Rnai constructs and methods for inhibiting CNR1 expression

Abstract

The present invention relates to RNAi constructs for reducing expression of the CNR1 gene. Methods of using such RNAi constructs to reduce visceral adiposity and treat or prevent obesity and obesity-related conditions, such as type 2 diabetes, fatty liver disease, steatohepatitis, and cardiovascular disease, are also described.

Description

10565-WO01-SEC Electronically Filed June 13, 2025 RNAi CONSTRUCTS AND METHODS FOR INHIBITING CNR1 EXPRESSION CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 660,076, filed June 14, 2024. DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

[0002] The present application contains a Sequence Listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The computer readable format copy of the Sequence Listing, which was created on June 13, 2025, is named 10565-WO01-SEC_SequenceListing.xml and is 5,785,195 bytes in size. FIELD OF THE INVENTION

[0003] The present invention relates to compositions and methods for modulating expression of the CNR1 gene, which encodes the cannabinoid receptor 1 (CB1) protein. In particular, the present invention relates to nucleic acid-based therapeutics for reducing CNR1 gene expression via RNA interference and methods of using such nucleic acid-based therapeutics to reduce visceral adiposity and body weight and to treat or prevent obesity and obesity-related conditions. BACKGROUND OF THE INVENTION

[0004] Obesity, which is characterized by excessive fat deposits, has increased to epidemic proportions globally and has become a global health concern. According to the World Health Organization, the worldwide prevalence of obesity in adults more than doubled between 1990 and 2022 and adolescent obesity had quadrupled (World Health Organization, Obesity and Overweight Fact Sheet, March 2024 (who.int / news-room / fact-sheets / detail / obesity-and- overweight). In 2022, 890 million adults and 160 million adolescents worldwide were living with obesity. Obesity can lead to the development of a multitude of other diseases (i.e. obesity-related conditions) including type 2 diabetes, high blood pressure, cardiovascular disease, metabolic syndrome, fatty liver diseases, osteoarthritis, sleep apnea, kidney diseases, and some types of cancer. Medicines to treat obesity and decrease the risk of developing these other serious obesity-related conditions are greatly needed.

[0005] The endocannabinoid system, including cannabinoid receptor 1 (CB1) and cannabinoid receptor 2 (CB2) and their endogenous ligands, have been implicated in the regulation of various metabolic pathways (Bermudez-Silva et al., Pharmacol Biochem Behav, Vol.95: 375–382, 2010; Scheen et al., Curr Protein Pept Sci, Vol.10: 56–74, 2009; Vermuri et al., Physiol Behav, Vol.93: 671–686, 2008). Overactivation of the CB1 receptor in peripheral tissues (e.g. adipose, pancreas, and liver) has been associated with development of obesity and metabolic syndrome both in animal models and humans (Starowicz et al., Obesity, Vol.16: 553-565, 2008; Bluher et al., Diabetes, Vol.55: 3053-3060, 2006; Engeli et al., Diabetes, Vol.54: 2838–2843, 2005). Antagonists of CB1 receptor signaling have demonstrated effects in reducing body weight as well as improving insulin sensitivity, glucose homeostasis, and serum cholesterol and triglyceride levels (Cinar et al., Phrmacol Ther, Vol.208: 107477, 2020). In fact, rimonabant, a small molecule CB1 receptor antagonist / inverse agonist, was studied in phase 3 clinical trials and was shown to induce weight loss in overweight people with metabolic syndrome as well as significantly improve various cardiometabolic parameters, such as waist circumference, hemoglobin A1c, HDL, plasma cholesterol and triglycerides. See Cinar et al., 2020 for a review. Although rimonabant was approved for use in Europe for the treatment of obesity, its penetrance into the central nervous system caused undesirable psychiatric effects, such as anxiety, depression, and increased suicidal ideation, which led to its withdrawal from the market in 2008 (Sayburn, BMJ, Vol.337: a2301, 2008). Research into the development of peripherally-restricted CB1 receptor antagonists is an area of interest but no successful effective therapeutics have been developed thus far. Accordingly, there is a need in the art for novel approaches to inhibit peripheral CB1 receptors to treat obesity and obesity-related conditions. SUMMARY OF THE INVENTION

[0006] The present invention is based, in part, on the design and generation of RNAi constructs that target the CNR1 gene, which encodes the CB1 receptor, and reduce its expression, particularly in adipose tissue. The sequence-specific inhibition of CNR1 gene expression is useful for reducing body weight and fat mass (e.g. visceral adiposity) and thus treating or preventing obesity and obesity-related conditions, such as type 2 diabetes, visceral obesity, metabolic syndrome, cardiovascular disease, and fatty liver disease. Accordingly, the present invention provides an RNAi construct comprising a sense strand and an antisense strand, whereinthe antisense strand comprises a region having a sequence that is substantially complementary to a CNR1 mRNA sequence. For instance, in some embodiments, the antisense strand comprises a sequence that is substantially complementary to the sequence of at least 15 contiguous nucleotides of a region of the human CNR1 mRNA sequence (SEQ ID NO: 1) with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand comprises a region having at least 15 contiguous nucleotides from an antisense sequence listed in Table 2 (SEQ ID NOs: 355- 694) or Table 3 (SEQ ID NOs: 1093-1432).

[0007] In some embodiments, the sense strand of the RNAi constructs described herein comprises a sequence that is sufficiently complementary to the sequence of the antisense strand to form a duplex region of about 15 to about 30 base pairs in length. In these and other embodiments, the sense and antisense strands are each independently about 19 to about 30 nucleotides in length. In some embodiments, the RNAi constructs comprise one or two blunt ends. In other embodiments, the RNAi constructs comprise one or two nucleotide overhangs. Such nucleotide overhangs may comprise 1 to 4 unpaired nucleotides and can be located at the 3ʹ end of the sense strand, the 3ʹ end of the antisense strand, or the 3ʹ end of both the sense and antisense strand. In certain embodiments, the RNAi constructs comprise an overhang of two unpaired nucleotides at the 3ʹ end of the sense strand and the 3ʹ end of the antisense strand. In other embodiments, the RNAi constructs comprise an overhang of two unpaired nucleotides at the 3ʹ end of the antisense strand and a blunt end at the 3ʹ end of the sense strand / 5ʹ end of the antisense strand.

[0008] The RNAi constructs of the invention may comprise one or more modified nucleotides, including nucleotides having modifications to the ribose ring, nucleobase, or phosphodiester backbone. In some embodiments, the RNAi constructs comprise one or more 2ʹ-modified nucleotides. Such 2ʹ-modified nucleotides can include 2ʹ-fluoro modified nucleotides, 2ʹ-O- methyl modified nucleotides, 2ʹ-O-methoxyethyl modified nucleotides, 2ʹ-O-alkyl modified nucleotides, 2ʹ-O-allyl modified nucleotides, bicyclic nucleic acids (BNA), deoxyribonucleotides, or combinations thereof. In one particular embodiment, the RNAi constructs comprise one or more 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, or combinations thereof. In some embodiments, all of the nucleotides in the sense and antisense strand of the RNAi construct are modified nucleotides. Abasic nucleotides may be incorporated into the RNAi constructs of the invention, for example, as the terminal nucleotide atthe 3ʹ end, the 5ʹ end, or both the 3ʹ end and the 5ʹ end of the sense strand. In such embodiments, the abasic nucleotide may be inverted, e.g. linked to the adjacent nucleotide through a 3ʹ-3ʹ internucleotide linkage or a 5ʹ-5ʹ internucleotide linkage.

[0009] In some embodiments, the RNAi constructs comprise at least one backbone modification, such as a modified internucleotide or internucleoside linkage. In certain embodiments, the RNAi constructs described herein comprise at least one phosphorothioate internucleotide linkage. In particular embodiments, the phosphorothioate internucleotide linkages may be positioned at the 3ʹ or 5ʹ ends of the sense and / or antisense strands. For instance, in some embodiments, the antisense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends. In some such embodiments, the sense strand comprises one or two phosphorothioate internucleotide linkages between the terminal nucleotides at its 3ʹ end. In other such embodiments, the sense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end. In one embodiment, the sense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end and one phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end.

[0010] In certain embodiments, the antisense strand and / or the sense strand of the RNAi constructs of the invention may comprise or consist of a sequence from the antisense and sense sequences listed in Table 2 or Table 3. In certain such embodiments, the RNAi construct may be any one of the duplex compounds listed in Table 2 or Table 3. In some embodiments, the antisense strand of the RNAi constructs of the invention comprises or consists of a sequence selected from any one of the sequences set forth in SEQ ID NOs: 355-694 and 1093-1432. In these and other embodiments, the sense strand of the RNAi constructs of the invention comprises or consists of a sequence selected from any one of the sequences set forth in 14-353 and 696- 1091. In some embodiments, the RNAi construct is D-1069, D-1070, D-1072, D-1078, D-1082, D-1083, D-1088, D-1116, D-1122, D-1144, D-1157, D-1162, D-1163, D-1165, D-1166, D-1167, D-1169, D-1170, D-1172, D-1174, D-1185, D-1264, D-1279, D-1318, D-1321, D-1342, D-1343, D-1346, D-1347, D-1348, D-1356, D-1358, D-1359, D-1360, D-1363, D-1365, D-1366, D-1367, D-1369, D-1376, D-1377, D-1378, D-1395, D-1396, D-1397, D-1398, D-1400, D-1401, D-1402, D-1403, or D-1406. In certain embodiments, the RNAi construct is D-1082, D-1083, D-1116, D- 1122, D-1144, D-1157, D-1163, D-1165, D-1166, D-1167, D-1169, D-1170, D-1264, D-1279,D-1318, D-1321, D-1342, D-1343, D-1346, D-1347, D-1348, D-1356, D-1358, D-1363, D-1365, D-1367, D-1369, D-1377, D-1378, D-1395, D-1396, D-1397, D-1398, D-1400, D-1401, D-1402, D-1403, or D-1406.

[0011] The RNAi constructs of the invention may further comprise a ligand to facilitate delivery or uptake of the RNAi constructs to specific tissues or cells, such as adipose tissue or liver cells. In certain embodiments, the ligand targets delivery of the RNAi constructs to adipocytes and hepatocytes. In these and other embodiments, the ligand comprises hydrophobic moieties, such as fatty acids, cholesterol moieties, vitamins, folate moieties, steroids, and bile acids. In some embodiments, the ligand comprises a saturated or unsaturated C12-C24hydrocarbon chain (e.g., C12-C24alkyl or alkenyl). For instance, in certain embodiments, the ligand comprises a fatty acid, such as lauric acid (C12), myristic acid (C14), palmitic acid (C16), palmitoleic acid (C16:1), stearic acid (C18), oleic acid (C18:1), linoleic acid (C18:2), arachidic acid (C20), arachidonic acid (C20:4), docosanoic acid (C22), docosahexaenoic acid (C22:6), or lignoceric acid (C24). In one particular embodiment, the ligand comprises palmitic acid. In another particular embodiment, the ligand comprises docosanoic acid. In other embodiments, the ligand may target delivery of the RNAi constructs specifically to hepatocytes. In some such embodiments, the ligand may comprise galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand comprises a multivalent galactose or multivalent GalNAc moiety, such as a trivalent or tetravalent galactose or GalNAc moiety. The ligand may be covalently attached to the 5ʹ or 3ʹ end of the sense strand of the RNAi construct, optionally through a linker. In some embodiments, the RNAi constructs comprise a ligand and linker having a structure according to any one of Formulas I to III described herein.

[0012] The present invention also provides pharmaceutical compositions comprising any of the RNAi constructs described herein and a pharmaceutically acceptable carrier, excipient, or diluent. Such pharmaceutical compositions are particularly useful for reducing expression of the CNR1 gene in the cells (e.g. adipocytes or hepatocytes) of a patient in need thereof. Patients who may be administered a pharmaceutical composition of the invention can include patients diagnosed with or at risk for obesity or an obesity-related condition, such as metabolic syndrome, visceral obesity, type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, cardiovascular disease, osteoarthritis, or sleep apnea. Accordingly, the present invention includes methods of treating, preventing, or reducing the risk of developing obesity or an obesity-relatedcondition in a patient in need thereof comprising administering an RNAi construct or pharmaceutical composition described herein. In certain embodiments, the present invention provides methods for reducing body weight or fat mass (e.g. visceral adiposity) in a patient in need thereof comprising administering an RNAi construct or pharmaceutical composition described herein. In some embodiments, the patient to be administered an RNAi construct or pharmaceutical composition according to the methods of the invention is diagnosed with visceral obesity. In such embodiments, the patient may have a body mass index of ≥ 30.0 kg / m2or a waist-to-hip ratio (WHR) greater than 1.0.

[0013] The use of CNR1-targeting RNAi constructs in any of the methods described herein or for preparation of medicaments for administration according to the methods described herein is specifically contemplated. For instance, the present invention includes a CNR1-targeting RNAi construct for use in a method for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof. The present invention also includes a CNR1-targeting RNAi construct for use in a method for reducing body weight or fat mass (e.g. visceral adiposity) in a patient in need thereof.

[0014] The present invention also encompasses the use of a CNR1-targeting RNAi construct in the preparation of a medicament for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof. In certain embodiments, the present invention provides the use of a CNR1-targeting RNAi construct in the preparation of a medicament for reducing body weight or fat mass (e.g. visceral adiposity) in a patient in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 shows the nucleotide sequence of a transcript of the human CNR1 gene (Ensembl transcript no. ENST00000369501.2; SEQ ID NO: 1). The transcript sequence is depicted as the complementary DNA (cDNA) sequence with thymine bases replacing uracil bases.

[0016] Figures 2A-2D depict the percent change in body weight from baseline (Figure 2A), cumulative food intake (Figure 2B), fat mass (Figure 2C), and lean mass (Figure 2D) in mice on a high fat diet receiving weekly subcutaneous injections of saline or a 30 mg / kg dose of one of two C16-conjugated siRNA molecules targeting the mouse Cnr1 gene (duplex nos.35866 or35867) for six weeks. Mean values ± standard error of the mean (SEM) are shown. N = 8 animals per treatment group. * = p <0.05;** = p <0.01; *** = p <0.001; **** = p <0.0001 vs. saline control group.

[0017] Figures 3A-3D show the percent change in body weight from baseline (Figure 3A), mass of subcutaneous white adipose tissue (WAT) at end of study (Figure 3B), liver mass at end of study (Figure 3C), and percent liver fat at end of study (Figure 3D) in mice on a high fat diet receiving weekly subcutaneous injections of saline (vehicle), 30 mg / kg C16-conjugated non- targeting control siRNA (C16-NT siRNA; duplex no.46770), 5 mg / kg or 30 mg / kg C16- conjugated Cnr1-targeted siRNA molecule (C16-CB1 siRNA; duplex no.35866); 5 mg / kg GalNAc-conjugated non-targeting control siRNA (GalNAc-NT siRNA; duplex no.46657), or 5 mg / kg GalNAc-conjugated Cnr1-targeted siRNA molecule (GalNAc-CB1-siRNA; duplex no. 46655) for six weeks. Mean values ± standard error of the mean (SEM) are shown. N = 8 animals per treatment group. * = p <0.05;** = p <0.01; *** = p <0.001; **** = p <0.0001.

[0018] Figure 4A-4D show the relative human CNR1 mRNA expression in inguinal white adipose tissue (WAT) (Figure 4A), epididymal WAT (Figure 4B), kidney (Figure 4C) and liver (Figure 4D) in transgenic mice in which the human CNR1 gene was knocked in. Mice received a single subcutaneous injection of saline or 20 mg / kg of one of six C22-conjugated siRNA molecules. Duplex nos. D-52723 and D-50225 are non-targeting control siRNA molecules, whereas duplex nos. D-1394, D-1395, D-1396, and D-1397 are human CNR1-targeted siRNA molecules. Data are depicted as mean values ± standard error of the mean (SEM). One-way ANOVA with Dunnett’s multiple comparisons was performed in GraphPad Prism. Statistical significance denoted as ns = not significant; * = p <0.05;** = p <0.01; *** = p <0.001; **** = p <0.0001. N = 5 animals per treatment group.

[0019] Figure 5A and 5B depict the relative murine Cnr1 mRNA expression in inguinal white adipose tissue (WAT) (Figure 5A) and liver (Figure 5B) in C57 / Bl6 lean mice. Mice received a single subcutaneous injection of saline or 20 mg / kg of one of eleven C22-conjugated siRNA molecules. Duplex no. D-1408 is a non-targeting control siRNA molecule, whereas duplex nos. D-1398, D-1399, D-1400, D-1401, D-1402, D-1403, D-1404, D-1405, D-1406 and D-1407 are human CNR1-targeted siRNA molecules that also cross-react with the murine Cnr1 gene. Data are depicted as mean values ± standard error of the mean (SEM). N = 4 animals per treatment group.DETAILED DESCRIPTION

[0020] The present invention is directed to compositions and methods for regulating the expression of the CNR1 gene, which encodes the cannabinoid receptor 1 (CB1) protein, in a cell or mammal. In some embodiments, compositions of the invention comprise RNAi constructs that target a mRNA transcribed from the CNR1 gene, particularly the human CNR1 gene, and reduce expression of the CB1 protein in a cell or mammal. Such RNAi constructs are useful for reducing body weight and fat mass as well as treating or preventing obesity and various obesity- related conditions.

[0021] As used herein, the term “RNAi construct” refers to an agent comprising an RNA molecule that is capable of downregulating expression of a target gene (e.g. CNR1 gene) via an RNA interference mechanism when introduced into a cell. RNA interference is the process by which a nucleic acid molecule induces the cleavage and degradation of a target RNA molecule (e.g. messenger RNA or mRNA molecule) in a sequence-specific manner, e.g. through an RNA- induced silencing complex (RISC) pathway. In some embodiments, the RNAi construct comprises a double-stranded RNA molecule comprising two antiparallel strands of contiguous nucleotides that are sufficiently complementary to each other to hybridize to form a duplex region. “Hybridize” or “hybridization” refers to the pairing of complementary polynucleotides, typically via hydrogen bonding (e.g. Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary bases in the two polynucleotides. The strand comprising a region having a sequence that is substantially complementary to a target sequence (e.g. target mRNA) is referred to as the “antisense strand” or “guide strand.” The “sense strand” or “passenger strand” refers to the strand that includes a region that is substantially complementary to a region of the antisense strand. In some embodiments, the sense strand may comprise a region that has a sequence that is substantially identical to the target sequence.

[0022] A double-stranded RNA molecule may include chemical modifications to ribonucleotides, including modifications to the ribose sugar, base, or backbone components of the ribonucleotides, such as those described herein or known in the art. Any such modifications, as used in a double-stranded RNA molecule (e.g. siRNA, shRNA, or the like), are encompassed by the term “double-stranded RNA” for the purposes of this disclosure.

[0023] As used herein, a first sequence is “complementary” to a second sequence if a polynucleotide comprising the first sequence can hybridize to a polynucleotide comprising thesecond sequence to form a duplex region under certain conditions, such as physiological conditions. Other such conditions can include moderate or stringent hybridization conditions, which are known to those of skill in the art. A first sequence is considered to be fully complementary (100% complementary) to a second sequence if a polynucleotide comprising the first sequence base pairs with a polynucleotide comprising the second sequence over the entire length of one or both nucleotide sequences without any mismatches. A sequence is “substantially complementary” to a target sequence if the sequence is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a target sequence. Percent complementarity can be calculated by dividing the number of bases in a first sequence that are complementary to bases at corresponding positions in a second or target sequence by the total length of the first sequence. A sequence may also be said to be substantially complementary to another sequence if there are no more than 5, 4, 3, or 2 mismatches over a 30 base pair duplex region when the two sequences are hybridized. Generally, if any nucleotide overhangs, as defined herein, are present, the sequence of such overhangs is not considered in determining the degree of complementarity between two sequences. By way of example, a sense strand of 21 nucleotides in length and an antisense strand of 21 nucleotides in length that hybridize to form a 19 base pair duplex region with a 2- nucleotide overhang at the 3ʹ end of each strand would be considered to be fully complementary as the term is used herein.

[0024] In some embodiments, a region of the antisense strand comprises a sequence that is substantially or fully complementary to a region of the target RNA sequence (e.g. CNR1 mRNA sequence). In such embodiments, the sense strand may comprise a sequence that is fully complementary to the sequence of the antisense strand. In other such embodiments, the sense strand may comprise a sequence that is substantially complementary to the sequence of the antisense strand, e.g. having 1, 2, 3, 4, or 5 mismatches in the duplex region formed by the sense and antisense strands. In certain embodiments, it is preferred that any mismatches occur within the terminal regions (e.g. within 6, 5, 4, 3, or 2 nucleotides of the 5ʹ and / or 3ʹ ends of the strands). In one embodiment, any mismatches in the duplex region formed from the sense and antisense strands occur within 6, 5, 4, 3, or 2 nucleotides of the 5ʹ end of the antisense strand.

[0025] In certain embodiments, the sense strand and antisense strand of the double-stranded RNA may be two separate molecules that hybridize to form a duplex region but are otherwise unconnected. Such double-stranded RNA molecules formed from two separate strands arereferred to as “small interfering RNAs” or “short interfering RNAs” (siRNAs). Thus, in some embodiments, the RNAi constructs of the invention comprise an siRNA.

[0026] In other embodiments, the sense strand and the antisense strand that hybridize to form a duplex region may be part of a single RNA molecule, i.e. the sense and antisense strands are part of a self-complementary region of a single RNA molecule. In such cases, a single RNA molecule comprises a duplex region (also referred to as a stem region) and a loop region. The 3ʹ end of the sense strand is connected to the 5ʹ end of the antisense strand by a contiguous sequence of unpaired nucleotides, which will form the loop region. The loop region is typically of a sufficient length to allow the RNA molecule to fold back on itself such that the antisense strand can base pair with the sense strand to form the duplex or stem region. The loop region can comprise from about 3 to about 25, from about 5 to about 15, from about 8 to about 12, or from about 4 to about 6 unpaired nucleotides. Such RNA molecules with at least partially self- complementary regions are referred to as “short hairpin RNAs” (shRNAs). In certain embodiments, the RNAi constructs of the invention comprise a shRNA. The length of a single, at least partially self-complementary RNA molecule can be from about 40 nucleotides to about 100 nucleotides, from about 45 nucleotides to about 85 nucleotides, or from about 50 nucleotides to about 60 nucleotides and comprise a duplex region and loop region each having the lengths recited herein.

[0027] In some embodiments, the RNAi constructs of the invention comprise a sense strand and an antisense strand, wherein the antisense strand comprises a region having a sequence that is substantially or fully complementary to a CNR1 messenger RNA (mRNA) sequence. As used herein, a “CNR1 mRNA sequence” refers to any messenger RNA sequence, including allelic variants and splice variants, encoding a CB1 protein, including CB1 protein variants or isoforms from any species (e.g. non-human primate, human). The CNR1 gene (also known as CANN6, CB-R, CB1, CB1A, CB1K5, or CNR) encodes the G protein-coupled cannabinoid receptor 1. In humans, the CNR1 gene is found on chromosome 6 at locus 6q15.

[0028] A CNR1 mRNA sequence also includes the transcript sequence expressed as its complementary DNA (cDNA) sequence. A cDNA sequence refers to the sequence of an mRNA transcript expressed as DNA bases (e.g. guanine, adenine, thymine, and cytosine) rather than RNA bases (e.g. guanine, adenine, uracil, and cytosine). Thus, the antisense strand of the RNAi constructs of the invention may comprise a region having a sequence that is substantially or fullycomplementary to a target CNR1 mRNA sequence or CNR1 cDNA sequence. A CNR1 mRNA or cDNA sequence can include, but is not limited to, any CNR1 mRNA or cDNA sequences in the Ensembl Genome or National Center for Biotechnology Information (NCBI) databases, such as human sequences: Ensembl transcript no. ENST00000369501.2 (Figure 1, SEQ ID NO: 1), Ensembl transcript no. ENST00000369501.3, and NCBI Reference sequence NM_016083.6; cynomolgus monkey sequences: NCBI Reference sequences XM_005552390.2, XM_005552390.3, XM_045391221.1, XM_005552387.2, XM_005552387.3, XM_005552388.2, and XM_005552388.3; rhesus monkey sequence: Ensembl transcript no. ENSMMUT00000104316.1, ENSMMUT00000001100.3, ENSMMUT00000001100.4, and ENSMMUT00000107349.1 and NCBI Reference sequence NM_001032825.1; chimpanzee sequences: NCBI Reference sequences XM_009451531.5, XM_063812008.1, XM_009451529.5, and XM_009451530.5; rat sequences: NCBI Reference sequence NM_012784.6, NM_001429314.1, NM_001429315.1, NM_001429316.1, NM_001429317.1, XM_017593151.3, XM_039109284.2, XM_063287170.1, XM_006237984.5, XM_063287167.1, and XM_063287169.1; and mouse sequences: Ensembl transcript no. ENSMUST00000057188.6 and ENSMUST00000084736.2 and NCBI Reference sequences NM_001355020.2, NM_001355021.2, NM_007726.5, NM_001365881.1, XM_030253149.1, XM_006537594.4, and XM_006537595.4. In certain embodiments, the CNR1 mRNA sequence is the human transcript set forth in Figure 1 (SEQ ID NO: 1).

[0029] A region of the antisense strand can be substantially complementary or fully complementary to at least 15 consecutive nucleotides of the CNR1 mRNA sequence. In certain embodiments, the region of the antisense strand comprises a sequence that is substantially complementary to the sequence of at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides of a region of the CNR1 mRNA sequence (e.g. a human CNR1 mRNA sequence (SEQ ID NO: 1)) with no more than 1, 2, or 3 mismatches. In related embodiments, the antisense strand comprises a region having a sequence that is substantially complementary to the sequence of at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides of a region of the CNR1 mRNA sequence with no more than 1 mismatch. In embodiments in which the sequence of the antisense strand is not fully complementary to the target CNR1 mRNA sequence and contains a mismatch, the mismatch may occur between the target CNR1 mRNA sequence and the nucleotide at position 6, position 7, and / or position 8 from the 5ʹ end of theantisense strand. In some embodiments, the target region of the CNR1 mRNA sequence to which the antisense strand comprises a region of complementarity can range from about 15 to about 30 consecutive nucleotides, from about 16 to about 28 consecutive nucleotides, from about 18 to about 26 consecutive nucleotides, from about 17 to about 24 consecutive nucleotides, from about 19 to about 30 consecutive nucleotides, from about 19 to about 25 consecutive nucleotides, from about 19 to about 23 consecutive nucleotides, or from about 19 to about 21 consecutive nucleotides. In certain embodiments, the region of the antisense strand comprising a sequence that is substantially or fully complementary to a CNR1 mRNA sequence may comprise at least 15 contiguous nucleotides from an antisense sequence listed in Table 2 or Table 3. In other embodiments, the sequence of the antisense strand comprises at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides from an antisense sequence listed in Table 2 or Table 3.

[0030] The sense strand of the RNAi construct typically comprises a sequence that is sufficiently complementary to the sequence of the antisense strand such that the two strands hybridize under physiological conditions to form a duplex region. A “duplex region” refers to the region in two complementary or substantially complementary polynucleotides that form base pairs with one another, either by Watson-Crick base pairing or other hydrogen bonding interaction, to create a duplex between the two polynucleotides. The duplex region of the RNAi construct should be of sufficient length to allow the RNAi construct to enter the RNA interference pathway, e.g. by engaging the Dicer enzyme and / or the RISC complex. For instance, in some embodiments, the duplex region is about 15 to about 30 base pairs in length. Other lengths for the duplex region within this range are also suitable, such as about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 base pairs, or about 19 to about 21 base pairs. In certain embodiments, the duplex region is about 17 to about 24 base pairs in length. In other embodiments, the duplex region is about 19 to about 21 base pairs in length. In one embodiment, the duplex region is about 19 base pairs in length. In another embodiment, the duplex region is about 21 base pairs in length.

[0031] For embodiments in which the sense strand and antisense strand are two separate molecules (e.g. RNAi construct comprises an siRNA), the sense strand and antisense strand need not be the same length as the length of the duplex region. For instance, one or both strands maybe longer than the duplex region and have one or more unpaired nucleotides or mismatches flanking the duplex region. Thus, in some embodiments, the RNAi construct comprises at least one nucleotide overhang. As used herein, a “nucleotide overhang” refers to the unpaired nucleotide or nucleotides that extend beyond the duplex region at the terminal ends of the strands. Nucleotide overhangs are typically created when the 3ʹ end of one strand extends beyond the 5ʹ end of the other strand or when the 5ʹ end of one strand extends beyond the 3ʹ end of the other strand. The length of a nucleotide overhang is generally between 1 and 6 nucleotides, 1 and 5 nucleotides, 1 and 4 nucleotides, 1 and 3 nucleotides, 2 and 6 nucleotides, 2 and 5 nucleotides, or 2 and 4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In one particular embodiment, the nucleotide overhang comprises 1 to 4 nucleotides. In certain embodiments, the nucleotide overhang comprises 2 nucleotides. In certain other embodiments, the nucleotide overhang comprises a single nucleotide.

[0032] The nucleotides in the overhang can be ribonucleotides or modified nucleotides as described herein. In some embodiments, the nucleotides in the overhang are 2ʹ-modified nucleotides (e.g.2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides), deoxyribonucleotides, abasic nucleotides, inverted nucleotides (e.g. inverted abasic nucleotides, inverted deoxyribonucleotides), or combinations thereof. For instance, in one embodiment, the nucleotides in the overhang are deoxyribonucleotides, e.g. deoxythymidine. In another embodiment, the nucleotides in the overhang are 2ʹ-O-methyl modified nucleotides, 2ʹ-fluoro modified nucleotides, 2ʹ-methoxyethyl modified nucleotides, or combinations thereof. In other embodiments, the overhang comprises a 5ʹ-uridine-uridine-3ʹ (5ʹ-UU-3ʹ) dinucleotide. In such embodiments, the UU dinucleotide may comprise ribonucleotides or modified nucleotides, e.g. 2ʹ-modified nucleotides. In other embodiments, the overhang comprises a 5ʹ-deoxythymidine- deoxythymidine-3ʹ (5ʹ-dTdT-3ʹ) dinucleotide. When a nucleotide overhang is present in the antisense strand, the nucleotides in the overhang can be complementary to the target gene sequence, form a mismatch with the target gene sequence, or comprise some other sequence (e.g. polypyrimidine or polypurine sequence, such as UU, TT, AA, GG, etc.).

[0033] The nucleotide overhang can be at the 5ʹ end or 3ʹ end of one or both strands. For example, in one embodiment, the RNAi construct comprises a nucleotide overhang at the 5ʹ end and the 3ʹ end of the antisense strand. In another embodiment, the RNAi construct comprises a nucleotide overhang at the 5ʹ end and the 3ʹ end of the sense strand. In some embodiments, theRNAi construct comprises a nucleotide overhang at the 5ʹ end of the sense strand and the 5ʹ end of the antisense strand. In other embodiments, the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the sense strand and the 3ʹ end of the antisense strand. In another embodiment, the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the sense strand. In yet another embodiment, the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the antisense strand.

[0034] The RNAi constructs may comprise a single nucleotide overhang at one end of the double-stranded RNA molecule and a blunt end at the other. A “blunt end” means that the sense strand and antisense strand are fully base-paired at the end of the molecule and there are no unpaired nucleotides that extend beyond the duplex region. In some embodiments, the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the sense strand and a blunt end at the 5ʹ end of the sense strand and 3ʹ end of the antisense strand. In other embodiments, the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the antisense strand and a blunt end at the 5ʹ end of the antisense strand and the 3ʹ end of the sense strand. In certain embodiments, the RNAi construct comprises a blunt end at both ends of the double-stranded RNA molecule. In such embodiments, the sense strand and antisense strand have the same length and the duplex region is the same length as the sense and antisense strands (i.e. the molecule is double-stranded over its entire length).

[0035] The sense strand and antisense strand in the RNAi constructs of the invention can each independently be about 15 to about 30 nucleotides in length, about 19 to about 30 nucleotides in length, about 18 to about 28 nucleotides in length, about 19 to about 27 nucleotides in length, about 19 to about 25 nucleotides in length, about 19 to about 23 nucleotides in length, about 19 to about 21 nucleotides in length, about 21 to about 25 nucleotides in length, or about 21 to about 23 nucleotides in length. In certain embodiments, the sense strand and antisense strand are each independently about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides in length. In some embodiments, the sense strand and antisense strand have the same length but form a duplex region that is shorter than the strands such that the RNAi construct has two nucleotide overhangs. For instance, in one embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand that are each 21 nucleotides in length, (ii) a duplex region that is 19 base pairs in length, and (iii) nucleotide overhangs of 2 unpaired nucleotides at both the 3ʹ end of the sense strand and the 3ʹ end of the antisense strand. In another embodiment, theRNAi construct comprises (i) a sense strand and an antisense strand that are each 23 nucleotides in length, (ii) a duplex region that is 21 base pairs in length, and (iii) nucleotide overhangs of 2 unpaired nucleotides at both the 3ʹ end of the sense strand and the 3ʹ end of the antisense strand. In other embodiments, the sense strand and antisense strand have the same length and form a duplex region over their entire length such that there are no nucleotide overhangs on either end of the double-stranded molecule. In one such embodiment, the RNAi construct is blunt ended (e.g. has two blunt ends) and comprises (i) a sense strand and an antisense strand, each of which is 21 nucleotides in length, and (ii) a duplex region that is 21 base pairs in length. In another such embodiment, the RNAi construct is blunt ended (e.g. has two blunt ends) and comprises (i) a sense strand and an antisense strand, each of which is 23 nucleotides in length, and (ii) a duplex region that is 23 base pairs in length. In still another such embodiment, the RNAi construct is blunt ended (e.g. has two blunt ends) and comprises (i) a sense strand and an antisense strand, each of which is 19 nucleotides in length, and (ii) a duplex region that is 19 base pairs in length.

[0036] In other embodiments, the sense strand or the antisense strand is longer than the other strand and the two strands form a duplex region having a length equal to that of the shorter strand such that the RNAi construct comprises at least one nucleotide overhang. For example, in one embodiment, the RNAi construct comprises (i) a sense strand that is 19 nucleotides in length, (ii) an antisense strand that is 21 nucleotides in length, (iii) a duplex region of 19 base pairs in length, and (iv) a nucleotide overhang of 2 unpaired nucleotides at the 3ʹ end of the antisense strand. In another embodiment, the RNAi construct comprises (i) a sense strand that is 21 nucleotides in length, (ii) an antisense strand that is 23 nucleotides in length, (iii) a duplex region of 21 base pairs in length, and (iv) a nucleotide overhang of 2 unpaired nucleotides at the 3ʹ end of the antisense strand.

[0037] The antisense strand of the RNAi constructs of the invention can comprise or consist of the sequence of any one of the antisense sequences listed in Table 2 or Table 3, the sequence of nucleotides 1-19 of any of these antisense sequences, or the sequence of nucleotides 2-19 of any of these antisense sequences. Thus, in some embodiments, the antisense strand comprises or consists of a sequence selected from SEQ ID NOs: 355-694 or 1093-1432. In other embodiments, the antisense strand comprises or consists of a sequence of nucleotides 1-19 of any one of SEQ ID NOs: 355-694 or 1093-1432. In still other embodiments, the antisense strand comprises or consists of a sequence of nucleotides 2-19 of any one of SEQ ID NOs: 355-694 or1093-1432. In certain embodiments, the antisense strand comprises or consists of a sequence selected from SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 427, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 443, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 512, SEQ ID NO: 517, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 521, SEQ ID NO: 522, SEQ ID NO: 524, SEQ ID NO: 525, SEQ ID NO: 527, SEQ ID NO: 529, SEQ ID NO: 540, SEQ ID NO: 619, SEQ ID NO: 634, SEQ ID NO: 673, and SEQ ID NO: 676. In some embodiments, the antisense strand comprises or consists of a sequence selected from SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 512, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 521, SEQ ID NO: 522, SEQ ID NO: 524, SEQ ID NO: 525, SEQ ID NO: 527, SEQ ID NO: 529, SEQ ID NO: 540, SEQ ID NO: 619, SEQ ID NO: 634, SEQ ID NO: 673, and SEQ ID NO: 676. In other embodiments, the antisense strand comprises or consists of a sequence selected from SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 673, and SEQ ID NO: 676.

[0038] In these and other embodiments, the sense strand of the RNAi constructs of the invention can comprise or consist of the sequence of any one of the sense sequences listed in Table 2 or Table 3, the sequence of nucleotides 1-19 of any of these sense sequences, or the sequence of nucleotides 2-19 of any of these sense sequences. Thus, in some embodiments, the sense strand comprises or consists of a sequence selected from SEQ ID NOs: 14-353 and 696-1091. In other embodiments, the sense strand comprises or consists of a sequence of nucleotides 1-19 of any one of SEQ ID NOs: 14-353 and 696-1091. In still other embodiments, the sense strand comprises or consists of a sequence of nucleotides 2-19 of any one of SEQ ID NOs: 14-353 and 696-1091. In certain embodiments, the sense strand comprises or consists of a sequence selected from SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 102, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 171, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 199, SEQ ID NO: 278, SEQ ID NO: 293, SEQ ID NO: 332, and SEQ ID NO: 335. In certain other embodiments, the sense strand comprises or consists of a sequence selected from SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, SEQID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 199, SEQ ID NO: 278, SEQ ID NO: 293, SEQ ID NO: 332, and SEQ ID NO: 335. In yet other embodiments, the sense strand comprises or consists of a sequence selected from SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 332, and SEQ ID NO: 335.

[0039] In certain embodiments of the invention, the RNAi constructs comprise (i) a sense strand comprising or consisting of a sequence selected from 14-353 and 696-1091 and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NOs: 355-694 and 1093- 1432. In some embodiments, the RNAi constructs comprise (i) a sense strand comprising or consisting of a sequence selected from SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 102, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 171, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 199, SEQ ID NO: 278, SEQ ID NO: 293, SEQ ID NO: 332, and SEQ ID NO: 335 and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 427, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 443, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 512, SEQ ID NO: 517, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 521, SEQ ID NO: 522, SEQ ID NO: 524, SEQ ID NO: 525, SEQ ID NO: 527, SEQ ID NO: 529, SEQ ID NO: 540, SEQ ID NO: 619, SEQ ID NO: 634, SEQ ID NO: 673, and SEQ ID NO: 676. In other embodiments, the RNAi constructs comprise (i) a sense strand comprising or consisting of a sequence selected from SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 199, SEQ ID NO: 278, SEQ ID NO: 293, SEQ ID NO: 332, and SEQ ID NO: 335 and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 512, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 521, SEQ ID NO: 522, SEQ ID NO: 524, SEQ ID NO: 525, SEQ ID NO: 527, SEQ ID NO: 529, SEQ ID NO: 540, SEQ ID NO: 619, SEQ ID NO: 634, SEQ ID NO: 673, and SEQ ID NO: 676. In still other embodiments, the RNAi constructs comprise (i) a sense strand comprising or consisting of a sequence selected from SEQ ID NO:96, SEQ ID NO: 97, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 332, and SEQ ID NO: 335 and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 673, and SEQ ID NO: 676.

[0040] In certain embodiments, the RNAi constructs of the invention comprise: (i) a sense strand comprising or consisting of the sequence of SEQ ID NO: 102 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 443; (ii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 188 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 529; (iii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 92 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 433; (iv) a sense strand comprising or consisting of the sequence of SEQ ID NO: 84 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 425; (v) a sense strand comprising or consisting of the sequence of SEQ ID NO: 83 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 424; (vi) a sense strand comprising or consisting of the sequence of SEQ ID NO: 86 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 427; (vii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 176 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 517; (viii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 199 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 540; (ix) a sense strand comprising or consisting of the sequence of SEQ ID NO: 171 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 512; (x) a sense strand comprising or consisting of the sequence of SEQ ID NO: 181 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 522; (xi) a sense strand comprising or consisting of the sequence of SEQ ID NO: 278 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 619; (xii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 293 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 634; (xiii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 332 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 673; (xiv) a sense strand comprising or consisting of the sequence of SEQ ID NO: 335 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 676; (xv) a sense strand comprising or consisting of thesequence of SEQ ID NO: 177 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 518; (xvi) a sense strand comprising or consisting of the sequence of SEQ ID NO: 180 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 521; (xvii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 186 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 527; (xviii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 184 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 525; (xix) a sense strand comprising or consisting of the sequence of SEQ ID NO: 136 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 477; (xx) a sense strand comprising or consisting of the sequence of SEQ ID NO: 179 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 520; (xxi) a sense strand comprising or consisting of the sequence of SEQ ID NO: 130 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 471; (xxii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 158 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 499; (xxiii) a sense strand comprising or consisting of the sequence of SEQ ID NO: 97 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 438; (xxiv) a sense strand comprising or consisting of the sequence of SEQ ID NO: 96 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 437; or (xxv) a sense strand comprising or consisting of the sequence of SEQ ID NO: 183 and an antisense strand comprising or consisting of the sequence of SEQ ID NO: 524.

[0041] In some embodiments, the RNAi constructs of the invention comprise: (i) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 784 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1181; (ii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 870 or SEQ ID NO: 1055 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1267; (iii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 774 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1171; (iv) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 766 and an antisense strand comprising or consisting of the sequence of modified nucleotides according toSEQ ID NO: 1163; (v) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 853 or SEQ ID NO: 1065 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1250; (vi) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 863 or SEQ ID NO: 1073 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1260; (vii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 765 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1162; (viii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 768 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1165; (ix) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 858 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1255; (x) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 881 or SEQ ID NO: 1072 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1278; (xi) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 960 or SEQ ID NO: 1054 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1357; (xii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 975 or SEQ ID NO: 1038 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1372; (xiii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1014 or SEQ ID NO: 1042 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1411; (xiv) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1017 or SEQ ID NO: 1039 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1414; (xv) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 859 or SEQ ID NO: 1044 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1256; (xvi) a sense strand comprising or consisting of thesequence of modified nucleotides according to SEQ ID NO: 862 or SEQ ID NO: 1074 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1259; (xvii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 868 or SEQ ID NO: 1056 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1265; (xviii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 866 or SEQ ID NO: 1059 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1263; (xix) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 818 or SEQ ID NO: 1052 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1215; (xx) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 861 or SEQ ID NO: 1043 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1258; (xxi) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 812 or SEQ ID NO: 1063 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1209; (xxii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 840 or SEQ ID NO: 1062 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1237; (xxiii) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 779 or SEQ ID NO: 1090 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1176; (xxiv) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 778 or SEQ ID NO: 1091 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1175; or (xxv) a sense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 865 or SEQ ID NO: 1061 and an antisense strand comprising or consisting of the sequence of modified nucleotides according to SEQ ID NO: 1262.

[0042] The RNAi construct of the invention can be any of the duplex compounds listed in Tables 2 or 3 (including the unmodified nucleotide sequences and / or modified nucleotide sequences of the compounds). In some embodiments, the RNAi construct is any of the duplex compoundslisted in Table 2. In other embodiments, the RNAi construct is any of the duplex compounds listed in Table 3 (including the unmodified nucleotide sequences and / or modified nucleotide sequences of the compounds). In certain embodiments, the RNAi construct is D-1069, D-1070, D-1072, D-1078, D-1082, D-1083, D-1088, D-1116, D-1122, D-1144, D-1157, D-1162, D-1163, D-1165, D-1166, D-1167, D-1169, D-1170, D-1172, D-1174, D-1185, D-1264, D-1279, D-1318, D-1321, D-1342, D-1343, D-1346, D-1347, D-1348, D-1356, D-1358, D-1359, D-1360, D-1363, D-1365, D-1366, D-1367, D-1369, D-1376, D-1377, D-1378, D-1395, D-1396, D-1397, D-1398, D-1400, D-1401, D-1402, D-1403, or D-1406. In certain other embodiments, the RNAi construct is D-1082, D-1083, D-1116, D-1122, D-1144, D-1157, D-1163, D-1165, D-1166, D-1167, D- 1169, D-1170, D-1264, D-1279, D-1318, D-1321, D-1342, D-1343, D-1346, D-1347, D-1348, D-1356, D-1358, D-1363, D-1365, D-1367, D-1369, D-1377, D-1378, D-1395, D-1396, D-1397, D-1398, D-1400, D-1401, D-1402, D-1403, or D-1406.

[0043] The RNAi constructs of the invention may comprise one or more modified nucleotides. A “modified nucleotide” refers to a nucleotide that has one or more chemical modifications to the nucleoside, nucleobase, pentose ring, or phosphate group. As used herein, modified nucleotides do not encompass ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate. However, the RNAi constructs may comprise combinations of modified nucleotides and ribonucleotides. Incorporation of modified nucleotides into one or both strands of double-stranded RNA molecules can improve the in vivo stability of the RNA molecules, e.g., by reducing the molecules’ susceptibility to nucleases and other degradation processes. The potency of RNAi constructs for reducing expression of the target gene can also be enhanced by incorporation of modified nucleotides.

[0044] In certain embodiments, the modified nucleotides have a modification of the ribose sugar. These sugar modifications can include modifications at the 2ʹ and / or 5ʹ position of the pentose ring as well as bicyclic sugar modifications. In some embodiments, the RNAi constructs of the invention comprise one or more 2ʹ-modified nucleotides. A 2ʹ-modified nucleotide refers to a nucleotide having a pentose ring with a substituent at the 2ʹ position other than OH. Such 2ʹ- modifications include, but are not limited to, 2ʹ-H (e.g. deoxyribonucleotides), 2ʹ-O-alkyl (e.g. - O-C1-C10or -O-C1-C10substituted alkyl), 2ʹ-O-allyl (-O-CH2CH=CH2), 2ʹ-C-allyl, 2'-deoxy-2'- fluoro (also referred to as 2'-F or 2ʹ-fluoro), 2ʹ-O-methyl (-OCH3), 2ʹ-O-methoxyethyl (-O-(CH2)2OCH3), 2ʹ-OCF3, 2ʹ-O(CH2)2SCH3, 2ʹ-O-aminoalkyl, 2ʹ-amino (e.g. -NH2), 2ʹ-O- ethylamine, and 2ʹ-azido. Modifications at the 5ʹ position of the pentose ring include, but are not limited to, 5ʹ-methyl (R or S configuration); 5ʹ-vinyl, and 5ʹ-methoxy.

[0045] A “bicyclic sugar modification” refers to a modification of the pentose ring where a bridge connects two atoms of the ring to form a second ring resulting in a bicyclic sugar structure. In some embodiments the bicyclic sugar modification comprises a bridge between the 4ʹ and 2ʹ carbons of the pentose ring. Nucleotides comprising a sugar moiety with a bicyclic sugar modification are referred to herein as bicyclic nucleic acids or BNAs. Exemplary bicyclic sugar modifications include, but are not limited to, α-L-Methyleneoxy (4ʹ-CH2—O-2ʹ) bicyclic nucleic acid (BNA); β-D-Methyleneoxy (4ʹ-CH2—O-2ʹ) BNA (also referred to as a locked nucleic acid or LNA); Ethyleneoxy (4ʹ-(CH2)2—O-2ʹ) BNA; Aminooxy (4ʹ-CH2—O—N(R)- 2ʹ, wherein R is H, C1-C12alkyl, or a protecting group) BNA; Oxyamino (4ʹ-CH2—N(R) —O-2ʹ, wherein R is H, C1-C12 alkyl, or a protecting group) BNA; Methyl(methyleneoxy) (4ʹ-CH(CH3) —O-2ʹ) BNA (also referred to as constrained ethyl or cEt); methylene-thio (4ʹ-CH2—S-2ʹ) BNA; methylene-amino (4ʹ-CH2-N(R)- 2ʹ, wherein R is H, C1-C12alkyl, or a protecting group) BNA; methyl carbocyclic (4ʹ-CH2—CH(CH3)- 2ʹ) BNA; propylene carbocyclic (4ʹ-(CH2)3-2ʹ) BNA; and Methoxy(ethyleneoxy) (4ʹ-CH(CH2OMe)-O-2ʹ) BNA (also referred to as constrained MOE or cMOE). These and other sugar-modified nucleotides that can be incorporated into the RNAi constructs of the invention are described in U.S. Patent No.9,181,551, U.S. Patent Publication No.2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol.19: 937-954, 2012.

[0046] In some embodiments, the RNAi constructs comprise one or more 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, 2ʹ-O-methoxyethyl modified nucleotides, 2ʹ-O- alkyl modified nucleotides, 2ʹ-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), deoxyribonucleotides, or combinations thereof. In certain embodiments, the RNAi constructs comprise one or more 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, 2ʹ-O- methoxyethyl modified nucleotides, or combinations thereof. In one particular embodiment, the RNAi constructs comprise one or more 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides or combinations thereof.

[0047] Both the sense and antisense strands of the RNAi constructs can comprise one or multiple modified nucleotides. For instance, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In certain embodiments, all nucleotides in thesense strand are modified nucleotides. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In other embodiments, all nucleotides in the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides can be 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, or combinations thereof.

[0048] In certain embodiments, the modified nucleotides incorporated into one or both of the strands of the RNAi constructs of the invention have a modification of the nucleobase (also referred to herein as “base”). A “modified nucleobase” or “modified base” refers to a base other than the naturally occurring purine bases adenine (A) and guanine (G) and pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases can be synthetic or naturally occurring modifications and include, but are not limited to, universal bases, 5-methylcytosine (5- me-C), 5-hydroxymethyl cytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6- methyladenine, 6-methylguanine, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine.

[0049] In some embodiments, the modified base is a universal base. A “universal base” refers to a base analog that indiscriminately forms base pairs with all of the natural bases in RNA and DNA without altering the double helical structure of the resulting duplex region. Universal bases are known to those of skill in the art and include, but are not limited to, inosine, C-phenyl, C- naphthyl and other aromatic derivatives, azole carboxamides, and nitroazole derivatives, such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole.

[0050] Other suitable modified bases that can be incorporated into the RNAi constructs of the invention include those described in Herdewijn, Antisense Nucleic Acid Drug Dev., Vol.10: 297–310, 2000 and Peacock et al., J. Org. Chem., Vol.76: 7295–7300, 2011. The skilled person is well aware that guanine, cytosine, adenine, thymine, and uracil may be replaced by othernucleobases, such as the modified nucleobases described above, without substantially altering the base pairing properties of a polynucleotide comprising a nucleotide bearing such replacement nucleobase.

[0051] In some embodiments, the sense and antisense strands of the RNAi constructs may comprise one or more abasic nucleotides. An “abasic nucleotide” or “abasic nucleoside” is a nucleotide or nucleoside that lacks a nucleobase at the 1ʹ position of the ribose sugar. In certain embodiments, the abasic nucleotides are incorporated into the terminal ends of the sense and / or antisense strands of the RNAi constructs. In one embodiment, the sense strand comprises an abasic nucleotide as the terminal nucleotide at its 3ʹ end, its 5ʹ end, or both its 3ʹ and 5ʹ ends. In another embodiment, the antisense strand comprises an abasic nucleotide as the terminal nucleotide at its 3ʹ end, its 5ʹ end, or both its 3ʹ and 5ʹ ends. In such embodiments in which the abasic nucleotide is a terminal nucleotide, it may be an inverted nucleotide – that is, linked to the adjacent nucleotide through a 3ʹ-3ʹ internucleotide linkage (when on the 3ʹ end of a strand) or through a 5ʹ-5ʹ internucleotide linkage (when on the 5ʹ end of a strand) rather than the natural 3ʹ- 5ʹ internucleotide linkage. Abasic nucleotides may also comprise a sugar modification, such as any of the sugar modifications described above. In certain embodiments, abasic nucleotides comprise a 2ʹ-modification, such as a 2ʹ-fluoro modification, 2ʹ-O-methyl modification, or a 2ʹ-H (deoxy) modification. In one embodiment, the abasic nucleotide comprises a 2ʹ-O-methyl modification. In another embodiment, the abasic nucleotide comprises a 2ʹ-H modification (i.e. a deoxy abasic nucleotide).

[0052] In certain embodiments, the RNAi constructs of the invention may comprise modified nucleotides incorporated into the sense and antisense strands according to a particular pattern, such as the patterns described in WIPO Publication No. WO 2020 / 123410. RNAi constructs having such chemical modification patterns have been shown to have improved gene silencing activity in vivo. In one embodiment, the RNAi construct of the invention comprises a sense strand and an antisense strand that comprise sequences that are sufficiently complementary to each other to form a duplex region of at least 15 base pairs, wherein: • nucleotides at positions 2, 7, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides; • nucleotides in the sense strand at positions paired with positions 8 to 11 and 13 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides; and• neither the sense strand nor the antisense strand each have more than 7 total 2′-fluoro modified nucleotides.

[0053] In other embodiments, the RNAi construct of the invention comprises a sense strand and an antisense strand that comprise sequences that are sufficiently complementary to each other to form a duplex region of at least 19 base pairs, wherein: • nucleotides at positions 2, 7, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides, nucleotides at positions 4, 6, 10, and 12 (counting from the 5′ end) are optionally 2′-fluoro modified nucleotides, and all other nucleotides in the antisense strand are modified nucleotides other than 2′-fluoro modified nucleotides; and • nucleotides in the sense strand at positions paired with positions 8 to 11 and 13 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides, nucleotides in the sense strand at positions paired with positions 3 and 5 in the antisense strand (counting from the 5′ end) are optionally 2′-fluoro modified nucleotides; and all other nucleotides in the sense strand are modified nucleotides other than 2′-fluoro modified nucleotides.

[0054] In such embodiments, the modified nucleotides other than 2′-fluoro modified nucleotides can be selected from 2ʹ-O-methyl modified nucleotides, 2ʹ-O-methoxyethyl modified nucleotides, 2ʹ-O-alkyl modified nucleotides, 2ʹ-O-allyl modified nucleotides, BNAs, and deoxyribonucleotides. In these and other embodiments, the terminal nucleotide at the 3ʹ end, the 5ʹ end, or both the 3ʹ end and the 5ʹ end of the sense strand can be an abasic nucleotide or a deoxyribonucleotide. In such embodiments, the abasic nucleotide or deoxyribonucleotide may be inverted – i.e. linked to the adjacent nucleotide through a 3ʹ-3ʹ internucleotide linkage (when on the 3ʹ end of a strand) or through a 5ʹ-5ʹ internucleotide linkage (when on the 5ʹ end of a strand) rather than the natural 3ʹ-5ʹ internucleotide linkage.

[0055] In any of the above-described embodiments, nucleotides at positions 2, 7, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides. In other embodiments, nucleotides at positions 2, 4, 7, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides. In yet other embodiments, nucleotides at positions 2, 4, 6, 7, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides. In still other embodiments, nucleotides at positions 2, 4, 6, 7, 10, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides. In alternativeembodiments, nucleotides at positions 2, 7, 10, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides. In certain other embodiments, nucleotides at positions 2, 4, 7, 10, 12, and 14 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides.

[0056] In any of the above-described embodiments, nucleotides in the sense strand at positions paired with positions 3, 8 to 11, and 13 in the antisense strand (counting from the 5′ end) are 2′- fluoro modified nucleotides. In some embodiments, nucleotides in the sense strand at positions paired with positions 5, 8 to 11, and 13 in the antisense strand (counting from the 5′ end) are 2′- fluoro modified nucleotides. In other embodiments, nucleotides in the sense strand at positions paired with positions 3, 5, 8 to 11, and 13 in the antisense strand (counting from the 5′ end) are 2′-fluoro modified nucleotides.

[0057] In some embodiments, the RNAi construct of the invention comprises a structure represented by Formula (A): 5′-(NA)xNLNLNLNLNLNLNFNLNFNFNFNFNLNLNMNLNMNLNT(n)y-3′ 3′-(NB)zNLNLNLNLNLNFNLNMNLNMNLNLNFNMNLNMNLNFNL-5′ (A)

[0058] In Formula (A), the top strand listed in the 5′ to 3′ direction is the sense strand and the bottom strand listed in the 3′ to 5′ direction is the antisense strand; each NFrepresents a 2′-fluoro modified nucleotide; each NMindependently represents a modified nucleotide selected from a 2ʹ- fluoro modified nucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide; each NLindependently represents a modified nucleotide selected from a 2ʹ- O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide; and NT represents a modified nucleotide selected from an abasic nucleotide, an inverted abasic nucleotide, an inverted deoxyribonucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O- methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. X can be an integer from 0 to 4, provided that when x is 1, 2, 3, or 4, one or more of the NAnucleotides is a modified nucleotide independently selected from an abasic nucleotide, an inverted abasic nucleotide, an inverteddeoxyribonucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. One or more of the NAnucleotides can be complementary to nucleotides in the antisense strand. Y can be an integer from 0 to 4, provided that when y is 1, 2, 3, or 4, one or more n nucleotides are modified or unmodified overhang nucleotides that do not base pair with nucleotides in the antisense strand. Z can be an integer from 0 to 4, provided that when z is 1, 2, 3, or 4, one or more of the NBnucleotides is a modified nucleotide independently selected from a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. One or more of the NBnucleotides can be complementary to NAnucleotides when present in the sense strand or can be overhang nucleotides that do not base pair with nucleotides in the sense strand.

[0059] In some embodiments in which the RNAi construct comprises a structure represented by Formula (A), there is a nucleotide overhang at the 3′ end of the sense strand – i.e. y is 1, 2, 3, or 4. In one such embodiment, y is 2. In embodiments in which there is an overhang of 2 nucleotides at the 3′ end of the sense strand (i.e. y is 2), x is 0 and z is 2 or x is 1 and z is 2. In other embodiments in which the RNAi construct comprises a structure represented by Formula (A), the RNAi construct comprises a blunt end at the 3′ end of the sense strand and the 5′ end of the antisense strand (i.e. y is 0). In such embodiments where there is no nucleotide overhang at the 3′ end of the sense strand (i.e. y is 0): (i) x is 2 and z is 4, (ii) x is 3 and z is 4, (iii) x is 0 and z is 2, (iv) x is 1 and z is 2, or (v) x is 2 and z is 2. In any of the embodiments in which x is greater than 0, the NA nucleotide that is the terminal nucleotide at the 5′ end of the sense strand can be an inverted nucleotide, such as an inverted abasic nucleotide or an inverted deoxyribonucleotide.

[0060] In certain embodiments in which the RNAi construct comprises a structure represented by Formula (A), the NM at positions 4 and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In other embodiments, the NMat positions 4, 6, and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In yet other embodiments, the NM at positions 4, 6, 10, and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In alternative embodiments in which the RNAi construct comprises a structure represented by Formula (A), the NMat positions 10 and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In relatedembodiments, the NM at positions 4, 10, and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In other alternative embodiments in which the RNAi construct comprises a structure represented by Formula (A), the NMat positions 4, 6, and 10 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide, and the NM at position 12 in the antisense strand counting from the 5ʹ end is a 2′-fluoro modified nucleotide. In some embodiments in which the RNAi construct comprises a structure represented by Formula (A), each NMin the sense strand is a 2ʹ-O-methyl modified nucleotide. In other embodiments, each NM in the sense strand is a 2′-fluoro modified nucleotide. In still other embodiments in which the RNAi construct comprises a structure represented by Formula (A), each NMin both the sense and antisense strands is a 2ʹ-O-methyl modified nucleotide.

[0061] In any of the above-described embodiments in which the RNAi construct comprises a structure represented by Formula (A), each NL in both the sense and antisense strands can be a 2ʹ-O-methyl modified nucleotide. In these embodiments and any of the embodiments described above, NT in Formula (A) can be an inverted abasic nucleotide, an inverted deoxyribonucleotide, or a 2ʹ-O-methyl modified nucleotide.

[0062] In other embodiments of the invention, the RNAi construct of the invention comprises a structure represented by Formula (B): 5′-(NA)xNLNLNLNLNMNLNFNFNFNFNLNLNLNLNLNLNLNLNT(n)y-3′ 3′-(NB)zNLNLNLNMNLNFNLNMNLNLNMNMNMNMNLNMNLNFNL-5′ (B)

[0063] In Formula (B), the top strand listed in the 5′ to 3′ direction is the sense strand and the bottom strand listed in the 3′ to 5′ direction is the antisense strand; each NFrepresents a 2′-fluoro modified nucleotide; each NM independently represents a modified nucleotide selected from a 2ʹ- fluoro modified nucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide; each NL independently represents a modified nucleotide selected from a 2ʹ- O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide; and NTrepresents a modified nucleotide selected from an abasic nucleotide, an inverted abasic nucleotide, an inverted deoxyribonucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. X can be an integer from 0 to 4, provided that when x is 1, 2, 3, or 4, one or more of the NAnucleotides is a modified nucleotide independently selected from an abasic nucleotide, an inverted abasic nucleotide, an inverted deoxyribonucleotide, a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. One or more of the NAnucleotides can be complementary to nucleotides in the antisense strand. Y can be an integer from 0 to 4, provided that when y is 1, 2, 3, or 4, one or more n nucleotides are modified or unmodified overhang nucleotides that do not base pair with nucleotides in the antisense strand. Z can be an integer from 0 to 4, provided that when z is 1, 2, 3, or 4, one or more of the NB nucleotides is a modified nucleotide independently selected from a 2ʹ-O-methyl modified nucleotide, a 2ʹ-O-methoxyethyl modified nucleotide, a 2ʹ-O-alkyl modified nucleotide, a 2ʹ-O-allyl modified nucleotide, a BNA, and a deoxyribonucleotide. One or more of the NB nucleotides can be complementary to NA nucleotides when present in the sense strand or can be overhang nucleotides that do not base pair with nucleotides in the sense strand.

[0064] In some embodiments in which the RNAi construct comprises a structure represented by Formula (B), there is a nucleotide overhang at the 3′ end of the sense strand – i.e. y is 1, 2, 3, or 4. In one such embodiment, y is 2. In embodiments in which there is an overhang of 2 nucleotides at the 3′ end of the sense strand (i.e. y is 2), x is 0 and z is 2 or x is 1 and z is 2. In other embodiments in which the RNAi construct comprises a structure represented by Formula (B), the RNAi construct comprises a blunt end at the 3′ end of the sense strand and the 5′ end of the antisense strand (i.e. y is 0). In such embodiments where there is no nucleotide overhang at the 3′ end of the sense strand (i.e. y is 0): (i) x is 2 and z is 4, (ii) x is 3 and z is 4, (iii) x is 0 and z is 2, (iv) x is 1 and z is 2, or (v) x is 2 and z is 2. In any of the embodiments in which x is greater than 0, the NA nucleotide that is the terminal nucleotide at the 5′ end of the sense strand can be an inverted nucleotide, such as an inverted abasic nucleotide or an inverted deoxyribonucleotide.

[0065] In certain embodiments in which the RNAi construct comprises a structure represented by Formula (B), the NMat positions 4, 6, 8, 9, and 16 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide and the NMat positions 7 and 12 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide. In otherembodiments, the NM at positions 4 and 6 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide and the NM at positions 7 to 9 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide. In still other embodiments, the NM at positions 4, 6, 8, 9, and 16 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide and the NM at positions 7 and 12 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In alternative embodiments in which the RNAi construct comprises a structure represented by Formula (B), the NMat positions 4, 6, 8, 9, and 12 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide and the NMat positions 7 and 16 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In certain other embodiments in which the RNAi construct comprises a structure represented by Formula (B), the NM at positions 7, 8, 9, and 12 in the antisense strand counting from the 5ʹ end are each a 2ʹ-O-methyl modified nucleotide and the NMat positions 4, 6, and 16 in the antisense strand counting from the 5ʹ end are each a 2′-fluoro modified nucleotide. In these and other embodiments in which the RNAi construct comprises a structure represented by Formula (B), the NM in the sense strand is a 2′-fluoro modified nucleotide. In alternative embodiments, the NMin the sense strand is a 2ʹ-O-methyl modified nucleotide.

[0066] In any of the above-described embodiments in which the RNAi construct comprises a structure represented by Formula (B), each NLin both the sense and antisense strands can be a 2ʹ-O-methyl modified nucleotide. In these embodiments and any of the embodiments described above, NT in Formula (B) can be an inverted abasic nucleotide, an inverted deoxyribonucleotide, or a 2ʹ-O-methyl modified nucleotide.

[0067] The RNAi constructs of the invention may also comprise one or more modified internucleotide linkages. As used herein, the term “modified internucleotide linkage” refers to an internucleotide linkage other than the natural 3ʹ to 5ʹ phosphodiester linkage. In some embodiments, the modified internucleotide linkage is a phosphorous-containing internucleotide linkage, such as a phosphotriester, aminoalkylphosphotriester, an alkylphosphonate (e.g. methylphosphonate, 3ʹ-alkylene phosphonate), a phosphinate, a phosphoramidate (e.g.3ʹ-amino phosphoramidate and aminoalkylphosphoramidate), a phosphorothioate, a chiral phosphorothioate, a phosphorodithioate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, and a boranophosphate. In one embodiment, a modifiedinternucleotide linkage is a 2ʹ to 5ʹ phosphodiester linkage. In other embodiments, the modified internucleotide linkage is a non-phosphorous-containing internucleotide linkage and thus can be referred to as a modified internucleoside linkage. Such non-phosphorous-containing linkages include, but are not limited to, morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane linkages (—O—Si(H)2—O—); sulfide, sulfoxide and sulfone linkages; formacetyl and thioformacetyl linkages; alkene containing backbones; sulfamate backbones; methylenemethylimino (—CH2—N(CH3) —O—CH2—) and methylenehydrazino linkages; sulfonate and sulfonamide linkages; amide linkages; and others having mixed N, O, S and CH2 component parts. In one embodiment, the modified internucleoside linkage is a peptide-based linkage (e.g. aminoethylglycine) to create a peptide nucleic acid or PNA, such as those described in U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. Other suitable modified internucleotide and internucleoside linkages that may be employed in the RNAi constructs of the invention are described in U.S. Patent No.6,693,187, U.S. Patent No.9,181,551, U.S. Patent Publication No.2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol.19: 937- 954, 2012.

[0068] In certain embodiments, the RNAi constructs of the invention comprise one or more phosphorothioate internucleotide linkages. The phosphorothioate internucleotide linkages may be present in the sense strand, antisense strand, or both strands of the RNAi constructs. For instance, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, or more phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, or more phosphorothioate internucleotide linkages. In still other embodiments, both strands comprise 1, 2, 3, 4, 5, 6, 7, 8, or more phosphorothioate internucleotide linkages. The RNAi constructs can comprise one or more phosphorothioate internucleotide linkages at the 3ʹ-end, the 5ʹ-end, or both the 3ʹ- and 5ʹ-ends of the sense strand, the antisense strand, or both strands. For instance, in certain embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 3′-end of the sense strand, the antisense strand, or both strands. In other embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 5'-end of the sense strand, the antisense strand, or both strands. In one particular embodiment, the antisense strand comprises at least 1 but no more than 6 phosphorothioate internucleotidelinkages and the sense strand comprises at least 1 but no more than 4 phosphorothioate internucleotide linkages. In another particular embodiment, the antisense strand comprises at least 1 but no more than 4 phosphorothioate internucleotide linkages and the sense strand comprises at least 1 but no more than 2 phosphorothioate internucleotide linkages.

[0069] In some embodiments, the RNAi construct comprises a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the sense strand. In other embodiments, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3ʹ end of the sense strand. In certain embodiments, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end of the sense strand. In certain other embodiments, the RNAi construct comprises a sense strand having two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end and a phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end. In one embodiment, the RNAi construct comprises a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the sense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the antisense strand. In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3ʹ end of the antisense strand (i.e. a phosphorothioate internucleotide linkage at the first and second internucleotide linkages at the 3ʹ end of the antisense strand). In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand. In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and two consecutive phosphorothioate internucleotide linkages at the 5ʹ end of the sense strand. In still another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3ʹ end of the sense strand. In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and two consecutive phosphorothioate internucleotidelinkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the sense strand (i.e. a phosphorothioate internucleotide linkage at the first and second internucleotide linkages at both the 5ʹ and 3ʹ ends of the antisense strand and a phosphorothioate internucleotide linkage at the first and second internucleotide linkages at both the 5ʹ and 3ʹ ends of the sense strand). In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the sense strand. In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand (i.e. four total phosphorothioate internucleotide linkages in the antisense strand), and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end of the sense strand and a third phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the sense strand (i.e. three total phosphorothioate internucleotide linkages in the sense strand). In any of the embodiments in which one or both strands comprise one or more phosphorothioate internucleotide linkages, the remaining internucleotide linkages within the strands can be the natural 3ʹ to 5ʹ phosphodiester linkages. For instance, in some embodiments, each internucleotide linkage of the sense and antisense strands is selected from phosphodiester and phosphorothioate, wherein at least one internucleotide linkage is a phosphorothioate.

[0070] In embodiments in which the RNAi construct comprises a nucleotide overhang, two or more of the unpaired nucleotides in the overhang can be connected by a phosphorothioate internucleotide linkage. In certain embodiments, all the unpaired nucleotides in a nucleotide overhang at the 3ʹ end of the antisense strand and / or the sense strand are connected by phosphorothioate internucleotide linkages. In other embodiments, all the unpaired nucleotides in a nucleotide overhang at the 5ʹ end of the antisense strand and / or the sense strand are connected by phosphorothioate internucleotide linkages. In still other embodiments, all the unpaired nucleotides in any nucleotide overhang are connected by phosphorothioate internucleotide linkages.

[0071] Incorporation of a phosphorothioate internucleotide linkage introduces an additional chiral center at the phosphorous atom in the oligonucleotide and therefore creates a diastereomer pair (Rp and Sp) at each phosphorothioate internucleotide linkage. Diastereomers ordiastereoisomers are different configurations of a compound that have the same molecular formula and sequence of bonded atoms but differ in the three-dimensional orientations of their atoms in space. Unlike enantiomers, diastereomers are not mirror-images of each other. Each chiral phosphate atom can be in the “R” configuration (Rp) or the “S” configuration (Sp). In certain embodiments, the RNAi constructs of the invention may comprise one or more phosphorothioate internucleotide linkages where the chiral phosphates are selected to be primarily in either the Rp or Sp configuration. For instance, in some embodiments in which the RNAi constructs have one or more phosphorothioate internucleotide linkages, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the chiral phosphates are in the Sp configuration. In other embodiments in which the RNAi constructs have one or more phosphorothioate internucleotide linkages, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the chiral phosphates are in the Rp configuration. All the chiral phosphates in the RNAi construct can be either in the Sp configuration or the Rp configuration (i.e. the RNAi construct is stereopure). In one particular embodiment, all the chiral phosphates in the RNAi construct are in the Sp configuration. In another particular embodiment, all the chiral phosphates in the RNAi construct are in the Rp configuration.

[0072] In certain embodiments, the chiral phosphates in the RNAi construct may have different configurations at different positions in the sense strand or antisense strand. In one such embodiment in which the RNAi construct comprises one or two phosphorothioate internucleotide linkages at the 5ʹ end of the antisense strand, the chiral phosphates at the 5ʹ end of the antisense strand may be in the Rp configuration. In another such embodiment in which the RNAi construct comprises one or two phosphorothioate internucleotide linkages at the 3ʹ end of the antisense strand, the chiral phosphates at the 3ʹ end of the antisense strand may be in the Sp configuration. In certain embodiments, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3ʹ end of the sense strand, wherein the chiral phosphates at the 5ʹ end of the antisense strand are in the Rp configuration, the chiral phosphates at the 3ʹ end of the antisense strand are in the Sp configuration, and the chiral phosphates at the 3ʹ end of the sense strand can be either in the Rp or Sp configuration. In certain other embodiments, theRNAi construct comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends of the antisense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end of the sense strand, wherein the chiral phosphates at the 5ʹ end of the antisense strand are in the Rp configuration, the chiral phosphates at the 3ʹ end of the antisense strand are in the Sp configuration, and the chiral phosphate at the 3ʹ end of the sense strand can be either in the Rp or Sp configuration. Methods of controlling the stereochemistry of phosphorothioate linkages during oligonucleotide synthesis are known to those skilled in the art and can include methods described in Nawrot and Rebowska, Curr Protoc Nucleic Acid Chem.2009, Chapter 4:. doi:10.1002 / 0471142700.nc0434s362009; Jahns et al., Nat. Commun, Vol.6: 6317, 2015; Knouse et al., Science, Vol.361: 1234-1238, 2018; and Sakamuri et al., Chembiochem, Vol. 21(9): 1304-1308, 2020.

[0073] In some embodiments of the RNAi constructs of the invention, the 5ʹ end of the sense strand, antisense strand, or both the antisense and sense strands comprises a phosphate moiety. As used herein, the term “phosphate moiety” refers to a terminal phosphate group that includes unmodified phosphates (—O—P=O)(OH)OH) as well as modified phosphates. Modified phosphates include phosphates in which one or more of the O and OH groups are replaced with H, O, S, N(R) or alkyl (e.g. C1 to C12) where R is H, an amino protecting group or unsubstituted or substituted alkyl (e.g. C1to C12). Exemplary phosphate moieties include, but are not limited to, 5ʹ-monophosphate; 5ʹ-diphosphate; 5ʹ-triphosphate; 5ʹ-guanosine cap (7-methylated or non- methylated); 5ʹ-adenosine cap or any other modified or unmodified nucleotide cap structure; 5ʹ- monothiophosphate (phosphorothioate); 5ʹ-monodithiophosphate (phosphorodithioate); 5ʹ-alpha- thiotriphosphate; 5ʹ-gamma-thiotriphosphate, 5ʹ-phosphoramidates; 5ʹ-vinylphosphates; 5ʹ- alkylphosphonates (e.g., alkyl = methyl, ethyl, isopropyl, propyl, etc.); and 5ʹ- alkyletherphosphonates (e.g., alkylether = methoxymethyl, ethoxymethyl, etc.).

[0074] The modified nucleotides that can be incorporated into the RNAi constructs of the invention may have more than one chemical modification described herein. For instance, the modified nucleotide may have a modification to the ribose sugar as well as a modification to the nucleobase. By way of example, a modified nucleotide may comprise a 2ʹ sugar modification (e.g.2ʹ-fluoro or 2ʹ-O-methyl) and comprise a modified base (e.g.5-methyl cytosine or pseudouracil). In other embodiments, the modified nucleotide may comprise a sugarmodification in combination with a modification to the 5ʹ phosphate that would create a modified internucleotide or internucleoside linkage when the modified nucleotide was incorporated into a polynucleotide. For instance, in some embodiments, the modified nucleotide may comprise a sugar modification, such as a 2ʹ-fluoro modification, a 2ʹ-O-methyl modification, or a bicyclic sugar modification, as well as a 5ʹ phosphorothioate group. Accordingly, in some embodiments, one or both strands of the RNAi constructs of the invention comprise a combination of 2ʹ modified nucleotides or BNAs and phosphorothioate internucleotide linkages. In certain embodiments, both the sense and antisense strands of the RNAi constructs of the invention comprise a combination of 2ʹ-fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, and phosphorothioate internucleotide linkages. Exemplary RNAi constructs comprising modified nucleotides and internucleotide linkages are shown in Table 3.

[0075] The RNAi constructs of the invention can readily be made using techniques known in the art, for example, using conventional nucleic acid solid phase synthesis. The polynucleotides of the RNAi constructs can be assembled on a suitable nucleic acid synthesizer utilizing standard nucleotide or nucleoside precursors (e.g. phosphoramidites). Automated nucleic acid synthesizers are sold commercially by several vendors, including DNA / RNA synthesizers from Applied Biosystems (Foster City, CA), MerMade synthesizers from BioAutomation (Irving, TX), and OligoPilot synthesizers from GE Healthcare Life Sciences (Pittsburgh, PA). An exemplary method for synthesizing the RNAi constructs of the invention is described in Example 2.

[0076] A 2ʹ silyl protecting group can be used in conjunction with acid labile dimethoxytrityl (DMT) at the 5ʹ position of ribonucleosides to synthesize oligonucleotides via phosphoramidite chemistry. Final deprotection conditions are known not to significantly degrade RNA products. All syntheses can be conducted in any automated or manual synthesizer on large, medium, or small scale. The syntheses may also be carried out in multiple well plates, columns, or glass slides.

[0077] The 2ʹ-O-silyl group can be removed via exposure to fluoride ions, which can include any source of fluoride ion, e.g., those salts containing fluoride ion paired with inorganic counterions e.g., cesium fluoride and potassium fluoride or those salts containing fluoride ion paired with an organic counterion, e.g., a tetraalkylammonium fluoride. A crown ether catalyst can be utilized in combination with the inorganic fluoride in the deprotection reaction. Exemplary fluoride ionsources are tetrabutylammonium fluoride or aminohydrofluorides (e.g., combining aqueous HF with triethylamine in a dipolar aprotic solvent, e.g., dimethylformamide).

[0078] The choice of protecting groups for use on the phosphite triesters and phosphotriesters can alter the stability of the triesters towards fluoride. Methyl protection of the phosphotriester or phosphite triester can stabilize the linkage against fluoride ions and improve process yields.

[0079] Since ribonucleosides have a reactive 2ʹ hydroxyl substituent, it can be desirable to protect the reactive 2ʹ position in RNA with a protecting group that is orthogonal to a 5ʹ-O- dimethoxytrityl protecting group, e.g., one stable to treatment with acid. Silyl protecting groups meet this criterion and can be readily removed in a final fluoride deprotection step that can result in minimal RNA degradation.

[0080] Tetrazole catalysts can be used in the standard phosphoramidite coupling reaction. Exemplary catalysts include, e.g., tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, p- nitrophenyltetrazole.

[0081] As can be appreciated by the skilled artisan, further methods of synthesizing the RNAi constructs described herein will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds. Other synthetic chemistry transformations, protecting groups (e.g., for hydroxyl, amino, etc. present on the bases) and protecting group methodologies (protection and deprotection) useful in synthesizing the RNAi constructs described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof. Custom synthesis of RNAi constructs is also available from several commercial vendors, including Dharmacon, Inc. (Lafayette, CO), AxoLabs GmbH (Kulmbach, Germany), and Ambion, Inc. (Foster City, CA).

[0082] The RNAi constructs of the invention may comprise a ligand. As used herein, a “ligand” refers to any compound or molecule that is capable of interacting with another compound or molecule, directly or indirectly. The interaction of a ligand with another compound or molecule may elicit a biological response (e.g. initiate a signal transduction cascade, induce receptor-mediated endocytosis) or may just be a physical association. The ligand can modify one or more properties of the double-stranded RNA molecule to which it is attached, such as the pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties of the RNA molecule.

[0083] The ligand may comprise a serum protein (e.g., human serum albumin, low-density lipoprotein, globulin), a cholesterol moiety, a vitamin (biotin, vitamin E, vitamin B12), a folate moiety, a steroid, a bile acid (e.g. cholic acid), a fatty acid (e.g., palmitic acid, myristic acid, stearic acid, docosanoic acid), a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), a glycoside, a phospholipid, or antibody or binding fragment thereof (e.g. antibody or binding fragment that targets the RNAi construct to a specific cell type, such as liver or adipose tissue). Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), peptides (e.g., antennapedia peptide, Tat peptide, RGD peptides), alkylating agents, polymers, such as polyethylene glycol (PEG )(e.g., PEG-40K), polyamino acids, and polyamines (e.g. spermine, spermidine).

[0084] In certain embodiments, the ligands have endosomolytic properties. The endosomolytic ligands promote the lysis of the endosome and / or transport of the RNAi construct of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand may be a polycationic peptide or peptidomimetic, which shows pH- dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at endosomal pH. The “active” conformation is that conformation in which the endosomolytic ligand promotes lysis of the endosome and / or transport of the RNAi construct of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, Vol.26: 2964-2972, 1987), the EALA peptide (Vogel et al., J. Am. Chem. Soc., Vol.118: 1581-1586, 1996), and their derivatives (Turk et al., Biochem. Biophys. Acta, Vol. 1559: 56-68, 2002). In one embodiment, the endosomolytic component may contain a chemicalgroup (e.g., an amino acid) which will undergo a change in charge or protonation in response to a change in pH. The endosomolytic component may be linear or branched.

[0085] In some embodiments, the ligand comprises a lipid or other hydrophobic molecule. For instance, the ligand may comprise a saturated or unsaturated C12-C24 hydrocarbon chain (e.g., C12-C24 alkyl or alkenyl). In some embodiments, the ligand comprises a saturated or unsaturated C16-C22hydrocarbon chain (e.g., C16-C22alkyl or alkenyl). In one embodiment, the ligand comprises a saturated or unsaturated C16hydrocarbon chain (e.g., C16alkyl or alkenyl). In another embodiment, the ligand comprises a saturated or unsaturated C22 hydrocarbon chain (e.g., C22alkyl or alkenyl). In related embodiments, the ligand comprises a saturated or unsaturated fatty acid. For instance, in certain embodiments, the ligand comprises a saturated fatty acid selected from dodecanoic acid (C12, lauric acid), tridecanoic acid (C13, tridecylic acid), tetradecanoic acid (C14, myristic acid), pentadecanoic acid (C15, pentadecylic acid), hexadecanoic acid (C16, palmitic acid), heptadecanoic acid (C17, margaric acid), octadecanoic acid (C18, stearic acid), nonadecanoic acid (C19, nonadecylic acid), icosanoic acid (C20, arachidic acid), heneicosanoic acid (C21, heneicosylic acid), docosanoic acid (C22, behenic acid), tricosanoic acid (C23, tricosylic acid), and tetracosanoic acid (C24, lignoceric acid). In other embodiments, the ligand comprises a fatty acid that is unsaturated and has one or more carbon-carbon double bonds. In some such embodiments, the ligand comprises an unsaturated fatty acid selected from 9-tetradecenoic acid (C14:1, myristoleic acid), 9-cis-hexadecenoic acid (C16:1, palmitoleic acid), cis-9-octadecenoic acid (C18:1, oleic acid), cis,cis-9,12- octadecadienoic acid (C18:2, linoleic acid), cis,cis,cis-9,12,15-octadecatrienoic acid (C18:3, α- linolenic acid), cis-11-eicosenoic acid (C20:1, gondoic acid), all-cis-5,8,11,14-eicosatetraenoic acid (C20:4, arachidonic acid), all-cis-7,10,13,16-docosatetraenoic acid (C22:4, adrenic acid), all cis-4,7,10,13,16,19-docosahexaenoic acid (C22:6, DHA / cervonic acid), and cis-15-tetracosenoic acid (C24:1, nervonic acid). In certain embodiments, the ligand comprises a fatty selected from lauric acid (C12), myristic acid (C14), palmitic acid (C16), palmitoleic acid (C16:1), stearic acid (C18), oleic acid (C18:1), linoleic acid (C18:2), arachidic acid (C20), arachidonic acid (C20:4), docosanoic acid (C22), docosahexaenoic acid (C22:6), or lignoceric acid (C24). In one particular embodiment, the ligand comprises palmitic acid. In another particular embodiment, the ligand comprises docosanoic acid. In any of the embodiments in which the ligand comprises a fatty acid, the free terminal carboxylic acid of the fatty acid can be used to conjugate the fatty acid tothe RNAi construct, optionally through a linker, as shown in Formula 1 and Formula 2. When used herein, terms to describe hydrophobic molecules that can be comprised in a ligand such as a free fatty acid (e.g. palmitic acid) are used interchangeably with the radical term (e.g. palmitoyl) for the conjugated form of the hydrophobic molecule.

[0086] In certain embodiments, the ligand comprises a cholesterol moiety or other steroid. Cholesterol-conjugated oligonucleotides have been reported to be more active than their unconjugated counterparts (Manoharan, Antisense Nucleic Acid Drug Development, Vol.12: 103-228, 2002). Ligands comprising cholesterol moieties and other lipids for conjugation to nucleic acid molecules have also been described in U.S. Patent Nos.7,851,615; 7,745,608; and 7,833,992. In other embodiments, the ligand comprises a folate moiety. Polynucleotides conjugated to folate moieties can be taken up by cells via a receptor-mediated endocytosis pathway. Such folate-polynucleotide conjugates are described in U.S. Patent No.8,188,247.

[0087] In some embodiments, it is desirable to specifically deliver the RNAi constructs of the invention to adipose tissue or adipocytes to reduce expression of CB1 protein specifically in adipocytes or adipose tissue, such as subcutaneous white adipose tissue or epididymal white adipose tissue. Conjugation of the RNAi constructs to ligands comprising hydrophobic moieties, such as fatty acids, cholesterol moieties, vitamins, folate moieties, steroids, and bile acids as described above are suitable for delivering the RNAi constructs to adipose tissue and adipocytes. In certain embodiments, the RNAi constructs are targeted to adipose tissue or adipocytes by conjugation to C12-C24hydrocarbon chains (e.g., C12-C24alkyl or alkenyl moieties). In some such embodiments, ligands comprising fatty acids with 12 to 24 carbons, such as those described herein, are conjugated to the RNAi constructs of the invention to deliver them to adipocytes and adipose tissue.

[0088] In other embodiments, it is desirable to specifically deliver the RNAi constructs of the invention to liver cells to reduce expression of CB1 protein specifically in the liver. Accordingly, in certain embodiments, the ligand targets delivery of the RNAi construct specifically to liver cells (e.g. hepatocytes) using various approaches as described in more detail below. In some embodiments, the RNAi constructs are targeted to liver cells with a ligand that binds to the surface-expressed asialoglycoprotein receptor (ASGR) or component thereof (e.g. ASGR1, ASGR2).

[0089] In some embodiments, RNAi constructs can be specifically targeted to the liver by employing ligands that bind to or interact with proteins expressed on the surface of liver cells. For example, in certain embodiments, the ligands may comprise antigen binding proteins (e.g. antibodies or binding fragments thereof (e.g. Fab, scFv)) that specifically bind to a receptor expressed on hepatocytes, such as the asialoglycoprotein receptor and the LDL receptor. In one particular embodiment, the ligand comprises an antibody or binding fragment thereof that specifically binds to ASGR1 and / or ASGR2. In another embodiment, the ligand comprises a Fab fragment of an antibody that specifically binds to ASGR1 and / or ASGR2. A “Fab fragment” is comprised of one immunoglobulin light chain (i.e. light chain variable region (VL) and constant region (CL)) and the CH1 region and variable region (VH) of one immunoglobulin heavy chain. In another embodiment, the ligand comprises a single-chain variable antibody fragment (scFv fragment) of an antibody that specifically binds to ASGR1 and / or ASGR2. An “scFv fragment” comprises the VH and VL regions of an antibody, wherein these regions are present in a single polypeptide chain, and optionally comprising a peptide linker between the VH and VL regions that enables the Fv to form the desired structure for antigen binding. Exemplary antibodies and binding fragments thereof that specifically bind to ASGR1 that can be used as ligands for targeting the RNAi constructs of the invention to the liver are described in WIPO Publication No. WO 2017 / 058944. Other antibodies or binding fragments thereof that specifically bind to ASGR1, LDL receptor, or other liver surface-expressed proteins suitable for use as ligands in the RNAi constructs of the invention are commercially available.

[0090] In certain embodiments, the ligand comprises a carbohydrate. A “carbohydrate” refers to a compound made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Carbohydrates include, but are not limited to, the sugars (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides, such as starches, glycogen, cellulose and polysaccharide gums. In some embodiments, the carbohydrate incorporated into the ligand is a monosaccharide selected from a pentose, hexose, or heptose and di- and tri-saccharides including such monosaccharide units. In other embodiments, the carbohydrate incorporated into the ligand is an amino sugar, such as galactosamine, glucosamine, N-acetylgalactosamine, and N-acetylglucosamine.

[0091] In some embodiments, the ligand comprises a hexose or hexosamine. The hexose may be selected from glucose, galactose, mannose, fucose, or fructose. The hexosamine may be selected from fructosamine, galactosamine, glucosamine, or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine, or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine, or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine. In particular embodiments, the ligand comprises N-acetyl-galactosamine. Ligands comprising glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective in targeting compounds to liver cells because such ligands bind to the ASGR expressed on the surface of hepatocytes. See, e.g., D’Souza and Devarajan, J. Control Release, Vol.203: 126-139, 2015. Examples of GalNAc- or galactose-containing ligands that can be incorporated into the RNAi constructs of the invention are described in U.S. Patent Nos.7,491,805; 8,106,022; and 8,877,917; U.S. Patent Publication No.20030130186; and WIPO Publication No. WO 2013166155.

[0092] In certain embodiments, the ligand comprises a multivalent carbohydrate moiety. As used herein, a “multivalent carbohydrate moiety” refers to a moiety comprising two or more carbohydrate units capable of independently binding or interacting with other molecules. For example, a multivalent carbohydrate moiety comprises two or more binding domains comprised of carbohydrates that can bind to two or more different molecules or two or more different sites on the same molecule. The valency of the carbohydrate moiety denotes the number of individual binding domains within the carbohydrate moiety. For instance, the terms “monovalent,” “bivalent,” “trivalent,” and “tetravalent” with reference to the carbohydrate moiety refer to carbohydrate moieties with one, two, three, and four binding domains, respectively. The multivalent carbohydrate moiety may comprise a multivalent lactose moiety, a multivalent galactose moiety, a multivalent glucose moiety, a multivalent N-acetyl-galactosamine moiety, a multivalent N-acetyl-glucosamine moiety, a multivalent mannose moiety, or a multivalent fucose moiety. In some embodiments, the ligand comprises a multivalent galactose moiety. In other embodiments, the ligand comprises a multivalent N-acetyl-galactosamine moiety. In these and other embodiments, the multivalent carbohydrate moiety can be bivalent, trivalent, or tetravalent. In such embodiments, the multivalent carbohydrate moiety can be bi-antennary or tri-antennary. In one particular embodiment, the multivalent N-acetyl-galactosamine moiety is trivalent ortetravalent. In another particular embodiment, the multivalent galactose moiety is trivalent or tetravalent.

[0093] The ligand can be attached or conjugated to the RNA molecule of the RNAi construct directly or indirectly. For instance, in some embodiments, the ligand is covalently attached directly to the sense or antisense strand of the RNAi construct. In other embodiments, the ligand is covalently attached via a linker to the sense or antisense strand of the RNAi construct. The ligand can be attached to nucleobases, sugar moieties, or internucleotide linkages of polynucleotides (e.g. sense strand or antisense strand) of the RNAi constructs of the invention. Conjugation or attachment to purine nucleobases or derivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In certain embodiments, the 2-, 6-, 7-, or 8-positions of a purine nucleobase are attached to a ligand. Conjugation or attachment to pyrimidine nucleobases or derivatives thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be attached to a ligand. Conjugation or attachment to sugar moieties of nucleotides can occur at any carbon atom. Exemplary carbon atoms of a sugar moiety that can be attached to a ligand include the 2ʹ, 3ʹ, and 5ʹ carbon atoms. The 1ʹ position can also be attached to a ligand, such as in an abasic nucleotide. Internucleotide linkages can also support ligand attachments. For phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithiotate, phosphoroamidate, and the like), the ligand can be attached directly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. For amine- or amide-containing internucleoside linkages (e.g., PNA), the ligand can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0094] In some embodiments, the ligand may be attached to the 3ʹ or 5ʹ end of either the sense or antisense strand of the RNAi constructs of the invention. In certain embodiments, the ligand is covalently attached to the 5ʹ end of the sense strand. In such embodiments, the ligand is attached to the 5ʹ-terminal nucleotide of the sense strand. In these and other embodiments, the ligand is attached at the 5ʹ-position of the 5ʹ-terminal nucleotide of the sense strand. In embodiments in which an inverted abasic nucleotide is the 5ʹ-terminal nucleotide of the sense strand and linked to the adjacent nucleotide via a 5ʹ-5ʹ internucleotide linkage, the ligand can be attached at the 3ʹ- position of the inverted abasic nucleotide. In other embodiments, the ligand is covalently attached to the 3ʹ end of the sense strand. For example, in some embodiments, the ligand is attached to the 3ʹ-terminal nucleotide of the sense strand. In certain such embodiments, theligand is attached at the 3ʹ-position of the 3ʹ-terminal nucleotide of the sense strand. In embodiments in which an inverted abasic nucleotide is the 3ʹ-terminal nucleotide of the sense strand and linked to the adjacent nucleotide via a 3ʹ-3ʹ internucleotide linkage, the ligand can be attached at the 5ʹ-position of the inverted abasic nucleotide. In alternative embodiments, the ligand is attached near the 3ʹ end of the sense strand, but before one or more terminal nucleotides (i.e. before 1, 2, 3, or 4 terminal nucleotides). In some embodiments, the ligand is attached at the 2ʹ-position of the sugar of the 3ʹ-terminal nucleotide of the sense strand. In other embodiments, the ligand is attached at the 2ʹ-position of the sugar of the 5ʹ-terminal nucleotide of the sense strand.

[0095] In certain embodiments, the ligand is attached to the sense or antisense strand via a linker. A “linker” is an atom or group of atoms that covalently joins a ligand to a polynucleotide component of the RNAi construct. The linker may be from about 1 to about 30 atoms in length, from about 2 to about 28 atoms in length, from about 3 to about 26 atoms in length, from about 4 to about 24 atoms in length, from about 6 to about 20 atoms in length, from about 7 to about 20 atoms in length, from about 8 to about 20 atoms in length, from about 8 to about 18 atoms in length, from about 10 to about 18 atoms in length, and from about 12 to about 18 atoms in length. In some embodiments, the linker may comprise a bifunctional linking moiety, which generally comprises an alkyl moiety with two functional groups. One of the functional groups is selected to bind to the compound of interest (e.g. sense or antisense strand of the RNAi construct) and the other is selected to bind essentially any selected group, such as a ligand as described herein. In certain embodiments, the linker comprises a chain structure or an oligomer of repeating units, such as ethylene glycol or amino acid units. Examples of functional groups that are typically employed in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.

[0096] Linkers that may be used to attach a ligand to the sense or antisense strand in the RNAi constructs of the invention include, but are not limited to, pyrrolidine, 8-amino-3,6- dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 6- aminohexanoic acid, substituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10 alkynyl. Suitable substituent groups for such linkers include,but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0097] In certain embodiments, the linkers are cleavable. A cleavable linker is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In some embodiments, the cleavable linker is cleaved at least 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in the target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0098] Cleavable linkers are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linker by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linker by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0099] A cleavable linker may comprise a moiety that is susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable group that is cleaved at a preferred pH, thereby releasing the RNA molecule from the ligand inside the cell, or into the desired compartment of the cell.

[0100] A linker can include a cleavable group that is cleavable by a particular enzyme. The type of cleavable group incorporated into a linker can depend on the cell to be targeted. For example, liver-targeting ligands can be linked to RNA molecules through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other types of cells rich in esterasesinclude cells of the lung, renal cortex, and testis. Linkers that contain peptide bonds can be used when targeting cells rich in peptidases, such as liver cells and synoviocytes.

[0101] In general, the suitability of a candidate cleavable linker can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linker. It will also be desirable to also test the candidate cleavable linker for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It may be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In some embodiments, useful candidate linkers are cleaved at least 2, 4, 10, 20, 50, 70, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0102] In other embodiments, redox cleavable linkers are utilized. Redox cleavable linkers are cleaved upon reduction or oxidation. An example of a reductively cleavable group is a disulfide linking group (-S–S-). To determine if a candidate cleavable linker is a suitable “reductively cleavable linker,” or for example is suitable for use with a particular RNAi construct and particular ligand, one can use one or more methods described herein. For example, a candidate linker can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent known in the art, which mimics the rate of cleavage that would be observed in a cell, e.g., a target cell. The candidate linkers can also be evaluated under conditions which are selected to mimic blood or serum conditions. In a specific embodiment, candidate linkers are cleaved by at most 10% in the blood. In other embodiments, useful candidate linkers are degraded at least 2, 4, 10, 20, 50, 70, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions).

[0103] In yet other embodiments, phosphate-based cleavable linkers, which are cleaved by agents that degrade or hydrolyze the phosphate group, are employed to covalently attach a ligand to the sense or antisense strand of the RNAi construct. An example of an agent that hydrolyzesphosphate groups in cells are enzymes, such as phosphatases in cells. Examples of phosphate- based cleavable groups are –O–P(O)(ORk)-O–, –O–P(S)(ORk)-O–, –O–P(S)(SRk)-O–, –S–P(O) (ORk)-O–, –O–P(O)(ORk)-S–, –S–P(O)(ORk)-S–, –O–P(S)(ORk)-S–, –S–P(S)(ORk)-O–, –O– P(O)(Rk)-O–, –O–P(S)(Rk)-O–, –S–P(O)(Rk)-O–, –S–P(S)(Rk)-O–, –S–P(O)(Rk)-S–, and –O– P(S)(Rk)-S–, where Rk can be hydrogen or C1-C10 alkyl. Specific embodiments include –O– P(O)(OH)–O–, –O–P(S)(OH)–O–, –O–P(S)(SH)–O–, –S–P(O)(OH)–O–, –O–P(O)(OH)–S–, –S– P(O)(OH)–S–, –O–P(S)(OH)–S–, –S–P(S)(OH)–O–, –O–P(O)(H)–O–, –O–P(S)(H)–O–, –S– P(O)(H)–O–, –S–P(S)(H)–O–, –S–P(O)(H)–S–, and –O–P(S)(H)–S–. Another specific embodiment is –O–P(O)(OH)–O–. These candidate linkers can be evaluated using methods analogous to those described above.

[0104] In other embodiments, the linkers may comprise acid cleavable groups, which are groups that are cleaved under acidic conditions. In some embodiments, acid cleavable groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents, such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes, can provide a cleaving environment for acid cleavable groups. Examples of acid cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula –C=NN–, C(O)O, or –OC(O). A specific embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl, pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[0105] In other embodiments, the linkers may comprise ester-based cleavable groups, which are cleaved by enzymes, such as esterases and amidases in cells. Examples of ester-based cleavable groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups. Ester cleavable groups have the general formula –C(O)O–, or –OC(O) –. These candidate linkers can be evaluated using methods analogous to those described above.

[0106] In further embodiments, the linkers may comprise peptide-based cleavable groups, which are cleaved by enzymes, such as peptidases and proteases in cells. Peptide-based cleavable groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups include the amide group (– C(O)NH–). The amide group can be formed between any alkylene, alkenylene or alkynylene. Apeptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins. Peptide-based cleavable linking groups have the general formula –NHCHRAC(O)NHCHRBC(O) –, where RAand RBare the side chains of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

[0107] Other types of linkers suitable for attaching ligands to the sense or antisense strands in the RNAi constructs of the invention are known in the art and can include the linkers described in U.S. Patent Nos. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551.

[0108] In certain embodiments, the ligand covalently attached to the sense or antisense strand of the RNAi constructs of the invention comprises a GalNAc moiety, e.g, a multivalent GalNAc moiety. In some embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 3ʹ end of the sense strand. In other embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 5ʹ end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 3ʹ end of the sense strand. In still other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 5ʹ end of the sense strand.

[0109] In certain embodiments, the RNAi constructs of the invention comprise a ligand having the following structure ([Structure 1]):In preferred embodiments, the ligand having this structure is covalently attached to the 5ʹ end of the sense strand (e.g. to the 5ʹ terminal nucleotide of the sense strand) via a linker, such as the linkers described herein. In one embodiment, the linker is an aminohexyl linker.

[0110] In one embodiment, the RNAi construct comprises a ligand and linker having the following structure of Formula I, wherein X = O or S, and the ligand and linker are attached to the 5ʹ carbon of the 5′ terminal nucleotide of the sense strand of the double-stranded RNA molecule (represented by the squiggly line):Formula I

[0111] In another embodiment, the RNAi construct comprises a ligand and linker having the following structure of Formula II, wherein X = O or S, and the ligand and linker are attached to the 5ʹ carbon of the 5′ terminal nucleotide of the sense strand of the double-stranded RNA molecule (represented by the squiggly line):Formula II

[0112] Any of the fatty acids described herein can be substituted for the palmitoyl moiety in Formula 1 or the docosanoyl moiety in Formula II. For example, the ligand can comprise a lauroyl, myristoyl, palmitoyl, palmitoleoyl, stearoyl, oleoyl, linoleoyl, arachidoyl, arachidonoyl, docosanoyl, docosahexaenoyl, or lignoceroyl moiety and be conjugated to the 5ʹ carbon of the 5′ terminal nucleotide of the sense strand via an aminohexyl linker.

[0113] In another embodiment, the RNAi construct comprises a ligand and linker having the following structure of Formula III, wherein X = O or S, “Ac” represents an acetyl group, and the ligand and linker are attached to the 5ʹ carbon of the 5′ terminal nucleotide of the sense strand of the double-stranded RNA molecule (represented by the squiggly line):

[0114] In any one of Formulas I-III, X can be S such that a phosphorothioate bond is used to covalently attach the ligand and linker to the nucleic acid strand.

[0115] The present invention also includes pharmaceutical compositions and formulations comprising the RNAi constructs described herein and pharmaceutically acceptable carriers, excipients, or diluents. Such compositions and formulations are useful for reducing expression of the CNR1 gene in a patient in need thereof. Where clinical applications are contemplated, pharmaceutical compositions and formulations will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.

[0116] The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, “pharmaceutically acceptable carrier, excipient, or diluent” includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the RNAi constructs of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the RNAi constructs of the compositions.

[0117] Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, type and extent of disease or disorder to be treated, or dose to be administered. In some embodiments, the pharmaceutical compositions are formulated based on the intended route of delivery. For instance, in certain embodiments, the pharmaceutical compositions are formulated for parenteral delivery. Parenteral forms of delivery include intravenous, intraarterial, subcutaneous, intrathecal, intraperitoneal or intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In such an embodiment, the pharmaceutical composition may include a lipid-based delivery vehicle. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery. In such an embodiment, the pharmaceutical composition may include a targeting ligand (e.g. ligands containing fatty acids or GalNAc moieties as described herein).

[0118] In some embodiments, the pharmaceutical compositions comprise an effective amount of an RNAi construct described herein. An “effective amount” is an amount sufficient to produce a beneficial or desired clinical result. In some embodiments, an effective amount is an amount sufficient to reduce CNR1 gene expression in a particular tissue or cell-type (e.g. adipocytes or adipose tissue, particularly white adipose tissue) of a patient. An effective amount of an RNAi construct of the invention may be from about 0.01 mg / kg body weight to about 100 mg / kg body weight, and may be administered daily, weekly, monthly, or at longer intervals. The precise determination of what would be considered an effective amount and frequency of administration may be based on several factors, including a patient’s size, age, and general condition, type of disorder to be treated (e.g. obesity, fatty liver disease, visceral obesity, type 2 diabetes, metabolic syndrome, or cardiovascular disease), particular RNAi construct employed, and route of administration.

[0119] Administration of the pharmaceutical compositions of the present invention may be via any common route so long as the target tissue is available via that route. Such routes include, but are not limited to, parenteral (e.g., subcutaneous, intramuscular, intraperitoneal or intravenous), oral, nasal, buccal, intradermal, transdermal, and sublingual routes, or by direct injection into adipose or liver tissue or delivery through the hepatic portal vein. In some embodiments, the pharmaceutical composition is administered parenterally. For instance, in certain embodiments,the pharmaceutical composition is administered intravenously. In other embodiments, the pharmaceutical composition is administered subcutaneously.

[0120] Colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes, may be used as delivery vehicles for the RNAi constructs of the invention. Commercially available fat emulsions that are suitable for delivering the nucleic acids of the invention include Intralipid®(Baxter International Inc.), Liposyn®(Abbott Pharmaceuticals), Liposyn®II (Hospira), Liposyn®III (Hospira), Nutrilipid (B. Braun Medical Inc.), and other similar lipid emulsions. An exemplary colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The RNAi constructs of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, RNAi constructs of the invention may be complexed to lipids, in particular to cationic lipids. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl ethanolamine (DOPE), dimyristoylphosphatidyl choline (DMPC), and dipalmitoyl phosphatidylcholine (DPPC)), distearolyphosphatidyl choline), negative (e.g., dimyristoylphosphatidyl glycerol (DMPG)), and cationic (e.g., dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidyl ethanolamine (DOTMA)). The preparation and use of such colloidal dispersion systems are well known in the art. Exemplary formulations are also disclosed in U.S. Pat. No.5,981,505; U.S. Pat. No.6,217,900; U.S. Pat. No.6,383,512; U.S. Pat. No.5,783,565; U.S. Pat. No.7,202,227; U.S. Pat. No.6,379,965; U.S. Pat. No.6,127,170; U.S. Pat. No.5,837,533; U.S. Pat. No.6,747,014; and WIPO Publication No. WO 03 / 093449.

[0121] In some embodiments, the RNAi constructs of the invention are fully encapsulated in a lipid formulation, e.g., to form a SNALP or other nucleic acid-lipid particle. As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle. SNALPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs are exceptionally useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous injection and accumulate at distal sites (e.g., sites physically separated from the administration site). The nucleic acid-lipid particles typically have a mean diameter of about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles are resistant in aqueous solution todegradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos.5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and WIPO Publication No. WO 96 / 40964.

[0122] The pharmaceutical compositions suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0123] Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0124] The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with free amino groups) derived from inorganic acids (e.g., hydrochloric or phosphoric acids), orfrom organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like). Salts formed with the free carboxyl groups can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like). Pharmaceutically acceptable salts are described in detail in Berge et al., J. Pharmaceutical Sciences, Vol.66: 1-19, 1977. In certain embodiments, the RNAi constructs of the invention are formulated as sodium salts.

[0125] For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- 1038 and 1570-1580). For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA standards. In certain embodiments, a pharmaceutical composition of the invention comprises or consists of a sterile saline solution and an RNAi construct described herein. In other embodiments, a pharmaceutical composition of the invention comprises or consists of an RNAi construct described herein and sterile water (e.g. water for injection, WFI). In still other embodiments, a pharmaceutical composition of the invention comprises or consists of an RNAi construct described herein and phosphate-buffered saline (PBS).

[0126] In some embodiments, the pharmaceutical compositions of the invention are packaged with or stored within a device for administration. Devices for injectable formulations include, but are not limited to, injection ports, pre-filled syringes, autoinjectors, injection pumps, on-body injectors, and injection pens. Devices for aerosolized or powder formulations include, but are not limited to, inhalers, insufflators, aspirators, and the like. Thus, the present invention includes administration devices comprising a pharmaceutical composition of the invention for treating or preventing one or more of the diseases or disorders described herein.

[0127] The present invention provides a method for reducing or inhibiting expression of the CNR1 gene, and thus the production of CB1 protein, in a cell (e.g. adipocyte, hepatocyte, neuron,lymphocyte) by contacting the cell with any one of the RNAi constructs described herein. The cell may be in vitro or in vivo. CB1 expression can be assessed by measuring the amount or level of CNR1 mRNA, CB1 protein, or another biomarker linked to CB1 expression, such as serum levels of insulin, leptin, adiponectin, total cholesterol, LDL-cholesterol, or triglycerides. The reduction of CNR1 expression in cells or animals treated with an RNAi construct of the invention can be determined relative to the CNR1 expression in cells or animals not treated with the RNAi construct or treated with a control RNAi construct. For instance, in some embodiments, reduction of CNR1 expression is assessed by (a) measuring the amount or level of CNR1 mRNA in liver or adipose cells treated with an RNAi construct of the invention, (b) measuring the amount or level of CNR1 mRNA in liver or adipose cells treated with a control RNAi construct (e.g. RNAi construct directed to an RNA molecule not expressed in liver or adipose cells or a RNAi construct having a nonsense or scrambled sequence) or no construct, and (c) comparing the measured CNR1 mRNA levels from treated cells in (a) to the measured CNR1 mRNA levels from control cells in (b). The CNR1 mRNA levels in the treated cells and controls cells can be normalized to RNA levels for a control gene (e.g.18S ribosomal RNA or housekeeping gene) prior to comparison. CNR1 mRNA levels can be measured by a variety of methods, including Northern blot analysis, nuclease protection assays, fluorescence in situ hybridization (FISH), reverse-transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, droplet digital PCR, and the like.

[0128] In other embodiments, reduction of CNR1 expression is assessed by (a) measuring the amount or level of CB1 protein in liver or adipose cells treated with an RNAi construct of the invention, (b) measuring the amount or level of CB1 protein in liver or adipose cells treated with a control RNAi construct (e.g. RNAi construct directed to an RNA molecule not expressed in liver or adipose cells or a RNAi construct having a nonsense or scrambled sequence) or no construct, and (c) comparing the measured CB1 protein levels from treated cells in (a) to the measured CB1 protein levels from control cells in (b). Methods of measuring CB1 protein levels are known to those of skill in the art, and include Western Blots, immunoassays (e.g. ELISA), and flow cytometry. Any method capable of measuring CNR1 mRNA or CB1 protein can be used to assess the efficacy of the RNAi constructs of the invention.

[0129] In some embodiments, the methods to assess CNR1 expression levels are performed in vitro in cells that natively express CB1 (e.g. adipocytes, hepatocytes, neurons, lymphocytes) orcells that have been engineered to express CB1. Cells and cell lines that natively express CB1 include, but are not limited to, adipose cells, such as primary adipocytes (e.g. human or non- human primate adipocytes), and cells isolated from inguinal or epididymal white adipose tissue, neural cells, such as primary neurons (e.g. human or non-human primate neurons), hair cells (e.g. hair outer root sheath cells, dermal fibroblasts, liver cells, such as primary hepatocytes (e.g. human or non-human primate hepatocytes), KNS42 cells, U251 MG cells, DOHH2 cells, DB cells, OCILY7 cells, CA46 cells, NUDUL1 cells, SUDHL6 cells, CORL311 cells, MC116 cells, HEK293 cells, HuH-7 cells, Hep3B cells, and HepG2 cells. In one embodiment, the cells are human primary adipocytes. In another embodiment, the cells are human primary neurons. In another embodiment, the cells are U251 MG cells. In another embodiment, the cells are KNS42 cells. In yet another embodiment, the cells are Chinese Hamster Ovary (CHO) cells engineered to express human CB1.

[0130] In other embodiments, the methods to assess CNR1 expression levels are performed in vivo. The RNAi constructs and any control RNAi constructs can be administered to an animal and CNR1 mRNA or CB1 protein levels assessed in adipose tissue or liver tissue harvested from the animal following treatment. Alternatively or additionally, a biomarker or functional phenotype associated with CNR1 expression can be assessed in the treated animals. For instance, CB1 receptor knockout mice have been reported to have reduced plasma levels of insulin and leptin, and increased plasma levels of adiponectin (see Ravinet Trillou et al., International Journal of Obesity, Vol.28: 640-648, 2004; Ruiz de Azua et al., J Clin Invest., Vol. 127(11):4148-4162, 2017). Antagonists of CB1 receptor signaling have been reported to improve serum cholesterol and triglyceride levels (see, e.g., Cinar et al., Phrmacol Ther, Vol.208: 107477, 2020). Thus, serum or plasma levels of insulin, leptin, adiponectin, total cholesterol, LDL-cholesterol, or triglycerides can be measured in animals treated with RNAi constructs of the invention to assess the functional efficacy of reducing CNR1 expression.

[0131] In certain embodiments, expression of CNR1 mRNA or CB1 protein is reduced in adipose cells or liver cells by at least 40%, at least 45%, or at least 50% by an RNAi construct of the invention. In some embodiments, expression of CNR1 mRNA or CB1 protein is reduced in adipose cells or liver cells by at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% by an RNAi construct of the invention. In other embodiments, the expression of CNR1 mRNA or CB1 protein is reduced in adipose cells or liver cells by about 90% or more,e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more by an RNAi construct of the invention. The percent reduction of CNR1 expression can be measured by any of the methods described herein as well as others known in the art.

[0132] The present invention provides methods for reducing or inhibiting expression of the CNR1 gene, and thus the production of CB1 protein, in a patient in need thereof as well as methods of treating or preventing conditions, diseases, or disorders associated with CNR1 expression or activity. A “condition, disease, or disorder associated with CNR1 expression” refers to conditions, diseases, or disorders in which CNR1 expression levels are altered or where elevated expression or activity levels of CB1 are associated with the condition, disease or disorder or an increased risk of developing the condition, disease or disorder. A condition, disease, or disorder associated with CNR1 expression can also include conditions, diseases, or disorders resulting from aberrant changes in energy metabolism, such as changes resulting in abnormal or elevated levels of cholesterol, lipids, triglycerides, glucose, and insulin.

[0133] Conditions, diseases, and disorders associated with CNR1 expression that can be treated or prevented according to the methods of the invention include, but are not limited to, obesity and obesity-related conditions, including but not limited to, visceral obesity; type 2 diabetes; metabolic syndrome; chronic kidney disease, cholecystitis, pancreatitis, gout, hypertension, fatty liver disease, such as non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH); osteoarthritis; sleep apnea; cardiovascular disease, such as myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g. peripheral artery disease), cerebrovascular disease, vulnerable plaque, and aortic valve stenosis; hypercholesterolemia; hyperlipidemia; and dyslipidemia (manifesting, e.g., as elevated total cholesterol, elevated low-density lipoprotein (LDL), elevated very low-density lipoprotein (VLDL), elevated triglycerides, and / or low levels of high-density lipoprotein (HDL)).

[0134] In certain embodiments, the present invention provides a method for reducing the expression of CB1 protein in a patient in need thereof comprising administering to the patient any of the RNAi constructs described herein. The term “patient,” as used herein, refers to a mammal, including humans, and can be used interchangeably with the term “subject.” Preferably, the expression level of CB1 in adipose tissue in the patient is reduced following administration of the RNAi construct as compared to the CB1 expression level in a patient notreceiving the RNAi construct or as compared to the CB1 expression level in the patient prior to administration of the RNAi construct. In certain embodiments, the expression level of CB1 in liver tissue in the patient is reduced following administration of the RNAi construct as compared to the CB1 expression level in a patient not receiving the RNAi construct or as compared to the CB1 expression level in the patient prior to administration of the RNAi construct. In some embodiments, following administration of an RNAi construct of the invention, expression of CB1 is reduced in the patient by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The percent reduction of CB1 expression can be measured by any of the methods described herein as well as others known in the art. In certain embodiments, the percent reduction of CB1 expression is determined by assessing levels of a serum or plasma biomarker, such as insulin, leptin, adiponectin, total cholesterol, LDL-cholesterol, or triglycerides, in the patient.

[0135] In some embodiments, a patient in need of reduction of CNR1 or CB1 expression is a patient who is diagnosed with or at risk for obesity or an obesity-related condition. Obesity refers to abnormal or excessive fat accumulation that may impair health of an individual. Obesity may be diagnosed by body mass index (BMI). BMI is defined as a person's weight in kilograms divided by the square of the person’s height in meters (e.g., kg / m2). Adults with a BMI equal to or greater than 25.0 kg / m2are considered to be overweight and adults with a BMI equal to or greater than 30.0 kg / m2are considered to be obese. Obesity or having excessive fat mass, particularly visceral fat mass (e.g. visceral obesity), can lead to an increased risk for developing other conditions. Such obesity-related conditions include, but are not limited to, type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, cardiovascular disease, hypertension, chronic kidney disease, cholecystitis, pancreatitis, gout, osteoarthritis, metabolic syndrome, and sleep apnea. In certain embodiments, a patient in need of reduction of CNR1 or CB1 expression is a patient who is diagnosed with or at risk for obesity, metabolic syndrome, visceral obesity, type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, or cardiovascular disease.

[0136] Accordingly, the present invention provides a method for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof comprising administering to the patient an RNAi construct described herein. In someembodiments, the present invention includes use of any of the RNAi constructs described herein in the preparation of a medicament for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof. In other embodiments, the present invention provides a CNR1-targeting RNAi construct, such as any of the RNAi constructs described herein, for use in a method for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof. Any of the obesity-related conditions described above may be treated or prevented with the methods of the invention. In certain embodiments, the obesity-related condition is type 2 diabetes, NAFLD, NASH, cardiovascular disease, osteoarthritis, metabolic syndrome, or sleep apnea. In some embodiments, a patient in need of treatment according to the methods of the invention has a BMI of ≥ 25.0 kg / m2. In other embodiments, a patient in need of treatment according to the methods of the invention has a BMI of ≥ 27.0 kg / m2. In still other embodiments, a patient in need of treatment according to the methods of the invention has a BMI of ≥ 30.0 kg / m2.

[0137] In some embodiments, a patient in need of reduction of CNR1 or CB1 expression is a patient who is overweight and / or has excessive body fat. Thus, the present invention includes a method for reducing body weight or fat mass in a patient in need thereof comprising administering to the patient an RNAi construct described herein. In certain embodiments, the present invention includes use of any of the RNAi constructs described herein in the preparation of a medicament for reducing body weight or fat mass in a patient in need thereof. In certain other embodiments, the present invention provides a CNR1-targeting RNAi construct, such as those described herein, for use in a method for reducing body weight or fat mass in a patient in need thereof. Patients in need of a reduction in body weight and / or fat mass may have a BMI of ≥ 25.0 kg / m2, for example, a BMI of 26.0 kg / m2, 27.0 kg / m2, 28.0 kg / m2, 29.0 kg / m2, 30.0 kg / m2, 31.0 kg / m2, 32.0 kg / m2, 33.0 kg / m2, 34.0 kg / m2, 35.0 kg / m2, 36.0 kg / m2, 37.0 kg / m2, 38.0 kg / m2, 39.0 kg / m2, 40.0 kg / m2, or greater. In one embodiment, the patient has a BMI of ≥ 27.0 kg / m2. In another embodiment, the patient has a BMI of ≥ 30.0 kg / m2. In another embodiment, the patient has a BMI of ≥ 40.0 kg / m2.

[0138] Body fat is typically distributed into two different categories, each with different metabolic characteristics: subcutaneous adipose tissue and visceral adipose tissue. Abnormally high deposition of visceral adipose tissue, which accumulates around the organs within the abdomen, is associated with an increased risk of developing metabolic syndrome, cardiovasculardiseases and some types of cancer (e.g. prostate, breast, and colorectal cancers). For a review, see Shuster et al., British Journal of Radiology, Vol.85: 1-10, 2012. Excessive deposition of visceral adipose tissue or visceral adiposity is known as visceral obesity or abdominal obesity. The extent of visceral adiposity can be measured by a variety of techniques, such as BMI, waist circumference, waist-to-hip ratio (WHR), bioelectrical impedance analysis, dual energy X-ray absorptiometry (DEXA), ultrasound, and imaging using CT and MRI scans (see, e.g., Shuster et al., 2012). Higher WHRs reflect increased visceral adiposity. Visceral obesity is diagnosed in women having a WHR of at least 0.85 and is diagnosed in men having a WHR of at least 0.90. People of either gender having a WHR greater than 1.0 are considered to be at an even greater risk of developing type 2 diabetes or other cardiovascular conditions. In some embodiments, patients in need of reduction in body weight and / or fat mass according to the methods of the invention have a WHR ≥ 0.85. In other embodiments, patients in need of reduction in body weight and / or fat mass according to the methods of the invention have a WHR ≥ 0.90. In certain embodiments, patients in need of reduction in body weight and / or fat mass according to the methods of the invention have a WHR greater than 1.0.

[0139] In some embodiments, a patient in need of reduction of CNR1 or CB1 expression is a patient who is diagnosed with visceral obesity. Accordingly, the present invention also provides a method of reducing visceral adiposity in a patient in need thereof comprising administering to the patient an RNAi construct described herein. In certain embodiments, the present invention includes use of any of the RNAi constructs described herein in the preparation of a medicament for reducing visceral adiposity in a patient in need thereof. In certain other embodiments, the present invention provides a CNR1-targeting RNAi construct, such as those described herein, for use in a method for reducing visceral adiposity in a patient in need thereof.

[0140] In other embodiments, a patient in need of reduction of CNR1 or CB1 expression is a patient who is diagnosed with or at risk of fatty liver disease. Thus, the present invention includes a method for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof comprising administering to the patient any of the RNAi constructs of the invention. In some embodiments, the present invention includes use of any of the RNAi constructs described herein in the preparation of a medicament for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof. In certain embodiments, the present invention provides a CNR1-targeting RNAi construct, such as thosedescribed herein, for use in a method for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof. Fatty liver disease is a condition in which fat accumulates in the liver. There are two primary types of fatty liver disease: a first type that is associated with heavy alcohol use (alcoholic steatohepatitis) and a second type that is not related to use of alcohol (nonalcoholic fatty liver disease (NAFLD)). NAFLD is typically characterized by the presence of fat accumulation in the liver but little or no inflammation or liver cell damage. NAFLD can progress to nonalcoholic steatohepatitis (NASH), which is characterized by liver inflammation and cell damage, both of which in turn can lead to liver fibrosis and eventually cirrhosis or hepatic cancer. In certain embodiments, the fatty liver disease to be treated, prevented, or reduce the risk of developing according to the methods of the invention is NAFLD. In other embodiments, the fatty liver disease to be treated, prevented, or reduce the risk of developing according to the methods of the invention is NASH. In some embodiments, a patient in need of treatment or prevention for fatty liver disease according to the methods of the invention or is at risk of developing fatty liver disease has been diagnosed with type 2 diabetes, a metabolic disorder, visceral obesity or is obese (e.g. has a body mass index of ≥ 30.0). In other embodiments, a patient in need of treatment or prevention for fatty liver disease according to the methods of the invention or is at risk of developing fatty liver disease has elevated levels of non- HDL cholesterol or triglycerides. Depending on the particular patient and other risk factors that patient may have, elevated levels of non-HDL cholesterol may be about 130 mg / dL or greater, about 160 mg / dL or greater, about 190 mg / dL or greater, or about 220 mg / dL or greater. Elevated triglyceride levels may be about 150 mg / dL or greater, about 175 mg / dL or greater, about 200 mg / dL or greater, or about 250 mg / dL or greater.

[0141] The following examples, including the experiments conducted and the results achieved, are provided for illustrative purposes only and are not to be construed as limiting the scope of the appended claims. EXAMPLES Example 1. Inhibition of Cnr1 Expression Prevents Body Weight Gain in a Diet-Induced Obesity Mouse Model

[0142] To determine the effect of suppression of Cnr1 gene expression in adipocytes on body weight gain, siRNA molecules targeting the mouse Cnr1 gene were conjugated to palmitic acid(hexadecanoic acid; CH₃(CH₂)₁₄COOH; C16) and evaluated in a diet-induced obesity (DIO) mouse model. The DIO mouse model is described in Wang and Liao, Methods Mol Biol., Vol. 821: 421-433, 2012. Mice approximately 18 weeks old (The Jackson Laboratory) were fed a 60% high fat diet (D12492, Research Diets Inc.) for 12 weeks. Mice received, by subcutaneous injection, saline (n = 8) or 30 mg / kg of one of two C16-conjugated Cnr1-targeted siRNA molecules (duplex nos. D-35866 or D-35867; n = 8 per group) once every week for six weeks. Body weight and food intake were measured at the start of treatment and twice per week thereafter until the end of study. Fat mass and lean mass were measured by magnetic resonance imaging (EchoMRI LLC, Houston, TX) for each animal 5 days prior to treatment and again at 43 days following treatment. The siRNA molecules were synthesized and conjugated to palmitic acid (C16 saturated fatty acid; ligand and linker structure shown in Formula I) as described in Example 2 below. The structure of each of the siRNA molecules is provided in Table 1. Both C16-conjugated siRNA molecules D-35866 and D-35867 suppressed Cnr1 gene expression in inguinal and epididymal white adipose tissue by about 70-80% five days after a single subcutaneous 30 mg / kg injection, which was sustained for 20 days following the single subcutaneous injection (data not shown).

[0143] The results of the study are shown in Figures 2A-2D. Mice receiving saline injections gained approximately 12% body weight on the high fat diet (Figure 2A). Treatment with the D- 35866 siRNA molecule significantly reduced body weight gain as well as food intake (Figures 2A and 2B). Administration of the D-35866 siRNA molecule reduced fat mass by 24% as compared to mice receiving saline injections without affecting lean mass. See Figures 2C and 2D. These data demonstrate that administration of a C16-conjugated siRNA molecule targeting the Cnr1 gene can effectively prevent the gain in body mass induced by a high fat diet in a DIO mouse model. SiRNA treatment reduces the gain in fat mass without affecting lean mass.

[0144] A second study was conducted in the DIO mouse model to determine whether the efficacy of the Cnr1-targeted siRNA molecules in reducing body weight gain was due to suppression of the Cnr1 gene in hepatocytes (GalNAc conjugate) or adipocytes (C16-conjugate). In this second study, mice approximately 19 weeks old (The Jackson Laboratory) were fed a 60% high fat diet (D12492, Research Diets Inc.) for 13 weeks. Mice were subcutaneously administered once per week for five weeks one of the following treatments: (i) saline (n = 8), (ii) 30 mg / kg C16-conjugated non-targeting control siRNA (duplex no. D-46770; n = 8), (iii) 30mg / kg C16-conjugated Cnr1-targeted siRNA molecule (duplex no. D-35866; n = 8); (iv) 5 mg / kg C16-conjugated Cnr1-targeted siRNA molecule (duplex no. D-35866; n = 8), (v) 5 mg / kg GalNAc-conjugated non-targeting control siRNA (duplex no. D-46657; n = 8), or (vi) 5 mg / kg GalNAc-conjugated Cnr1-targeted siRNA molecule (duplex no. D-46655; n = 8). The siRNA molecules were synthesized and conjugated to palmitic acid (C16 saturated fatty acid; ligand and linker structure shown in Formula I) or a trivalent GalNAc moiety (ligand and linker structure shown in Formula III) as described in Example 2 below. The structure of each of the siRNA molecules is provided in Table 1.

[0145] Consistent with the results of the first study, animals receiving treatment with the 30 mg / kg dose of the C16-conjugated Cnr1-targeted siRNA molecule had reduced body weight as compared to both the saline and C16-conjugated non-targeting control siRNA. See Figure 3A. This reduction in body weight was associated with reduced food intake of about 7 percent and a reduction in fat mass of about 27 percent at the end of the study as compared to animals receiving the C16-conjugated non-targeting control siRNA. The GalNAc-conjugated Cnr1- targeted siRNA molecule had no significant effect on body weight gain (Figure 3A). The C16- conjugated Cnr1-targeted siRNA molecule reduced the mass of subcutaneous white adipose tissue, whereas the GalNAc-conjugated Cnr1-targeted siRNA molecule reduced liver mass. See Figures 3B and 3C. Interestingly, both Cnr1-targeted siRNA conjugates reduced the amount of fat in the liver (Figure 3D). Animals receiving the C16-conjugated Cnr1-targeted siRNA molecule had elevated serum levels of triglycerides and insulin, whereas animals receiving the GalNAc-conjugated Cnr1-targeted siRNA molecule had reduced serum levels of total cholesterol, which included reduced HDL cholesterol levels and increased LDL cholesterol levels (data not shown). The serum lipid and insulin results may be explained by potential off- target effects of the siRNA molecules on genes affecting insulin and lipid levels, such as Vxn, Gm37052, Gm39465, Gm12709, and Hsf2.

[0146] The results of the second study suggest that the efficacy of the Cnr1-targeted siRNA molecule in inducing weight loss is primarily due to suppression of Cnr1 gene expression in tissues outside the liver, such as adipose tissue. However, suppression of Cnr1 gene expression in both liver tissue and adipose tissue effectively reduced the amount of fat in the liver indicating that Cnr1-targeted siRNA molecules may also be therapeutic for non-alcoholic fatty liver disease and non-alcoholic steatohepatitis.Table 1. Structure of siRNA molecules used in DIO mouse model studies Duplex Targeting Unmodified Unmodified Modified Sense Modified Antisense No. Ligand1Sense Sequence Antisense Sequence (5ʹ-3ʹ)2Sequence (5ʹ-3ʹ)2(5ʹ-3ʹ) Sequence (5ʹ-3ʹ) Af Cf A Af A rea, u, g, an c = correspon ng -O-me y r onuc eo e; , U , G , an C = correspon ng - eoxy- - uoro (“2ʹ-fluoro”) ribonucleotide; “s” = a phosphorothioate internucleotide linkage; all other nucleotides are connected by 3ʹ-5ʹ phosphodiester groups. Example 2. Design and Synthesis of CNR1-Targeted siRNA Molecules

[0147] Candidate sequences for the design of therapeutic siRNA molecules targeting the human CNR1 gene were identified using a bioinformatics analysis of the human CNR1 transcript, the sequence of which is provided herein as SEQ ID NO: 1 (Ensembl transcript no. ENST00000369501.2; see Figure 1). Sequences were analyzed using an in-house siRNA design algorithm and selected if certain criteria were met. Sequences were evaluated for various features, including (i) cross-reactivity with CNR1 transcripts from cynomolgus monkeys and rodents, (ii) sequence identity to other human, cynomolgus monkey, and rodent gene sequences, (iii) overlap with known human single nucleotide polymorphisms, and (iv) seed region matches to human microRNA (miRNA) sequences to predict off-target effects. Based on the results of the bioinformatics analysis, 340 sequences were selected for initial synthesis and in vitro testing.

[0148] RNAi constructs were synthesized using solid phase phosphoramidite chemistry. Synthesis was performed on a MerMade12 or MerMade192X (Bioautomation) instrument. Various chemical modifications, including 2′-fluoro modified nucleotides, 2′-O-methyl modified nucleotides, inverted abasic nucleotides, and phosphorothioate internucleotide linkages, were incorporated into the molecules. The RNAi constructs were generally formatted to be duplexesof 19-21 base pairs when annealed with one or two overhangs of unpaired nucleotides at the 3ʹ end of the antisense strand and / or the sense strand. For in vivo studies, the sense strands of the RNAi constructs were conjugated to a trivalent N-acetyl-galactosamine (GalNAc) moiety, palmitic acid (hexadecanoic acid; CH₃(CH₂)₁₄COOH; C16), or behenic acid (docosanoic acid; CH3(CH2)20COOH; C22) as described further below. Materials

[0149] Acetonitrile (DNA Synthesis Grade, AXO152-2505, EMD)

[0150] Capping Reagent A (80:10:10 (v / v / v) tetrahydrofuran / lutidine / acetic anhydride, BIO221 / 4000, EMD)

[0151] Capping Reagent B (16% 1-methylimidazole / tetrahydrofuran, BIO345 / 4000, EMD)

[0152] Activator Solution (0.25 M 5-(ethylthio)-1H-tetrazole (ETT) in acetonitrile, BIO152 / 0960, EMD)

[0153] Detritylation Reagent (3% dichloroacetic acid in dichloromethane, BIO830 / 4000, EMD)

[0154] Oxidation Reagent (0.02 M iodine in 70:20:10 (v / v / v) tetrahydrofuran / pyridine / water, BIO420 / 4000, EMD)

[0155] Diethylamine solution (20% DEA in acetonitrile, NC0017-0505, EMD)

[0156] Thiolation Reagent (0.05 M 5-N-[(dimethylamino)methylene]amino-3H-1,2,4-dithiazole- 3-thione (BIOSULII / 160K) in pyridine)

[0157] 5′-Aminohexyl linker phosphoramidite and 2′-methoxy and 2′-fluoro phosphoramidites of adenosine, guanosine, and cytosine (Thermo Fisher Scientific), 0.10 M in acetonitrile over Molecular Trap Packs (0.5g per 30 mL, Bioautomation)

[0158] 2′-methoxy-uridine phosphoramidite (Thermo Fisher Scientific), 0.10 M in 90:10 (v / v) acetonitrile / DMF over Molecular Trap Packs (0.5g per 30 mL, Bioautomation)

[0159] 2′-deoxy-reverse absaic phosphoramidite (ChemGenes), 0.10 M in acetonitrile over Molecular Trap Packs (0.5g per 30 mL, Bioautomation)

[0160] CPG Support (Hi-Load Universal Support, 500A (BH5-3500-G1), 79.6 μmol / g, 0.126 g (10 μmol)) or 1 μmol Universal Synthesis Column, 500A, Pipette Style Body (MM5-3500-1, Bioautomation)

[0161] Ammonium hydroxide (concentrated, J. T. Baker)Synthesis

[0162] Reagent solutions, phosphoramidite solutions, and solvents were attached to the MerMade12 or MerMade192X instrument. Solid support was added to each column (4 mL SPE tube with top and bottom frit for 10 μmol), and the columns were affixed to the instrument. The columns were washed twice with acetonitrile. The phosphoramidite and reagent solution lines were purged. The synthesis was initiated using the Poseidon software. The synthesis was accomplished by repetition of the deprotection / coupling / oxidation / capping synthesis cycle. Specifically, to the solid support was added detritylation reagent to remove the 5ʹ- dimethoxytrityl (DMT) protecting group. The solid support was washed with acetonitrile. To the support was added phosphoramidite (4 eq.) and activator solution (20 eq.) followed by incubation to couple the incoming nucleotide to the free 5’-hydroxyl group. The coupling reaction (6 min) was repeated twice. The support was washed with acetonitrile. To the support was added oxidation or thiolation reagent to convert the phosphite triester to the phosphate triester or phosphorothioate. To the support was added capping reagents A and B to terminate any unreacted oligonucleotide chains. The support was washed with acetonitrile. After the final reaction cycle, the resin was washed with diethylamine solution to remove the 2-cyanoethyl protecting groups. The support was washed with acetonitrile and dried under vacuum. Targeting ligand conjugation

[0163] Sense strands for conjugation to palmitic acid (C16), behenic acid (C22), or a trivalent GalNAc moiety (structures shown in Formulae I to III, respectively, below) were prepared with a 5′-aminohexyl linker. After automated synthesis, the column was removed from the instrument and transferred to a vacuum manifold in a hood. The 5′-monomethoxytrityl (MMT) protecting group was removed from the solid support by successive treatments with 2 mL aliquots of 1% trifluoroacetic acid (TFA) in dichloromethane (DCM) with vacuum filtration. When the orange / yellow color was no longer observable in the eluent, the resin was washed with dichloromethane. The resin was washed with 5 mL of 10% diisopropylethylamine in N,N- dimethylformamide (DMF).

[0164] When conjugation to a palmitoyl group (C16; structure shown in Formula I below) was desired, palmitic acid (10 molar equivalents relative to the resin) was dissolved in DCM (300 mM, 25.64 mg, 100 µmol, Aldrich) was transferred to a polypropylene tube (10 molarequivalents relative to the resin) and TATU (500 mM DMSO) (32.2 mg, 100 µmol, ChemPep) was added (10 eq) followed by DIEA (500 mM DCM) (25.24 mg, 200 µmol, Aldrich) (20 eq). The solution was mixed and let stand to pre-activate for 5-10 min. The activated ester was added to the oligo-resin and the reaction vessels sealed. The reaction vessels were placed on a vortex mixer at 700 RPM for 14h at room temperature. The solution was drained, and the resin washed with DMF and DCM. Formula Ito the 5′ terminal nucleotide of the sense strand of the RNAi construct. The palmitoyl group was attached to the 5′ carbon of the 5′ terminal nucleotide of the sense strand via an aminohexyl linker.

[0165] When conjugation to docosanoyl group (C22; structure shown in Formula II below) was desired, behenic acid (docosanoic acid)(10 molar equivalents relative to the resin) was dissolved in DCM (70 mM, 34.1 mg, 100 µmol, TCI) and TATU (500 mM DMSO) (32.2 mg, 100 µmol, ChemPep) was added (10 eq) followed by DIEA (500 mM DCM) (25.24 mg, 200 µmol, Aldrich) (20 eq). The solution was mixed and let stand to pre-activate for 5min. The activated ester was added to the oligo-resin and the reaction vessels sealed. The reaction vessels were placed on a vortex mixer at 700 RPM for 14h at 30oC. The solution was drained, and the resin washed with DMF and DCM. Formula IIwherein X = O or S. The squiggly line represents the point of attachment to the 5′ terminal nucleotide of the sense strand of the RNAi construct. The docosanoyl group was attached to the 5′ carbon of the 5′ terminal nucleotide of the sense strand via an aminohexyl linker.

[0166] For conjugation to a trivalent GalNAc moiety, a solution of GalNAc3-Lys2-Ahx (67 mg, 40 µmol) in DMF (0.5 mL) was prepared in a separate vial. GalNAc3-Lys2-Ahx, which has the structure shown as Formula III below, was prepared with 1,1,3,3-tetramethyluronium tetrafluoroborate (TATU, 12.83 mg, 40 µmol) and diisopropylethylamine (DIEA, 13.9 μL, 80 µmol). The activated coupling solution was added to the resin, and the column was capped and incubated at room temperature overnight. The resin was washed with DMF, DCM, and dried under vacuum. Formula IIIof attachment to the 5′ terminal nucleotide of the sense strand of the RNAi construct. The GalNAc moiety was attached to the 5′ carbon of the 5′ terminal nucleotide of the sense strand via an aminohexyl linker. Cleavage

[0167] The synthesis columns were removed from the synthesizer or vacuum manifold and transferred to a cleavage apparatus. To the solid support was added 4 x 1 mL (for 10 μmol) or 4 x250 μL (for 1 μmol) of concentrated ammonium hydroxide. The eluent was collected by gravity or light vacuum filtration into a 24- or 96-well deep well plate, respectively. The plate was sealed, bolted into a cleavage chuck (Bioautomation), and the mixture was heated at 55°C for 4h. The plate was moved to the freezer and cooled for 20 minutes before opening the cleavage chuck in the hood. Analysis and Purification

[0168] The crude lipid-conjugated oligonucleotides (C16- and C22-conjugated sense strands) were purified by reverse phase high-performance liquid chromatography (RP-HPLC) using a Phenomenex Oligo-RP C18 column (5μm, 10 x 250 mm) with a flowrate of 6 mL / min. The mobile phase consisted of 20 mM ammonium bicarbonate with 5% acetonitrile (Buffer A) and 75% acetonitrile (Buffer B). The fractions were pooled for desalting as described below.

[0169] The antisense strands and GalNAc-conjugated sense strands were purified by anion exchange (AEX) chromatography. Oligonucleotides were eluted from two Tosoh TSK Gel SuperQ-5PW columns connected in series (21 x 150 mm, 13 μm) with a flowrate of 8 mL / min using a linear gradient of 1 M sodium bromide in 20 mM sodium phosphate, 15% acetonitrile, pH 8.5. Samples were desalted and UV quantified as described below.

[0170] The pooled fractions were desalted by size exclusion chromatography on a GE Akta Pure using a GE Hi-Prep 26 / 10 column and 20% ethanol mobile phase. Desalted samples were analyzed by ion-pairing liquid chromatography mass spectrometry (IP-LCMS), quantified by UV (Nanodrop), and lyophilized in a Genevac S3-HT12. Preparative RP-HPLC chromatography:

[0171] Column: Phenomenex Oligo-RP C18 column (5μm, 10 x 250 mm)

[0172] Instrument: Agilent 1100 HPLC

[0173] Buffer A: 20 mM ammonium bicarbonate, 5% acetonitrile

[0174] Buffer B: 20 mM ammonium bicarbonate, 75% acetonitrile

[0175] Flow rate: 6 mL / min

[0176] Gradient: 10-70% in 45 min Preparative anion exchange chromatography (AEX):

[0177] Column: Tosoh TSK Gel SuperQ-5PW, 28 x 250 mm, 13 μm

[0178] Instrument: Agilent 1200 HPLC

[0179] Buffer A: 20 mM sodium phosphate, 15% acetonitrile, pH 8.5

[0180] Buffer B: 20 mM sodium phosphate, 15% acetonitrile, pH 8.5, 1 M sodium bromide

[0181] Flow rate: 14 mL / min

[0182] Injection volume: 5 mL

[0183] Gradient: 30-75% B over 45 min for sense strands and 50-90% B over 45 min for antisense strands Preparative size exclusion chromatography (SEC):

[0184] Column: 3 x GE Hi-Prep 26 / 10 in series

[0185] Instrument: GE AKTA Pure

[0186] Buffer: 20% ethanol in water

[0187] Flow Rate: 10 mL / min

[0188] Injection volume: 45 mL using sample loading pump Ion Pair-Reversed Phase (IP-RP) HPLC:

[0189] Column: Water Xbridge BEH OST C18, 2.5 μm, 2.1 x 50 mm

[0190] Instrument: Agilent 1100 HPLC

[0191] Buffer A: 15.7 mM DIEA, 50 mM hexafluoroisopropanol (HFIP) in water

[0192] Buffer B: 15.7 mM DIEA, 50 mM HFIP in 50:50 water / acetonitrile

[0193] Flow rate: 0.5 mL / min

[0194] Gradient: 10-30% B over 6 min Annealing

[0195] A small amount of the sense strand and the antisense strand were weighed into individual vials. To the vials was added phosphate buffered saline (PBS, Gibco) to an approximate concentration of 2 mM based on the dry weight. The actual sample concentration was measured on the NanoDrop One (ssDNA, extinction coefficient = 33 μg / OD260) and each strand was further diluted to 1 mM with PBS (1x). The two strands were then mixed in an equimolar ratio, and the sample was heated for 5 minutes in a 90°C incubator and allowed to cool slowly to roomtemperature. The sample was analyzed by analytical anion exchange chromatography. The duplex was registered and submitted for in vitro and in vivo testing as described in more detail in Examples 3-5 below.

[0196] Table 2 below lists the unmodified sense and antisense sequences for molecules prioritized from the bioinformatics analysis. The range of nucleotides targeted by siRNA molecules in each sequence family within the human CNR1 transcript (SEQ ID NO: 1) is also shown in Table 2. Table 3 provides the sequences of the sense and antisense strands with chemical modifications. The nucleotide sequences are listed according to the following notations: a, u, g, and c = corresponding 2ʹ-O-methyl ribonucleotide; Af, Uf, Gf, and Cf = corresponding 2ʹ-deoxy-2ʹ-fluoro (“2ʹ-fluoro”) ribonucleotide; and invAb = inverted abasic deoxynucleotide (i.e. abasic deoxynucleotide linked to adjacent nucleotide via a substituent at its 3ʹ position (a 3ʹ-3ʹ linkage) when on the 3ʹ end of a strand. Insertion of an “s” in the sequence indicates that the two adjacent nucleotides are connected by a phosphorothiodiester group (e.g. a phosphorothioate internucleotide linkage). Unless indicated otherwise, all other nucleotides are connected by 3ʹ-5ʹ phosphodiester groups. [GalNAc3] represents the GalNAc moiety shown in Formula III, which was covalently attached to the 5ʹ terminal nucleotide at the 5′ end of the sense strand via a phophodiester bond or a phoshorothioate bond when an “s” follows the [GalNAc3] notation. [DCA-C6] represents the docosanoyl group shown in Formula II, which was covalently attached to the 5ʹ terminal nucleotide at the 5′ end of the sense strand via a phophodiester bond or a phoshorothioate bond when an “s” follows the [DCA-C6] notation. The GalNAc moiety and the docosanoyl group were covalently attached to the 5′ carbon of the 5′ terminal nucleotide of the sense strand. Table 2. Unmodified CNR1 siRNA sequences Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID :Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Duplex Target Sense Strand Sequence (5ʹ-3ʹ) SEQ Antisense Strand Sequence (5ʹ-3ʹ) SEQ No. site ID ID within NO: NO:Table 3. Modified CNR1 siRNA sequences Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 1 4 2 4 1 9 1 8 6 1 8 1 8 8 0 8 5 7 7Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 7 5 3 2 3 1 2 7 9 7 0 9 5 2 1 5 8 8 0 9 5 3 7 6 5 4 2 1 0 9 8 4 6 3 3 1 7 6 5 4Duplex Modifed Sense Strand Sequence (5ʹ-3ʹ) SEQ Modified Antisense Strand SEQ No. ID Sequence (5ʹ-3ʹ) ID NO: NO: 1 9 1 8 6 8 8 5 6.

[0197] The CNR1-targeted siRNA molecules having different sequences prioritized from the bioinformatics analyses described in Example 2 were screened for efficacy in reducing human CNR1 mRNA using an RNA FISH (fluorescence in situ hybridization) assay. Human U251 MG cells (purchased from ATCC) were cultured in Eagle's Minimum Essential Medium (EMEM) (ATCC 30-2003) supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% penicillin- streptomycin (P-S, Corning). siRNAs were transfected into cells by reverse transfection using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific). The CNR1-targeted siRNA molecules were tested in a 10-point dose response format, 3-fold dilutions, ranging from 500 nM to 25 pM final concentrations.1 μL of the test siRNA molecule or phosphate-buffered saline (PBS) vehicle and 4 μL of base EMEM without supplements were added to PDL-coated CellCarrier-384 Ultra assay plates (PerkinElmer) by a Bravo automated liquid handling platform (Agilent).5 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific), pre-diluted in base EMEM without supplements (0.06 μL of RNAiMAX in 5 μL EMEM), was then dispensed into the assay plates by a Multidrop Combi reagent dispenser (Thermo Fisher Scientific). After 20- minute incubation of the siRNA / RNAiMAX mixture at room temperature (RT), 30 μL of U251 MG cells (2000 cells per well) in EMEM supplemented with 10% FBS and 1% P-S were added to the transfection complex using a Multidrop Combi reagent dispenser. The assay plates were incubated at RT for 20 mins prior to being placed in an incubator. Cells were incubated for 72 hrs at 37 °C and 5% CO2.

[0198] RNA FISH assay was performed 72 hours after siRNA transfection using the manufacturer’s assay reagents and protocol (QuantiGene® ViewRNA HC Screening Assay fromThermo Fisher Scientific) on an in-house assembled automated FISH assay platform. In brief, cells were fixed in 4% formaldehyde (Thermo Fisher Scientific) for 15 mins at RT, permeabilized with detergent for 3 mins at RT and then treated with protease solution for 10 mins at RT. Target-specific probes (Thermo Fisher Scientific, Cat.# VX-02, Assay ID:VA6- 17425-VC) or vehicle (target probe diluent without target probes as negative control) were incubated for 3 hours, whereas preamplifiers, amplifiers, and label probes were incubated for 1 hour each. All hybridization steps were carried out at 40 °C in a Cytomat 2 C-LIN automated incubator (Thermo Fisher Scientific). After hybridization reactions, cells were stained for 30 mins with Hoechst and CellMask Blue (Thermo Fisher Scientific) and then imaged on an Opera Phenix high-content screening system (PerkinElmer). The images were analyzed using a Columbus image data storage and analysis system (PerkinElmer) to obtain the mean spot count per cell. The mean spot count per cell was normalized using the high (PBS with target probes) and low (PBS without target probes) control wells. The normalized values against the total siRNA concentrations were plotted and the data were fit to a four-parameter sigmoidal model using Genedata Screener data analysis software (Genedata) to obtain IC50 and maximum activity values. If the data could not be fit to the model, an IC50 value was not calculated and only a maximum activity value was reported. The results of the assays are shown in Table 4 below. Table 4. In vitro inhibition of human CNR1 mRNA in U251 MG cells Duplex IC50 [M] Max Duplex IC50 [M] Max Duplex IC50 [M] Max No. Activity No. Activity No. ActivityDuplex IC50 [M] Max Duplex IC50 [M] Max Duplex IC50 [M] Max No. Activity No. Activity No. Activity D-1019 5.92E-09 -34.02 D-1133 > 500E-09 -9.96 D-1247 4.77E-09 -59.96Duplex IC50 [M] Max Duplex IC50 [M] Max Duplex IC50 [M] Max No. Activity No. Activity No. Activity D-1071 1.44E-09 -70.21 D-1185 1.76E-08 -82.22 D-1299 > 500E-09 -24.98

[0199] Of the 340 CNR1-targeted siRNA molecules evaluated in the RNA FISH assay, 43 molecules exhibited an average of 70% or greater knockdown of human CNR1 mRNA, the majority of which had IC50 values in the single-digit nanomolar range. In particular, 27 molecules (duplex nos. D-1088, D-1174, D-1078, D-1070, D-1069, D-1072, D-1162, D-1185, D-1157, D-1167, D-1120, D-1160, D-1169, D-1186, D-1077, D-1073, D-1116, D-1164, D-1089, D-1119, D-1122, D-1156, D-1075, D-1279, D-1010, D-1105, and D-1128) reduced human CNR1 mRNA by at least 75%. Compounds D-1088, D-1174, D-1078, and D-1070 induced the greatest reduction (at least 85%) of human CNR1 mRNA with IC50 values in the single-digit nanomolar range. Example 4. In Vivo Efficacy of siRNA Molecules in AAV Human CB1 Mouse Model

[0200] SiRNA molecules exhibiting significant suppression of the human CNR1 mRNA in the in vitro assay described in Example 3 were selected for evaluation of their efficacy in vivo using a mouse model expressing different portions of the human CNR1 gene. The sense strand in each siRNA molecule was conjugated to the trivalent GalNAc moiety shown in Formula III by the methods described in Example 2.10-12-week-old female C57BL / 6 mice (The Jackson Laboratory) were fed standard chow (Harlan, 2020× Teklad global soy protein-free extruded rodent diet). Mice were injected intravenously (i.v.) with an adeno-associated virus (AAV) encoding enhanced green fluorescent protein (eGFP) and one of three human CNR1 gene fragments at a dose of 1×1012genome copies (GC) per animal. The first AAV construct (AAV1- hCNR1) included nucleotides 533-2432 of the human CNR1 mRNA transcript set forth in SEQ ID NO: 1. The second AAV construct (AAV2-hCNR1) included nucleotides 2333-4232 of SEQ ID NO: 1, whereas the third AAV construct (AAV3-hCNR1) included nucleotides 4132-6031 of SEQ ID NO: 1. Two weeks following injection with AAV1-hCNR1, AAV2-hCNR1, or AAV3- hCNR1, mice received a single subcutaneous (s.c.) injection of buffer (phosphate-buffered saline, PBS) or the CNR1-targeted siRNA molecule at a dose of 3 mg / kg body weight in PBS (n=4 each group). Three of the siRNA molecules (duplex nos. D-1347, D-1377, and D-1378) were evaluated in both animals expressing AAV1-hCNR1 and animals expressing AAV2- hCNR1 because these molecules targeted a region of the CNR1 transcript that was found in both constructs. Animals were fasted and harvested four weeks following siRNA administration for further analysis. Liver total RNA from harvested animals was processed for qPCR analysis. RNA was isolated from 50-100 mg tissue using RNeasy 96 universal tissue kit RNA isolation protocol following manufacturer’s instructions (Qiagen) or using a KingFisher Apex system and the MagMAX mirVana Total RNA Isolation Kit according to the manufacturer’s instructions (ThermoFisher). Real-time PCR was performed using TaqMan® RNA-to-Ct™ 1-Step Kitfollowing manufacturer’s instructions (ThermoFisher) with 50 ng RNA per reaction and the following primer probe sets: (1) eGFP1 Forward primer: CTATGTGCAGGAGAGAACCATC (Sense; SEQ ID NO: 1434); Reverse primer: GCCCTTCAGCTCGATTCTATT (Antisense; SEQ ID NO: 1435); Probe: 5ʹ-6FAM-TACAAGACCCGCGCTGAAGTCAAG TAMRA-3’ (Sense; SEQ ID NO: 1436); (2) eGFP2 Forward primer: TCATCTGCACCACTGGAAAG (Sense; SEQ ID NO: 1437); Reverse primer: CTGCTTCATATGGTCTGGGTATC (Antisense; SEQ ID NO: 1438); Probe: 5ʹ-6FAM CCAACACTGGTCACTACCCTCACC TAMRA-3’ (Sense; SEQ ID NO: 1439); (3) BGHpA Forward primer: 5’-GCCAGCCATCTGTTGT-3’ (SEQ ID NO: 1440); Reverse primer: 5’-GGAGTGGCACCTTCCA-3’ (SEQ ID NO: 1441); Probe: 5ʹ-6FAM- TCCCCCGTGCCTTCCTTGACC TAMRA-3’ (Sense; SEQ ID NO: 1442); and mPpib TaqMan® gene expression assay (Mm00478295 Thermo Fisher). Knockdown of mRNA levels were quantified using primer sets targeting either the eGFP sequence in the 5ʹ end of the construct (i.e., eGFP primer set #1 or eGFP primer set #2) or the bovine growth hormone polyadenylation signal present in the viral mRNA (BGHpA primer set) at the 3ʹ end of construct. The knockdown efficiency of the siRNA molecules was determined using semi-quantitative real- time polymerase chain reactions on a QuantStudio 7 Flex real time thermocycler. Gene expression was calculated using the ΔΔCt approach while utilizing cyclophilin (PPIB) as the reference gene. A percentage change in human CNR1 mRNA in liver for each animal was calculated relative to the level of human CNR1 mRNA in the liver of control animals. The control animals used to calculate the percentage change expressed the same human CNR1 mRNA but received the buffer only injection in place of an siRNA injection.

[0201] Results of the studies in the AAV-hCNR1 mouse model with different CNR1-targeted siRNA molecules are shown in Table 5 below. Data are expressed as average percent change from control at week 6 of study (4 weeks after siRNA injection) for each treatment group (n = 4 animals / group). Some of the siRNA molecules were cross-reactive with the mouse Cnr1 gene as indicated.Table 5. In vivo inhibition of human CNR1 mRNA in the liver of AAV-hCNR1 mice Treatment Target site Cross- AAV Average % Change in human CNR1 (duplex no.) within human reactive No. mRNA CNR1 with eGFP-1 eGFP-2 BGHpATreatment Target site Cross- AAV Average % Change in human CNR1 (duplex no.) within human reactive No. mRNA CNR1 with eGFP-1 eGFP-2 BGHpA were fully leotides.

[0202] Of the 54 CNR1-targeted siRNA molecules evaluated in the AAV human CB1 model, 31 molecules induced greater than 50% knockdown of human CNR1 mRNA in the liver with at least one primer probe set. Ten molecules (duplex nos. D-1342, D-1343, D-1346, D-1347, D- 1348, D-1358, D-1360, D-1365, D-1369, and D-1377) produced at least a 70% reduction of human CNR1 mRNA in the liver with at least one primer probe set. Of the 28 siRNA molecules that were cross-reactive with the mouse Cnr1 gene, 10 produced a greater than 50% reduction of human CNR1 mRNA in the liver with at least one primer probe set. Example 5. In Vivo Efficacy of Lipid-Conjugated CNR1-targeted siRNA Molecules

[0203] As described in Example 1, suppression of CB1 protein expression in adipose tissue correlated with reduction of diet-induced body weight gain in mice. To determine whether switching the targeting ligand to a fatty acid could effectively deliver the siRNA molecules to adipose tissue to suppress human CB1 protein expression, a subset of CNR1-targeted siRNA molecules were conjugated to a docosanoyl group (C22) and administered to transgenic mice in which the human CNR1 gene was knocked in. These knock-in (KI) mice were generated using CRISPR-Cas9 technology (Horizon Discovery) to mediate the replacement of mouse Cnr1 coding sequence with the human CNR1 counterpart. The mouse Cnr1 gene promoter and regulatory elements drive human CNR1 protein expression while endogenous expression is disrupted. The KI model was generated in the C57BL / 6J mouse background. The structure of thedocosanoyl group is shown in Formula 2 and was conjugated to the 5ʹ end of the sense strand of the siRNA molecules according to the methods described in Example 2.

[0204] 8-10-week old female transgenic human CNR1 KI mice received a single subcutaneous injection of one of the following treatments: (i) saline (n = 5), (ii) 20 mg / kg C22-conjugated non- targeting control siRNA (duplex no. D-52723; n = 5), (iii) 20 mg / kg C22-conjugated Hprt- targeted control siRNA molecule (duplex no. D-50225; n = 5); (iv) 20 mg / kg duplex no. D-1394 (C22-conjugated Cnr1-targeted siRNA molecule n = 5), (v) 20 mg / kg duplex no. D-1395 (C22- conjugated Cnr1-targeted siRNA molecule n = 5), (vi) 20 mg / kg duplex no. D-1396 (C22- conjugated Cnr1-targeted siRNA molecule n = 5), or (vii) 20 mg / kg duplex no. D-1397 (C22- conjugated Cnr1-targeted siRNA molecule n = 5). The unmodified and modified sequences for duplex nos. D-1394 to D-1397 are provided in Tables 2 and 3, respectively. The modified sequences for the control siRNA molecules (duplex nos. D-52723 and D-50225) are provided below in the 5ʹ to 3ʹ orientation using the same notations as for Table 3. D-52723 sense strand (SEQ ID NO: 1443) [DCA-C6]ugguuuAfcAfUfGfUfcgacusas{invAb} D-52723 antisense strand (SEQ ID NO: 1444) usUfsagucGfacauGfuAfaaccasusu D-50225 sense strand (SEQ ID NO: 1445) [DCA-C6]uccuaugaCfuGfUfAfGfauuuuas{invAb} D-50225 antisense strand (SEQ ID NO: 1446) asUfsaaaaUfcuacAfgUfcauaggasusu

[0205] The mice were fed standard chow (Harlan, 2020× Teklad global soy protein-free extruded rodent diet) throughout the experiment. Inguinal subcutaneous white adipose tissue (WAT), epididymal WAT, liver and kidney were collected 4 weeks after siRNA administration and analyzed. RNA from harvested animal tissues was processed for qPCR analysis. RNA was isolated from 50-100 mg tissue using RNeasy 96 universal tissue kit RNA isolation protocol following manufacturer’s instructions (Qiagen). The knockdown efficiency of the siRNA molecules was determined using semi-quantitative real-time polymerase chain reactions on a QuantStudio 7 Flex real time thermocycler. Gene expression was calculated using the ΔΔCt approach while utilizing cyclophilin (PPIB) as the reference gene. A percentage change in human CNR1 mRNA in the tissues collected for each animal was calculated relative to the level of human CNR1 mRNA in the tissues of control animals, which received the saline only injection.

[0206] As shown in Figures 4A and 4B, the four human CNR1-targeted siRNA molecules significantly reduced expression of human CNR1 mRNA in both inguinal and epididymal WAT in the transgenic knock-in mice as compared to the tissues from saline-injected control animals. The percentage knockdown of the human CNR1 mRNA in inguinal WAT was 35%, 78%, 60%, and 70% for duplex nos. D-1394, D-1395, D-1396, and D-1397, respectively. The percentage knockdown of the human CNR1 mRNA in epididymal WAT was 49%, 69%, 59%, and 68% for duplex nos. D-1394, D-1395, D-1396, and D-1397, respectively. None of four human CNR1- targeted siRNA molecules significantly affected human CNR1 expression in kidney or liver as compared to expression in tissues from saline-injected control mice (Figures 4C and 4D). These results demonstrate that conjugation of the siRNA molecules to a docosanoyl group (C22) enables delivery to white adipose tissue for selective suppression of human CB1 expression in adipose tissue.

[0207] To further evaluate the ability of the docosanoyl group to deliver the CNR1-targeted siRNA molecules to adipose tissue and suppress endogenous CB1 expression, a subset of the human CNR1-targeted siRNA molecules evaluated in the human CB1 AAV model described in Example 4 were screened for cross-reactivity with the murine Cnr1 gene. Ten duplexes were selected and conjugated to the docosanoyl group shown in Formula II using the methods described in Example 2.

[0208] 10-week old female C57 / Bl6 mice (Charles River Laboratories) received a single subcutaneous injection of saline, 20 mg / kg of a C22-conjugated non-targeting control siRNA (duplex no. D-1408), or 20 mg / kg of one of the ten C22-conjugated CNR1-targeted siRNA molecules that were cross-reactive with the mouse Cnr1 gene (duplex nos. D-1398, D-1399, D- 1400, D-1401, D-1402, D-1403, D-1404, D-1405, D-1406, and D-1407). There were four animals in each treatment group. The unmodified and modified sequences for duplex nos. D- 1398 to D-1407 are provided in Tables 2 and 3, respectively. The unmodified and modified sequences for D-1408 (non-targeting control siRNA) are provided below in the 5ʹ to 3ʹ orientation using the same notations as for Table 3. D-1408 unmodified sense strand (SEQ ID NO: 354) UUUGGUUUACAUGUCGACUA D-1408 unmodified antisense strand (SEQ ID NO: 695) UUAGUCGACAUGUAAACCAAAUU D-1408 modified sense strand (SEQ ID NO: 1092) [DCA-C6]uuugguuuAfcAfUfGfUfcgacuas{invAb}D-1408 modified antisense strand (SEQ ID NO: 1433) usUfsagucGfacauGfuAfaaccaaasusu

[0209] The mice were fed standard chow (Harlan, 2020× Teklad global soy protein-free extruded rodent diet) throughout the experiment. Inguinal subcutaneous WAT and liver were collected 4 weeks after siRNA administration and analyzed. RNA from harvested animal tissues was processed for qPCR analysis (Taqman PCR and droplet digital PCR). RNA was isolated from 50-100 mg tissue using RNeasy 96 universal tissue kit RNA isolation protocol following manufacturer’s instructions (Qiagen). A percentage change in murine Cnr1 mRNA in the tissues collected for each animal was calculated relative to the level of murine Cnr1 mRNA in the tissues of control animals, which received the saline only injection.

[0210] The relative mRNA expression in the inguinal WAT and liver as determined by droplet digital PCR (ddPCR) are shown in Figures 5A and 5B, respectively. The percentage of knockdown of murine Cnr1 expression in inguinal WAT as compared to expression in tissues from animals receiving the saline control are summarized in Table 6 below. Relative mRNA expression levels as determined by Taqman PCR (data not shown) were similar to those obtained with ddPCR. The majority of the C22-conjugated CNR1-targeted siRNA molecules produced significant knockdown in inguinal WAT four weeks following administration of a single dose with duplexes D-1402, D-1403, and D-1406 exhibiting greater than 75% knockdown. As expected, the non-targeting control conjugate, D-1408, did not exhibit significant activity. Moderate suppression of Cnr1 expression in the liver was also observed with some of the C22- siRNA conjugates (Figure 5B), albeit to a lesser extent than that observed in the inguinal WAT. Table 6. Inhibition of endogenous CB1 expression in mice with human / mouse cross- reactive CNR1-targeted siRNA molecules Duplex No. Percent Knockdown of Cnr1Duplex No. Percent Knockdown of Cnr1 mRNA vs. Saline Controllimited to the particular methodology, protocols and materials described as these can vary. It is also understood that the terminology used herein is for the purposes of describing particular embodiments only and is not intended to limit the scope of the appended claims.

[0212] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

CLAIMS What is claimed:

1. An RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region having a sequence that is substantially complementary to a CNR1 mRNA sequence, and wherein said region comprises at least 15 contiguous nucleotides from any one of the sequences set forth in SEQ ID NOs: 355-694 and 1093-1432.

2. The RNAi construct of claim 1, wherein the sense strand comprises a sequence that is sufficiently complementary to the sequence of the antisense strand to form a duplex region of about 15 to about 30 base pairs in length.

3. The RNAi construct of claim 2, wherein the duplex region is about 17 to about 24 base pairs in length.

4. The RNAi construct of claim 2, wherein the duplex region is about 19 to about 21 base pairs in length.

5. The RNAi construct of any one of claims 1 to 4, wherein the sense strand and the antisense strand are each independently about 19 to about 30 nucleotides in length.

6. The RNAi construct of claim 5, wherein the sense strand and the antisense strand are each independently about 19 to about 23 nucleotides in length.

7. The RNAi construct of any one of claims 1 to 6, wherein the RNAi construct comprises one or two blunt ends.

8. The RNAi construct of any one of claims 1 to 6, wherein the RNAi construct comprises one or two nucleotide overhangs of 1 to 4 unpaired nucleotides.

9. The RNAi construct of claim 8, wherein the nucleotide overhang has 2 unpaired nucleotides.

10. The RNAi construct of claim 8 or 9, wherein the RNAi construct comprises a nucleotide overhang at the 3ʹ end of the sense strand, the 3ʹ end of the antisense strand, or the 3ʹ end of both the sense strand and the antisense strand.

11. The RNAi construct of any one of claims 1 to 10, wherein the RNAi construct comprises one or more modified nucleotides.

12. The RNAi construct of claim 11, wherein the one or more modified nucleotides are 2ʹ- modified nucleotides.

13. The RNAi construct of claim 11, wherein the one or more modified nucleotides are 2ʹ- fluoro modified nucleotides, 2ʹ-O-methyl modified nucleotides, 2ʹ-O-methoxyethyl modified nucleotides, 2ʹ-O-alkyl modified nucleotides, 2ʹ-O-allyl modified nucleotides, bicyclic nucleic acids (BNA), deoxyribonucleotides, or combinations thereof.

14. The RNAi construct of claim 11, wherein all of the nucleotides in the sense and antisense strands are modified nucleotides.

15. The RNAi construct of claim 14, wherein the modified nucleotides are 2ʹ-O-methyl modified nucleotides, 2ʹ-fluoro modified nucleotides, or combinations thereof.

16. The RNAi construct of any one of claims 1 to 15, wherein the sense strand comprises an abasic nucleotide as the terminal nucleotide at its 3ʹ end, its 5ʹ end, or both its 3ʹ and 5ʹ ends.

17. The RNAi construct of claim 16, wherein the abasic nucleotide is linked to the adjacent nucleotide through a 3ʹ-3ʹ internucleotide linkage or a 5ʹ-5ʹ internucleotide linkage.

18. The RNAi construct of any one of claims 1 to 17, wherein the sense strand, the antisense strand, or both the sense and antisense strands comprise one or more phosphorothioate internucleotide linkages.

19. The RNAi construct of claim 18, wherein the antisense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3ʹ and 5ʹ ends.

20. The RNAi construct of claim 18 or 19, wherein the sense strand comprises a phosphorothioate internucleotide linkage between the terminal nucleotides at the 3ʹ end.

21. The RNAi construct of any one of claims 18 to 20, wherein the sense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 5ʹ end.

22. The RNAi construct of any one of claims 1 to 21, wherein the antisense strand comprises or consists of a sequence selected from any one of the sequences set forth in SEQ ID NOs: 355- 694 and 1093-1432.

23. The RNAi construct of any one of claims 1 to 22, wherein the antisense strand comprises or consists of a sequence selected from SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 427, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 443, SEQ ID NO: 471, SEQ ID NO: 477, SEQ ID NO: 499, SEQ ID NO: 512, SEQ ID NO: 517, SEQ ID NO: 518, SEQ ID NO: 520, SEQ ID NO: 521, SEQ ID NO: 522, SEQ ID NO: 524, SEQ ID NO: 525, SEQ ID NO: 527, SEQ ID NO: 529, SEQ ID NO: 540, SEQ ID NO: 619, SEQ ID NO: 634, SEQ ID NO: 673, and SEQ ID NO:

676.

24. The RNAi construct of any one of claims 1 to 23, wherein the sense strand comprises or consists of a sequence selected from any one of the sequences set forth in SEQ ID NOs: 14-353 and 696-1091.

25. The RNAi construct of claim 24, wherein the sense strand comprises or consists of a sequence selected from SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 102, SEQ ID NO: 130, SEQ ID NO: 136, SEQ ID NO: 158, SEQ ID NO: 171, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 179, SEQ IDNO: 180, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 199, SEQ ID NO: 278, SEQ ID NO: 293, SEQ ID NO: 332, and SEQ ID NO:

335.

26. The RNAi construct of any one of claims 1 to 25, wherein: (i) the sense strand comprises or consists of the sequence of SEQ ID NO: 102 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 443; (ii) the sense strand comprises or consists of the sequence of SEQ ID NO: 188 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 529; (iii) the sense strand comprises or consists of the sequence of SEQ ID NO: 92 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 433; (iv) the sense strand comprises or consists of the sequence of SEQ ID NO: 84 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 425; (v) the sense strand comprises or consists of the sequence of SEQ ID NO: 83 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 424; (vi) the sense strand comprises or consists of the sequence of SEQ ID NO: 86 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 427; (vii) the sense strand comprises or consists of the sequence of SEQ ID NO: 176 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 517; (viii) the sense strand comprises or consists of the sequence of SEQ ID NO: 199 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 540; (ix) the sense strand comprises or consists of the sequence of SEQ ID NO: 171 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 512; (x) the sense strand comprises or consists of the sequence of SEQ ID NO: 181 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 522; (xi) the sense strand comprises or consists of the sequence of SEQ ID NO: 278 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 619; (xii) the sense strand comprises or consists of the sequence of SEQ ID NO: 293 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 634; (xiii) the sense strand comprises or consists of the sequence of SEQ ID NO: 332 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 673;(xiv) the sense strand comprises or consists of the sequence of SEQ ID NO: 335 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 676; (xv) the sense strand comprises or consists of the sequence of SEQ ID NO: 177 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 518; (xvi) the sense strand comprises or consists of the sequence of SEQ ID NO: 180 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 521; (xvii) the sense strand comprises or consists of the sequence of SEQ ID NO: 186 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 527; (xviii) the sense strand comprises or consists of the sequence of SEQ ID NO: 184 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 525; (xix) the sense strand comprises or consists of the sequence of SEQ ID NO: 136 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 477; (xx) the sense strand comprises or consists of the sequence of SEQ ID NO: 179 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 520; (xxi) the sense strand comprises or consists of the sequence of SEQ ID NO: 130 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 471; (xxii) the sense strand comprises or consists of the sequence of SEQ ID NO: 158 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 499; (xxiii) the sense strand comprises or consists of the sequence of SEQ ID NO: 97 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 438; (xxiv) the sense strand comprises or consists of the sequence of SEQ ID NO: 96 and the antisense strand comprises or consists of the sequence of SEQ ID NO: 437; or (xxv) the sense strand comprises or consists of the sequence of SEQ ID NO: 183 and the antisense strand comprises or consists of the sequence of SEQ ID NO:

524.

27. The RNAi construct of claim 26, wherein: (i) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 784 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1181;(ii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 870 or SEQ ID NO: 1055 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1267; (iii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 774 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1171; (iv) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 766 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1163; (v) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 853 or SEQ ID NO: 1065 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1250; (vi) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 863 or SEQ ID NO: 1073 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1260; (vii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 765 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1162; (viii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 768 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1165; (ix) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 858 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1255; (x) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 881 or SEQ ID NO: 1072 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1278; (xi) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 960 or SEQ ID NO: 1054 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1357;(xii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 975 or SEQ ID NO: 1038 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1372; (xiii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1014 or SEQ ID NO: 1042 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1411; (xiv) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1017 or SEQ ID NO: 1039 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1414; (xv) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 859 or SEQ ID NO: 1044 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1256; (xvi) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 862 or SEQ ID NO: 1074 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1259; (xvii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 868 or SEQ ID NO: 1056 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1265; (xviii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 866 or SEQ ID NO: 1059 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1263; (xix) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 818 or SEQ ID NO: 1052 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1215; (xx) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 861 or SEQ ID NO: 1043 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1258; (xxi) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 812 or SEQ ID NO: 1063 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1209;(xxii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 840 or SEQ ID NO: 1062 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1237; (xxiii) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 779 or SEQ ID NO: 1090 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1176; (xxiv) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 778 or SEQ ID NO: 1091 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1175; or (xxv) the sense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 865 or SEQ ID NO: 1061 and the antisense strand comprises or consists of the sequence of modified nucleotides according to SEQ ID NO: 1262.

28. The RNAi construct of any one of claims 1 to 27, wherein the RNAi construct is any one of the duplex compounds listed in Tables 2 or 3.

29. The RNAi construct of claim 28, wherein the RNAi construct is D-1069, D-1070, D- 1072, D-1078, D-1082, D-1083, D-1088, D-1116, D-1122, D-1144, D-1157, D-1162, D-1163, D-1165, D-1166, D-1167, D-1169, D-1170, D-1172, D-1174, D-1185, D-1264, D-1279, D-1318, D-1321, D-1342, D-1343, D-1346, D-1347, D-1348, D-1356, D-1358, D-1359, D-1360, D-1363, D-1365, D-1366, D-1367, D-1369, D-1376, D-1377, D-1378, D-1395, D-1396, D-1397, D-1398, D-1400, D-1401, D-1402, D-1403, or D-1406.

30. The RNAi construct of any one of claims 1 to 29, wherein the RNAi construct further comprises a ligand.

31. The RNAi construct of claim 30, wherein the ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folate moiety, a fatty acid, a carbohydrate, a glycoside, or antibody or antigen-binding fragment thereof.

32. The RNAi construct of claim 31, wherein the fatty acid is lauric acid (C12), myristic acid (C14), palmitic acid (C16), palmitoleic acid (C16:1), stearic acid (C18), oleic acid (C18:1), linoleic acid (C18:2), arachidic acid (C20), arachidonic acid (C20:4), docosanoic acid (C22), docosahexaenoic acid (C22:6), or lignoceric acid (C24).

33. The RNAi construct of claim 32, wherein the fatty acid is palmitic acid.

34. The RNAi construct of claim 32, wherein the fatty acid is docosanoic acid.

35. The RNAi construct of claim 30, wherein the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine.

36. The RNAi construct of claim 35, wherein the ligand comprises a multivalent galactose moiety or multivalent N-acetyl-galactosamine moiety.

37. The RNAi construct of claim 36, wherein the multivalent galactose moiety or multivalent N-acetyl-galactosamine moiety is trivalent or tetravalent.

38. The RNAi construct of any one of claims 30 to 37, wherein the ligand is covalently attached to the sense strand optionally through a linker.

39. The RNAi construct of claim 38, wherein the ligand is covalently attached to the 5ʹ end of the sense strand.

40. A pharmaceutical composition comprising the RNAi construct of any one of claims 1 to 39 and a pharmaceutically acceptable carrier or excipient.

41. A method for reducing the expression of CB1 protein in a patient in need thereof comprising administering to the patient the RNAi construct of any one of claims 1 to 39 or the pharmaceutical composition of claim 40.

42. The method of claim 41, wherein the expression level of CB1 in adipose tissue is reduced in the patient following administration of the RNAi construct or pharmaceutical composition as compared to the CB1 expression level in a patient not receiving the RNAi construct or pharmaceutical composition.

43. The method of claim 41, wherein the patient is diagnosed with or at risk for obesity, metabolic syndrome, visceral obesity, type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, or cardiovascular disease.

44. A method for reducing body weight or fat mass in a patient in need thereof comprising administering to the patient the RNAi construct of any one of claims 1 to 39 or the pharmaceutical composition of claim 40.

45. The method of claim 44, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

46. The method of claim 44, wherein the patient has a waist-to-hip ratio greater than 1.

0.

47. The method of any one of claims 44 to 46, wherein the patient is diagnosed with visceral obesity.

48. A method for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof comprising administering to the patient the RNAi construct of any one of claims 1 to 39 or the pharmaceutical composition of claim 40.

49. The method of claim 48, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

50. The method of claim 48 or 49, wherein the obesity-related condition is type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, cardiovascular disease, osteoarthritis, metabolic syndrome, or sleep apnea.

51. A method for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof comprising administering to the patient the RNAi construct of any one of claims 1 to 39 or the pharmaceutical composition of claim 40.

52. The method of claim 51, wherein the fatty liver disease is nonalcoholic fatty liver disease or nonalcoholic steatohepatitis.

53. The method of claim 51 or 52, wherein the patient is obese.

54. The method of any one of claims 41 to 53, wherein the RNAi construct or pharmaceutical composition is administered to the patient via a parenteral route of administration.

55. The method of claim 54, wherein the parenteral route of administration is intravenous or subcutaneous.

56. An RNAi construct of any one of claims 1 to 39 for use in a method for reducing body weight or fat mass in a patient in need thereof.

57. The RNAi construct for use according to claim 56, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

58. The RNAi construct for use according to claim 56, wherein the patient has a waist-to-hip ratio greater than 1.

0.

59. The RNAi construct for use according to any one of claims 56 to 58, wherein the patient is diagnosed with visceral obesity.

60. An RNAi construct of any one of claims 1 to 39 for use in a method for treating, preventing, or reducing the risk of developing obesity or an obesity-related condition in a patient in need thereof.

61. The RNAi construct for use according to claim 60, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

62. The RNAi construct for use according to claim 60 or 61, wherein the obesity-related condition is type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, cardiovascular disease, osteoarthritis, metabolic syndrome, or sleep apnea.

63. An RNAi construct of any one of claims 1 to 39 for use in a method for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof.

64. The RNAi construct for use according to claim 63, wherein the fatty liver disease is nonalcoholic fatty liver disease or nonalcoholic steatohepatitis.

65. The RNAi construct for use according to claim 63 or 64, wherein the patient is obese.

66. Use of an RNAi construct of any one of claims 1 to 39 in the preparation of a medicament for reducing body weight or fat mass in a patient in need thereof.

67. The use of claim 66, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

68. The use of claim 66, wherein the patient has a waist-to-hip ratio greater than 1.

0.

69. The use of any one of claims 66 to 68, wherein the patient is diagnosed with visceral obesity.

70. Use of an RNAi construct of any one of claims 1 to 39 in the preparation of a medicament for treating, preventing, or reducing the risk of developing obesity or an obesity- related condition in a patient in need thereof.

71. The use of claim 70, wherein the patient has a body mass index (BMI) of ≥ 30.0 kg / m2.

72. The use of claim 70 or 71, wherein the obesity-related condition is type 2 diabetes, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, cardiovascular disease, osteoarthritis, metabolic syndrome, or sleep apnea.

73. Use of an RNAi construct of any one of claims 1 to 39 in the preparation of a medicament for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof.

74. The use of claim 73, wherein the fatty liver disease is nonalcoholic fatty liver disease or nonalcoholic steatohepatitis.

75. The use of claim 73 or 74, wherein the patient is obese.

Images