Use of ltvcx1-1 protein and ltvcx1-1 protein coding gene in regulating pathogenicity and stress resistance of lasiodiplodia theobromae

By knocking out the gene encoding the Ltvcx1-1 protein of Diplostomum cocovenenans, its pathogenicity and resistance to adverse conditions are reduced, thus solving the problem of the weak pathogenic mechanism of Diplostomum cocovenenans and realizing the theoretical basis for disease control and the development of pesticides.

WO2026040503A1PCT designated stage Publication Date: 2026-02-26GUIZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/095054
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-23
Filing Date
2025-05-15
Publication Date
2026-02-26

AI Technical Summary

Technical Problem

Current research on the pathogenic molecular biology of Diplostomum cocovenenans is relatively weak, and there is a lack of reports on the pathogenic mechanism, making it difficult to effectively control the damage caused by this disease and to breed disease-resistant varieties.

Method used

By knocking out the gene encoding the Ltvcx1-1 protein of Diplostomum cocovenenans, its pathogenicity, cell membrane integrity, and stress resistance are reduced. Antifungal drugs are designed using the Ltvcx1-1 protein as a target, and transgenic Diplostomum cocovenenans with reduced pathogenicity are bred.

Benefits of technology

It significantly reduced the pathogenicity and stress resistance of Diplocotomyces cocovenenans, providing a theoretical basis for disease control and a target for drug development, and has broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025095054_26022026_PF_FP_ABST
    Figure CN2025095054_26022026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed is a use of an Ltvcx1-1 protein and an Ltvcx1-1 protein coding gene in regulating the pathogenicity and stress resistance of Lasiodiplodia theobromae. The Ltvcx1-1 protein coding gene is derived from Lasiodiplodia theobromae. By constructing a knockout gene fragment directed at the Ltvcx1-1 gene of Lasiodiplodia theobromae and introducing the knockout gene fragment into a protoplast of Lasiodiplodia theobromae, a knockout mutant is obtained. It has been found from experiments that the Ltvcx1-1 gene plays a role in the cell membrane integrity and stress resistance of Lasiodiplodia theobromae and significantly reduces the pathogenicity of Lasiodiplodia theobromae to a host. Therefore, Ltvcx1-1 can be used as a target for a fungicide and a key protein of a pathogenic mechanism of a disease to develop an agent for a disease caused by Lasiodiplodia theobromae infection and breed a novel disease-resistant variety, and has wide application prospects in the control of phytopathogenic fungal diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Application of Ltvcx1-1 protein and its encoding gene in regulating pathogenicity and stress resistance of Lasiodiplodia theobromae TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to application of Ltvcx1-1 protein and its encoding gene in regulating pathogenicity and stress resistance of Lasiodiplodia theobromae. BACKGROUND

[0002] Lasiodiplodia theobromae belongs to Eumycetes, Ascomycota, Loculoascomycetes, Botryosphaeriales, Botryosphaeriaceae, and Lasiodiplodia. The fungus is widely distributed and has diverse hosts, and can cause diseases on tea, eggplant, kiwi, grape, pitaya, mango, and blueberry. The pathogen can cause leaf spot, rot, ulcer, branch dieback, and / or leaf dieback on the above-mentioned plants (Li D.X., Bao X.T., Ren Y.F., Song B.A., Chen Z. 2018. First report of Lasiodiplodia theobromae causing leaf spot on tea plant in Guizhou Province of China. Plant Dis. 103: 374. Vieira J.C.B., M.P.S., Bezerra J.D.P., Motta C.M.S., Machado A.R. 2018. First Report of Lasiodiplodia theobromae causing rot in eggplant fruit in Brazil. Plant Dis. 102:2039. Zhou Y., Gong G.S., Cui Y.L., Zhang D.X., Chang X.L., Hu R.P., Liu N., Sun X.F. 2015. Identification of Botryosphaeriaceae species causing kiwifruit rot in Sichuan Province, China. Plant Dis. 99:699-708. Xing Q., Zhou X., Cao Y., Peng J., Zhang W., Wang X., Wu J., Li X., Yan J. 2023. The woody plant-degrading pathogen Lasiodiplodia theobromae effector LtCre1 targets the grapevine sugar-signaling protein VvRHIP1 to suppress host immunity. J Exp Bot. 74:2768-2785. Ganesan G.S., Kumari N., Sahu S., Pattanaik M., Kishore K. 2023. Identification of Lasiodiplodia species inciting stem rot of dragon fruit in India through polyphasic approach. 3Biotech. 13:333. El Komy M.H., Ibrahim Y.E., Al-Saleh M.A. 2022. First report of Lasiodiplodia theobromae causing dieback, a destructive disease on Mango trees in Saudi Arabia. Plant Dis. 107:563.The Lasiodiplodia theobromae strain GZHS-2017-010 (China General Microbiological Culture Collection Center preservation number: CGMCC 3.20151, preservation address: No. 1, Beichen West Road, Chaoyang District, Beijing, preservation time: August 2020) is isolated and identified by the research group of the present inventors from the tea leaf spot of Qilichong Tea Garden in Huishui County, Guizhou Province. Since the pathogen can infect tea shoots, tender leaves and mature leaves, it seriously affects the quality and yield of tea leaves, and it is necessary to screen environmentally friendly and green efficient fungicides and develop comprehensive prevention and control measures for the disease (Li D. X., Bao X. T., Ren Y. F., Song B. A., Chen Z. 2018. First report of Lasiodiplodia theobromae causing leaf spot on tea plant in Guizhou Province of China. Plant Dis. 103: 374. Ren Y. F., Bao X. T., Li D. X., Wang Y., Wang D. L., Song B. A., Chen Z. A. Identification of Lasiodiplodia theobromae causing leaf spot on tea plant. Acta Phytopathologica Sinica, 2019, 49: 857-861. Bao X. T., Yang R., Jiang S. L., Zhao J. P., Wang D. L., Li D. X., Wu X., Song B. A., Chen Z. A novel sulfone derivative controls Lasiodiplodia theobromae in tea leaf spot by reducing the ergosterol content. Mol. Plant Microbe Interact. 2021. 34 (8): 922-938.). So far, the pathogenic molecular biology of Lasiodiplodia theobromae is still relatively weak at home and abroad, especially the lack of reports on the pathogenic mechanism of the pathogen.

[0003] Studies have shown that Lasiodiplodia theobromae successfully infects tea leaves through multiple pathogenic factors. Therefore, fully excavating the pathogenic related genes of Lasiodiplodia theobromae and carrying out functional research are helpful to fully understand the pathogenic mechanism of Lasiodiplodia theobromae, provide a theoretical basis for the prevention and control of the disease caused by Lasiodiplodia theobromae, and provide guidance for effectively controlling the harm of the disease and breeding disease-resistant varieties. SUMMARY

[0004] In view of this, one of the purposes of the present application is to provide a new use of the Ltvcx1-1 protein derived from Lasiodiplodia theobromae, i.e. the application of the Ltvcx1-1 protein in regulating the pathogenicity and / or cell membrane integrity and / or stress resistance of Lasiodiplodia theobromae, wherein the Ltvcx1-1 protein is a protein with an amino acid sequence as shown in SEQ ID NO. 3 or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein as shown in SEQ ID NO. 3.

[0005] The second purpose of the present application is to provide the application of a biological material related to the Ltvcx1-1 protein in regulating the pathogenicity and / or cell membrane integrity and / or stress resistance of Lasiodiplodia theobromae, wherein the biological material is a nucleic acid molecule encoding the Ltvcx1-1 protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule, such as a recombinant vector or a recombinant microorganism containing the expression cassette.

[0006] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1 or as shown in SEQ ID NO. 2. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc. The vector can be a plasmid, a cosmid, a bacteriophage or a viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0007] The third purpose of the present application is to provide the application of the above-mentioned Ltvcx1-1 protein as a target in the design and screening of antifungal drugs.

[0008] The fourth purpose of the present application is to provide the application of the above-mentioned Ltvcx1-1 protein or the above-mentioned biological material in cultivating transgenic Lasiodiplodia theobromae with reduced pathogenicity and / or cell membrane integrity and / or stress resistance.

[0009] The fifth purpose of the present application is to provide a method for cultivating transgenic Lasiodiplodia theobromae with reduced pathogenicity and / or cell membrane integrity and / or stress resistance, comprising the step of reducing the expression amount and / or activity of the above-mentioned Ltvcx1-1 protein in the recipient Lasiodiplodia theobromae to obtain the transgenic Lasiodiplodia theobromae. The pathogenicity and / or cell membrane integrity and / or stress resistance of the transgenic Lasiodiplodia theobromae is lower than that of the wild-type Lasiodiplodia theobromae.

[0010] Preferably, the method for reducing the expression amount and / or activity of the Ltvcx1-1 protein in the recipient Lasiodiplodia theobromae is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the Ltvcx1-1 protein in the recipient Lasiodiplodia theobromae.

[0011] Preferably, the method for knocking out is a method of homologous recombination to achieve the knockout of the coding gene of the Ltvcx1-1 protein in the recipient Lasiodiplodia theobromae.

[0012] Preferably, the method of homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplast of the recipient Lasiodiplodia theobromae.

[0013] The sixth object of the present application is to provide the use of the above method in the prevention and treatment of diseases caused by Lasiodiplodia theobromae.

[0014] The present application provides the use of the Ltvcx1-1 protein and its coding gene derived from Lasiodiplodia theobromae in regulating the pathogenicity, cell membrane integrity and stress resistance of the plant pathogenic fungus Lasiodiplodia theobromae. It is found that the pathogenicity, cell membrane integrity and stress resistance of the knockout Lasiodiplodia theobromae are significantly reduced after the knockout of the Ltvcx1-1 protein coding gene in the wild type Lasiodiplodia theobromae. Therefore, Ltvcx1-1 can be used as a fungicide target and a key protein in the pathogenic mechanism of disease to develop fungicides and cultivate new varieties resistant to diseases caused by Lasiodiplodia theobromae, and has a broad application prospect in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS

[0015] Fig. 1 is a schematic diagram of the knockout and mutant screening strategy of the Ltvcx1-1 gene of Lasiodiplodia theobromae according to the present application;

[0016] Fig. 2 is a map of the plasmid pct74 according to the present application;

[0017] Fig. 3 is a schematic diagram of the observation of the protoplast prepared according to the present application under a microscope;

[0018] Fig. 4 is a PCR electropherogram (amplification P1) for verification of the transformant according to the present application;

[0019] Fig. 5 is a PCR electropherogram (amplification P2) for verification of the transformant according to the present application;

[0020] Fig. 6 is a PCR electropherogram (amplification P3) for verification of the transformant according to the present application;

[0021] Fig. 7 is a PCR electropherogram (amplification P4) for verification of the transformant according to the present application;

[0022] Fig. 8 is a diagram of the colony growth of the wild type and mutant ΔLtvcx1-1 of Lasiodiplodia theobromae on PDA according to the present application;

[0023] Fig. 9 is a diagram of the colony growth of the wild type and mutant ΔLtvcx1-1 of Lasiodiplodia theobromae under different stress conditions according to the present application;

[0024] Figure 10 is a plot of colony growth inhibition rate of wild type and mutant ΔLtvcx1-1 under different stress conditions of the present application;

[0025] Figure 11 is the pathogenicity determination results of wild type and mutant ΔLtvcx1-1 on tea leaves of the present application. DETAILED DESCRIPTION

[0026] The present application will be described in detail below with reference to examples, which are only illustrative and do not limit the scope of application of the present application. The present application is not limited to the following embodiments or examples, and any modifications and variations made without departing from the spirit of the present application shall be included within the scope of the present application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0027] In the following examples, the wild strain of Colletotrichum cacao GZHS-2017-010 was isolated and identified from tea leaf spot in a tea garden in Huishui County, Guizhou Province, and was deposited with the China General Microbiological Culture Collection Center, with the strain preservation number CGMCC3.20151 and the preservation address No. 1 Beichen West Road, Chaoyang District, Beijing. The genomic DNA sequence of the Ltvcx1-1 gene in the strain is shown in SEQ ID NO. 1, the CDS sequence of the Ltvcx1-1 gene is shown in SEQ ID NO. 2, and the amino acid sequence of the Ltvcx1-1 protein encoded by the Ltvcx1-1 gene is shown in SEQ ID NO. 3.

[0028] Example 1 Knockout of Colletotrichum cacao Ltvcx1-1 gene

[0029] The schematic diagram of knockout and mutant screening strategy of Colletotrichum cacao Ltvcx1-1 gene is shown in Figure 1, and the specific construction and screening method is as follows:

[0030] 1. Construction of knockout gene fragment

[0031] 1) Amplification of upstream and downstream homologous sequences of the target gene: design primers based on SEQ ID NO. 1, use the genomic DNA of the wild strain of Colletotrichum cacao CGMCC3.20151 as the template, and use primers 1F and 2R to amplify the upstream A fragment, and use primers 3F and 4R to amplify the downstream B fragment. A reverse complementary sequence of primer HYGF is added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYGR is added to the 5' end of primer 3F. The sequences (5' end to 3' end) of primers 1F, 2R, 3F, 4R, HYGF and HYGR are as follows:

[0032] 1F: GAGCAAACGCTCTCTCGCAA

[0033] 2R: ACCTCCACTAGCTCCAGCCAAGCGAGGGTTGGGCAGAACTTA

[0034] 3F: GAATAGAGTAGATGCCGACCGGGGCGGATTTGCGATCAACGAA

[0035] 4R: CAGATGACCTCAGGCGCTTG

[0036] HYGF: CTTGGCTGGAGCTAGTGGAGGT

[0037] HYGR: CCCGGTCGGCATCTACTCTATTC

[0038] 2) Amplification of the hygromycin resistance gene hph: the first half of the hygromycin resistance gene H1 (1094 bp) was amplified using the plasmid pct74 (the map is shown in Figure 2) as the template and primers HYGF and HYG-1R; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYGR. The sequences of primers HYG-1F and HYG-1R (from 5' end to 3' end) are:

[0039] HYG-1F: CGTTGCAAGACCTGCCTGAA

[0040] HYG-1R: GGATGCCTCCGCTCGAAGTA

[0041] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment, respectively, to obtain A-H1 ligation fragment and H2-B ligation fragment. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0042] 2, Preparation of Aspergillus nomius protoplasts

[0043] 1) Aspergillus nomius was inoculated on potato glucose agar medium and cultured at 28°C for 36 h. 2-3 mL of sterile water was added dropwise on the surface of the colony, and the mycelium was broken with an inoculation loop. The mycelium suspension was transferred to CM liquid medium and shaken for 24 h. Fresh mycelium of Aspergillus nomius was collected by filtration;

[0044] 2) 10 mL 0.7 mol / L sodium chloride solution as osmotic pressure stabilizer, configuration of disintegration enzyme (Drislase) and snailase mixed enzyme solution, lysis of suspended mycelium 5 g, 28 ℃, 120 rpm enzymolysis 4 h;

[0045] 3) 2-3 layers of sterilized mirror paper (fiber mesh aperture 45 ± 12 μm) filtration, 1.2 mol / L sodium chloride rinse, collect the filtrate, the resulting filtrate at 4 ℃, 4000 rpm centrifugation 6 min. Resuspended with 15 mL 1.2 mol / L sorbitol buffer (STC) solution;

[0046] 4) Discard the supernatant, resuspend the protoplast with 1 mL STC buffer, make a concentration of 1 × 10 7 Protoplast suspension (protoplast microscope observation schematic diagram as shown in Figure 3), ice for standby.

[0047] 3, cocoa hair color two spore protoplast transformation

[0048] 1) Take 200 μL of protoplast suspension into a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knock-out transformation fragment, mix gently, and stand on ice for 20 min.

[0049] 2) Add 200 μL, 200 μL, 800 μL of 60% polyethylene glycol 3350 buffer (PTC) in turn, mix gently, stand at room temperature for 20 min, add 5 mL TB3 liquid medium, mix, stand and culture for 8-12 h.

[0050] 3) Room temperature, 4000 rpm / min centrifugation for 6 min, discard the supernatant, resuspend the remaining 1 mL with the regenerated protoplast.

[0051] 4) Add 50 mL of warm TB3 regeneration solid medium, mix well to prepare a plate. After 10 h of inverted culture at 28 ℃, cover with PDA medium containing 50 μg / mL hygromycin B, and culture at 28 ℃ for 3-4 days until the transformants grow, then subculture and select for 3 generations.

[0052] 4, transformant PCR verification

[0053] After subculturing for 3 generations on PDA medium containing hygromycin, 7 transformants of ΔLtvcx1-1 were obtained, and the transformants were numbered 1-7, and corresponded to lanes 2-8 of the electrophoretic map of PCR amplification below. DNA was extracted from the transformant colonies by CTAB method, and four pairs of primers were used for PCR amplification. Primer pair HYGF / HYGR was used to amplify fragment P1 to detect the presence of hph gene (as shown in Figure 4, wherein lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P1 in the transformants; lane 9: amplification of P1 in the wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type); primer pair 5F / 6R was used to amplify fragment P2 to detect whether the target gene was knocked out (as shown in Figure 5, wherein lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P2 in the transformants; lane 9: amplification of P2 in the wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type); primer pair 7F / HYG-1R was used to amplify fragment P3 to detect the occurrence of homologous recombination at the upstream (as shown in Figure 6, wherein lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P3 in the transformants; lane 9: amplification of P3 in the wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type); primer pair HYG-1F / 8R was used to amplify fragment P4 to detect the occurrence of homologous recombination at the downstream (as shown in Figure 7, wherein lane 1: 2kb Plus II DNA Marker, lanes 2-8: amplification of P4 in the transformants; lane 9: amplification of P4 in the wild type strain of Colletotrichum gloeosporioides CGMCC 3.20151 wild type). As shown in Figures 4-7, 1 positive transformant was obtained.

[0054] 5F: ATGTACCGCTTAGACACCATCAAGTCCCGA

[0055] 6R: TTAATCGGGGTAAACGAAGGCGGCGACG

[0056] 7F: ATATTCCTCGTCTATGTGGCGT

[0057] 8R: AACAGATGACCTCAGGCG

[0058] Using homologous recombination method, the gene knockout fragment was transformed into the protoplast of Colletotrichum gloeosporioides, and 7 hygromycin positive transformants (No. 1-7) were obtained. The positive transformants were analyzed by PCR using hph gene specific primers, and the results are shown in Figures 4-7. The hph gene was detected in the 6 transformants, the upstream homologous recombination was detected in 4 transformants, the downstream homologous recombination was detected in 7 transformants, and the Ltvcx1-1 gene was not amplified in No. 4 and 6. Therefore, one positive transformant was screened, i.e. ΔLtvcx1-1 knockout mutant was obtained.

[0059] Example 2 Phenotype observation and stress resistance analysis of Colletotrichum gloeosporioides wild type and ΔLtvcx1-1 knockout mutant

[0060] 1. Colony morphology observation and growth rate determination

[0061] The wild type and knockout mutant ΔLtvcx1-1 of Colletotrichum gloeosporioides were inoculated on PDA medium, and cultured at 28°C in the dark. The colony diameter was measured by cross method at 3d, and the colony morphology was observed. Four replicates were set for each treatment.

[0062] The results of colony morphology observation and growth rate determination of the wild type and knockout mutant ΔLtvcx1-1 of Colletotrichum gloeosporioides on PDA medium are shown in Figure 8. Figure 8A shows the growth of the wild type and mutant strain ΔLtvcx1-1 inoculated on PDA medium for 24h, and the scale is 1cm. Figure 8B shows the colony growth rate of the wild type and mutant strain ΔLtvcx1-1 inoculated on PDA medium for 24h, and the vertical coordinate is the lesion measurement diameter. The values are the mean values based on 4 independent experiments, and the data were analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 8, there was no significant difference in colony morphology and growth rate between the knockout mutant ΔLtvcx1-1 and the wild type of Colletotrichum gloeosporioides on PDA medium, indicating that the Ltvcx1-1 gene had no significant effect on the growth of Colletotrichum gloeosporioides.

[0063] 2. Stress resistance analysis

[0064] 1) Oxidative stress analysis: The wild type and knockout mutant ΔLtvcx1-1 of Colletotrichum gloeosporioides were inoculated on PDA medium containing 29.4mol / L H2O2, and cultured in an inverted incubator at 28°C for 2-3d. The colony growth of the knockout mutant ΔLtvcx1-1 and the wild type was observed.

[0065] 2) Cell wall integrity analysis

[0066] C. herbarum wild type and knockout mutant ΔLtvcx1-1 were inoculated on PDA medium containing 170 μmol / mL Congo red, respectively, and cultured in 28°C incubator for 2-3 days. The growth of colonies of knockout mutant ΔLtvcx1-1 and wild type strain were observed.

[0067] 3) Cell membrane integrity analysis

[0068] C. herbarum wild type and knockout mutant ΔLtvcx1-1 were inoculated on PDA medium containing 1.73 mmol / L sodium dodecyl sulfate (SDS), respectively, and cultured in 28°C incubator for 2-3 days. The growth of colonies of knockout mutant ΔLtvcx1-1 and wild type strain were observed.

[0069] 4) High osmotic stress analysis

[0070] C. herbarum wild type and knockout mutant ΔLtvcx1-1 were inoculated on PDA medium containing 0.6 mol / L NaCl and containing 0.5 mol / L sorbitol, respectively, and cultured in 28°C incubator for 2-3 days. The growth of colonies of knockout mutant ΔLtvcx1-1 and wild type strain were observed.

[0071] The colony diameters of all strains were measured (cross method) and photographed. The growth inhibition rate of strains = (colony diameter of control strain - colony diameter of treated strain) / colony diameter of control strain * 100%.

[0072] The growth of the cocoa hairy metulae Ltvcx1-1 gene knockout mutant ΔLtvcx1-1 and the wild type under different stress conditions is shown in Figure 9 (wherein A-E are the growth of the cocoa hairy metulae wild type strain CGMCC 3.20151 on the medium under different stress conditions; F-J are the growth of the cocoa hairy metulae mutant strain ΔLtvcx1-1 on the medium under different stress conditions; 170 μmol / L Congo red: containing a final concentration of 170 μmol / L Congo red; 0.5 mol / L sorbitol: containing a final concentration of 0.5 mol / L sorbitol; 1.73 mmol / L SDS: containing a final concentration of 1.73 mmol / L SDS; 29.4 mol / L H2O2: containing a final concentration of 29.4 mol / L H2O2; 0.6 mol / L NaCl: containing a final concentration of 0.6 mol / L NaCl; the scale is 1 cm); and the results of the colony relative growth inhibition rate of the wild type and the knockout mutant under different stress conditions are shown in Figure 10, wherein the vertical coordinate is the relative growth inhibition rate, the numerical value is the mean value based on four independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). From left to right in Figure 10 are the colony relative growth inhibition rates of the wild type and the knockout mutant under Congo red, sorbitol, SDS, H2O2 and NaCl stress; the data is analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 9, the growth rate of the knockout mutant ΔLtvcx1-1 under SDS, H2O2 and NaCl is significantly lower than that of the wild type; as shown in Figure 10, the relative growth inhibition rate of the knockout mutant ΔLtvcx1-1 in the PDA medium containing 1.73 mmol / L SDS and 29.4 mol / L H2O2 is significantly higher than that of the wild type, indicating that the knockout of the Ltvcx1-1 gene improves the sensitivity to SDS and H2O2.

[0073] In summary, the knockout of the Ltvcx1-1 gene reduces the cell membrane integrity and the tolerance to high salt and oxidative stress of the cocoa hairy metulae.

[0074] Example 3 Pathogenicity analysis of the cocoa hairy metulae knockout mutant

[0075] The cocoa hairy metulae wild type and the knockout mutant ΔLtvcx1-1 were inoculated on PDA medium, respectively, and incubated in an incubator at 28°C for 24 h, and then several bacterial cakes were punched at the edge of the colony with a sterilized puncher with a diameter of 4 mm, and then inoculated on the surface of tea leaves, and the tea leaf disease was investigated after 3 days.

[0076] The pathogenicity of the cocoa hairy metulae two-spotted mutant ΔLtvcx1-1 on tea leaves is shown in Figure 11, wherein Figure 11A is a plot of lesions of the cocoa hairy metulae two-spotted wild type strain and mutant strain ΔLtvcx1-1 inoculated on tea leaves after 3 days; Figure 11B is a plot of lesion diameter measurement results of the cocoa hairy metulae two-spotted wild type strain and mutant strain ΔLtvcx1-1 inoculated on tea leaves after 3 days, the vertical coordinate is the lesion measurement diameter, the numerical value is the mean value based on 30 independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 11, compared with the wild type, the lesion diameter of the knockout mutant ΔLtvcx1-1 is smaller on tea leaves, indicating that after knocking out the Ltvcx1-1 gene, the pathogenicity of the cocoa hairy metulae two-spotted strain is significantly reduced.

[0077] In summary, the Ltvcx1-1 gene or Ltvcx1-1 protein provided by the present application can be used for the prevention and control of diseases caused by cocoa hairy metulae two-spotted, and can be used as a target for plant disease prevention and control drugs. Those skilled in the art can follow the teachings and inspirations of the present specification to develop drugs for preventing and controlling plant diseases, especially diseases caused by cocoa hairy metulae two-spotted.

[0078] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, and therefore will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Use of a Ltvcx1-1 protein in modulating the pathogenicity and / or cell membrane integrity and / or stress tolerance of Colletotrichum cacao, characterized in that, The Ltvcx1-1 protein is a protein with an amino acid sequence as shown in SEQ ID NO. 3 or a fusion protein with a tag linked to the N-terminus and / or C-terminus of the protein with an amino acid sequence as shown in SEQ ID NO.

3.

2. Use of biological material related to the Ltvcxl-1 protein as described in claim 1, for modulating the pathogenicity and / or the cell membrane integrity and / or the stress resistance of Colletotrichum gloeosporioides, characterized in that, The biological material is a nucleic acid molecule encoding the Ltvcx1-1 protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

3. Use according to claim 2, wherein the compound is ###0002### The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1 or as shown in SEQ ID NO.

2.

4. Use of the Ltvcx1-1 protein as claimed in claim 1 as a target in the design and screening of antifungal drugs.

5. Use of the Ltvcx1-1 protein as claimed in claim 1 in breeding transgenic Colletotrichum cacao with reduced pathogenicity and / or reduced cell membrane integrity and / or reduced stress resistance.

6. A method for breeding transgenic Colletotrichum gloeosporioides with reduced pathogenicity and / or reduced cell membrane integrity and / or reduced stress tolerance, characterized in that, The method for reducing the expression amount and / or activity of the Ltvcx1-1 protein as claimed in claim 1 in a recipient Colletotrichum cacao is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the Ltvcx1-1 protein in the recipient Colletotrichum cacao.

7. The method of claim 6, wherein, The method for knocking out is a method using homologous recombination.

8. The method of claim 7, wherein, The method using homologous recombination is a method of introducing a homologous recombination fragment for homologous recombination into protoplasts of the recipient Colletotrichum cacao.

9. The method of claim 8, wherein, 10. Use of the method as claimed in claim 9 in the prevention and treatment of diseases caused by Colletotrichum cacao. ​

Citation Information

Patent Citations

  • Lasiodiplodia theobromae LtALTA1 gene and application thereof

    CN112125963A

  • Compositions and methods comprising endophytic bacterium for application to target plants to increase plant growth, and increase resistance to abiotic and biotic stressors

    US20210310017A1