA extraction, exosomes were eluted in 700 μl of QIAzol reagent (QIAGEN, Valencia, CA, USA) and mixed with RNA Spike-In Control (QIAGEN, Valencia, CA, USA). After adding 90 μl of chloroform to the lysate for subsequent phase separation, the upper phase containing RNA was transferred to a new collection tube. After mixing 400 μl of the aqueous phase and 800 μl of 100% ethanol, the mixture was transferred to an Rneasy MinElute Spin column (QIAGEN, Valencia, CA, USA) in a 2-ml collection tube. After centrifugation, RNA was bound to the column membrane, washed with Buffer RWT and RPE, and DNase / RNase-Free water was added. Total exosomal RNA was collected by centrifugation at 10,000 × g for 1–2 min.

[0060]

[0061] 2-4. RNA quality and integrity check

[0062] RNA purity and concentration were assessed spectrophotometrically using a NanoDrop ND-2000 (ThermoFisher, Waltham, MA, US). Quality, total RNA, and small RNA size were assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, US). Electron images were visualized using the Agilent 2100 Expert software, which includes data acquisition, peak detection, and interpretation of various profiles.

[0063]

[0064] 2-5. Quantification of exosomal miR-223

[0065] For detection and quantification of exosomal miR-223, cDNA was synthesized from the extracted exosomal RNA using the TaqMan miRNA cDNA Synthesis Kit (Applied Biosystems, MA, USA), using the primer sequences listed in Table 1 below.

[0066] Sequence number Sequence name Base sequence (5' > 3')1miR-223 forwardAGCCGTGTCAGTTTGTCAAAT2miR-223 reverseGTGCAGGGTCCGAGGTC3U6 forwardCTCGCTTCGGCAGCACA4U6 reverseAACGCTTCACGAATTTGCGT

[0067] miRNA expression was examined by real-time PCR using Green master mix (Exiqon, Vedbaek, Denmark) on an Applied Biosystems 7900 real-time PCR machine (Life Technologies, Carlsbad, CA, USA). The reaction conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 10 s and 60°C for 1 min.

[0068] The relative expression of miR-223 was normalized to the endogenous control miR-16 expression using the comparative cycle threshold (CT) method. When comparing different groups, data were log-transformed.

[0069]

[0070] Experimental Example 3: Cell Culture and Transformation

[0071] 3-1. miRNA expression profiling, target gene prediction, and pathway analysis related to sepsis.

[0072] To identify miRNAs important in regulating the sepsis process and confirm that miR-223 is upregulated in sepsis, we determined miRNA expression profiles in plasma exosomes from 135 sepsis patients and 11 healthy controls in a derivation cohort. For this purpose, we used miRCURY LNA miRNA Focus PCR Panels (QIAGEN, Hilgen, Germany), a quantitative real-time PCR-based microarray containing 179 different miRNAs. MiRNA expression levels were normalized to has-miR-486-5p, has-miR-151a-5p, and has-miR-532-3p. In addition, the functions or sepsis-related pathways associated with exosomal miR-223 were analyzed using KOBAS v3.0 (http: / kobas.cbi.pku.edu.cn / anno_iden.php) and the Database for Annotation, Visualization and Integrated Discovery (DAVID; https: / david.ncifcrf.gov / ) 6.8, and GO (Gene Ontology) functional annotation and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis. The target genes of up-expressed miR-223 were predicted by two databases, TargetScan and miRanda.

[0073]

[0074] 3-2. Cell culture and treatment

[0075] Human umbilical cord endothelial cells (HUVECs, ATCC® PCS 100013), human acute T-cell leukemia Jurkat cells (Jurkat T Cells, ATCC-TIB-152), and human acute monocytic leukemia cell line THP-1 (ATCC-TIB-152) were purchased from ATCC and cultured in RPMI 1640 medium (Thermo Fisher Scientific Inc.) containing 10% FBS (ATCC-TIB-152) and 1% penicillin streptomycin solution in a cell incubator at 37°C. Exosomes were extracted from 1 ml of plasma using the ExoQuick Exosome Precipitation kit (SBI) and resuspended in 50–100 μl sterile PBS. Cells were seeded in 6-well plates with 2 ml culture medium per well and treated with 50–100 μl exosomes for miR-223 detection.

[0076]

[0077] 3-3. Transfection of exosomal miR-223 mimics and inhibitors in HUVEC, Jurkat T cells, and THP-1 cells.

[0078] Since the cells were transfected with different miRNAs, they were classified into four groups: (1) miRNA mimic control, (2) miR-223 mimic, (3) miRNA inhibitor control, and (4) miR-223 inhibitor. Transfection of miRNA mimic or inhibitor and control were performed using lipofectamine RNAiMAX transfection agent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. After 48 hours of culture, cells were harvested and the corresponding changes in the expression of various genes and proteins were investigated.

[0079] The miRNA mimic control group was mirVana® miRNA Mimic, Negative Control #1 (ThermoFisher, MA, USA), the miR-223 mimic was mirVana® miRNA mimic for hsa-miR-223-3p (ThermoFisher, MA, USA), the miRNA inhibitor control group was mirVana® miRNA Inhibitor, Negative Control #1 (ThermoFisher, MA, USA), and the miR-223 inhibitor was mirVana® miRNA inhibitor for hsa-miR-223-3p (ThermoFisher, MA, USA, Assay ID: MH12301). The mature miRNAs used as miRNA mimics and inhibitors are shown in Table 2 below.

[0080] Sequence Number Sequence Name RNA Base Sequence 5miR-223 mimic_mature miRNAUGUCAGUUUGUCAAAUACCCCA 6miR-223 inhibitor_mature miRNAUGUCAGUUUGUCAAAUACCCCA

[0081]

[0082] 3-4. Analysis of transfected cell viability using cell counting kit-8

[0083] HUVEC, THP-1, and Jurkat T cells transfected with miRNA mimic control, miR-223 mimic, miRNA inhibitor control, and miR-223 inhibitor were cultured at 1X10 4Cells were seeded into 96-well plates at a density of 10 cells / μl and cultured for 0, 24, 48, and 72 h. Cells were incubated with 10 μl of cell counting kit-8 reagent (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan). The absorbance was set at 450 nm and measured using a microplate spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

[0084]

[0085] 3-5. RNA extraction and RT-PCR from transformed cells

[0086] Total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using the TaqMan miRNA cDNA synthesis kit (Applied Biosystems, Bedford, MA, USA). qPCR was then performed using SYBR Green master mix (Exiqon, Vedbaek, Denmark) on an Applied Biosystems 7900 real-time PCR machine (Life Technologies, Carlsbad, CA, USA) to measure miR-223 expression levels. The thermocycling conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 10 s and 55°C for 10 s, and a final extension at 72°C for 30 s. Real-time PCR (RT-PCR) was also performed to evaluate protein expression in exosomes extracted from HUVECs, THP-1, and Jurkat T cells transfected with miRNA mimic control, miR-223 mimic, miRNA inhibitor control, and miR-223 inhibitor. The gene primers are listed in Table 3 below, and the relative mRNA levels of target genes were 2 -△△Cq Normalized to β-actin using the method.

[0087] SEQ ID NO Sequence NamePrimer Sequence 7ERK_FGAACTCCAAGGGCTATACCAAGT8ERK_RGGAGGGCAGAGACTGTAG GTAGT9JNK_FAACTCTTTGACGCTGCTTGC10JNK_RTGAAGCACTGTGCCTTTACC11p38_FGAGCGTTACCAGAACCTGTCTC12p38_RAGTAACCGCAGTTCTCTGTAGGT1 3TGF-β_FTGGAAACCCACAACGAAATC14TGF-β_RGGGTTCAGGTACCGCTTCTC15β-actin_FCTCTTCCAGCCTTCCTTCCT16β-actin_RGACAGCACCGTGTTAGCGTA

[0088]

[0089] 3-6. Western blotting of the TGF-β signaling pathway

[0090] Western blotting was used to measure cellular protein levels. Total protein was extracted from the cells using radioimmunoprecipitation assay (RIPA) buffer (Shanghai Yeasen Biotech Co., Ltd., Shanghai, China). The BCA method was used to measure protein concentration. Protein samples were separated by 10% polyacrylamide gel electrophoresis. The separated proteins were transferred to polyvinylidene difluoride membranes and blocked with 5% skim milk at 20°C for 2 hours. The membrane was incubated overnight at 4°C with primary antibodies, including JNK (Cell Signaling Technology, Inc., Danvers, MA, USA), p38 (Cell Signaling Technology, Inc., Danvers, MA, USA), ERK (Cell Signaling Technology, Inc., Danvers, MA, USA), TGF-beta (Abcam, Cambridge, MA, USA), and beta-actin (Abcam, Cambridge, MA, USA). The membrane was washed with Tris-buffered saline containing Tween® 20 before incubation with biotinylated secondary antibodies (cat. no. 14708; 1:1,000; Cell Signaling Technology, Inc.) for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (Immobilon Western Chemiluminescence HRP Substrate; EMD Millipore, Billerica, MA, USA).

[0091]

[0092] Experimental Example 4: Study Design and Patient Enrollment

[0093] This study analyzed clinical data and plasma samples collected from 250 critically ill adults admitted to the intensive care unit (ICU) from two prospective registries. Patients were enrolled on day 1 or 2 of ICU admission. A derivation cohort of 130 patients was derived from the Intensive Care Unit of Samsung Medical Center (SMC-RoCI), and a validation cohort of 120 patients was derived from the Intensive Care Unit of Asan Medical Center. The primary outcome was 28-day mortality. The protocols for recruitment, data collection, and sample processing are described in the previous examples. Sepsis was diagnosed based on the guidelines of the Third International Consensus Definition of Sepsis and Septic Shock (Sepsis-3). Because enrollment in this study began before the publication of the Sepsis-3 definition, patients enrolled before the new definition were reclassified.

[0094]

[0095] Experimental Example 5: Isolation, Quantification, and Functional Analysis of Exosomal miR-223

[0096] In our initial investigation, we performed miRNA expression profiling using sequencing, which identified miR-223 as one of the exosomal miRNAs with significantly high levels. Peripheral plasma samples were collected from a cohort of 130 sepsis patients and analyzed. Exosomal RNA was extracted using the exoRNeasy Midi Kit (QIAGEN, CA, USA) and quality assessed using a NanoDrop 2000 (Thermo Fisher Scientific, MA, USA) and an Agilent 2100 bioanalyzer (Agilent Technologies, CA, USA) and a TaqMan miRNA cDNA synthesis Kit (Applied Biosystems, MA, USA). In addition, bioinformatics analysis was used to predict target pathways and genes of exosomal miR-223. To evaluate the function of exosomal miR-223 and its associated pathways in sepsis, HUVECs, Jurkat T cells, and THP-1 cells were treated with exosomal miR-223 mimics, inhibitors, and controls, followed by cell viability assays using DDK-8. mRNA and protein expression were detected using RT-PCR and Western blotting analyses.

[0097]

[0098] Experimental Example 6: Statistical Analysis

[0099] For clinical data, categorical variables were compared using the chi-square test and Fisher's exact test, and continuous variables were compared using the Mann-Whitney U test. Receiver operating characteristic (ROC) analysis was performed to determine the area under the curve (AUC) to evaluate the performance of miR-223 in predicting 28-day mortality in the derivation and validation cohorts. Furthermore, patients were reclassified into two groups with high and low miR-223 levels according to the optimal cutoff level calculated in the derivation cohort by Youden's index, and the association between exosomal miR-223 levels and mortality was compared in each cohort. The Kaplan-Meier equation was used to determine the 90-day mortality curve according to exosomal miR-223 levels, and these were then compared using the log-rank test. Statistically significant differences between cells treated with miR-223 mimics or inhibitors and control cells (mimetic-control or inhibitor-control) were calculated using an unpaired t-test (Student's t-test). All tests were two-tailed, and a p value < 0.05 was considered statistically significant. All statistical analyses were performed using R version 3.6.1 (R Foundation for Statistical Computing, http: / / www.r-project.org) and Prism 9 (GraphPad Software).

[0100]

[0101] Example 1: Association of exosomal miR-223 with disease severity and mortality.

[0102] The study included 130 patients in the derivation cohort and 120 patients in the validation cohort, and the patient information and outcome values ​​are shown in Table 4 below. The data in Table 4 below are expressed as median (interquartile range) or number (%), and the following terms ICU (intensive care unit), APACHE (Acute Physiology and Chromic Health Evaluation), and SOFA (Sequntial Organ Failure Assessment) are abbreviated.

[0103] Derivation cohort(n = 130)Validation cohort(n = 120)PvalueAge, years66 (55-74)69 (59-74)0.445Sex, male89 (69)81 (68)0.978ComorbidityChronic heart failure3 (2)2 (2)0.718Chronic lung disease16 (12)23 (20)0.187Chronic liver disease10 (8)11 (9)0.848Chronic kidney disease10 (8)12 (10)0.674Solid tumor60 (46)39 (33)0.038Hematologic malignancy15 (12)10 (8)0.527Diagnosis<0.001Sepsis44 (34)75 (63)Septic shock86 (66)45 (37)Clinical status on ICU admission Need for mechanical ventilation55 (42)69 (58)0.023Need for vasopressor support102 (78)57 (48)<0.001Severity of illnessAPACHE II score24 (20-30)24 (20-28)0.571Initial SOFA score9 (7-11)10 (7-12)0.033Laboratory findingsExosomal miR-223 (Ct value)0.56 (0.25-0.84)0.81 (0.62-1.15)0.001Lactic acid (mmol / L)2.77 (1.88-4.33)2.10 (1.45-4.15)0.019CRP (mg / dL)12.5 (5.77-24.2)17.5 (8.10-26.0)0.070PCT (ng / mL)5.20 (0.81-25.2)12.3 (3.21-38.1)0.011Mortality28-day mortality20 (15)31 (26)0.059In-hospital mortality29 (22)33 (28)0.42290-day mortality41 (32)40 (33)0.867.

[0104]

[0105] As shown in Table 4 above, the rate of septic shock was lower in the validation cohort (37%) compared to the derivation cohort. Patients in the validation cohort had an initial SOFA score of 10, indicating a higher likelihood of having a higher initial SOFA score than patients in the derivation cohort. Regarding clinical status upon ICU admission, patients in the validation cohort were more likely to require mechanical ventilation but less likely to require vasopressor therapy compared to patients in the derivation cohort. In contrast, there were no significant differences in age, gender, or other comorbidities between the two cohorts, except for the proportion of patients with solid tumors. Furthermore, no significant differences in 28-day, in-hospital, or 90-day mortality were observed between the two groups.

[0106] Exosomal miR-223 levels were measured in all patients. The Ct values, representing median exosomal miR-223 levels, were 0.56 in the derivation cohort and 0.81 in the validation cohort. All sepsis patients had higher exosomal miR-223 levels (0.71) than the healthy controls (0.2). However, no significant difference was observed between the Ct values ​​of sepsis patients (0.66) and septic shock patients (0.71).

[0107] As shown in Figure 1A, the area under the ROC curve (AUROC) was 0.94 (95% CI, 0.90–0.98) in the derivation cohort, and the optimal cutoff point Ct value for the relationship between exosomal miR-223 levels and 28-day mortality was 0.802. Furthermore, as shown in Figure 1B, the AUROC of exosomal miR-223 levels was 0.76 (95% CI, 0.66–0.87) in the validation cohort. In both cohorts, patients were reclassified into high and low exosomal miR-223 groups based on the optimal cutoff levels calculated in the derivation cohort, and the clinical status of ICU admission, disease severity, and mortality was compared between the two groups.

[0108] As shown in Table 5 below, patients in the derived cohort with high levels of exosomal miR-223 were significantly associated with the need for mechanical ventilation, disease severity as defined by initial SOFA score, 28-day mortality, in-hospital mortality, and 90-day mortality.

[0109] Furthermore, as shown in Table 5 below, patients with high levels of exosomal miR-223 in the validation cohort showed a significant association with severity, defined by APACHE II score, 28-day mortality, in-hospital mortality, and 90-day mortality. Conversely, no significant differences in clinical status with respect to ICU admission were observed between patients with high or low exosomal miRNA levels.

[0110] Derivation cohortValidation cohortLowmiR-223(n=90)HighmiR-223(n=40)PvalueLowmiR-223(n=58)HighmiR-223(n=62)PvalueDiagnosis0.6990.018Sepsis29 (32)15 (38)43 (74)32 (52)Septic shock61 (68)25 (62)15 (26)30 (48)Clinical status on ICU admissionNeed for mechanical ventilation31 (34)24 (60)0.01131 (31)38 (61)0.494Need for vasopressor support74 (82)28 (70)0.18224 (41)33 (53)0.265Severity of illnessAPACHE II score24 (19-29)25 (22-31)0.06322 (18-26)26 (21-29)0.004Initial SOFA score9 (6-11)10 (8-12)0.0329 (7-12)10 (7-13)0.127Mortality28-day mortality020 (50)<0.0016 (10)25 (40)<0.001In-hospital mortality1 (1)28 (70)<0.0011 (2)32 (52)<0.00190-day mortality11 (12)30 (75)<0.0017 (12)33 (53)<0.001

[0111] As shown in Figure 2, Kaplan-Meier survival estimates showed a significant difference in 90-day mortality between the two groups according to high and low levels of exosomal miR-223 in both the derivation and validation cohorts (low-rank test, P<0.001).

[0112]

[0113] Example 2: Identification of the rich biological processes and molecular functions of miRNA target genes.

[0114] To predict target genes of miR-223, functional enrichment analysis was performed using DAVID's Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). The most differentially expressed genes among the GO terms listed by significance level in the enrichment analysis are shown in Figure 3.

[0115] To further investigate the relationship between miR-223 and the TGF-β signaling pathway in sepsis, potential binding sites of miR-223 and the TGF-β signaling pathway were predicted by targetscan and miRanda online websites, which indicated that TGF-β receptors could be targets of Mir-223.

[0116]

[0117] Example 3: Results of confirming the transfection efficiency of exosomal miR-223

[0118] HUVEC, Jurkat cells, and THP-1 cells were transfected with miR-223 mimic, miR-223 inhibitor, and miR-223 control, and cellular expression levels were detected using qRT-PCR. After 24–48 hours of transfection, qRT-PCR results confirmed that the expression level of exosomal miR-223 in these cells was increased by the miR-223 mimic compared to the miRNA mimic control. In contrast, as shown in Figure 4, the level of miR-223 expression was confirmed to be decreased by the miR-223 inhibitor compared to the miRNA inhibitor control.

[0119]

[0120] Example 4: CCK-8 assay results

[0121] To detect changes in the activity of HUVECS, Jurkat T cells, and THP-1 cells treated with miR-223 mimics and inhibitors, a CCK-8 assay was used.

[0122] As shown in Fig. 5, the viability of HUVECS, Jurkat T cells, and THP-1 cells was confirmed to gradually decrease over time when transfected with exosomal miR-223 mimic, but was confirmed to increase over time when transfected with miR-223 inhibitor.

[0123]

[0124] Example 5: Results of mRNA expression analysis by RT-qPCR

[0125] The results of RT-qPCR analysis for mRNA expression are shown in Fig. 6. As shown in Fig. 6, when THP-1, HUVEC, and Jurkat T cells were transfected with miR-223 mimic, the TGF-β-mRNA expression level increased approximately 2-fold compared to the mimic control. On the other hand, the mimic-223 inhibitor decreased the TGF-β-mRNA expression level in THP-1, HUVEC, and Jurkat T cells compared to the inhibitor control.

[0126] Afterwards, the expression of ERK, JNK, and p38, which act as downstream effectors of the TGF-β pathway, was confirmed within each cell.

[0127] As a result, as shown in Fig. 7, ERK mRNA expression was significantly reduced in all cells treated with miR-223 mimic, whereas ERK mRNA expression was significantly increased in all cells treated with miR-223 inhibitor compared to the control group. However, the mRNA expression levels of JNK and p38 were confirmed to increase in response to miR-223 mimic in all cell types, and to decrease when exposed to miR-223 inhibitor compared to the mimic / inhibitor-control group.

[0128]

[0129] Example 6: Western blot analysis results

[0130] After transfection of JHP-1, HUVEC, and Jurkat T cells with miR-223 mimic or miR-223 inhibitor, TGF-β protein levels and the expression of JNK and p38, key proteins of the TGF-β pathway, were analyzed by Western blot.

[0131] As shown in Fig. 8, compared to the mimic-control, the protein level of TGF-β was confirmed to significantly increase when infected with miR-223.

[0132] As shown in Figure 9, p38 protein was significantly increased in the miR-223 mimic group compared to the control group in all cell types, and was significantly decreased after treatment with the miR-223 inhibitor. However, in the case of JNK protein, treatment with the miR-223 mimic and the miR-223 inhibitor decreased the level of JNK protein compared to the mimic control or the inhibitor control. Therefore, as a result, the effects of the miR-223 mimic and the miR-223 inhibitor on JNK protein did not show a significant difference.

[0133]

[0134] Example 7: Consideration

[0135] This study evaluated the association between exosomal miR-223 levels and clinical outcomes in critically ill patients with sepsis in a cohort of 130 critically ill patients, and comprehensively evaluated the role of exosomal miR-223 on cell death and related neural pathways in sepsis.

[0136] Our results showed that exosomal miR-223 levels were associated with the severity of organ failure and mortality, a finding that was externally validated in a separate cohort of 120 critically ill patients. Furthermore, molecular and cellular experiments demonstrated that in vivo miR-223 overexpression activated the TGF-β pathway and significantly influenced the p38-MAPK signaling pathway, suggesting its potential as a promising therapeutic target for sepsis.

[0137] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A pharmaceutical composition for preventing or treating sepsis comprising a miR-223 inhibitor.

2. In paragraph 1, The above miR-223 inhibitor comprises at least one selected from the group consisting of an antisense nucleotide, siRNA (small interfering RNA), and shRNA (short hairpin RNA) for a polynucleotide constituting the miR-223 gene. A pharmaceutical composition for preventing or treating sepsis.

3. In paragraph 1, The above miR-223 inhibitor inhibits cell death. A pharmaceutical composition for preventing or treating sepsis.

4. In paragraph 1, The above miR-223 inhibitor reduces the expression of p38 and TGF-β genes or proteins. A pharmaceutical composition for preventing or treating sepsis.

5. Step of treating the candidate substance to the cell; A step of measuring the expression level of miR-223 in cells treated with the above candidate substance; and A method for screening a sepsis treatment agent, comprising the step of selecting a candidate substance that reduces the measured miR-223 expression level compared to an untreated control group.

Images