Induced full organ system (i-FOS)
Genetically engineered organisms lacking CNS function provide a controlled environment for growing transplantable organs, addressing organ scarcity by reducing reliance on human donors and enhancing organ availability and quality.
Patent Information
- Application Number
- PCT/US2025/033857
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-01-13
- Filing Date
- 2025-06-16
- Publication Date
- 2025-12-18
AI Technical Summary
The scarcity of donated organs for transplantation is a critical issue due to reliance on young, healthy donors, leading to ethical concerns, emotional stress on donor families, and complex, time-sensitive matching processes, with demand exceeding supply and resulting in long waiting lists and patient mortality.
Development of Induced Full Organ Systems (I-FOS) through genetically engineered organisms lacking higher central nervous system function, created via targeted gene knockouts to prevent CNS development, allowing for the growth of transplantable organs without human donors, reducing pain and conscious awareness, and providing controlled organ growth.
This approach alleviates the reliance on human donors, enhances organ availability and quality, reduces rejection risks, and simplifies the organ supply process, addressing ethical concerns and improving patient outcomes.
Smart Images

Figure US2025033857_18122025_PF_FP_ABST
Abstract
Description
INDUCED FULL ORGAN SYSTEM (LFOS)1. CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 660,445, filed on June 14, 2024; U.S. Provisional Application No. 63 / 709,974, filed on October 21, 2024; and U.S. Provisional Application No. 63 / 744,831, filed on January 13, 2025; the contents of which are hereby incorporated by reference in their entirety.2. SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on Month XX, 20XX, is named XXXX, and is X, XXX, XXX bytes in size.3. BACKGROUND OF THE INVENTION
[0003] The scarcity of donated organs is a significant challenge in modern medicine, primarily because the optimal sources for transplantation are generally from relatively young, healthy individuals who die prematurely. These unfortunate circumstances include accidents, sudden medical conditions, or traumatic events that result in brain death while leaving other organs viable for donation. Consequently, the availability of such organs is inherently extremely limited and cannot meet the growing demand. This shortfall leads to long waiting lists and a considerable number of patients who suffer or die before a suitable donor organ becomes available.
[0004] The reliance on young, healthy donors raises several ethical and social concerns. It is distressing to consider that the best organ donations come from tragic, premature deaths. This reality places immense emotional stress on donor families and highlights the unpredictability and unreliability of the organ supply. Additionally, the process of matching and transplanting these organs is complex and time-sensitive, often exacerbating the challenges associated with organ scarcity. The need for a more dependable and ethically sound source of transplantable organs is therefore critical.4. SUMMARY OF THE INVENTION
[0005] The present strategy offers a method for producing tissues, including transplantable organs, by creating organisms that cannot develop higher central nervous system (CNS)function and that lack a general body plan. This phenotype is herein defined as an Induced Full Organ System (I-FOS), which is essentially a sack of organs that grows mostly on its own with some additional life support. Additionally, I-FOS are generally intended to be created artificially from non-reproductive cells that are induced to develop all the major organ systems, although in some model organisms reproductive materials may be used for proof of concept. In some embodiments, the engineered organisms possess enough nervous tissue to maintain basic organ function. In some embodiments, the engineered organisms lack any ability for conscious awareness. In other embodiments, lower CNS function is also reduced or eliminated, and the tissues and organs are kept alive through artificial means.
[0006] The engineered organisms preferably have layers of gene knockouts that eliminate the possibility of the formation of a complex brain and nervous system, lack pain sensing and have a total or near total lack of a complex body plan. The resulting organism resembles a sack-like structure with a complete lack of ability to feel, think, or sense the environment.
[0007] This approach reduces dependence on human donors, alleviating the emotional and physical burdens associated with traditional organ donation. It also provides a controlled environment for organ growth, which can improve the quality and availability of organs for transplantation. By potentially reducing the risk of organ rejection and disease transmission, this method can enhance patient outcomes.
[0008] Engineering the organism's body without a CNS, or parts of the CNS, allows the harvesting of tissues while solving critical issues of pain and suffering, and eliminating the potential for conscious awareness. The limited theoretical discussion in scientific literature around methodologies to create the kind of products articulated herein, the framing of the discussion around the kinds of disclosed gene edits and the specific gene targets, and the ethical and conceptual barriers highlighted, have helped to prevent the discussion and development of a product to fill this significant unmet need in cell and tissue therapy.
[0009] The ethical considerations surrounding traditional organ sources versus growing organs in I-FOS are significant. Traditional organ transplantation relies on human donors, which raises issues related to consent, the potential risks to living donors, and the fair allocation of scarce organs. Additionally, the demand for organs often exceeds the supply, leading to long waiting lists and many patients not receiving the transplants they need in time.5. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings, where:
[0011] FIGs. 1A-1D present a histological comparison between a genetically modified embryo and its wild type (WT) counterpart from the same litter, both of which were implanted simultaneously in the recipient female. FIG. 1 A depicts a cross-section of the whole brain of the genetically modified embryo where genes NDE1 and DCX have been inactivated using CRISPR technology. FIG. IB depicts a cross-section of the cortex of the genetically modified embryo where genes NDE1 and DCX have been inactivated using CRISPR technology. FIG. 1C depicts a cross-section of the whole brain of the WT embryo. FIG. ID depicts a cross-section of the cortex of the WT embryo.
[0012] FIG. 2 provides a complete view of the embryo which underwent CRISPR-mediated genetic modification targeting the NDE1 and DCX genes, at embryonic day 13 (E14).
[0013] FIGs. 3A-3H are immunohistochemical comparisons between a genetically modified embryo with targeted knockouts of IL1RAPL1, CHRNA7, and a wild-type counterpart. In the color versions of these images the brown staining represents the staining of IL1RAPL1 or CHRNA7 and the blue staining represents general staining of the tissue. FIG. 3 A displays the whole E14 mouse brain from a wild-type embryo, stained for IL1RAPL1. The diffuse darker staining throughout the brain indicates a global expression of IL1RAPL1; there is clear brown staining in the color version throughout the CNS. FIG. 3B is an enlarged view of the cortex from the same wild-type brain as in Panel A. Here, the surface of the cortex shows even darker staining, and very clear concentrated brown staining in the color version, denoting higher IL1RAPL1 expression, as highlighted by arrows. FIG. 3C shows the whole brain of the knockout embryo, stained for IL1RAPL1. The brain appears much lighter, indicating a lack of IL1RAPL1 expression; in the color version there is no brown staining at all. Additionally, dysmorphic features and enlarged ventricles are evident, along with a noticeable reduction in brain matter. FIG. 3D provides an enlarged view of the cortex from the knockout embryo in Panel C. This panel shows no staining for IL1RAPL1, aligning with the knockout of this gene; in the color version there is no brown staining at all. FIG. 3E features another section of the same wild type brain from Frames A and B, but stained forCHRNA7. This frame shows diffuse CHRNA7 presence, with several regions displaying more concentrated expression, as indicated by arrows. FIG. 3F displays an enlargement of the cortex from the same wild-type brain as in Frame E. The outer cortex exhibits clear dark staining, indicating high levels of CHRNA7 expression. FIG. 3G displays another section of the same knockout brain as in Frames C and D, stained for CHRNA7. The brain section replicates the dysmorphic features of Frame C and shows no CHRNA7 staining, no brown staining at all in the color version. FIG. 3H displays an enlargement of the cortex from the knockout brain in Frame G, demonstrating a complete absence of CHRNA7 staining, no brown staining at all in the color version.
[0014] FIG. 4 illustrates the expected additivity from multiplexing various mutations on the phenotypic reduction of CNS tissue in the engineered biological products of the present disclosure.
[0015] FIG. 5 illustrates an engineered induces full organ system (I-FOS) transitioning at an ideal time from natural womb to artificial support systems.
[0016] FIG. 6 shows knockout status of 3 different mouse fetal specimens treated with CRISPRs targeting GRIN2b and MFSD2a. All fetuses were alive and developing up to the point of measurement. Lane 0 is the control, specimen 1 was run in lanes 1 and 2, specimen 2 was run in lanes 3 and 4, specimen 3 was run in lanes 5 and 6.
[0017] FIG. 7 shows knockout status of two genes, NDE1 (N) and MFSD2a (M) via excision, in 5 different fetal specimens. All fetuses were alive and developing up to the point of measurement. N1 and Ml show the homozygous wildtype form for each gene. Shorter bands for N and M display knockout conditions.
[0018] FIG. 8 shows knockout status of 3 different fetal specimens treated with CRISPRs targeting CHRNB2 and IL1RAPL1. Specimen Gl-01 is homozygous for wild-type genes and was run in lanes 1 and 2, specimen Gl-04 is homozygous for knockout genes and was run in lanes 3 and 4, specimen Gl-02 was run in lanes 5 and 6.
[0019] FIG. 9 shows a microscopy image of group 4 from table 37 which is a group of mouse embryos treated to with CRISPR to knock out HTR6, NDE1, and MFSD2A, at 96 hours.
[0020] FIG. 10 is a cartoon representation of what a complete I-FOS can look like. As shown, the I-FOS lacks a head and limbs; inside (not shown) are internal organs.
[0021] FIG. 11 is a photograph of a whole mouse I-FOS example. Mouse zygotes were treated using CRISPR to alter genes OTX2, FGF10 and then implanted in recipient females and allowed to develop until day 18. These biological products show profound lack of development of craniofacial anatomy as well as profound loss of CNS development and limb development.
[0022] FIGs. 12A-12B show images of an I-FOS example. FIG. 12A is a photograph of the exterior of the whole I-FOS. FIG. 12B is a hematoxylin and eosin (H&E) stained histological image of a whole body section of the I-FOS. Residual hindbrain tissue is seen, some of which is in the compartment where forebrain would reside if it were not absent. The mouse zygote was treated using CRISPR to alter genes OTX2 and FGF10, and then implanted in recipient females and allowed to develop until day 18. The I-FOS example showed profound lack of development of craniofacial anatomy as well as profound loss of CNS development, and limb development.
[0023] FIG. 13 is a photograph showing the physical characteristics of an I-FOS (left side) with a wild-type litter mouse mate (right side). The zygote of the I-FOS was treated using CRISPR to alter genes DCX, NDE1, OTX2, FGF10, and DRD2 and then implanted in recipient females and allowed to develop until day 17.
[0024] FIG. 14. H&E stained histological images of the example from figure 12. FIG. 14A is the wild type animal and FIG. 14B is the I-FOS. Profound lack of development of craniofacial anatomy as well as profound loss of CNS development, and limb development is clearly evident on the histology for FIG. 14B. CNS lack of development is far more complete in this vs figure 12. Normal anatomy is evident in FIG. 14A.
[0025] FIG. 15 depicts a Foxgl promoter-driven RNAi polynucleotide expression construct for OTX2 to control absence of anterior development.
[0026] FIG. 16 depicts a Prrxl promoter-driven RNAi polynucleotide expression construct for FGF4 and FGF8 to control absence of limb development.6. DETAILED DESCRIPTION OF THE INVENTION6.1. Genetically engineered organisms
[0027] In a first aspect, genetically engineered organisms are provided. The genomic modifications prevent higher CNS development during maturation.6.1.1. Genomic modifications to prevent higher CNS development
[0028] In typical embodiments, mutations are not engineered into genes for which spontaneous mutations causing complete or near-complete anencephaly have been identified; in typical embodiments, the organisms are wild-type at these loci. These genes are known to broadly impact the functioning of centrioles, centromeres, microtubules or cell cycle checkpoint proteins (e.g., CDK6, MCPH1, CENPJ, and WDR62). Targeting such broadly expressed factors to prevent CNS formation could lead to incomplete or improper development, subsequent degeneration, and / or altered function of the musculoskeletal system and other peripheral organs, limiting the utility of the organisms for organ production. In addition, the anencephalic phenotype caused by mutations in such genes is sporadic, with significant variation in phenotypic outcome (i.e., resulting CNS development) from the same single gene alterations.
[0029] Therefore, in typical embodiments, a more controlled and specific genomic modification strategy is employed. In various embodiments, genes targeted for modification are largely specific to neural tissue or have highly enriched expression in neural tissue, and have a limited impact on non-neural tissue.
[0030] Naturally occurring mutations and animal models show that a spectrum of reduced CNS developmental states are possible in addition to full deletion of the cerebrum that occurs with neural tube closure failures resulting in anencephaly. Whereas neural tube closure failures are typically multifactorial and do not occur with reliability, certain genetic mutations that can cause reduced CNS development have consistent outcomes in humans and in animals. In some embodiments, the gene is selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, and TUBB3, or any established “microcephaly primary hereditary” (MCPH) genes (tier 1 genes).
[0031] While individual mutations are reproducible, they are unlikely to fully restrict higher CNS formation on their own. Thus, in some embodiments, modifications are made to a plurality of genes. This multiplexing enables strategic combinations of genetic alterations to be deployed to further limit CNS development and neuron survival, causing deletion of all, or of components, of the cerebrum. Using combinations of these key gene deletions with other gene deletions or other interventions ensures the profound and reliable prevention of higher nervous system formation. Any of the disclosed gene combinations are highly unlikely to be found in nature, as each gene described is highly conserved, very rarely inactivated in the homozygous state and important for the overall survival and fitness of the animal.
[0032] In some embodiments in which a plurality of genes are modified, at least one of the plurality of genes to be modified is selected from CIT, DCX, FTCD, GRIK3, GRIN2A, LHX1, LHX2, GRIN2B, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, and TUBB3, or any established MCPH gene (tier 1).
[0033] In certain embodiments in which a plurality of genes are modified, at least one of the plurality is a gene that affects neuronal signaling, preventing transmission or perception of pain signals. Modifying genes that alter the perception of pain or the ability to feel pain is beneficial, either on its own or in combination with other gene alterations that limit neural development. In some embodiments, such a gene is selected from NTRK1, PRDM12, genes related to monoamine neurotransmitter synthesis and production and serotonergic or dopaminergic neuron development or function.
[0034] Genes for the 5HT receptors (including HTR6, GPR26), dopamine receptors (DRD3), GABA receptors (GABRA6), glutamate receptors (GRM2, GRM4, SLC1A2), Interleukin- 1 receptor family (IL1RAPL1), transcription factors (such as SOX1, TBR1, VAX1) potassium channels (KCNK4), and PRDM12 (tier 2) are also usefully modified in combination gene modification strategies.
[0035] One such combination is shown in FIG. 4. In some embodiments, modifications are made in a plurality of genes selected from NTRK1, MFSD2A and GRIN2B. NTRK1 can be altered to prevent any sensation of pain. Certain DNA alterations in NTRK1 can also result in a progressive neuron loss that is significant enough to affect global CNS function. Additionally, these mutations may also sensitize surviving neurons to apoptosis, leading to an increase in efficacy of further intentional or unintentional stressors to cause prevention ofdevelopment of neural mass. MFSD2A can be altered to inhibit proper transport of certain fatty acids such as docosahexaenoic acid (DHA), thereby preventing proper neuron formation, which results in significantly reduced CNS development. GRIN2B (NMD A receptor) alteration results in neuron specific effects that can range from minor to major developmental impairment. The specific altered form of GRIN2B used can depend on the most favorable synergistic effect achieved through experimentation.
[0036] In some embodiments, modifications are made to genes that regulate stem cell maintenance and expansion, and / or genes that are otherwise related to the formation and proper function of neurons and their support cells.
[0037] The gene modifications can be performed on germ cells, or any other cell type that can be induced to revert to an embryonic-like state.
[0038] In some embodiments, genetic modification reduces expression of the encoded protein. In certain embodiments, the modification is a complete knock-out, eliminating expression of the encoded protein.
[0039] In some embodiments, the modification is introduction of an indel into the coding sequence, leading to frameshift and truncation, with the truncated protein having reduced function, no function, and / or reduced functional half-life. In certain embodiments, indels are introduced by nonhomologous end joining following a double strand break affected by an RNA guided DNA nuclease, such as CRISPR-Cas9.
[0040] In some embodiments, the modification alters the primary amino acid sequence of the protein, either by insertion of a modified gene or by editing the endogenous gene, such as by PRIME editing. In certain embodiments, the sequence of the protein is mutated in order to cause it to aggregate, or specific amino acid sequences can be added or removed to induce misfolding and aggregation of the protein. The mutation of the protein's sequence or the induction of misfolding and aggregation through the addition or removal of specific amino acid sequences can contribute to cellular stress and apoptosis. These changes to the protein can disrupt normal cellular processes and lead to the death of the cell.
[0041] Manipulations can include insertions, deletions, or other modifications to the gene(s) of interest or the corresponding regulatory elements. Modifications can be homozygous or heterozygous.6.1.2. Further genomic modifications for xenotransplantation organ production
[0042] In some embodiments, engineered livestock are created to provide organs for xenotransplantation. In certain of these embodiments, further genomic modifications can be made to reduce immunogenicity following xenogeneic transplantation into a human host.
[0043] In certain embodiments, the cells are porcine and the further engineering is a knockout of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA. In some embodiments, the further engineering is knock-out of a plurality of genes selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA. In some embodiments, the animal’s cells are further engineered to express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
[0044] In particular embodiments, the tissue to be transplanted is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.6.1.3. Gestational maturation
[0045] In some embodiments, the genetically modified I-FOS is implanted into a surrogate’s uterus, where it receives nourishment and support as it grows and develops. This embodiment allows for the natural development of the genetically modified I-FOS within the womb, taking advantage of the benefits provided by the maternal environment. Life support is provided following natural or induced birth.
[0046] In some embodiments, the genetically modified I-FOS is grown fully using artificial means outside of a natural womb environment. The genetically modified I-FOS receives nourishment from an artificial in utero environment for support as it grows and develops.This embodiment allows for the development of the genetically modified I-FOS to grow in an artificial environment. Additional life support may or may not be provided following decanting from the artificial in utero environment.
[0047] In some embodiments, the development of neural tissue can be monitored using methods such as ultrasound or other means.
[0048] In some embodiments, modifications are additionally made to genes that cause neurons to be more susceptible to apoptosis in response to changes in temperature, nutrient availability, oxygen availability, small molecule inhibitors, or other toxin exposures, compared to normally functioning neurons. These conditions can be adjusted during maturation to further reduce the development and survival of nervous tissue.
[0049] In some embodiments, factors that enhance the stability or resistance of developing tissues to stressors or apoptosis are prophylactically introduced or in response to changing parameters. These may include antioxidants, anti-apoptotic small molecules, and growth factors. An automatic sampling and monitoring system can be implemented to precisely adjust interventions in response to toxin levels, nutrient uptake, the state of nervous tissue, and basic vital signs.6.2. Engineered Tissues
[0050] In another aspect, genetically engineered tissues are provided. The tissues comprise a plurality of cells cohered into a three-dimensional structure, wherein the cells have differentiated from a single cell into at least two differentiated cell types, and wherein the cells commonly contain at least one genomic alteration that is neuronal signal reducing, neuron-depleting and neuron disrupting. In some embodiments, the cells contain a plurality of genomic alterations that are collectively in effect, at least one of the following neuronal signal reducing, neuron-depleting and neuron disrupting, body plan limiting or limb limiting.
[0051] In some embodiments, the cells are mammalian cells. In certain embodiments, the cells contain at least one genomic alteration that reduces expression of at least one gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, TUBB3, FGF4, FGF8, FGF10, FGFR2, FGFR3, RSPO2, or WNT3. In some embodiments, the cells contain at least one genomic alteration that reduces function of the protein respectively encoded by at least one gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, TUBB3, FGF4, FGF8, FGF10, FGFR2, FGFR3, RSPO2, or WNT3.
[0052] In certain embodiments, the cells contain genomic alterations in MFSD2A and NDE1.
[0053] In some embodiments, the genomic alteration comprises one or more mutations to the primary amino acid sequence of the protein. In particular embodiments, the one or more mutations cause misfolding and aggregation of the protein.
[0054] In some embodiments, the cells further contain at least one genomic alteration that reduces expression of at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0055] In some embodiments, the cells further contain at least one genomic alteration that reduces function of the protein respectively encoded by at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0056] In particular embodiments, the genomic alteration comprises one or more mutations to the primary amino acid sequence of the further altered protein. In certain embodiments, the one or more mutations cause misfolding and aggregation of the protein.
[0057] In some embodiments, the cells are homozygous for at least one of the described genomic alterations. In some embodiments, the cells are heterozygous for at least one of the described genomic alterations. In some embodiments, the tissue is in utero. In some embodiments, the tissue is ex vivo.
[0058] In some embodiments, the mammalian cells are from Family Bovidae, Parvorder Catarrhini, or Family Suidae.6.2.1. Organs for transplantation
[0059] In some embodiments, the cells of the tissue have been further engineered to reduce immunogenicity following transplantation into a human host. In certain embodiments, further engineering is a knock-out of at least one gene selected from GGTA1, CMAH,B5GALNT2, P2M, and CIITA. In certain embodiments, the further engineering is knock-out of a plurality of genes selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA. In some embodiments, the cells are porcine.
[0060] In some embodiments, the cells of the tissue have been further engineered to express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
[0061] In some embodiments, the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.6.3. Definitions
[0062] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The genes selected herein are defined as: being interchangeably the selected gene and any known gene(s) or its protein product with functional equivalency and / or a high degree of regional or gene / protein wide sequence homology that would have a reasonable expectation of a similar outcome to the selected gene, in context of its use. The terms Induced Full Organ System (I-FOS), Bio-Organ Unit and Integrated Organ Network (ION) are used interchangeably to describe the product claimed.6.4. Further embodiments I
[0063] In one aspect, provided is a genetically engineered tissue, comprising a plurality of cells cohered into a three-dimensional structure, wherein the cells have differentiated from a single cell into a plurality of differentiated cell types, and wherein the cells commonly contain at least one genomic alteration that is at least one of the following neuronal signal reducing, neuron-depleting and neuron disrupting. In various embodiments, the cells contain a plurality of genomic alterations that are collectively in effect that is at least one of the following neuronal signal reducing, neuron-depleting and neuron disrupting. In some embodiments of the genetically engineered tissue, the cells are mammalian cells.
[0064] In various embodiments of the genetically engineered tissue, the cells contain at least one genomic alteration that reduces expression of at least one gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, and TUBB3. In some embodiments, the cells contain atleast one genomic alteration that reduces function of at least one protein respectively encoded by a gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, 0TX1, 0TX2, PAFAH1B1 (LISI), RELN, and TUBB3. In some embodiments, the genomic alteration comprises one or more mutations to the primary amino acid sequence of the protein. In some embodiments, the one or more mutations cause misfolding and aggregation of the protein. In some embodiments, the cells contain genomic alterations in MFSD2A and NDE1.
[0065] In some embodiments of the genetically engineered tissue, the cells further contain at least one genomic alteration that reduces expression of at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DREG; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0066] In some embodiments of the genetically engineered tissue, the cells further contain at least one genomic alteration that reduces function of the protein respectively encoded by at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0067] In some further embodiments of the genetically engineered tissue, the genomic alteration comprises one or more mutations to the primary amino acid sequence of the further altered protein. In some embodiments, the one or more mutations cause misfolding and aggregation of the protein.
[0068] In various embodiments of the genetically engineered tissue, the cells are homozygous for at least one genomic alteration. In some embodiments, the cells are heterozygous for at least one genomic alteration.
[0069] In some embodiments, the mammalian cells are from Family Bovidae, Parvorder Catarrhini, or Family Suidae.
[0070] In some embodiments, the tissue is in utero. In some embodiments, the tissue is ex vivo.
[0071] In some embodiments, the cells are from a species of cattle, sheep, goats, pigs or rabbits.
[0072] In some embodiments, the cells are from a species of old world monkey.
[0073] In some embodiments of the genetically engineered tissue, the tissue is non-human and the cells have been further engineered to reduce immunogenicity following xenogeneic transplantation into a human host. In some embodiments, the cells are porcine and the further engineering is a knock-out of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA. In some embodiments, the further engineering is knock-out of a plurality of genes selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA. In some embodiments, the cells are further engineered to express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E. In some embodiments, the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.
[0074] In another aspect, provided are methods of producing a genetically engineered tissue comprising a plurality of cells cohered into a three dimensional structure, wherein the cells have differentiated from a single cell into at least two differentiated cell types, and wherein the cells commonly contain at least one genomic alteration is at least one of the following neuronal signal reducing, neuron-depleting and neuron disrupting, where the method comprises preparing an I-FOS ex vivo in which the cells commonly contain at least one genomic alteration that is at least one of the following neuronal signal reducing, neurondepleting and neuron disrupting, and implanting the I-FOS into the uterus of a suitably prepared host surrogate or artificial system.
[0075] In some embodiments of the method, the method further comprises the subsequent step, after a period of in utero growth and maturation that is less than the full gestational period, of transferring the I-FOS from host uterus to artificial life support. In some embodiments, after a full gestation in utero, the method further comprises delivering the fullterm animal.
[0076] In various embodiments of the method, the method further comprises the later step of sacrificing the animal and harvesting the tissue.
[0077] In another aspect, provided is an engineered organism, comprising cells having at least one genomic alteration that is at least one of the following neuronal signal reducing, neuron reducing, neuron-depleting and neuron disrupting. In various embodiments, the cells of the engineered organism contain a plurality of genomic alterations that are collectively in effect at least one of the following neuronal signal reducing, neuron reducing, neurondepleting and neuron disrupting.
[0078] In various embodiments of the engineered organism, the organism’s cells contain at least one genomic alteration that reduces expression of at least one gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, and TUBB3.
[0079] In various embodiments of the engineered organism, the cells contain at least one genomic alteration that reduces function of at least one protein respectively encoded by a gene selected from CIT, DCX, FTCD, GRIK3, GRIN2A, GRIN2B, LHX1, LHX2, MFSD2A, NDE1, NTRK1, OTX1, OTX2, PAFAH1B1 (LISI), RELN, and TUBB3. Some alterations to OTX2 will result in failure of development, especially those that disrupt the entire gene from being expressed. CRISPR guides used for viable development with CNS exclusion include paired guides: TCTGAACTCACTTCCCGAGC + CTATCCCATGACCTATACTC. In the embodiments proven out in figures 11-14, combinations of knockouts are used that demonstrate the viability of the LFOS product and the extent of modification that can be achieved with 2 to 6 alterations. Additional removal of neurotransmitter related genes or other neurodevelopmental genes should be reasonably expected to maintain organismal viability.
[0080] In various embodiments of the engineered organism, the organism’s cells further contain at least one genomic alteration that reduces expression of at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally ILIRAPLI; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0081] In various embodiments of the engineered organism, the cells further contain at least one genomic alteration that reduces function of the protein respectively encoded by at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0082] In various embodiments of the engineered organism, the organism’s cells contain at least one genomic alteration that reduces expression of at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0083] In various embodiments of the engineered organism, the cells contain at least one genomic alteration that reduces function of the protein respectively encoded by at least one gene encoding 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0084] In various embodiments of the engineered organism, the cells contain genomic alterations in MFSD2A and NDE1.
[0085] In various embodiments of the genetically engineered tissue, the cells contain at least one genomic alteration that alters or reduces expression of at least one gene selected from the genes FGF4, FGF8, FGF10, FGFR2, FGFR3, RSPO2, or WNT3 can play a crucial role in body plan restriction, specifically in limb development. These genes are integral components of the fibroblast growth factor (FGF) and Wnt signaling pathways, which are essential for the proper formation and patterning of limbs. FGF4 and FGF8 are involved in the initiation and outgrowth of limb buds, while FGF10 is crucial for limb bud induction and growth. FGFR2 and FGFR3 are receptors that mediate FGF signaling necessary for limb development.RSPO2 and WNT3 are key regulators of the Wnt signaling pathway, which is vital for theregulation of limb bud formation and growth. Disruptions in these genes can lead to significant limb abnormalities, including underdeveloped or missing limbs, as they disrupt the signaling processes that control limb bud formation, growth, and differentiation.
[0086] In some embodiments, RNAi constructs are employed to suppress or inhibit specific gene pathways that would otherwise lead to the development of extraneous anatomical features. This ensures that genetic and cellular resources are allocated exclusively to internal organ systems. By targeting genes that are instrumental in non-organ systems, the technology reorients developmental focus toward organs like the heart, lungs, kidneys, liver, and pancreas. Genes such as OTX1 and OTX2 are regulated to manage the anterior developmental pathways, ensuring that resources are directed away from extraneous formations and focused on core internal systems. To reinforce this, in some embodiments, the promoter elements governing OTX1 and / or OTX2 RNAi expression are Foxgl or Foxgl related or SOX2 or SOX2 related (Fig 15). Genes like FGF4 and FGF8, which are integral to posterior patterning and limb-associated pathways, are downregulated to optimize growth within the internal organ systems and minimize non-organ growth. To reinforce this, in some embodiments, genomically integrated RNAi elements are targeting FGF8 and / or FGF4 which are expressed via the PRRX1 promoter (Fig 16). Genes involved in unnecessary neural network formation are ideally absent, allowing biological resources to be channeled more effectively toward organogenesis. These can be: 5HT receptors, optionally HTR6 or GPR26; dopamine receptors, optionally DRD3; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.6.5. Further embodiments II6.5.1. I-FOS biological product
[0087] In another aspect, the techniques described herein relate to a genetically engineered biological product including a plurality of cells cohered in three dimensions, wherein the cells have differentiated from a single cell source into at least two differentiated cell types, and wherein the cells commonly contain a plurality of genomic alterations that are each respectively neuron-depleting and / or neuron disrupting, central nervous system restricting,central nervous system disrupting, and / or body plan restricting, wherein the biological product is a sac encasing at least one organ.
[0088] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2.
[0089] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2 and one or more genes selected from FGF4, FGF8 and FGF10.
[0090] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2 and FGF4.
[0091] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2 and FGF8.
[0092] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2 and FGF10.
[0093] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2 and NDE1.
[0094] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and one or more genes selected from FGF4, FGF8 and FGF10
[0095] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF4.
[0096] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF8.
[0097] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF10.
[0098] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and DCX.
[0099] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and one or more genes selected from FGF4, FGF8, and FGF10.
[0100] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF4.
[0101] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF8.
[0102] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF10.
[0103] In some embodiments, the techniques described herein relate to IThe biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and DRD2.
[0104] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2 and one or more genes selected from FGF4, FGF8 and FGF10. 19. The biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF4.
[0105] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF8.
[0106] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF10.
[0107] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, one or more genes selected from FGF4, FGF8, FGF10, and at least one neurotransmitter receptor gene.
[0108] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain further genomic alterations made in one or more of the following genes selected from CIT, FOXG1, FTCD, GRIK3, GRIN2A, GRIN2B, MFSD2A, NTRK1, PAFAH1B1 (LISI), RELN, SIX3 and TUBB3.
[0109] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain further genomic alterations made to one or more neurotransmitter genes selected from: nicotinic receptors, optionally CHRNA4, CHRNA7 or CHRNB2; 5HT receptors, optionally HTR5A, HTR6 or GPR26; dopamine receptors, optionally DRD1, DRD2, DRD3, DRD4; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0110] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are nicotinic receptors, optionally selected from CHRNA4, CHRNA7 and CHRNB2.[OHl] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are 5HT receptors, optionally selected from HTR5 A, HTR6 and GPR26.
[0112] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are dopamine receptors, optionally selected from DRD1, DRD2, DRD3, and DRD4.
[0113] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are GABA receptors, optionally GABRA6.
[0114] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are glutamate receptors, optionally selected from GRM2, GRM4, and SLC1A2.
[0115] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are interleukin- 1 receptor family members, optionally IL1RAPL1.
[0116] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are transcription factors, optionally selected from SOX1, TBR1, and VAX1.
[0117] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter genes are potassium channels, optionally KCNK4.
[0118] In some embodiments, the techniques described herein relate to a biological product, wherein the neurotransmitter gene is PRDM12.
[0119] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and at least one genomic alteration selected from OTX1, OTX2, RSPO2 and WNT3.
[0120] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX1.
[0121] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX2
[0122] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and RSPO2
[0123] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and WNT3.
[0124] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and at least one genomic alteration selected from LHX1, LHX2, RSPO2 and WNT3.
[0125] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX1
[0126] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX2
[0127] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and RSPO2.
[0128] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and WNT3. 44. The biological product, wherein the cells commonly contain genomic alterations in WNT3, and at least one genomic alteration selected from OTX1, OTX2, LHX1, LHX2 and RSPO2.
[0129] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in WNT3 and OTX1.
[0130] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in WNT3 and OTX2.
[0131] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in WNT3 and LHX1.
[0132] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in WNT3 and LHX2.
[0133] In some embodiments, the techniques described herein relate to a biological product, wherein the cells commonly contain genomic alterations in WNT3 and RSPO2. The biological product, wherein the commonly contain genomic alterations are in at least two genes selected from the group: FGF4, FGF8, FGF10, FGFR2, FGFR3, LHX1, LHX2, OTX1, OTX2, RSPO2 and WNT3. The biological product, wherein the alterations are CNS- restricting and body plan restricting. The biological product, wherein the cells have been further engineered to commonly contain a knock-out of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA.
[0134] In some embodiments, the techniques described herein relate to a biological product, wherein the cells have been further engineered to commonly contain a GGTA1 knock out.
[0135] In some embodiments, the techniques described herein relate to a biological product, wherein the cells have been further engineered to commonly contain a CMAH knock out.
[0136] In some embodiments, the techniques described herein relate to a biological product, wherein the cells have been further engineered to commonly contain a B5GALNT2 knockout.
[0137] In some embodiments, the techniques described herein relate to a biological product, wherein the cells have been further engineered to commonly contain a P2M knock-out.
[0138] In some embodiments, the techniques described herein relate to a biological product, wherein the cells have been further engineered to commonly contain a CIITA knock-out.
[0139] In some embodiments, the techniques described herein relate to a cells, wherein the cells are non-human cells.
[0140] In some embodiments, the techniques described herein relate to a non-human cells, wherein the cells have been further engineered to commonly express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
[0141] In some embodiments, the techniques described herein relate to a non-human cells, wherein the cells are from Parvorder Catarrhini.
[0142] In some embodiments, the techniques described herein relate to a non-human cells, wherein the cells are from the Family Suidae.
[0143] In some embodiments, the techniques described herein relate to a cells, wherein the cells form a tissue.
[0144] In some embodiments, the techniques described herein relate to a cells, wherein the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.
[0145] In some embodiments, the techniques described herein relate to a genomic alterations, wherein the genomic alterations reduce the expression and / or function 1-63.
[0146] In some embodiments, the techniques described herein relate to a biological product, wherein the product is grown in an artificial system.
[0147] In some embodiments, the biological product a tissue.6.5.2. Methods for producing an I-FOS biological product
[0148] In some embodiments, the techniques described herein relate to a method for producing a genetically engineered biological product including a plurality of cells cohered in three dimensions, wherein the cells have differentiated from a single cell source into at least two differentiated cell types, and wherein the cells commonly contain a plurality of genomic alterations that are each respectively neuron-depleting and / or neuron disrupting, central nervous system restricting, central nervous system disrupting, and / or body plan restricting, wherein the biological product is a sac encasing at least one organ, the method including: preparing an embryo ex vivo in which the cells have been engineered to commonly contain at least one genomic alteration that is neuronal signal reducing, neuron-depleting and / or neuron disrupting, and implanting the embryo into the uterus of a suitably prepared host surrogate.
[0149] In some embodiments, the techniques described herein relate to a method, further including the subsequent step, after a period of in utero growth and maturation that is less than the full gestational period, of transferring the embryo from host uterus to artificial life support.
[0150] In some embodiments, the techniques described herein relate to a method, further including the subsequent step, after a full gestation in utero, of delivering the full-term animal.
[0151] In some embodiments, the techniques described herein relate to a method or claim 68, further including the later step of sacrificing the animal and harvesting the tissue.
[0152] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2.
[0153] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2 and one or more genes selected from FGF4, FGF8 and FGF10.
[0154] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2 and FGF4.
[0155] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2 and FGF8.
[0156] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2 and FGF10.
[0157] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2 and NDE1.
[0158] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and one or more genes selected from FGF4, FGF8 and FGF10.
[0159] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF4.
[0160] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF8.
[0161] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF10.
[0162] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and DCX.
[0163] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and one or more genes selected from FGF4, FGF8, and FGF10.
[0164] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF4.
[0165] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF8.
[0166] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF10.
[0167] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and DRD2.
[0168] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2 and one or more genes selected from FGF4, FGF8 and FGF10.
[0169] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF4.
[0170] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF8.
[0171] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF10.
[0172] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, one or more genes selected from FGF4, FGF8, FGF10, and at least one neurotransmitter receptor gene.
[0173] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain further genomic alterations made in one or more of the following genes selected from CIT, FOXG1, FTCD, GRIK3, GRIN2A, GRIN2B, MFSD2A, NTRK1, PAFAH1B1 (LISI), RELN, SIX3 and TUBB3.
[0174] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain further genomic alterations made to one or more neurotransmitter genes selected from: nicotinic receptors, optionally CHRNA4, CHRNA7 or CHRNB2; 5HT receptors, optionally HTR5A, HTR6 or GPR26; dopamine receptors, optionally DRD1, DRD2, DRD3, DRD4; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin- 1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
[0175] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are nicotinic receptors, optionally selected from CHRNA4, CHRNA7 and CHRNB2.
[0176] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are 5HT receptors, optionally selected from HTR5 A, HTR6 and GPR26.
[0177] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are dopamine receptors, optionally selected from DRD1, DRD2, DRD3, and DRD4.
[0178] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are GABA receptors, optionally GABRA6.
[0179] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are glutamate receptors, optionally selected from GRM2, GRM4, and SLC1A2.
[0180] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are interleukin-1 receptor family members, optionally IL1RAPL1.
[0181] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are transcription factors, optionally selected from SOX1, TBR1, and VAX1.
[0182] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter genes are potassium channels, optionally KCNK4.
[0183] In some embodiments, the techniques described herein relate to a method, wherein the neurotransmitter gene is PRDM12.
[0184] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and at least one genomic alteration selected from OTX1, OTX2, RSPO2 and WNT3.
[0185] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and OTX1.
[0186] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX2
[0187] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and RSPO2
[0188] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and WNT3.
[0189] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and at least one genomic alteration selected from LHX1, LHX2, RSPO2 and WNT3.
[0190] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX1
[0191] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX2
[0192] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and RSPO2.
[0193] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and WNT3.
[0194] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3, and at least one genomic alteration selected from OTX1, OTX2, LHX1, LHX2 and RSPO2.
[0195] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3 and OTX1.
[0196] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3 and OTX2.
[0197] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3 and LHX1.
[0198] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3 and LHX2.
[0199] In some embodiments, the techniques described herein relate to a method, wherein the cells commonly contain genomic alterations in WNT3 and RSPO2.
[0200] In some embodiments, the techniques described herein relate to a method, wherein the commonly contain genomic alterations are in at least two genes selected from the group: FGF4, FGF8, FGF10, FGFR2, FGFR3, LHX1, LHX2, OTX1, OTX2, RSPO2 and WNT3.
[0201] In some embodiments, the techniques described herein relate to a method, wherein the alterations are CNS-restricting and body plan restricting.
[0202] In some embodiments, the techniques described herein relate to a method, wherein the cells have are further engineered to commonly contain a knock-out of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA.
[0203] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly contain a GGTA1 knock out.
[0204] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly contain a CMAH knock out.
[0205] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly contain a B5GALNT2 knock-out.
[0206] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly contain a P2M knock-out.
[0207] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly contain a CIITA knock-out.
[0208] In some embodiments, the techniques described herein relate to a method, wherein the cells are non-human cells.
[0209] In some embodiments, the techniques described herein relate to a method, wherein the cells have been further engineered to commonly express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
[0210] In some embodiments, the techniques described herein relate to a method, wherein the cells are from Parvorder Catarrhini.
[0211] In some embodiments, the techniques described herein relate to a method, wherein the cells are from the Family Suidae.
[0212] In some embodiments, the techniques described herein relate to a method, wherein the cells form a tissue.
[0213] In some embodiments, the techniques described herein relate to a method, wherein the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.
[0214] In some embodiments, the techniques described herein relate to a method, wherein the genomic alterations reduce the expression and / or function 66-131.
[0215] In some embodiments, the techniques described herein relate to a method, wherein RNA molecules are used to target the selected genes at the single cell stage. In some embodiments, the RNA molecules are used to target the selected genes at a multicellular stage. In some embodiments, the RNA molecules are used to target the selected genes at the blastocyst stage.
[0216] In some embodiments, the techniques described herein relate to a method, wherein RNA molecules are expressed from genomically integrated elements under the control of specific promoter(s).
[0217] In some embodiments, the techniques described herein relate to a method, wherein promoter enables targeted modulation of gene expression to prioritize development of internal organs.
[0218] In some embodiments, the techniques described herein relate to a method, wherein the promoter is able limit development of non-organ and / or undesired structures.
[0219] In some embodiments, the techniques described herein relate to a method, wherein the RNA molecules are RNA interference (RNAi) constructs.
[0220] In some embodiments, the techniques described herein relate to a method, wherein the RNAi construct targets OTX1, OTX2, FGF4, and / or FGF8.
[0221] In some embodiments, the techniques described herein relate to a method, wherein the RNAi construct is driven by a selective promoter promoting the development of non-targeted internal organ systems.
[0222] In some embodiments, the techniques described herein relate to a method, wherein the selective promoter is selected from FOXG1, PRRX1 or SOX2.
[0223] In some embodiments, the techniques described herein relate to a method, wherein the promoter elements governing OTX1 and / or OTX2 RNAi expression are FOXG1 or FOXG2 related.
[0224] In some embodiments, the techniques described herein relate to a method, wherein an OTX2 related enhancer element is paired with the FOXG1 promoter element.
[0225] In some embodiments, the techniques described herein relate to a method wherein the promoter elements governing OTX1 and / or OTX2 RNAi expression are SOX2 or SOX2 related.
[0226] In some embodiments, the techniques described herein relate to a method wherein an OTX2 related enhancer element is paired with the SOX2 related promoter element.
[0227] In some embodiments, the techniques described herein relate to a method, wherein additional genomically integrated RNAi elements are targeting FGF8 and / or FGF4.
[0228] In some embodiments, the techniques described herein relate to a method, wherein the additional genomically integrated RNAi elements are expressed via a PRRX1 promoter.
[0229] In some embodiments, the techniques described herein relate to a method, wherein a PRRX1 promoter drives RNAi constructs that selectively downregulate posterior developmental pathways through targeting one or more of FGF4, FGF8, and related genes including FGF9, FGF10, FGF17, and / or Tbx5.
[0230] In some embodiments, the techniques described herein relate to a method, wherein one or more compensatory anterior development genes are further targeted with RNAi or genomic knockout.
[0231] In some embodiments, the techniques described herein relate to a method, wherein the compensatory anterior development genes are PAX6, LHX1, and EMX2.
[0232] In some embodiments, the techniques described herein relate to a method, wherein genetic integration of RNAi constructs is performed at safe harbor loci, such as Rosa26, ensuring consistent gene expression and stable organ-specific development throughout the bio-organ unit's formation.
[0233] In some embodiments, the techniques described herein relate to a method, wherein the bio-organ unit is created using mammalian cells, including human and human-compatible cells, to generate fully functional organs suitable for transplantation.
[0234] In some embodiments, the techniques described herein relate to a method, wherein the bio-organ unit genome begins the process of embryonic development through a method that does not involve natural fertilization, for example from a modified cell or cells selected from a stem cell colony.
[0235] In some embodiments, the techniques described herein relate to a method wherein the disruption of targeted genes is mediated via the Cre-LoxP system which is activated by the disclosed tissue specific promoters.
[0236] In some embodiments, the techniques described herein relate to a method wherein the disruption of targeted genes is mediated via any other commonly known inducible system which is activated by the disclosed tissue specific promoters.
[0237] In some embodiments, the techniques described herein relate to a method wherein the disruption of targeted genes is mediated via any other commonly known inducible system which is activated by an exogenous element.6.6. Other interpretational conventions
[0238] Ranges: throughout this disclosure, various aspects of the invention are presented in a range format. Ranges include the recited endpoints. It should be understood that thedescription in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6, should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc. as well as individual number within that range, for example, 1, 2, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0239] In this disclosure, “comprises”, “comprising”, “containing”, “having”, “includes”, “including” and linguistic variants thereof have the meaning ascribed to them in U.S. Patent law, permitting the presence of additional components beyond those explicitly recited.
[0240] Unless specifically stated or apparent from context, as used herein the term “or” is understood to be inclusive.
[0241] Unless specifically stated or apparent from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural. That is, the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0242] Unless specifically stated or otherwise apparent from context, as used herein the term “about” is understood as within range of normal tolerance in the art. Unless otherwise specified, “about” intends ±10% of the stated value. Where a percentage is provided with respect to an amount of a component or material in a composition, the percentage should be understood to be a percentage based on weight, unless otherwise stated or understood from the context.7. EXAMPLES7.1. I-FOS genome editing
[0243] This example demonstrates the methodology in which the successful editing of select genes in I-FOS using the Cas9 nuclease system was performed. Protospacer adjacent motifs (PAM) site recognition by Cas9 nucleases is notably essential for the exploitation as effective genome editing tools and are provided as well as guide RNA (gRNA) target, gRNAsequences, and polymerase chain reaction (PCR) primers used in the exploitation of Cas9 nuclease system for each gene target. Tables 1 - 41.7.1.1. Materials and methods
[0244] Guide RNAs (gRNAs) were incubated together in various combinations for a minimum of 30 minutes with CAS9 in OPTI-MEM. The resulting ribonucleoparticles (RNPs) were electroporated into mouse zygotes at their pronuclear stage using an ECM830 square electroporator. Typically, this was performed at a voltage of 30V, using 5 pulses, a pulse length of 3 minutes, at an interval of 100 milliseconds (ms).Gene: NDEGene: MFSD2aGene: GRIN2BGene: DCXGene: I11RAPL1Gene: CHRNB2Gene: LHX1Gene: LHX2Gene: OTX1Gene: OTX2Gene: HTR6Gene: CHRNA71= Control 2=OTX1, OTX2, NDE 3=LHX1, LHX2, GRIN2B 4= HTR6, NDE1, MFSD2A 5=LHX1, OTX2, MFSD2A, GRIN2B 6=GRIN2B, MFSD2A, LHX17=I11RAPL1, CHRNA7Gene: FGF10Validated phenotypicallyGene: DRD2Single strand.7.1.1. Results: Confirmation of gene knockouts (KO)
[0245] Table 37 showed the result of a large scale screening of gene knockouts in mouse embryos. FIG. 9 showed a microscopy image of group 4 at 96 hours from table 37 as an example of how these counts were done with red dots on what we count as a healthy blastocyst. We employed CRISPR-Cas9 technology to knockout specific genes in mouse embryos. Applicants investigated the effects of the knockouts on embryonic development, viability, and ability for the embryos to form viable feti. Seven different conditions were tested, each targeting a unique combination of genes. The embryos were observed for developmental progress, with a particular focus on the hatching blastocyst stage.
[0246] The results showed that all treated embryos exhibited a developmental delay, which is common with embryos subjected to CRISPR and electroporation. Despite this delay, most conditions resulted in normal-looking, hatching blastocysts, except for Condition 5, which only had 5.88%.
[0247] Condition 5 (LHX1, OTX2, MFSD2A, GRIN2B): This involved the largest number of guide RNAs targeting the most genes. It showed a significant deviation from the expected developmental progression. This condition resulted in a marked reduction in the number of normal, hatching blastocysts. The complexity of targeting multiple genes simultaneously may have contributed to this outcome.
[0248] Results indicated that many embryos are progressing through normal development. This suggests that, despite the initial developmental delay, the CRISPR-induced gene knockouts do not entirely impede fetal development and produce plenty of viable embryos.
[0249] Control: As expected, the control embryos developed normally without any genetic alterations with very high rates of blastocyst formation and hatching.
[0250] Condition 2 (OTX1, OTX2, NDE): Embryos reduced blastocyst formation relative to control, but still more than sufficient to produce many viable fetuses if they were to be implanted.
[0251] Condition 3 (LHX1, LHX2, GRIN2B): Embryos reduced blastocyst formation relative to control, but still more than sufficient to produce many viable fetuses if they were to be implanted.
[0252] Condition 4 (HTR6, NDE1, MFSD2A): Embryos reduced blastocyst formation relative to control, but higher than condition 2 and 3 and very sufficient to produce many viable fetuses if they were to be implanted. Fig. 9 showed a microscopy image at 96 hours as an example of this condition
[0253] Condition 6 (GRIN2B, MFSD2A, LHX1): Embryos reduced blastocyst formation relative to control, but still more than sufficient to produce many viable fetuses if they were to be implanted.
[0254] Condition 7 (I11RAPL1, CHRNA7): This had a comparable proportion of normal development relative to other conditions and to control and we demonstrated fetal development and CNS impairment in fig 3 using this condition.
[0255] Table 37 demonstrated that CRISPR-Cas9 technology can be used to knockout multiple genes in mouse embryos critical to central nervous system development, and that these embryos, despite initial developmental delays, can progress blastocyst development and hatching. In combination with figures 1, 2, and 3 where we demonstrated KO combinations progressing all the way to late fetal stage and showing clear CNS impairment as predicted (condition 7 of table 37 is found in fig 3 demonstrating these conditions develop which was PCR verified as a double KO of I11RAPL1, CHRNA7), these data demonstrate that our gene combinations can both develop normally, and impair CNS development. The data collected thus far indicate that the majority of conditions result in normal-looking, hatching blastocysts that given that they lack critical CNS development genes will develop with CNS deficits like those shown in FIGs. 1 A-1D, 2, and 3A-3H.
[0256] Condition 5's more complex gene targeting highlights the potential challenges and effects of multi-gene knockouts but it does still have a smaller percentage of viable blastocysts.7.1.2. Results: Confirmation of gene knockouts (KO)
[0257] Gene knockouts were subsequently confirmed via histological studies (FIG. 1-3) and PCR results (FIG. 6-8)
[0258] Comparative Histological Analysis of Genetically Modified and Wild TypeEmbryonic Mouse CNSs
[0259] The results displayed in FIG 1A-1D presented a histological comparison between a genetically modified embryo and its wild type counterpart from the same litter, both of which were implanted simultaneously in the recipient female. The left panels depicted the genetically modified embryo, while the right panels featured the wild type embryo. More specifically, FIG. 1 A showcased the whole CNS of the genetically modified embryo, where genes NDE1 and DCX had been inactivated using CRISPR technology. This panel highlighted significant morphological differences, including dysmorphic features and areas of active degeneration in the cortex and other CNS regions, as indicated by arrows. Notably, there was a pronounced enlargement of the ventricles and a developmental abnormality characterized by the ventricles' failure to separate properly at this developmental stage. The cerebellum did not appear to be in the process of formation at all. FIG. IB showed a magnified view of the cerebral cortex in the genetically modified embryo. This detailed view underscored the extent of cortical anomalies and degenerative changes, and further complemented the observations of ventricular enlargement and malformation. FIG. 1C showed the whole brain of the wild type sibling embryo at a similar developmental stage for comparison. The morphology, particularly the ventricular structure and overall CNS architecture, contrasted sharply with that of the genetically modified embryo, where enlarged ventricles and a failure of ventricular separation were observed. FIG. ID provided an enlarged view of the cerebral cortex in the wild type embryo, illustrating normal cortical development. This panel served as a control, demonstrating the typical cortical structure absent in the genetically modified counterpart.7.1.3. Whole Mouse embryo visualization of the genetically modified embryo at embryonic day 14 (E14)
[0260] The results displayed in FIG. 2 captured the entire embryo at embryonic day 14 (E14). Notably, despite the pronounced cerebral modifications as detailed above and in FIG. 1 A-1D, the external morphology of the embryo appears unremarkable and is consistent with typical developmental milestones for this stage. A key finding at the time of harvest was the presence of an active heartbeat. This indicated embryonic vitality. This observation was significant as it highlighted the localized nature of the cerebral changes, with no evident impact on the embryo's overall viability.
[0261] It is important to emphasize that the genetic modifications primarily affected the CNS development, as extensively analyzed in FIG 1 A-1D. This figure underscored the contrastbetween the extensive CNS abnormalities and the otherwise normal external development of the embryo. It illustrated that profound internal changes in CNS morphology may not be externally visible at this developmental stage.
[0262] Notably, despite significant cerebral abnormalities in the genetically modified embryo, its overall embryonic development was grossly normal including an active heartbeat and the unremarkable appearance of other major organs at the time of harvest. FIG. 2.7.1.4. Detailed Immunohistochemical Analysis of IL1RAPL1 and CHRNA7 in Genetically Modified and Wild Type E14 Mouse CNSs
[0263] Results indicated that the immunohistochemical comparison between a genetically modified embryo with targeted knockouts of IL1RAPL1 and CHRNA7. FIG. 3 underscored the significant impact of IL1RAPL1, CHRNB2 and CHRNA7 knockouts on CNS morphology and function. FIG. 3A-3H. The combination of these 3 knockouts significantly altered CNS structure. Basic CNS structure and development was compromised.Acetylcholine signaling was also disrupted. As a result, CNS function and cognition was expected to be profoundly affected, other tissues and organ development were not significantly compromised.
[0264] PCR results showed that multiple combinations of knockouts can still result in the production of fetuses with the potential to develop to late term (FIG. 6-8). Histological results show both expression deficits and structural abnormalities in animals confirmed with knockout variants of the targeted genes.7.1.5. Implantation of KO Mouse embryos in recipient targets
[0265] The resulting knockout (KO) embryos were group cultured in groups sizing between 20 and 120 for 72 to 96 hours, in Embryomax® KSOM culture medium or similarly supportive mouse embryo culture media under mineral oil in an incubator at 37.0° C and 5% CO2. Conditions were adjusted to maintain a pH between 7.2 and 7.4.
[0266] Embryos at the blastocyst stage were transferred into roughly 2.5DPC pseudopregnant female CD1 (ARC) mice with an implantation target weight of approximately 30g. Recipient mouse target age was >8 full weeks of age. Synchronization was induced with either 2.5IU pregnant mare serum gonadotropin (PMSG) followed by 2.5IU - 5IU human chorionic gonadotropin (HCG) 48 hours later or 50 pl hyperova followed by 5IU HCG 48 hours later.Approximately 7 hours following HCG administration, pseudopregnancy was induced in properly cycled females via mechanical and vibration-based stimulation by inserting a smooth plastic rod into the vagina for 30 seconds, which could be contacted with an electric toothbrush module or trimmer.
[0267] The embryos were then transferred directly into the uterus of the recipient females at the receptive stage 2.5 days later directly through the vagina, non-surgically, using a nonsurgical embryo transfer (NSET) device (Paratechs). FIG. 6 and FIG. 7 represent the methods used to process the histological images referenced below. All wild type and knockout embryos compared with each other underwent identical processing.7.1.6. Implications of Combined Genetic Knockouts on Cognition in Animal Models
[0268] The data presented in FIG. 1 A - 3H offered compelling evidence of the profound effects of specific genetic knockouts on CNS development and, by extension, on overall cognition in mice. These figures collectively demonstrated that the combined knockouts of CNS-related and specific genes had more significant impacts than single-gene alterations.
[0269] In FIG. 1 A-1D, we observed the cerebral changes in mouse embryos with CRISPR- mediated knockouts of NDE1 and DCX genes. The dysmorphology of the CNS, particularly the enlargement of ventricles and the failure of ventricular separation, pointed towards significant developmental disruptions. These structural anomalies, especially in regions critical for cognitive processes, suggested a potential for substantial cognitive deficits in these animals.
[0270] FIG. 2 complemented these findings by showing that, despite profound internal CNS changes, the overall embryonic development appeared grossly normal. This observation was critical as it underscored the specificity of genetic modifications in affecting CNS development while leaving other developmental processes relatively unaffected. Organs and tissues remained functional and intact.
[0271] FIG. 3A-3H illustrated the effects of knocking out IL1RAPL1 and CHRNA7. The absence of IL1RAPL1 and CHRNA7 expression in the knockout models, as evidenced by the distinct staining patterns, highlighted the crucial roles these genes play in normal CNS function. Given the known associations of IL1RAPL1 with mental retardation and CHRNA7with neuronal acetylcholine receptor function, their absence strongly indicates potential impairments in cognitive abilities. The failure of CHRNB2 staining, while not visually documented, added another layer to our understanding of the complex gene interactions influencing CNS development.
[0272] Collectively, these results suggested that the combined effect of multiple gene knockouts on CNS morphology and function is greater than the sum of individual knockouts. This synergistic impact was particularly evident in the areas critical for cognition, implying that animals with these genetic modifications were likely to experience significant and profound cognitive deficiencies.7.1.7. Organ development in KO mice fetus I
[0273] In our exploration of the developmental impacts of genetic modifications, a particularly intriguing observation was the grossly normal development of organs and tissues, despite significant aberrations in CNS morphology and function. FIG. 2 demonstrated this phenomenon, showcasing an E14 embryo with a distinct active heartbeat, an indicator of overall embryonic vitality, despite the profound cerebral abnormalities induced by genetic knockouts, as detailed in FIG. 1 A-1B of this animal. This finding was remarkable in that it suggested a degree of developmental compartmentalization, where severe genetic alterations could lead to specific CNS malformations without disrupting the general developmental trajectory of other organs and tissues. The presence of a normal heartbeat, alongside typical morphological features in major organs, reinforced this notion. It also raised intriguing questions about the resilience and adaptability of embryonic development in the face of targeted genetic disruptions, particularly those affecting CNS development. Such observations, juxtaposing the CNS changes and greatly retarded CNS growth from FIG. 1 A- 1D and FIG. 3 A-3H against the otherwise unremarkable overall development in Figure 2, indicate complex interplay between genetic regulation, organ specificity, and developmental robustness.7.1.8. Organ development in KO mice fetus II
[0274] Mouse zygotes that were treated using CRISPR to alter genes OTX2, FGF10 showed show profound lack of development of craniofacial anatomy as well as profound loss of central nervous system (CNS) development and limb development. FIG. 11.
[0275] Histological studies confirmed that OTX2 and FGF10 knockouts showed profound lack of development of craniofacial anatomy as well as profound loss of CNS development, and limb development. FIG. 12A-12B.
[0276] Zygote mice where genes DCX, NDE1, OTX2, FGF10, and DRD2 were altered and then implanted in recipient females and allowed to develop until day 17, also showed lack of development compared to a wild-type litter mate (FIG. 13, left-side IFOS mouse; right side, wild-type).
[0277] Also, hematoxylin and eosin (H&E) stained histological slides further confirmed a significant lack of development of craniofacial anatomy as well as profound loss of CNS development, and limb development observed in FIG. 13. FIG. 14A is the stain for the wildtype animal and FIG. 14B is the stain for KO IFOS mouse. Note that lack of CNS development for the DCX, NDE1, OTX2, FGF10, and DRD2 KOs is far greater than the lack of development observed for the OTX2 and FGF10 KO. FIG. 14B and FIG. 12B.8. EQUIVALENTS AND INCORPORATION BY REFERENCE
[0279] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it will be understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.
[0280] U.S. Provisional Application No. 63 / 660,445, filed on June 14, 2024, U.S. Provisional Application No. 63 / 709,974, filed on October 21, 2024, and U.S. Provisional Application No. 63 / 744,831, filed on January 13, 2025, are hereby incorporated in their entireties by reference for all purposes.
Claims
1. WHAT IS CLAIMED IS:
1. A genetically engineered biological product comprising a plurality of cells cohered in three dimensions, wherein the cells have differentiated from a single cell source into at least two differentiated cell types, and wherein the cells commonly contain a plurality of genomic alterations that are each respectively neuron-depleting and / or neuron disrupting, central nervous system restricting, central nervous system disrupting, and / or body plan restricting, wherein the biological product is a sac encasing at least one organ.
2. The biological product of claim 1, wherein the cells commonly contain genomic alterations in 0TX2.
3. The biological product of claim 2, wherein the cells commonly contain genomic alterations in 0TX2 and one or more genes selected from FGF4, FGF8 and FGF10.
4. The biological product of claim 3, wherein the cells commonly contain genomic alterations in 0TX2 and FGF4.
5. The biological product of claim 3, wherein the cells commonly contain genomic alterations in 0TX2 and FGF8.
6. The biological product of claim 3, wherein the cells commonly contain genomic alterations in 0TX2 and FGF10.
7. The biological product of claim 2, wherein the cells commonly contain genomic alterations in 0TX2 and NDE1.
8. The biological product of claim 7, wherein the cells commonly contain genomic alterations in 0TX2, NDE1, and one or more genes selected from FGF4, FGF8 and FGF10.
9. The biological product of claim 8, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF4.
10. The biological product of claim 8, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF8.
11. The biological product of claim 8, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF10.
12. The biological product of claim 7, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and DCX.
13. The biological product of claim 12, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and one or more genes selected from FGF4, FGF8, and FGF10.
14. The biological product of claim 13, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF4.
15. The biological product of claim 13, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF8.
16. The biological product of claim 13, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF10.
17. IThe biological product of claim 12, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and DRD2.
18. The biological product of claim 17, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2 and one or more genes selected from FGF4, FGF8 and FGFlO.
19. The biological product of claim 18, wherein the cells commonly contain genomic alterations in 0TX2, NDE1, DCX, DRD2, and FGF4.
20. The biological product of claim 18, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF8.
21. The biological product of claim 18, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF10.
22. The biological product of claim 18, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, one or more genes selected from FGF4, FGF8, FGF10, and at least one neurotransmitter receptor gene.
23. The biological product of any one of claims 2-22, wherein the cells commonly contain further genomic alterations made in one or more of the following genes selected from CIT, FOXG1, FTCD, GRIK3, GRIN2A, GRIN2B, MFSD2A, NTRK1, PAFAH1B1 (LISI), RELN, SIX3 and TUBB3.
24. The biological product of any one of claims 2-23, wherein the cells commonly contain further genomic alterations made to one or more neurotransmitter genes selected from: nicotinic receptors, optionally CHRNA4, CHRNA7 or CHRNB2; 5HT receptors, optionally HTR5A, HTR6 or GPR26; dopamine receptors, optionally DRD1, DRD2, DRD3, DRD4; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
25. The biological product of claim 24, wherein the neurotransmitter genes are nicotinic receptors, optionally selected from CHRNA4, CHRNA7 and CHRNB2.
26. The biological product of claim 24, wherein the neurotransmitter genes are 5HT receptors, optionally selected from HTR5A, HTR6 and GPR26.
27. The biological product of claim 24, wherein the neurotransmitter genes are dopamine receptors, optionally selected from DRD1, DRD2, DRD3, and DRD4.
28. The biological product of claim 24, wherein the neurotransmitter genes are GABA receptors, optionally GABRA6.
29. The biological product of claim 24, wherein the neurotransmitter genes are glutamate receptors, optionally selected from GRM2, GRM4, and SLC1A2.
30. The biological product of claim 24, wherein the neurotransmitter genes are interleukin-1 receptor family members, optionally IL1RAPL1.
31. The biological product of claim 24, wherein the neurotransmitter genes are transcription factors, optionally selected from SOX1, TBR1, and VAX1.
32. The biological product of claim 24, wherein the neurotransmitter genes are potassium channels, optionally KCNK4.
33. The biological product of claim 24, wherein the neurotransmitter gene is PRDM12.
34. The biological product of claim 1, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and at least one genomic alteration selected from OTX1, OTX2, RSPO2 and WNT3.
35. The biological product of claim 34, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX1.
36. The biological product of claim 34, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX237. The biological product of claim 34, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and RSPO238. The biological product of claim 34, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and WNT3.
39. The biological product of claim 1, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and at least one genomic alteration selected from LHX1, LHX2, RSPO2 and WNT3.
40. The biological product of claim 39, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX141. The biological product of claim 39, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX242. The biological product of claim 39, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and RSPO2.
43. The biological product of claim 39, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and WNT3.
44. The biological product of claim 1, wherein the cells commonly contain genomic alterations in WNT3, and at least one genomic alteration selected from OTX1, OTX2, LHX1, LHX2 and RSPO2.
45. The biological product of claim 44, wherein the cells commonly contain genomic alterations in WNT3 and OTX1.
46. The biological product of claim 44, wherein the cells commonly contain genomic alterations in WNT3 and OTX2.
47. The biological product of claim 44, wherein the cells commonly contain genomic alterations in WNT3 and LHX1.
48. The biological product of claim 44, wherein the cells commonly contain genomic alterations in WNT3 and LHX2.
49. The biological product of claim 44, wherein the cells commonly contain genomic alterations in WNT3 and RSPO2.
50. The biological product of claim 1, wherein the commonly contain genomic alterations are in at least two genes selected from the group: FGF4, FGF8, FGF10, FGFR2, FGFR3, LHX1, LHX2, OTX1, OTX2, RSPO2 and WNT3.
51. The biological product of claim 50, wherein the alterations are CNS-restricting and body plan restricting.
52. The biological product of any one of claims 1-51, wherein the cells have been further engineered to commonly contain a knock-out of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA.
53. The biological product of claim 52, wherein the cells have been further engineered to commonly contain a GGTA1 knock out.
54. The biological product of claim 52, wherein the cells have been further engineered to commonly contain a CMAH knock out.
55. The biological product of claim 52, wherein the cells have been further engineered to commonly contain a B5GALNT2 knock-out.
56. The biological product of claim 52, wherein the cells have been further engineered to commonly contain a P2M knock-out.
57. The biological product of claim 52, wherein the cells have been further engineered to commonly contain a CIITA knock-out.
58. The cells of any one of claims 1-57, wherein the cells are non-human cells.
59. The non-human cells of claim 58, wherein the cells have been further engineered to commonly express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
60. The non-human cells of claim 58 or 59, wherein the cells are from Parvorder Catarrhini.
61. The non-human cells of claim 58 or 59, wherein the cells are from the Family Suidae.
62. The cells of any one of claims 1-61, wherein the cells form a tissue.
63. The cells of claim 62, wherein the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.
64. The genomic alterations of any one of claims 1-63, wherein the genomic alterations reduce the expression and / or function of the genes of claims 1-63.
65. The biological product of any one of claims 1-64, wherein the product is grown in an artificial system.
66. A method for producing a genetically engineered biological product comprising a plurality of cells cohered in three dimensions, wherein the cells have differentiated from a single cell source into at least two differentiated cell types, and wherein the cells commonly contain a plurality of genomic alterations that are each respectively neuron-depleting and / or neuron disrupting, central nervous system restricting, central nervous system disrupting, and / or body plan restricting, wherein the biological product is a sac encasing at least one organ, the method comprising: preparing an embryo ex vivo in which the cells have been engineered to commonly contain at least one genomic alteration that is neuronal signal reducing, neuron-depleting and / or neuron disrupting, and implanting the embryo into the uterus of a suitably prepared host surrogate.
67. The method of claim 66, further comprising the subsequent step, after a period of in utero growth and maturation that is less than the full gestational period, of transferring the embryo from host uterus to artificial life support.
68. The method of claim 67, further comprising the subsequent step, after a full gestation in utero, of delivering the full-term animal.
69. The method of claim 67 or claim 68, further comprising the later step of sacrificing the animal and harvesting the tissue.
70. The method of any one of claims 66-69, wherein the cells commonly contain genomic alterations in OTX2.
71. The method of claim 70, wherein the cells commonly contain genomic alterations in OTX2 and one or more genes selected from FGF4, FGF8 and FGF10.
72. The method of claim 71, wherein the cells commonly contain genomic alterations inOTX2 and FGF4.
73. The method of claim 71, wherein the cells commonly contain genomic alterations in OTX2 and FGF8.
74. The method of claim 71, wherein the cells commonly contain genomic alterations in OTX2 and FGF10.
75. The method of claim 70, wherein the cells commonly contain genomic alterations in OTX2 and NDE1.
76. The method of claim 75, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and one or more genes selected from FGF4, FGF8 and FGF10.
77. The method of claim 76, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF4.
78. The method of claim 76, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGF8.
79. The method of claim 76, wherein the cells commonly contain genomic alterations in OTX2, NDE1 and FGFlO.
80. The method of claim 75, wherein the cells commonly contain genomic alterations in OTX2, NDE1, and DCX.
81. The method of claim 80, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and one or more genes selected from FGF4, FGF8, and FGF10.
82. The method of claim 81, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF4.
83. The method of claim 81, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF8.
84. The method of claim 81, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and FGF10.
85. The method of claim 80, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, and DRD2.
86. The method of claim 85, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2 and one or more genes selected from FGF4, FGF8 and FGF10.
87. The method of claim 86, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF4.
88. The method of claim 86, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF8.
89. The method of claim 86, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, and FGF10.
90. The method of claim 86, wherein the cells commonly contain genomic alterations in OTX2, NDE1, DCX, DRD2, one or more genes selected from FGF4, FGF8, FGF10, and at least one neurotransmitter receptor gene.
91. The method of any one of claims 70-90, wherein the cells commonly contain further genomic alterations made in one or more of the following genes selected from CIT, FOXG1, FTCD, GRIK3, GRIN2A, GRIN2B, MFSD2A, NTRK1, PAFAH1B1 (LISI), RELN, SIX3 and TUBB3.
92. The method of any one of claims 70-91, wherein the cells commonly contain further genomic alterations made to one or more neurotransmitter genes selected from: nicotinic receptors, optionally CHRNA4, CHRNA7 or CHRNB2; 5HT receptors, optionally HTR5A,HTR6 or GPR26; dopamine receptors, optionally DRD1, DRD2, DRD3, DRD4; GABA receptors, optionally GABRA6; glutamate receptors, optionally GRM2, GRM4, or SLC1A2; interleukin-1 receptor family members, optionally IL1RAPL1; transcription factors, optionally SOX1, TBR1, or VAX1; potassium channels, optionally KCNK4; and PRDM12.
93. The method of claim 92, wherein the neurotransmitter genes are nicotinic receptors, optionally selected from CHRNA4, CHRNA7 and CHRNB2.
94. The method of claim 92, wherein the neurotransmitter genes are 5HT receptors, optionally selected from HTR5A, HTR6 and GPR26.
95. The method of claim 92, wherein the neurotransmitter genes are dopamine receptors, optionally selected from DRD1, DRD2, DRD3, and DRD4.
96. The method of claim 92, wherein the neurotransmitter genes are GABA receptors, optionally GABRA6.
97. The method of claim 92, wherein the neurotransmitter genes are glutamate receptors, optionally selected from GRM2, GRM4, and SLC1A2.
98. The method of claim 92, wherein the neurotransmitter genes are interleukin- 1 receptor family members, optionally IL1RAPL1.
99. The method of claim 92, wherein the neurotransmitter genes are transcription factors, optionally selected from SOX1, TBR1, and VAX1.
100. The method of claim 92, wherein the neurotransmitter genes are potassium channels, optionally KCNK4.
101. The method of claim 92, wherein the neurotransmitter gene is PRDM12.
102. The method of claim 66, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and at least one genomic alteration selected from OTX1, OTX2, RSPO2 and WNT3.
103. The method of claim 102, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and OTX1.
104. The method of claim 102, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and OTX2105. The method of claim 102, wherein the cells commonly contain genomic alterations in of both LHX1 and LHX2, and RSPO2106. The method of claim 102, wherein the cells commonly contain genomic alterations in both LHX1 and LHX2, and WNT3.
107. The method of claim 66, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and at least one genomic alteration selected from LHX1, LHX2, RSPO2 and WNT3.
108. The method of claim 107, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX1109. The method of claim 107, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and LHX2110. The method of claim 107, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and RSPO2.
111. The method of claim 107, wherein the cells commonly contain genomic alterations in both OTX1 and OTX2, and WNT3.
112. The method of claim 66, wherein the cells commonly contain genomic alterations in WNT3, and at least one genomic alteration selected from OTX1, OTX2, LHX1, LHX2 and RSPO2.
113. The method of claim 112, wherein the cells commonly contain genomic alterations in WNT3 and OTX1.
114. The method of claim 112, wherein the cells commonly contain genomic alterations in WNT3 and OTX2.
115. The method of claim 112, wherein the cells commonly contain genomic alterations in WNT3 and LHX1.
116. The method of claim 112, wherein the cells commonly contain genomic alterations in WNT3 and LHX2.
117. The method of claim 112, wherein the cells commonly contain genomic alterations in WNT3 and RSPO2.
118. The method of claim 66, wherein the commonly contain genomic alterations are in at least two genes selected from the group: FGF4, FGF8, FGF10, FGFR2, FGFR3, LHX1, LHX2, OTX1, OTX2, RSPO2 and WNT3.
119. The method of claim 118, wherein the alterations are CNS-restricting and body plan restricting.
120. The method of any one of claims 66-119, wherein the cells have are further engineered to commonly contain a knock-out of at least one gene selected from GGTA1, CMAH, B5GALNT2, P2M, and CIITA.
121. The method of claim 120, wherein the cells have been further engineered to commonly contain a GGTA1 knock out.
122. The method of claim 120, wherein the cells have been further engineered to commonly contain a CMAH knock out.
123. The method of claim 120, wherein the cells have been further engineered to commonly contain a B5GALNT2 knock-out.
124. The method of claim 120, wherein the cells have been further engineered to commonly contain a P2M knock-out.
125. The method of claim 120, wherein the cells have been further engineered to commonly contain a CIITA knock-out.
126. The method of any one of claims 66-125, wherein the cells are non-human cells.
127. The method of claim 126, wherein the cells have been further engineered to commonly express at least one human transgene selected from CD39, CD46, CD47, CD55, EPCR, TFPI, THBD, HO-1, vWF, and HLA-E.
128. The method of claim 126 or 127, wherein the cells are from Parvorder Catarrhini.
129. The method of claim 126 or 127, wherein the cells are from the Family Suidae.
130. The method of any one of claims 66-129, wherein the cells form a tissue.
131. The method of claim 130, wherein the tissue is cartilage, cardiac valve, heart, kidney, pancreatic islets, or lung.
132. The method of any one of claims 66-131, wherein the genomic alterations reduce the expression and / or function of the genes of claims 66-131.
133. The method of any one of claims 66-132, wherein RNA molecules are used to target the selected genes at the single cell stage.
134. The method of claim 133, wherein RNA molecules are expressed from genomically integrated elements under the control of specific promoter(s).
135. The method of claim 134, wherein promoter enables targeted modulation of gene expression to prioritize development of internal organs.
136. The method of claim 135, wherein the promoter is able limit development of nonorgan and / or undesired structures.
137. The method of any one of claims 133-136, wherein the RNA molecules are RNA interference (RNAi) constructs.
138. The method of claim 137, wherein the RNAi construct targets OTX1, OTX2, FGF4, and / or F GF 8.
139. The method of claim 138, wherein the RNAi construct is driven by a selective promoter promoting the development of non-targeted internal organ systems.
140. The method of claim 139, wherein the selective promoter is selected from FOXG1, PRRX1 or SOX2.
141. The method of claim 139 or 140, wherein the promoter elements governing OTX1 and / or OTX2 RNAi expression are FOXG1 or FOXG2 related.
142. The method of claim 141, wherein an OTX2 related enhancer element is paired with the FOXG1 promoter element.
143. The method of claim 139 wherein the promoter elements governing OTX1 and / or OTX2 RNAi expression are SOX2 or SOX2 related.
144. The method of claim 143 wherein an OTX2 related enhancer element is paired with the SOX2 related promoter element.
145. The method of any one of claims 137-144, wherein additional genomically integrated RNAi elements are targeting FGF8 and / or FGF4.
146. The method of claim 145, wherein the additional genomically integrated RNAi elements are expressed via a PRRX1 promoter.
147. The method of claim 136, wherein a PRRX1 promoter drives RNAi constructs that selectively downregulate posterior developmental pathways through targeting one or more of FGF4, FGF8, and related genes including FGF9, FGF10, FGF17, and / or Tbx5.
148. The method of any one of claims 140-147, wherein one or more compensatory anterior development genes are further targeted with RNAi or genomic knockout.
149. The method of claim 148, wherein the compensatory anterior development genes are PAX6, LHX1, and EMX2.
150. The method of any one of claims 136-149, wherein genetic integration of RNAi constructs is performed at safe harbor loci, such as Rosa26, ensuring consistent gene expression and stable organ-specific development throughout the bio-organ unit's formation.
151. The method of any one of claim 66-150, wherein the bio-organ unit is created using mammalian cells, including human and human-compatible cells, to generate fully functional organs suitable for transplantation.
152. The method of any one of claims 66-151, wherein the bio-organ unit genome begins the process of embryonic development through a method that does not involve natural fertilization, for example from a modified cell or cells selected from a stem cell colony.
153. The method of any one of claims 66-152 wherein the disruption of targeted genes is mediated via the Cre-LoxP system which is activated by the disclosed tissue specific promoters.
154. The method of any one of claims 66-153 wherein the disruption of targeted genes is mediated via any other commonly known inducible system which is activated by the disclosed tissue specific promoters.
155. The method of any one of claims 66-153 wherein the disruption of targeted genes is mediated via any other commonly known inducible system which is activated by an exogenous element.
Citation Information
Patent Citations
Application of pluripotent stem cells having modified differential potential to producing animals
EP3696266A1
Ethical tissues for transplantation
WO2024151682A1
Ethical tissues for transplantation
WO2024259382A1
US202463660445P
US202463709974P