Double-stranded ribonucleic acid for inhibiting inhbe gene expression, and modifier thereof, conjugate thereof and use thereof

By developing double-stranded ribonucleic acid and its modifications, and utilizing the RNA-induced silencing complex to cleave the INHBE gene, the problem of insufficient INHBE inhibitors in existing technologies has been solved, providing an effective treatment option for INHBE-related diseases.

WO2026052140A1PCT designated stage Publication Date: 2026-03-12BEIJING WINSUNNY PHARMA CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/125277
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-04-18
Filing Date
2025-09-29
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

The lack of effective INHBE inhibitors in current technologies leads to low treatment adherence and significant side effects for INHBE-related diseases such as obesity, non-alcoholic fatty liver disease, cirrhosis, liver fibrosis, hepatocellular carcinoma, and hypercholesterolemia.

Method used

Develop double-stranded RNA, double-stranded RNA modifiers, and double-stranded RNA conjugates to selectively inhibit INHBE gene expression via RNA-induced silencing complex (RISC)-mediated cleavage.

Benefits of technology

This study achieved effective inhibition of the INHBE gene, demonstrating its potential to treat INHBE-related diseases and providing a new therapeutic approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025125277-FTAPPB-I100001
    Figure PCTCN2025125277-FTAPPB-I100001
  • Figure PCTCN2025125277-FTAPPB-I100002
    Figure PCTCN2025125277-FTAPPB-I100002
  • Figure PCTCN2025125277-FTAPPB-I100003
    Figure PCTCN2025125277-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a double-stranded ribonucleic acid for inhibiting INHBE gene expression, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and the use, and a method for inhibiting the INHBE gene expression in a cell. The double-stranded ribonucleic acid and the modifier thereof, the conjugate thereof, and the prodrug thereof can bind in a cell to form an RNA-induced silencing complex (RISC), which cleaves mRNA transcribed from an INHBE gene, thereby efficiently and specifically inhibiting the expression of the INHBE gene. The present invention is used for treating diseases mediated by the INHBE gene, and thus has important application prospects in clinical disease treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Double-stranded ribonucleic acids and modifications, conjugates, and uses thereof for inhibiting expression of INHBE gene TECHNICAL FIELD

[0001] The present disclosure belongs to the field of biomedicine, in particular, the present disclosure relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and uses thereof for inhibiting expression of INHBE gene, and a method for inhibiting expression of INHBE gene in cells. BACKGROUND

[0002] Inhibin subunit beta E (INHBE) is a member of the transforming growth factor-beta (TGF-beta) family. The proprotein of INHBE is proteolytically processed to produce inhibin beta subunit. INHBE is involved in the regulation of many cellular processes, including cell proliferation, apoptosis, immune response, and hormone secretion. This gene can be upregulated under endoplasmic reticulum stress conditions, and this protein can inhibit cell proliferation and growth in the pancreas and liver. INHBE mRNA is mainly expressed in the liver, involved in the regulation of hepatocyte growth and differentiation, and has been shown to be positively correlated with body mass index and insulin resistance in humans. Real-time quantitative PCR analysis also shows that INHBE gene expression is increased in liver samples of insulin-resistant patients. In addition, the expression of INHBE gene is increased in the liver of db / db mice, a rodent model of type 2 diabetes. It is proved that inhibiting the expression of INHBE in db / db mice can inhibit weight gain, which is attributed to fat reduction rather than weight loss.

[0003] Current treatments for lipid metabolism disorders include lifestyle changes, diet, exercise, and medication, such as lipid-lowering drugs, statins, and other drugs. However, these therapies and treatments are often limited by compliance and are not always effective, leading to side effects and drug interactions.

[0004] In addition, there are reports of exome sequencing of 360,000 individuals, highlighting INHBE as a new therapeutic target for the treatment of abdominal obesity and cardiometabolic diseases. It is confirmed that there is a causal relationship between healthy body mass index and cardiometabolic diseases. INHBE pLOF variant carriers have more favorable metabolic characteristics and lower risk of coronary heart disease and type 2 diabetes (T2D) than non-carriers. Importantly, by reducing abdominal fat, drugs targeting INHBE will have a different biological mechanism from existing coronary heart disease and T2D drugs, and can complement current therapies.

[0005] The present application aims to provide double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate, prodrug and pharmaceutical composition, which can be effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcript of INHBE gene, so as to selectively and effectively inhibit the expression of INHBE gene, and achieve the purpose of disease treatment. SUMMARY

[0006] PROBLEMS TO BE SOLVED BY THE INVENTION

[0007] In view of the problems in the prior art, for example, it is necessary to develop more INHBE inhibitors for the treatment of INHBE-related diseases including obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, glucose intolerance, hyperglycemia, type II diabetes and metabolic syndrome, and other yet to be identified related conditions, pathologies or syndromes. The present disclosure aims to provide a series of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate, prodrug and pharmaceutical composition for inhibiting the expression of INHBE gene, which can inhibit the expression of INHBE gene and has important application prospects in clinical disease treatment.

[0008] SOLUTIONS FOR SOLVING THE PROBLEMS

[0009] [1]. A double-stranded ribonucleic acid for inhibiting the expression of INHBE gene, the double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand and the antisense strand being reverse complementary and / or substantially reverse complementary to form a double-stranded region of the double-stranded ribonucleic acid;

[0010] wherein the sense strand comprises a sequence A which differs from at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides, and the antisense strand comprises a sequence B which differs from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides;

[0011] The target sequence is selected from the nucleotide sequence as shown in any one of SEQ ID NO: 1-6, 507-509, 610, 611 and the sequence consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NO: 1-6, 507-509, 610, 611.

[0012] [2]. The double-stranded ribonucleic acid of [1], wherein the target sequence is selected from the group consisting of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, the sense strand comprises a sequence A consisting of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, and the antisense strand comprises a sequence B which is the reverse complement and / or substantially reverse complement of the sequence consisting of at least 15 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

[0013] [3]. The double-stranded ribonucleic acid of [1] or [2], wherein the sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 20, 21, or 23 nucleotides.

[0014] [4]. The double-stranded ribonucleic acid of [3], wherein the nucleotide sequence of the sense strand is a sequence A which differs by no more than 1 nucleotide from a sequence consisting of 15-28 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, preferably 19-25 contiguous nucleotides, more preferably 19-23 contiguous nucleotides, more preferably 19, 20, 21, or 23 nucleotides.

[0015] [5]. The double-stranded ribonucleic acid of any one of [1]-[4], wherein the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 21, or 23 nucleotides.

[0016] [6]. The double-stranded ribonucleic acid of [5], wherein the nucleotide sequence of the antisense strand is a sequence B which differs by no more than 1 nucleotide from the reverse complement of a sequence consisting of 15-28 contiguous nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, preferably 19-25 contiguous nucleotides, more preferably 19-23 contiguous nucleotides, more preferably 19, 21, or 23 nucleotides.

[0017] [7]. The double-stranded ribonucleic acid of any one of [1]-[6], wherein the double-stranded region is 15-25 nucleotides in length, preferably 19-23 nucleotides in length, more preferably 19, 20, 21, or 23 nucleotides in length.

[0018] [8]. The double-stranded ribonucleic acid of any one of [1]-[7], wherein,

[0019] the 3' end of the antisense strand forms a blunt end; or,

[0020] the 3' end of the antisense strand forms a blunt end; or,

[0021] the 3' end of the antisense strand forms a blunt end; or,

[0022] the 3' end of the antisense strand forms a blunt end.

[0023] [9]. The double-stranded ribonucleic acid of any one of [1]-[8], wherein the sense strand and the antisense strand are selected from the following combinations:

[0024] the sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA;

[0025] Preferably, the sense strand and the antisense strand are selected from the following combinations:

[0026] the sense strand comprises the sense strand of any one of siRNA 15, siRNA 419, siRNA 421-siRNA 425, siRNA 434, siRNA 466, siRNA 480-siRNA 487, siRNA 492 shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0027]

[0010] . The double-stranded ribonucleic acid of any one of [1]-[9], wherein each nucleotide in the sense strand is independently of each other a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently of each other a modified nucleotide or an unmodified nucleotide.

[0028]

[0011] . The double-stranded ribonucleic acid of any one of [1]-

[0010] , wherein any two nucleotides connected in the sense strand are connected by a phosphodiester bond, a phosphorothioate bond or a phosphorodithioate bond, and / or any two nucleotides connected in the antisense strand are connected by a phosphodiester bond, a phosphorothioate bond or a phosphorodithioate bond.

[0029]

[0012] . The double-stranded ribonucleic acid of any one of [1]-

[0011] , wherein the 5’ terminal nucleotide of the antisense strand is linked to a 5’ phosphate group or a 5’ phosphate derivative group, or the 5’ terminal nucleotide of the antisense strand is not linked to a 5’ phosphate group or a 5’ phosphate derivative group.

[0030]

[0013] . The double-stranded ribonucleic acid of any one of [1]-

[0012] , wherein neither the 5’ terminal nor the 3’ terminal of the sense strand is linked to an inverted abasic deoxyribose residue, or the 5’ terminal or 3’ terminal nucleotide of the sense strand is linked to an inverted abasic deoxyribose residue, or the 5’ terminal and 3’ terminal nucleotides of the sense strand are respectively linked to an inverted abasic deoxyribose residue.

[0031]

[0014] . The double-stranded ribonucleic acid of any one of [1]-

[0013] , wherein the double-stranded ribonucleic acid is an siRNA.

[0032]

[0015] . A double-stranded ribonucleic acid modifier, which is a modifier of the double-stranded ribonucleic acid of any one of [1]-

[0014] , the double-stranded ribonucleic acid modifier comprising a chemical modification of at least one of:

[0033] (1) a modification of at least one nucleotide in the sense strand,

[0034] (2) a modification of a phosphodiester bond at at least one position in the sense strand,

[0035] (3) a modification of at least one nucleotide in the antisense strand,

[0036] (4) a modification of a phosphodiester bond at at least one position in the antisense strand;

[0037] Optionally, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modifier comprises a sequence A and a sequence D, the 3’ terminal of the sequence A in the sense strand is linked to a sequence D consisting of 1-3 nucleotides, preferably a sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modifier comprises a sequence B and a sequence E, the 3’ terminal of the sequence B in the antisense strand is linked to a sequence E consisting of 1-3 nucleotides, preferably a sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modifier comprises a sequence A’, which is formed by excluding 1-3 nucleotides from the 3’ terminal of the sequence A in the sense strand;

[0038] Optionally, the sense strand and the antisense strand of the double-stranded ribonucleic acid modifier are selected from the following sequence combinations:

[0039] the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;

[0040] or, the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;

[0041] or, the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;

[0042] or, the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;

[0043] or, the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;

[0044] or, the nucleotide sequence of the antisense strand is the sequence shown in Sequence B.

[0045]

[0016] . The double-stranded ribonucleic acid modifier of

[0015] , wherein the modification of the nucleotide is selected from 2’-fluoro modification, 2’-alkoxy modification, 2’-substituted alkoxy modification, 2’-alkyl modification, 2’-substituted alkyl modification, 2’-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.

[0046] Preferably, the modification of the nucleotide is selected from 2’-F modification, 2’-O-CH3 modification, 2’-O-CH2-CH2-O-CH3 modification, 2’-O-CH2-CH=CH2 modification, 2’-CH2-CH2-CH=CH2 modification, 2’-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.

[0047]

[0017] . The double-stranded ribonucleic acid modifier of

[0015] or

[0016] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from iso-nucleotide, LNA, ENA, cET, UNA, or GNA.

[0048]

[0018] . The double-stranded ribonucleic acid modifier of any one of

[0015] -

[0017] , wherein, in the direction from 5’ end to 3’ end, the ribonucleotides at positions 7, 9, 10, and 11 in the sense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2’-O-CH3 modified ribonucleotides.

[0049] or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 5, 7, 8 and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0050] or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9 and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0051] or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, 11 and 13 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0052] or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 8 and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0053] or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9 and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0054] or, along the 3' end to the 5' end direction, the ribose nucleotides at positions 11, 12, 13 and 17 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides;

[0055] or, along the 3' end to the 5' end direction, the ribose nucleotides at positions 10, 11, 12 and 16 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides.

[0056]

[0019] . The double-stranded ribonucleic acid modification according to any one of

[0015] -

[0018] , wherein neither the 5' end nor the 3' end of the sense strand is connected to an inverted abasic deoxyribose residue, or, the 5' end or the 3' end nucleotide of the sense strand is connected to an inverted abasic deoxyribose residue, or, the 5' end and the 3' end nucleotide of the sense strand are respectively connected to an inverted abasic deoxyribose residue.

[0057]

[0020] . The double-stranded ribonucleic acid modification of any one of

[0015] -

[0019] , wherein the sense strand comprises phosphorothioate linkages at positions:

[0058] between the 1st and 2nd nucleotides from the 5' terminus of the sense strand;

[0059] between the 2nd and 3rd nucleotides from the 5' terminus of the sense strand;

[0060] between the 1st and 2nd nucleotides from the 3' terminus of the sense strand;

[0061] between the 2nd and 3rd nucleotides from the 3' terminus of the sense strand;

[0062] or,

[0063] the sense strand comprises phosphorothioate linkages at positions:

[0064] between the 1st and 2nd nucleotides from the 5' terminus of the sense strand;

[0065] between the 2nd and 3rd nucleotides from the 5' terminus of the sense strand;

[0066] or,

[0067] when the 3' terminal nucleotide of the sense strand is linked to an inverted abasic deoxyribose residue, the sense strand comprises phosphorothioate linkages at positions:

[0068] between the 1st and 2nd nucleotides from the 5' terminus of the sense strand;

[0069] between the 2nd and 3rd nucleotides from the 5' terminus of the sense strand; and

[0070] between the inverted abasic deoxyribose residue and the 1st nucleotide from the 3' terminus of the sense strand;

[0071] when the 5' and 3' terminal nucleotides of the sense strand are linked to inverted abasic deoxyribose residues, respectively, the sense strand comprises phosphorothioate linkages at positions:

[0072] between the inverted abasic deoxyribose residue and the 1st nucleotide from the 5' terminus of the sense strand;

[0073] between the 1st and 2nd nucleotides from the 5' terminus of the sense strand; and

[0074] the reverse 3' end of the sense strand.

[0075]

[0021] . The double-stranded ribonucleic acid modifier of any one of

[0015] -

[0020] , wherein the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0076] or, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0077] or, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0078] or, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0079] or, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0080] or, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2’-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2’-O-CH3 modified ribonucleotides, in the 5’-end to 3’-end direction;

[0081] or, along the 5' end to the 3' end direction, the ribonucleotides at positions 2, 7, 10, and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-0-CH3 modified ribonucleotides;

[0082] or, along the 5' end to the 3' end direction, the ribonucleotides at positions 2, 5, 7, and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-0-CH3 modified ribonucleotides.

[0083]

[0022] . The double stranded ribonucleic acid modification according to any one of

[0015] to

[0021] , wherein, along the 5' end to the 3' end direction, the nucleotide at the 5' end of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group, or the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0084]

[0023] . The double stranded ribonucleic acid modification according to any one of

[0015] to

[0022] , wherein the antisense strand comprises a phosphorothioate linkage or a phosphorodithioate linkage at a position as shown below:

[0085] the antisense strand comprises a phosphorothioate linkage between the first and second nucleotides from the 5' end of the antisense strand;

[0086] the antisense strand comprises a phosphorodithioate linkage between the first and second nucleotides from the 5' end of the antisense strand;

[0087] the antisense strand comprises a phosphorothioate linkage between the second and third nucleotides from the 5' end of the antisense strand;

[0088] the antisense strand comprises a phosphorodithioate linkage between the second and third nucleotides from the 5' end of the antisense strand;

[0089] the antisense strand comprises a phosphorothioate linkage between the first and second nucleotides from the 3' end of the antisense strand;

[0090] or,

[0091] the antisense strand comprises a phosphorothioate linkage and a phosphorodithioate linkage at a position as shown below:

[0092] the antisense strand comprises a phosphorothioate linkage between the first and second nucleotides from the 5' end of the antisense strand;

[0093] the antisense strand comprises a phosphorodithioate linkage between the second and third nucleotides from the 5' end of the antisense strand;

[0094] the first nucleotide to the second nucleotide from the 3' terminus of the antisense strand is a phosphorodithioate linkage.

[0095]

[0024] . The double stranded ribonucleic acid modification of any one of

[0015] -

[0023] , wherein the sense strand of the double stranded ribonucleic acid modification has the structure according to any one of (a1)-(a 14 ) as shown in any one of (a1)-(a

[0096] (a1) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0097] (a2) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0098] (a3) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0099] (a4) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0100] (a5) 5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0101] (a6) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0102] (a7) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0103] (a8) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ',

[0104] (a9) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ',

[0105] (a 10 ) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3 ',

[0106] (a 11 ) 5'-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3 ',

[0107] (a 12 )5’-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’,

[0108] (a 13 )5’-mN 21 -(s)-mN 20 -(s)-mN 19 -mN 18 -N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’,

[0109] (a 14 )5’-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 f-N 11 f-N 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’,

[0110] wherein N1-N 23 are independently of each other selected from ribonucleotides with the base A, U, C or G,

[0111] the capital letter T denotes a deoxyribonucleotide with the base thymine,

[0112] lowercase letter m means that the ribose nucleotide immediately to the right of the letter m is a 2'-0-CH3 modified ribose nucleotide,

[0113] lowercase letter f means that the ribose nucleotide immediately to the left of the letter f is a 2'-F modified ribose nucleotide,

[0114] (invAb): represents an inverted abasic deoxyribose residue,

[0115] -(s)- means that the two nucleotides immediately adjacent to the left and right are connected by a phosphorothioate diester bond,

[0116] Optionally, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group.

[0117]

[0025] . The double-stranded ribonucleic acid modifier of any one of

[0015] -

[0024] , wherein the antisense strand of the double-stranded ribonucleic acid modifier has a structure as set forth in any one of (b1)-(b 32 ) any one of:

[0118] (b1) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0119] (b2) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0120] (b3) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0121] (b4) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0122] (b5) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0123] (b6) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0124] (b7)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0125] (b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0126] (b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0127] (b 10 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13-N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0128] (b 11 )5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0129] (b 12 )5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0130] (b 13 )5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0131] (b 14 )5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0132] (b 15 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0133] (b 16 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0134] (b 17 )5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0135] (b 18 )5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0136] (b 19 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0137] (b 20 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN18 - mN 19 - (s)-mN 20 - (s)-mN 21 - 3’,

[0138] (b 21 ) 5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 - mN 20 - mN 21 - (s)-mN 22 - (s)-mN 23 - 3’,

[0139] (b 22 ) 5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 - mN 20 - mN 21 - (s)-mN 22 - (s)-mN 23 - 3’,

[0140] (b 23 ) 5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 - mN 20 - mN 21-(s)-mN 22 -(s)-mN 23 -3’,

[0141] (b 24 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0142] (b 25 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0143] (b 26 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0144] (b27 )5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0145] (b 28 )5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0146] (b 29 )5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0147] (b 30 )5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0148] (b 31 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0149] (b 32 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -(ss)-mN 21 -3’, 23 are independently of each other selected from ribonucleotides with the bases A, U, C or G,

[0150] the capital letter T denotes a deoxyribonucleotide with the base thymine,

[0151] the lower case letter m denotes that the ribonucleotide adjacent to the right of this letter m is a 2’-O-CH3 modified ribonucleotide,

[0152] the lower case letter f denotes that the ribonucleotide adjacent to the left of this letter f is a 2’-F modified ribonucleotide,

[0153] P1 denotes that the nucleotide adjacent to the right of this letter is a 5’-phosphate nucleotide,

[0154] EVP indicates that the nucleotide adjacent to the right side of the letter combination is a 5'-anti- vinyl phosphonate nucleotide,

[0155] -(s)- indicates that the two nucleotides adjacent to the front and back are connected by a phosphorothioate bond,

[0156] -(ss)- indicates that the two nucleotides adjacent to the front and back are connected by a phosphorodithioate bond,

[0157] [GNA] indicates that the ribose nucleotide adjacent to the right side thereof is a ribose nucleotide with GNA modification,

[0158] Optionally, the 5' terminal nucleotide of the antisense strand is not P1 or EVP indicates that the ribose group of the nucleotide has a 5' hydroxyl group.

[0159]

[0026] . The double-stranded ribonucleic acid modifier according to any one of

[0015] -

[0025] , wherein the sense strand and the antisense strand are selected from the following combinations:

[0160] the sense strand comprises the sense strand of any one of the double-stranded ribonucleic acid modifiers shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding double-stranded ribonucleic acid modifier;

[0161] Preferably, the sense strand and the antisense strand are selected from the following combinations:

[0162] the sense strand comprises the sense strand of any one of siRNA 414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, siRNA 488-siRNA 489 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0163]

[0027] . A double-stranded ribonucleic acid modifier, comprising a modifier in which the 3' terminal end of the sense strand of the double-stranded ribonucleic acid modifier according to any one of

[0015] -

[0026] is modified to be a blunt end, optionally by excluding the overhanging nucleotide of the double-stranded region extending out from the 3' end of the sense strand of the double-stranded ribonucleic acid modifier according to any one of

[0015] -

[0026] .

[0164]

[0028] . A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid according to any one of [1]-

[0014] or the double-stranded ribonucleic acid modifier according to any one of

[0015] -

[0027] ; and a conjugate group conjugated to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modifier.

[0165]

[0029] . The double-stranded ribonucleic acid conjugate of

[0028] , wherein the conjugate group has a structure of any one of the following:

[0166]

[0030] . The double-stranded ribonucleic acid conjugate of

[0028] or

[0029] , wherein the conjugate group is linked to the 3’-end of the sense strand.

[0167]

[0031] . The double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0030] , wherein the conjugate group is conjugated to the 3’-end of the sense strand via a phosphodiester bond or a phosphorothioate bond;

[0168] Preferably, the sense strand of the double-stranded ribonucleic acid conjugate is complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3’-end of the sense strand forms a blunt end, and the 3’-end of the antisense strand has 1-3 overhanging nucleotides extending out of the double-stranded region;

[0169] or,

[0170] the sense strand of the double-stranded ribonucleic acid conjugate is complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3’-end of the sense strand forms a blunt end, and the 3’-end of the antisense strand forms a blunt end.

[0171]

[0032] . The double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0031] , wherein the double-stranded ribonucleic acid conjugate has a structure of the following:

[0172] wherein the double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modifier.

[0173]

[0033] . The double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0032] , wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting the expression of an INHBE gene.

[0174]

[0034] . The double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0033] , wherein the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 herein to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 herein to a conjugate group;

[0175] Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand and the antisense strand are selected from the following combinations:

[0176] the sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate;

[0177] More preferably, the sense strand and the antisense strand are selected from the following combinations:

[0178] the sense strand comprises the sense strand of any one of siRNA 417, siRNA 451- siRNA 455, siRNA 464, siRNA 476, siRNA 490-siRNA 491 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0179]

[0035] . A prodrug of the double-stranded ribonucleic acid of any one of [1]-

[0014] , the double-stranded ribonucleic acid modifier of any one of

[0015] -

[0027] , or the double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0034] .

[0180]

[0036] . A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of the double-stranded ribonucleic acid of any one of [1]-

[0014] , the double-stranded ribonucleic acid modifier of any one of

[0015] -

[0027] , the double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0034] , the prodrug of

[0035] .

[0181]

[0037] . The pharmaceutical composition of

[0036] , wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, and optionally further comprises one or more additional therapeutic agents.

[0182]

[0038] . Use of the double-stranded ribonucleic acid of any one of [1]-

[0014] , the double-stranded ribonucleic acid modifier of any one of

[0015] -

[0027] , the double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0034] , the prodrug of

[0035] , or the pharmaceutical composition of

[0036] or

[0037] in at least one of:

[0183] (1) inhibiting INHBE gene expression in vivo or in vitro, or preparing a medicament for inhibiting INHBE gene expression;

[0184] (2) for preventing or treating a disease associated with abnormal expression of INHBE gene, or preparing a medicament for preventing or treating a disease associated with abnormal expression of INHBE gene;

[0185] (3) for use in treating a subject having a disease that would benefit from a reduction in INHBE gene expression, or in the preparation of a medicament for treating a subject having a disease that would benefit from a reduction in INHBE gene expression.

[0186]

[0039] . The use according to

[0038] , wherein the disease associated with abnormal expression of the INHBE gene is selected from the group consisting of:

[0187] obesity (e.g. abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (e.g. coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes and metabolic syndrome.

[0188]

[0040] . A method for inhibiting INHBE gene expression in a cell in vivo or in vitro, wherein the method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of [1] -

[0014] , the double-stranded ribonucleic acid modifier according to any one of

[0015] -

[0027] , the double-stranded ribonucleic acid conjugate according to any one of

[0028] -

[0034] , the prodrug according to

[0035] or the pharmaceutical composition according to

[0036] or

[0037] .

[0189]

[0041] . The method according to

[0040] , wherein the cell is a cell in vivo or a cell in vitro.

[0190]

[0042] . The method according to

[0040] or

[0041] , wherein the cell is in a subject;

[0191] Preferably, the subject is a mammal, more preferably a human;

[0192] Preferably, the subject has at least one of the following characteristics:

[0193] abnormal expression of the INHBE gene in vivo, more specifically abnormal high expression of the INHBE gene;

[0194] has a disease associated with abnormal expression of the INHBE gene;

[0195] has a disease that would benefit from a reduction in INHBE gene expression.

[0196]

[0043] . The double-stranded ribonucleic acid of any one of [1]-

[0014] , the double-stranded ribonucleic acid modification of any one of

[0015] -

[0027] , the double-stranded ribonucleic acid conjugate of any one of

[0028] -

[0034] , the prodrug of

[0035] or the pharmaceutical composition of

[0036] or

[0037] for use in therapy.

[0197] Effects of the invention

[0198] In some embodiments, the double-stranded ribonucleic acid provided by the present disclosure can bind to form an RNA-induced silencing complex (RISC) in cells, cleave the mRNA transcribed from the INHBE gene, and efficiently and specifically inhibit the expression of the INHBE gene, for use in the treatment of INHBE-related diseases such as obesity (e.g., abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (e.g., coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, and other yet unidentified related conditions, pathologies or syndromes.

[0199] Further, the double-stranded ribonucleic acid in the present disclosure is siRNA, which targets and degrades the mRNA transcribed from the INHBE gene, plays a role of RNA interference, and inhibits the protein expression of the INHBE gene, and is an INHBE inhibitor with high inhibition rate and good specificity.

[0200] In some embodiments, the double-stranded ribonucleic acid is modified to obtain a double-stranded ribonucleic acid modification, which has high stability and is suitable for use in the treatment of diseases in vivo.

[0201] Further, the double-stranded ribonucleic acid modification is an siRNA modification, which has high stability and good inhibitory activity.

[0202] In some embodiments, a conjugate group is connected to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification to obtain a double-stranded ribonucleic acid or double-stranded ribonucleic acid modification conjugate, which can be used for efficient targeted delivery to tissues and cells, reduce the impact of the double-stranded ribonucleic acid or double-stranded ribonucleic acid modification on non-targeted normal tissues and cells, and improve its safety in the treatment of clinical diseases.

[0203] Further, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, which maintains the inhibitory activity and stability of the siRNA, has organ or tissue targeting property, can reduce the influence on other tissues or organs and reduce the use amount of siRNA molecules, and can achieve the purposes of reducing toxicity and reducing cost.

[0204] Further, the conjugate group in the present disclosure is a group of the structure shown in Formula I (GalNAc), which can be used for targeted delivery into liver cells and tissues for efficient inhibition of the expression of the INHBE gene in the liver. In addition, the siRNA conjugate of the present disclosure has lower toxicity and has an excellent drug safety window. BRIEF DESCRIPTION OF DRAWINGS

[0205] FIG. 1 is the inhibition rate of N-ER-FY046149M47L96 at various concentrations in PHH cells in Example 14.

[0206] FIG. 2 is the differential genes that meet |log2(FoldChange)|>1 & padj<0.05 of N-ER-FY046149M47L96 at a concentration of 20nM in Example 14.

[0207] FIG. 3 is the differential genes that meet |log2(FoldChange)|>1 & padj<0.05 of N-ER-FY046149M47L96 at a concentration of 100nM in Example 14. DETAILED DESCRIPTION

[0208] DEFINITIONS

[0209] Unless otherwise stated, the terms used in the present disclosure have the following meanings.

[0210] In the claims and / or specification of this application, the word "a" or "an" can mean "one," but it can also mean "one or more" or "at least one." Thus, the examples are not intended to limit the claims.

[0211] As used in the claims and specification, the words "comprises," "comprising," "includes," "including," "contains," "containing," or variations thereof, mean "including but not limited to," and do not exclude additional, unrecited elements or method steps.

[0212] Throughout this application the term "about" is used to indicate that a value includes the standard deviation of error of the device or method being employed to determine the value. Numerical ranges and parameters recited in the specification and claims are intended to be approximations. Although the exact numerical values used in the description and claims are not to be construed as being perfect, they are intended to be used as approximations. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Therefore, it is understood that any numerical value stated in the specification and claims is subject to normal fluctuations. The term "about" is used herein to describe approximations which up to positive or negative 10%, 5%, 1%, or 0.5% of a particular value or range. Thus, for example, "about 90%" means up to positive or negative 9%, 4.5%, 0.9%, or 0.5% of 90%.

[0213] The term "INHBE", as used in the context of the present disclosure, refers to the well-known gene and polypeptide. The INHBE gene, INHBE mRNA sequence is readily available, for example, using GenBank, UniProt, Online Mendelian Inheritance in Man (OMIM), and the like.

[0214] The term "INHBE gene" can be a wild-type INHBE gene, or an INHBE gene mutant in which sequence variations exist. Numerous sequence variations in the INHBE gene have been identified and can be found, for example, in the NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp).

[0215] The terms "polypeptide" and "protein" are used interchangeably to refer to a string of at least two amino acid residues connected to one another by covalent bonds, e.g., peptide bonds, which can be recombinant, natural, or synthetic. A polypeptide can be linear or branched, it can contain modified amino acids, and it can be interrupted by non-amino acids. The term also encompasses an amino acid polymer that has been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0216] The term "target sequence", as used in the context of the present disclosure, refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is a product of RNA processing of a primary transcript.

[0217] In some embodiments, the target sequence is a nucleotide sequence consisting of no less than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 80, 100, or 150 contiguous linked nucleosides. In some alternative embodiments, the target sequence can comprise another shorter target sequence. In some embodiments, the target sequence can comprise one or more shorter target sequences. It is to be understood that two or more shorter target sequences contained in the same target sequence have the same characteristics, for example, target sequence I comprises target sequences I-1 to I-2.

[0218] In some embodiments, the target gene is the INHBE gene. In some embodiments, the target portion of the gene sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near the portion of the nucleotide sequence of the mRNA molecule formed during transcription of the INHBE gene.

[0219] In the art, "G," "C," "A," "T," and "U" generally represent the bases containing guanine, cytosine, adenine, thymine, and uracil, respectively, but it is also generally known in the art that "G," "C," "A," "T," and "U" each also generally represent the nucleotides containing guanine, cytosine, adenine, thymine, and uracil as the bases, respectively, which is a common way of representing deoxyribonucleic acid sequences and / or ribonucleic acid sequences, and thus, in the context of the present disclosure, the meaning of "G," "C," "A," "T," "U" includes the various possibilities described above, however, it is to be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as described further below) or to a nucleotide having an alternative substitution moiety, and "nucleotide," "ribonucleotide," and "ribonucleic acid" are used interchangeably in the present application, and "deoxyribonucleotide" and "2'-deoxyribonucleotide" are used interchangeably in the present application. One of skill in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide, including a nucleotide having such a replacement moiety. For example, and without limitation, a nucleotide comprising inosine as its base can base pair with a nucleotide comprising adenine, cytosine, or uracil. Thus, a nucleotide comprising uracil, guanine, or adenine can be replaced by a nucleotide comprising, for example, inosine in the nucleotide sequence of a dsRNA characterized herein. In another example, adenine and cytosine anywhere in an oligonucleotide can be replaced by guanine and uracil, respectively, to form a G-U wobble base pair with a target mRNA. Sequences comprising such replacement moieties are suitable for use in the compositions and methods characterized herein.

[0220] In the present application, a "5'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 5' carbon of the pentose sugar, which is the predominant type of nucleotide found free in living organisms. A "3'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 3' carbon of the pentose sugar, which can include, for example, adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-phosphorothioate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-phosphorothioate, 2'-O-methylguanosine-3'-phosphate, 2'-O-methylguanosine-3'-phosphorothioate, 2'-fluoroguanosine-3'-phosphate, 2'-fluoroguanosine-3'-phosphorothioate, 2'-O-methylcytidine-3'-phosphate, 2'-O-methylcytidine-3'-phosphorothioate, 2'-fluorocytidine-3'-phosphate, 2'-fluorocytidine-3'-phosphorothioate, 2'-O-methyluridine-3'-phosphate, 2'-O-methyluridine-3'-phosphorothioate, 2'-fluorouridine-3'-phosphate, 2'-fluorouridine-3'-phosphorothioate, 2'-deoxythymidine-3'-phosphorothioate. This definition can apply to modified or unmodified nucleoside phosphoramidite monomers.

[0221] The terms "iRNA," "RNAi agent," "iRNA agent," "RNA interference agent," used in the context of the present disclosure, are used interchangeably herein and refer to the term as defined herein includes siRNA and mediates the targeted cleavage of RNA transcripts by the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNAs modulate, e.g., inhibit, the expression of a target gene in a cell, such as a cell of a subject, e.g., a mammalian subject.

[0222] The terms "double-stranded ribonucleic acid," "double-stranded RNA (dsRNA) molecule," "dsRNA," used in the context of the present disclosure, can be used interchangeably. The term "dsRNA," refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientation with respect to a target gene, e.g., an INHBE gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, e.g., mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0223] Typically, a majority of the nucleotides of each strand of a dsRNA molecule are double-stranded ribonucleotides, but as detailed herein, each or both of the two strands can also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides. In addition, as used in the present disclosure, “double-stranded ribonucleic acid” can include ribonucleotides having chemical modifications, phosphate backbones, and the like. These modifications can include all types of modifications disclosed herein or known in the art.

[0224] The term “heteronucleotide” as used in the context of the present disclosure refers to a compound in which the position of the base on the ribose ring is altered, e.g., a compound in which the base is not attached to the 1’-position of the ribose ring, but is instead attached to the 2’-position or the 3’-position of the ribose ring.

[0225] In some embodiments, the double-stranded ribonucleic acids of the present disclosure are siRNAs that interact with an mRNA sequence transcribed from a target gene, e.g., an mRNA sequence transcribed from an INHBE gene, to direct cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNAs introduced into cells are cleaved by a type III endonuclease known as Dicer into siRNAs (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic double- stranded 3’ overhangs (Bernstein et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, which allows the complementary antisense strand to guide target recognition (Nykanen et al., (2001) Cell 107:309). Once bound to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al., (2001) Genes Dev. 15:188).

[0226] In the context of the present disclosure, a nucleotide sequence has a “nucleotide difference” with another nucleotide sequence if the base type of a nucleotide at a position is different in the former compared to the latter, e.g., a nucleotide base is A in the latter, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, in which case a nucleotide difference is recognized to exist between the two nucleotide sequences at that position. In some embodiments, a nucleotide difference is also recognized to exist at a position when a nucleotide analog is substituted for the nucleotide at the position.

[0227] The term "overhanging nucleotides," "overhang," as used in the context of the present disclosure, refers to one or more unpaired nucleotides that overhang from a duplex structure of a double-stranded ribonucleic acid when one 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. A "blunt end" or "blunt" means that there are no unpaired nucleotides at that end of the double-stranded ribonucleic acid, i.e., there is no nucleotide overhang. A "blunt-ended" double-stranded ribonucleic acid is a dsRNA that is double-stranded over its entire length, i.e., there is no nucleotide overhang at either end of the molecule. A "double-stranded region" refers to a region of a siRNA in which the sense strand and the antisense strand are complementary to form a double-stranded region of the siRNA.

[0228] The term "antisense strand" refers to the nucleic acid strand in a double-stranded ribonucleic acid that is substantially complementary to a target sequence (e.g., derived from a human INHBE mRNA). Where the region of complementarity is not perfectly complementary to the target sequence, mismatches are most tolerable in the terminal regions, and if present, they are usually within one or more regions of the terminus, e.g., 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' terminus.

[0229] The term "sense strand" refers to the nucleic acid strand in a double-stranded ribonucleic acid that contains a region that is substantially complementary to the antisense strand.

[0230] The terms "complementary" or "reverse complement" are used interchangeably and have the meaning well known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or, in RNA, uracil (U)); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair includes one purine and one pyrimidine. When the adenine on one strand always pairs with the thymine (or uracil) on the other strand, and the guanine always pairs with the cytosine, the two strands are considered to be complementary to each other, and the sequence of one strand can be inferred from the sequence of its complementary strand. Accordingly, a "mismatch" in the art means that the bases at the corresponding positions in a double-stranded nucleic acid are not paired in a complementary manner.

[0231] The terms "substantially reverse complement," "substantially complementary" mean that there are no more than 3 base mismatches between the two nucleotide sequences involved, i.e., there are 1, 2, or 3 base mismatches between the two nucleotide sequences involved; "perfectly complementary" means that there are no base mismatches between the two nucleotide sequences.

[0232] The terms "complementary," "fully complementary," and "substantially complementary" can be used in reference to base pairing between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0233] In the foregoing and hereinafter, particularly in describing the methods of making the double-stranded ribonucleic acid, the double-stranded ribonucleic acid modification, or the conjugate or pharmaceutical composition thereof of the present disclosure, unless otherwise indicated, a nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer used in the phosphoramidite solid phase synthesis according to the kind and order of nucleotides in the siRNA or siRNA conjugate to be prepared. The phosphoramidite solid phase synthesis is a method used in RNA synthesis well known to those skilled in the art. All the nucleoside monomers used in the present disclosure are commercially available.

[0234] The term "inhibit," can be used interchangeably with "reduce," "silence," "down- regulate," "suppress," and other similar terms, and includes inhibition at any level.

[0235] The term "inhibiting expression of an INHBE gene" includes inhibiting expression of any INHBE gene (such as, for example, a mouse INHBE gene, a rat INHBE gene, a monkey INHBE gene, or a human INHBE gene), as well as variants (e.g., naturally occurring variants) or mutants of an INHBE gene. Thus, the INHBE gene can be a wild-type INHBE gene, a mutant INHBE gene, or a transgenic INHBE gene in the context of a genetically manipulated cell, group of cells, or organism.

[0236] "Inhibiting expression of an INHBE gene" includes inhibition of an INHBE gene at any level, such as at least partial inhibition of expression of an INHBE gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0237] The term "independently" means that at least two groups (or ring systems) in a structure that have the same or similar range of values can have the same or different meanings in a particular instance. For example, substituent X and substituent Y are each independently hydrogen, hydroxyl, alkyl, or aryl, then when substituent X is hydrogen, substituent Y can be hydrogen, hydroxyl, alkyl, or aryl; similarly, when substituent Y is hydrogen, substituent X can be hydrogen, hydroxyl, alkyl, or aryl.

[0238] The term "alkyl" includes straight chain, branched chain, or cyclic saturated alkyl groups. For example, alkyl includes, but is not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, iso-butyl, sec-butyl, t-butyl, cyclobutyl, n-pentyl, cyclohexyl, and the like. By way of example, "C 1-6 The term "C 1-6 " in the context of "alkyl" means a straight chain, branched chain, or cyclic arrangement of groups containing 1, 2, 3, 4, 5, or 6 carbon atoms.

[0239] The term "alkoxy" refers herein to an alkyl group attached to the remainder of the molecule through an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, n-pentoxy, and the like.

[0240] The term "treat" means to cause a subject to contact (e.g., be administered) a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition, after the subject has contracted a disease, such that the symptoms of the disease are reduced as compared to not contacting, and does not necessarily mean that the symptoms of the disease are completely inhibited. To contract a disease means that the body has developed symptoms of the disease.

[0241] The term "prevent" means to cause a subject to contact (e.g., be administered) a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition, before the subject has contracted a disease, such that the symptoms of the disease are reduced as compared to not contacting, and does not necessarily mean that the subject does not contract the disease.

[0242] The term "effective amount" refers to the amount or dose of a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, prodrug, or pharmaceutical composition of the application that, upon single or multiple dose administration to a patient, produces the intended effect in the patient being treated or prevented. The effective amount can be readily determined by the attending physician, as one of ordinary skill in the art of medicine, by the consideration of numerous factors, such as species of mammal; its size, age, and general health; the specific disease involved; the degree or severity of the disease; the individual patient's response to treatment; the particular antibody employed; the mode of administration; the bioavailability of the formulation administered; the dose schedule; and any concomitant therapy being administered. The term "therapeutically effective amount" refers to the amount or dose of a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, conjugate, prodrug, or pharmaceutical composition of the application that, upon single or multiple dose administration to a patient, produces the intended therapeutic effect in the patient being treated or prevented.

[0243] The term "disease associated with abnormal expression of INHBE gene" is a disease or disorder associated with the involvement of INHBE. The term "disease associated with abnormal expression of INHBE gene" includes a disease, disorder or condition that would benefit from a reduction in expression of INHBE (i.e., "INHBE-associated disease"). In some embodiments, the disease associated with abnormal expression of INHBE gene is selected from the group consisting of obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes and metabolic syndrome. Exemplarily, reference is made to the following scientific literature, but not limited thereto: Jiali Cao, et al. Identification and validation of INHBE and P4HA1 as hub genes in non-alcoholic fatty liver disease. Biochemical and Biophysical Research Communications, 686 (2023) 149180; Masakazu Sugiyama, et al. Inhibin βE (INHBE) is a possible insulin resistance-associated hepatokine identified by comprehensive gene expression analysis in human liver biopsy samples. PLOS ONE, March 29, 2018; Aimee M. Deaton, et al. Rare loss of function variants in the hepatokine gene INHBE protect from abdominal obesity. Nat Commun. 2022, 13(1): 4319; Parsa Akbari et al. Multiancestry exome sequencing reveals INHBE mutations associated with favorable fat distribution and protection from diabetes. Nat Commun. 2022, 13: 4844.

[0244] The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to an auxiliary material that is widely employed in the pharmaceutical production field. The main purpose of using an excipient is to provide a pharmaceutical composition that is safe to use, stable in nature, and / or has a specific functionality, and also to provide a method by which, after administering the pharmaceutical to a subject, the active ingredient can be eluted at a desired rate, or the active ingredient is facilitated to be effectively absorbed in the body of the subject to which the drug is administered. The pharmaceutically acceptable excipient can be an inert filler or a functional ingredient that provides a certain function to the pharmaceutical composition, such as stabilizing the overall pH of the composition or preventing the degradation of the active ingredient in the composition. Non-limiting examples of the pharmaceutically acceptable excipient include, but are not limited to, a binder, a suspending agent, an emulsifying agent, a diluent (or a filler), a granulating agent, a gum, a disintegrant, a lubricant, an anti-adherent, a glidant, a wetting agent, a gelling agent, an absorption delaying agent, a dissolution inhibitor, an enhancer, an adsorbent, a buffer, a chelating agent, a preservative, a coloring agent, a flavoring agent, a sweetening agent, and the like.

[0245] The term "pharmaceutical composition" refers to a mixture of one or more double-stranded ribonucleic acids, double-stranded ribonucleic acid modifiers, prodrugs, or conjugates thereof of the present disclosure with a pharmaceutically acceptable excipient / carrier. The purpose of the pharmaceutical composition is to facilitate the administration of the double-stranded ribonucleic acids, double-stranded ribonucleic acid modifiers, or conjugates thereof of the present disclosure to an organism.

[0246] The pharmaceutical composition in the present disclosure can be prepared using any method known to those skilled in the art. For example, conventional mixing, dissolving, granulating, emulsifying, dragee-making, encapsulating, entrapping, and / or lyophilizing processes.

[0247] In the present disclosure, the administration route can be varied or adjusted in any applicable manner to meet the needs of the nature of the drug, the convenience of the patient and medical staff, and other relevant factors.

[0248] The term "individual," "patient," or "subject" used in the context of the present disclosure includes a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0249] The term "corresponding siRNA" as used in the context of the present disclosure refers to the same siRNA as previously mentioned, for example when referring to "the sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 herein and the antisense strand comprises the antisense strand of the corresponding siRNA" it refers to the sense strand and the antisense strand comprised are from the same siRNA shown in Table 1 and Table 1-1 herein, for example when the sense strand comprises 5'-AGCACAGCUAUCCAUCAGA-3' (SEQ ID NO: 25) the antisense strand comprises 5'-UCUGAUGGAUAGCUGUGCU-3' (SEQ ID NO: 121). Similarly, the term "corresponding siRNA modifier" refers to the same siRNA modifier as previously mentioned, for example when referring to "the sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 herein and the antisense strand comprises the antisense strand of the corresponding siRNA modifier" it refers to the sense strand and the antisense strand comprised are from the same siRNA modifier shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the same siRNA conjugate as previously mentioned, for example when referring to "the sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate" it refers to the sense strand and the antisense strand comprised are from the same siRNA conjugate shown in Table 3 herein. Further, in these contexts "comprises" includes the case where the sequences consist of these sequences.

[0250] Unless otherwise defined, all technical and scientific terms used in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0251] Double-stranded ribonucleic acid

[0252] A first aspect of the present disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of an INHBE gene. One strand of the double-stranded ribonucleic acid is an antisense strand that is complementary to a sequence of mRNA formed during expression of a target gene (i.e., the INHBE gene) for directing cleavage of the target mRNA (i.e., the transcription product of the INHBE gene). The other sense strand of the double-stranded ribonucleic acid comprises a double-stranded region that is partially complementary and fully complementary to the antisense strand forming the double-stranded ribonucleic acid.

[0253] In some embodiments, the double-stranded ribonucleic acid is cleaved into small fragments of dsRNA, i.e., siRNA, as a substrate for an endonuclease enzyme (Dicer). In some embodiments, the double-stranded ribonucleic acid is siRNA. The siRNA is assembled into an RNA-induced silencing complex (RISC) RISC complex, cleaves the target mRNA, and inhibits expression of the INHBE gene.

[0254] siRNAs that bind to the target mRNA are designed according to a target sequence derived from human INHBE mRNA (NM_031479.5). In some embodiments, the target sequence is selected from the group consisting of the nucleotide sequences set forth in any one of SEQ ID NOs: 1-6, 507-509, 610, 611. In some more specific embodiments, the target sequence is selected from the group consisting of the nucleotide sequences set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

[0255] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 1 comprises the nucleotide sequences set forth in SEQ ID NOs: 7 and 8.

[0256] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 2 comprises the nucleotide sequences set forth in SEQ ID NOs: 9-11.

[0257] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 3 comprises the nucleotide sequences set forth in SEQ ID NOs: 12 and 13.

[0258] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 4 comprises the nucleotide sequences set forth in SEQ ID NOs: 14-16, 504-506.

[0259] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 5 comprises the nucleotide sequences set forth in SEQ ID NOs: 17-19.

[0260] In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO: 6 comprises the nucleotide sequences set forth in SEQ ID NOs: 20-24.

[0261] In some embodiments, the antisense strand comprises a sequence B that differs from the reverse complement of a sequence consisting of at least 15 contiguous nucleotides in the target sequence by no more than 3 nucleotides. Specifically, a starting nucleotide is selected in the target sequence along the direction from the 5' end to the 3' end, and at least 15 nucleotides extending in the 3' direction including the starting nucleotide are selected as the binding region of the siRNA. The antisense strand comprises the reverse complement of the nucleotide sequence corresponding to the binding region. It is noted that the starting nucleotide can be a nucleotide at any position in the target sequence, as long as at least 15 contiguous nucleotides (including the nucleotide at the starting position) can be obtained by extending in the 3' direction from the starting nucleotide in the target sequence.

[0262] In the present disclosure, the nucleotide sequence of the antisense strand can be fully complementary or substantially complementary to the target sequence. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than 3 mismatched bases in the nucleotide sequence of the antisense strand and the target sequence. For example, there is 1, 2, or 3 mismatched bases. When the nucleotide sequence of the antisense strand is fully complementary to the target sequence, there are no mismatched bases in the nucleotide sequence of the antisense strand and the target sequence.

[0263] Further, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the antisense strand has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides.

[0264] As a preference, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21, or 23 nucleotides.

[0265] In some alternative embodiments, the antisense strand comprises a sequence B that is identical to the reverse complement of a sequence consisting of at least 15 contiguous nucleotides in the target sequence.

[0266] In some specific embodiments, the antisense strand comprises a sequence B that is identical to the reverse complement of a sequence consisting of 15-28 contiguous nucleotides in the target sequence. Preferably, the target sequence consists of 19-25 contiguous nucleotides, more preferably the target sequence consists of 19-23 contiguous nucleotides, and most preferably the target sequence consists of 19, 21, or 23 contiguous nucleotides.

[0267] In some alternative embodiments, the antisense strand comprises a sequence B that differs from the reverse complement of a sequence consisting of at least 15 contiguous nucleotides in the target sequence by 1 nucleotide.

[0268] In some embodiments, the antisense strand comprises a sequence B that differs by one nucleotide from the reverse complement of a sequence consisting of 15-28 nucleotides of the target sequence. Preferably, the target sequence consists of 19-25 contiguous nucleotides, more preferably, the target sequence consists of 19-23 contiguous nucleotides, most preferably, the target sequence consists of 19, 21, or 23 contiguous nucleotides.

[0269] In some embodiments, the nucleotide that differs is located at the 3' end of sequence B. In other embodiments, the nucleotide that differs is located at the 5' end of sequence B.

[0270] In some embodiments, the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 contiguous nucleotides of the target sequence. The sense strand comprises a region that is complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or essentially identical to the sequence of the region of the target sequence to which the antisense strand binds. Thus, the nucleotide sequence of the sense strand is identical to at least 15 contiguous nucleotides of the target sequence to which the antisense strand binds; alternatively, the nucleotide sequence of the sense strand differs by one, two, or three different nucleotides from at least 15 contiguous nucleotides of the target sequence to which the antisense strand binds.

[0271] Further, the sense strand consists of at least 15 nucleotides. In some embodiments, the sense strand consists of 15-28 nucleotides. For example, the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length.

[0272] Preferably, the sense strand consists of 19-25 nucleotides, more preferably, 19-23 nucleotides, most preferably, 19, 20, 21, or 23 nucleotides.

[0273] In some alternative embodiments, the sense strand comprises a sequence A that is identical to a sequence consisting of at least 15 contiguous nucleotides of the target sequence.

[0274] In some embodiments, the sense strand comprises a sequence A that is identical to a sequence consisting of 15-28 contiguous nucleotides of the target sequence. Preferably, the target sequence consists of 19-25 contiguous nucleotides, more preferably, the target sequence consists of 19-23 contiguous nucleotides, most preferably, the target sequence consists of 19, 20, 21, or 23 contiguous nucleotides.

[0275] In some alternative embodiments, the sense strand comprises a sequence A that differs by one nucleotide from a sequence consisting of at least 15 contiguous nucleotides of the target sequence.

[0276] In some specific embodiments, the sense strand comprises a sequence A which differs by one nucleotide from a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably, the sequence consists of 19-25 consecutive nucleotides on the target sequence, more preferably, the sequence consists of 19-23 consecutive nucleotides on the target sequence, most preferably, the sequence consists of 19, 20, 21 or 23 consecutive nucleotides on the target sequence.

[0277] In some specific embodiments, the nucleotide which is different is located at the 3' end of sequence A. In other specific embodiments, the nucleotide which is different is located at the 5' end of sequence A.

[0278] In the present disclosure, the length of the sense strand can be the same or different from the length of the antisense strand.

[0279] In some embodiments, the length of the sense strand is the same as the length of the antisense strand, specifically, the length ratio of the sense strand / antisense strand is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27 or 28 / 28. Preferably, the length ratio of the sense strand / antisense strand is 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24 or 25 / 25, more preferably 19 / 19, 20 / 20, 21 / 21, 22 / 22 or 23 / 23, most preferably 19 / 19, 21 / 21 or 23 / 23.

[0280] In some embodiments, the length of the sense strand is different from the length of the antisense strand. For example, the length ratio of the sense strand / antisense strand is 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 19, 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25 or 23 / 26, etc.; in some preferred embodiments, the length ratio of the sense strand / antisense strand is 19 / 21, 20 / 22, 20 / 23, or 21 / 23.

[0281] In the present disclosure, the sense strand and the antisense strand can be fully complementary or substantially complementary, when they are substantially complementary, there are no more than 3 mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.

[0282] In some embodiments, after the sense strand and the antisense strand are complementary to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has overhanging nucleotides extending beyond the double-stranded region. The number of overhanging nucleotides can be one or more, e.g., 1, 2, or 3. In addition, the overhanging 1-3 nucleotides can be located at the 5' end, the 3' end, or both ends of any of the antisense strand or the sense strand, and each of the overhanging nucleotides can be any type of nucleotide. For example, in the case where the sense strand consists of a sequence A+D of 21 in length and the antisense strand consists of a sequence B+E of 21 in length, the nucleotides 1-19 of the sequence A are completely reverse complementary to the nucleotides 1-19 of the sequence B in the direction from the 5' end to the 3' end, and thus the sequence D and the sequence E form overhanging nucleotides at the 3' end of the strand where they are located, respectively. For example, in the case where the sense strand consists of a sequence A of 19 in length and the antisense strand consists of a sequence B+E of 21 in length, the nucleotides 1-19 of the sequence A are completely reverse complementary to the nucleotides 1-19 of the sequence B in the direction from the 5' end to the 3' end, and thus the sequence E forms an overhanging nucleotide at the 3' end of the antisense strand.

[0283] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the sense strand has 1-3 overhanging nucleotides extending beyond the double-stranded region, and the 3' end of the antisense strand forms a blunt end.

[0284] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-3 overhanging nucleotides extending beyond the double-stranded region, and the 3' end of the sense strand forms a blunt end.

[0285] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of both the sense strand and the antisense strand has 1-3 overhanging nucleotides extending beyond the double-stranded region.

[0286] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of both the sense strand and the antisense strand forms a blunt end.

[0287] In some embodiments, the sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0288] In some embodiments, the sense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 25-120, 493, 510-522, and 582-586, 612, and the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 121-216, 449-453, 494, 523-536, 587-592, 607-609, 613, 618-620, 623.

[0289] In some embodiments, the double-stranded ribonucleic acid is selected from any of the siRNAs set forth in Table 1 and Table 1-1. In some embodiments, the siRNA of the present disclosure has an inhibition rate of at least about 10% on the INHBE gene, which can be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between any two of these values.

[0290] The siRNAs provided by the present disclosure have high specificity in binding to the target mRNA (INHBE mRNA), have good silencing activity on the target mRNA, can significantly inhibit the expression of the INHBE gene, and are used for treating INHBE-related diseases including obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, and other yet unidentified related diseases, pathologies, or syndromes.

[0291] In some embodiments, the present disclosure provides a siRNA composition comprising any one or a combination of two or more of the siRNAs set forth in Table 1 and Table 1-1.

[0292] In some embodiments, each nucleotide of the sense strand is independently a modified nucleotide or an unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0293] In some embodiments, any two nucleotides connected in the sense strand are connected by a phosphodiester bond, a phosphorothioate bond, or a phosphorodithioate bond. In some embodiments, any two nucleotides connected in the antisense strand are connected by a phosphodiester bond, a phosphorothioate bond, or a phosphorodithioate bond.

[0294] In some embodiments, the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0295] In this context, the structure of the 5' terminal nucleotide of the antisense strand when it is not linked to a 5' phosphate group, a 5' phosphate derivative group, or (invAb) (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group) is shown in Formula X:

[0296] wherein Base represents a base, e.g., A, U, G, C, or T; and R is a hydroxyl group or is substituted with various groups known to those skilled in the art, e.g., R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0297] The structure of the 5' terminal nucleotide of the antisense strand when it is linked to a 5' phosphate group or a 5' phosphate derivative group is shown below:

[0298] wherein Formula (1) shows the structure of the 5' terminal nucleotide linked to a 5' phosphate group, Formula (2) shows the structure of the 5' terminal nucleotide linked to an EVP, Formula (3) shows the structure of the 5' terminal nucleotide linked to a 5' methylene phosphate group, Base represents a base, e.g., A, U, G, C, or T; and R' is a hydroxyl group or is substituted with various groups known to those skilled in the art, e.g., R' can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino.

[0299] In some embodiments, the sense strand can comprise one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more of the terminal ends of the nucleotide sequence of an siRNA disclosed herein. In some cases, a capping residue can provide certain beneficial properties to the siRNA, such as protection against exonuclease degradation. In some embodiments, an inverted abasic deoxyribose residue (invAb) is added as a capping residue. In some embodiments, the capping residue occurs at the 3' terminal end of the sense strand or at both the 5' and 3' terminal ends.

[0300] In some embodiments, one or more inverted abasic deoxyribose residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic deoxyribose residues (invAb) are added to the 5' end of the sense strand and the 3' end of the sense strand. The inverted abasic deoxyribose residues can be linked via a phosphoester linkage, a phosphorothioate linkage, or other internucleoside linkage. In describing the modification site in a modification method, (invAb) is not counted as the 1st site of the sequence. In some embodiments, an inverted abasic deoxyribose residue (invAb) (also referred to as an "inverted abasic site" in the art) can be added. Among them, the chemical structure of the inverted abasic deoxyribose residue is as follows:

[0301] Formula B when (invAb) is located at the 3' end of the siRNA; Formula C when (invAb) is located at the 5' end of the siRNA:

[0302] Double-stranded ribonucleic acid modifier

[0303] The second aspect of the present disclosure provides a double-stranded ribonucleic acid modifier. Further, the double-stranded ribonucleic acid modifier is an siRNA modifier. The siRNA modifier can improve the stability of the siRNA while maintaining high INHBE mRNA inhibition activity.

[0304] In some embodiments, the double-stranded ribonucleic acid modifier comprises at least one modification of a nucleotide. The modification of the nucleotide is selected from at least one of a modification of a ribose group and a modification of a base. In some embodiments, the "modification of a nucleotide" refers to a nucleotide or a nucleotide derivative in which the 2' position hydroxyl group of the ribose group of the nucleotide is replaced by another group, or a nucleotide in which the base on the nucleotide is a modified base. The modification of the nucleotide does not cause the function of the siRNA to be significantly weakened or lost in inhibiting gene expression. For example, the modified nucleotide disclosed in J. K. Watts, G. F. Deleavey, and M. J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20):842-55 can be selected. The stability of the siRNA can be improved by the modification of the nucleotide, and its high inhibition efficiency on the INHBE gene is maintained.

[0305] Exemplarily, the modified nucleotide has the structure as shown below:

[0306] wherein Base represents a base, such as A, U, G, C, or T. The 2' position of the ribose group is substituted with R. The 2' position of the ribose group can be substituted with various groups known to one of skill in the art, such as, for example, a 2'-fluoro (2'-F) modified nucleotide, a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-deoxyribonucleotide.

[0307] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'- OMe, 2'-O-CH3) modified nucleotide, and the like.

[0308] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a 2'- methoxyethoxy (2'-O-CH2-CH2-O-CH3) modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, and the like.

[0309] In some embodiments, the 2'-substituted alkyl modified nucleotide is a 2'-CH2- CH2-CH=CH2 modified nucleotide, and the like.

[0310] In some embodiments, the modification of the nucleotide is a modification of the base. The modification of the base can be various types of modifications known to one of skill in the art. Illustratively, the modification of the base includes, but is not limited to, m 6 A, Ψ, m 1 A, m 5 A, ms 2 i 6 A, i 6 A, m 3 C, m 5 C, ac 4 C, m 7 G, m 2,2 G, m 2 G, m 1 G, Q, m 5 U, mcm 5 U, ncm 5 U, ncm 5 Um, D, mcm 5 s 2 U, Inosine (I), hm 5 C, s 4 U, s 2 U, Azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or a derivative thereof.

[0311] In some embodiments, a nucleotide derivative refers to a compound that can replace a nucleotide in a nucleic acid, but has a structure different from that of an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. In some embodiments, a nucleotide derivative can be an iso-nucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide. A BNA refers to a constrained or inaccessible nucleotide. A BNA can contain a five-, six-, or seven-membered ring with a “fixed” C3’-endo sugar puckering bridged structure. The bridge is typically incorporated at the 2’-, 4’-position of the ribose to provide a 2’,4’-BNA nucleotide, such as LNA, ENA, cET, etc.

[0312] LNA is shown in Formula (4), ENA is shown in Formula (5), and cET is shown in Formula (6):

[0313] wherein Base refers to a base.

[0314] An acyclic nucleotide is a class of nucleotides in which the sugar ring of a nucleotide is opened, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), wherein UNA is shown in Formula (7) and GNA is shown in Formula (8):

[0315] In Formula (7) and Formula (8) above, Base refers to a base, and R is selected from H, OH, or an alkoxy group (O-alkyl).

[0316] In some embodiments, a nucleotide derivative modification refers to a nucleotide in a nucleic acid being replaced by a nucleotide derivative. Exemplarily, the nucleotide derivative is selected from an iso-nucleotide, LNA, ENA, cET, UNA, or GNA.

[0317] In some embodiments, a nucleotide in a nucleic acid is replaced by an iso-nucleotide, which is also referred to as an iso-nucleoside modification in the context of the present disclosure. In some embodiments, an iso-nucleoside modification includes incorporating an iso-nucleoside at one or more positions of a sense strand and / or an antisense strand of an siRNA to be modified to replace a natural nucleoside at the corresponding position.

[0318] In some embodiments, an iso-nucleoside modification employs a D-iso-nucleoside modification. In other embodiments, an iso-nucleoside modification employs an L-iso-nucleoside modification. In yet other embodiments, an iso-nucleoside modification employs both a D-iso-nucleoside modification and an L-iso-nucleoside modification.

[0319] In some embodiments, the double-stranded ribonucleic acid modifier comprises a modification of a phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to substitution of one oxygen atom in the phosphodiester bond with a sulfur atom to form a phosphorothioate bond. The phosphorothioate bond can stabilize the double-stranded structure of the siRNA, maintaining the specificity of base pairing. Exemplarily, the phosphorothioate bond structure is shown as follows:

[0320] The phosphorodithioate bond structure is shown as follows:

[0321] In some embodiments, the double-stranded ribonucleic acid modifier comprises a chemical modification of at least one of the following:

[0322] (1) a modification of at least one nucleotide in the sense strand,

[0323] (2) a modification of a phosphodiester bond at at least one position in the sense strand,

[0324] (3) a modification of at least one nucleotide in the antisense strand,

[0325] (4) a modification of a phosphodiester bond at at least one position in the antisense strand.

[0326] Further, the double-stranded ribonucleic acid modifier is an siRNA modifier comprising a chemical modification of at least one of (1)-(4).

[0327] In the present disclosure, after sequence A in the sense strand and sequence B in the antisense strand are complementary to form a double-stranded region, the 3' ends of sequence A and sequence B can be any one of the following:

[0328] (1) the 3' ends of sequence A and sequence B are both blunt ends;

[0329] (2) the 3' end of sequence A has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of sequence B is a blunt end;

[0330] (3) the 3' end of sequence B has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of sequence A is a blunt end;

[0331] (4) the 3' end of sequence A has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of sequence B has 1-3 overhanging nucleotides extending out of the double-stranded region.

[0332] In some embodiments, the nucleotide sequence of the sense strand is the sequence shown as sequence A, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B.

[0333] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, 1-3 nucleotides are added to the 3' end of at least one of the sense strand and the antisense strand as overhanging nucleotides. Among them, the 1-3 nucleotides connected to the 3' end of the sense strand constitute sequence D, and the 1-3 nucleotides connected to the 3' end of the antisense strand constitute sequence E. Accordingly, the nucleotide sequence of the sense strand is the sequence shown as sequence A connected with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B connected with sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown as sequence A, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B connected with sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown as sequence A connected with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B.

[0334] For example, 2 deoxyribonucleotides (TT) are added to the 3' end of the sense strand sequence A as sequence D, and 2 deoxyribonucleotides (TT) are added to the 3' end of the antisense strand sequence B as sequence E. Alternatively, only 2 deoxyribonucleotides (TT) are added to the 3' end of the antisense strand as sequence E. Alternatively, only 2 deoxyribonucleotides (TT) are added to the 3' end of the sense strand sequence A as sequence D.

[0335] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, a sequence D consisting of 1-3 nucleotides is added to the 3' end of the sense strand as overhanging nucleotides. Then, when the nucleotide sequence formed by sequence A connected with sequence D is completed after chemical modification, the sequence D consisting of 1-3 nucleotides is excluded. Accordingly, in the double-stranded ribonucleic acid modifier, the nucleotide sequence of the sense strand is the sequence shown as sequence A, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B. Alternatively, in the double-stranded ribonucleic acid modifier, the nucleotide sequence of the sense strand is the sequence shown as sequence A, and the nucleotide sequence of the antisense strand is the sequence shown as sequence B connected with sequence E. In some embodiments, when sequence A has 1-3 overhanging nucleotides extending out of the double-stranded region at the 3' end after being complementary to sequence B to form a double-stranded region, the overhanging nucleotides at the 3' end in sequence A are excluded as the nucleotide sequence of the sense strand. The sequence excluding the overhanging nucleotides at the 3' end is referred to as sequence A'. Accordingly, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modifier is the sequence shown as sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modifier is the sequence shown as sequence B. Alternatively, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modifier is the sequence shown as sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modifier is the sequence shown as sequence B connected with sequence E.

[0336] In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleic acid modifier comprises the following modifications: the ribose nucleotides at positions 7, 9, 10, and 11 of the sense strand are 2'-fluoro-modified ribose nucleotides; the ribose nucleotides at other positions of the sense strand are 2'-methoxy-modified ribose nucleotides;

[0337] In some embodiments, along the 5' end to the 3' end direction, the ribose nucleotides at positions 5, 7, 8, and 9 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0338] In some embodiments, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, and 11 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0339] In some embodiments, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, 11, and 13 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0340] In some embodiments, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 8, and 9 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0341] In some embodiments, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0342] In some embodiments, along the 3' end to the 5' end direction, the ribose nucleotides at positions 11, 12, 13, and 17 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides.

[0343] In some embodiments, along the 3' end to the 5' end direction, the ribose nucleotides at positions 10, 11, 12, and 16 of the sense strand are 2'-F-modified ribose nucleotides, and the ribose nucleotides at other positions of the sense strand are 2'-O-CH3-modified ribose nucleotides

[0344] In this context, the 5' terminal nucleotide of the sense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group or an inverted abasic deoxyribose residue (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), the structure of which is shown as Formula X:

[0345] wherein Base represents a base, such as A, U, G, C, or T; R is a hydroxyl group or is substituted with various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0346] In some embodiments, neither the 5' terminal nor the 3' terminal nucleotide of the sense strand is linked to an inverted abasic deoxyribose residue, or, the 5' terminal or 3' terminal nucleotide of the sense strand is linked to an inverted abasic deoxyribose residue, or, the 5' terminal and 3' terminal nucleotides of the sense strand are each linked to an inverted abasic deoxyribose residue.

[0347] In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at positions: between the 1st and 2nd nucleotides from the 5' end, between the 2nd and 3rd nucleotides from the 5' end, between the 1st and 2nd nucleotides from the 3' end, and between the 2nd and 3rd nucleotides from the 3' end, in the 5' end to 3' end direction.

[0348] In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at positions: between the 1st and 2nd nucleotides from the 5' end, between the 2nd and 3rd nucleotides from the 5' end, between the 1st and 2nd nucleotides from the 3' end, and between the 2nd and 3rd nucleotides from the 3' end, in the 5' end to 3' end direction.

[0349] In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at positions: between the 1st and 2nd nucleotides from the 5' end; between the 2nd and 3rd nucleotides from the 5' end; between the inverted abasic deoxyribose residue and the 1st nucleotide from the 3' end; and between the 2nd and 3rd nucleotides from the 3' end, in the 5' end to 3' end direction, when the 3' terminal nucleotide of the sense strand is linked to an inverted abasic deoxyribose residue.

[0350] In some embodiments, along the 5' end to 3' end direction, the sense strand of the siRNA modification comprises phosphorothioate linkages at positions between the 5' end starting reverse abasic deoxyribose residue and the 1st nucleotide; between the 5' end starting 1st nucleotide and the 2nd nucleotide; between the 3' end starting reverse abasic deoxyribose residue and the 1st nucleotide.

[0351] In some specific embodiments, the siRNA modification sense strand has a structure as set forth in any one of (a1)-(a 14 ) above.

[0352] In some embodiments, along the 5' end to 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribose nucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribose nucleotides.

[0353] In some embodiments, along the 5' end to 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribose nucleotides at positions 2, 6, 8, 9, 14 and 16 of the antisense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribose nucleotides.

[0354] In some embodiments, along the 5' end to 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribose nucleotides at positions 2, 14 and 16 of the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 of the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribose nucleotides.

[0355] In some embodiments, along the 5' end to 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribose nucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 7 of the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribose nucleotides.

[0356] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications in the 5' end to 3' end direction: the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-0-CH3 modified ribonucleotides.

[0357] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications in the 5' end to 3' end direction: the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the remaining positions of the antisense strand are 2'-0-CH3 modified ribonucleotides.

[0358] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications in the 5' end to 3' end direction: the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-0-CH3 modified ribonucleotides.

[0359] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications in the 5' end to 3' end direction: the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-0-CH3 modified ribonucleotides.

[0360] In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate linkages at the following positions in the 5' end to 3' end direction: between the 1st and 2nd nucleotides from the 5' end, between the 2nd and 3rd nucleotides from the 5' end, between the 1st and 2nd nucleotides from the 3' end, and between the 2nd and 3rd nucleotides from the 3' end.

[0361] In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate linkages and phosphorodithioate linkages at the following positions in the 5' end to 3' end direction: between the 1st and 2nd nucleotides from the 5' end is a phosphorothioate linkage, between the 2nd and 3rd nucleotides from the 5' end is a phosphorothioate linkage, between the 1st and 2nd nucleotides from the 3' end is a phosphorodithioate linkage.

[0362] In some embodiments, the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group, in the direction from the 5' end to the 3' end.

[0363] In the present description, in the description of the modification method of the sense strand or the antisense strand of the siRNA modifier, when the base is "T", the base "T" means deoxyribonucleotide according to the general understanding of those skilled in the art, and there is no modification of the base "T" by 2'-F, 2'-O-CH3, nucleotide derivative, etc.

[0364] In the present description, when the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), the structure of the 5' terminal nucleotide is shown as Formula X.

[0365] In some specific embodiments, the antisense strand of the siRNA modifier has the structure shown in any one of (b1)-(b 32 ) described above.

[0366] In some alternative embodiments, the sense strand and the antisense strand are selected from the following combinations:

[0367] The sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modifier.

[0368] Preferably, the sense strand and the antisense strand are selected from the following combinations:

[0369] The sense strand comprises the sense strand of any one of siRNA 414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, siRNA 488-siRNA 489 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modifier.

[0370] In some embodiments, the double-stranded ribonucleic acid modifier includes but is not limited to the siRNA modifier as shown in Table 2.

[0371] In some specific embodiments, the siRNA modification of the present disclosure has an inhibition rate of at least about 20% on the INHBE gene, which can be at least about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between any two of these values. In some embodiments, the siRNA modification of the present disclosure has an IC50 of less than about 1.5 nM, which can be less than about 1.4 nM, about 1.3 nM, about 1.2 nM, about 1.1 nM, about 1 nM, about 0.9 nM, about 0.8 nM, about 0.7 nM, about 0.6 nM, about 0.5 nM, about 0.4 nM, about 0.3 nM, about 0.2 nM, about 0.1 nM, about 0.05 nM. 50 In some specific embodiments, the siRNA modification of the present disclosure has an inhibition rate of at least about 20% on the INHBE gene, which can be at least about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between any two of these values. In some embodiments, the siRNA modification of the present disclosure has an IC50 of less than about 1.5 nM, which can be less than about 1.4 nM, about 1.3 nM, about 1.2 nM, about 1.1 nM, about 1 nM, about 0.9 nM, about 0.8 nM, about 0.7 nM, about 0.6 nM, about 0.5 nM, about 0.4 nM, about 0.3 nM, about 0.2 nM, about 0.1 nM, about 0.05 nM.

[0372] Double-stranded ribonucleic acid conjugate

[0373] The third aspect of the present disclosure provides a double-stranded ribonucleic acid conjugate, which is obtained by conjugating the double-stranded ribonucleic acid provided in the first aspect of the present disclosure or the double-stranded ribonucleic acid modification provided in the second aspect of the present disclosure with a conjugating group.

[0374] In the present disclosure, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end. In some embodiments, the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate has 1-3 overhanging nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate forms a blunt end. In the present disclosure, "the 3' end of the sense strand forms a blunt end" includes the case where the 3' end of the sense strand originally has a blunt end, and the case where the 3' end of the sense strand originally has an overhanging end, and the overhanging end is removed to form a blunt end.

[0375] In some preferred embodiments, the double-stranded ribonucleic acid conjugate is obtained by conjugating the double-stranded ribonucleic acid modification with a conjugating group. In this case, the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are complementary to form a double-stranded region of the double-stranded ribonucleic acid modification, and the 3' end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end. The conjugating group is conjugated to the 3' end of the sense strand having a blunt end to form the double-stranded ribonucleic acid conjugate.

[0376] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. And the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected with a conjugate group to form a double-stranded RNA conjugate.

[0377] Exemplarily, the siRNA conjugate as shown in N-ER-FY046176M47L96 has a blunt end sequence at the 3' end of the sense strand, and the blunt end is used as a nucleotide sequence for connecting the L96 conjugate group (i.e. connecting L96 through a phosphodiester bond after sequence synthesis (invAb)), therefore, the sequence of the siRNA conjugate is: the sense strand is mUsmUsCfmCmAmUUfCfUfmGmCmCmGmUmCmUmUmCmAs(invAb)L96 (SEQ ID NO: 576), and the antisense strand is EVPmUsGfsmAmAmGmACfmGmGCfmAmGmAAfmUmGmGmAmAsmAsmG (SEQ ID NO: 561).

[0378] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. And the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected with a conjugate group to form a double-stranded RNA conjugate.

[0379] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. And the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected with a conjugate group to form a double-stranded RNA conjugate.

[0380] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. And the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected with a conjugate group to form a double-stranded RNA conjugate.

[0381] Exemplarily, the sense strand of the double-stranded RNAi agent is the sequence as shown in sequence A, and the antisense strand is the sequence as shown in sequence B. Wherein, the 3' end of sequence A has overhanging nucleotides extending out of the double-stranded region, and the sequence after excluding the overhanging nucleotides at the 3' end of sequence A (also referred to as sequence A') is used as the nucleotide sequence for connecting the conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded RNAi conjugate is the sequence as shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence as shown in sequence B.

[0382] Exemplarily, the sense strand of the double-stranded RNAi agent is the sequence as shown in sequence A, and the antisense strand is the sequence as shown in sequence B. Wherein, the 3' end of sequence A has overhanging nucleotides extending out of the double-stranded region, and the sequence after excluding the overhanging nucleotides at the 3' end of sequence A (also referred to as sequence A') is used as the nucleotide sequence for connecting the conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded RNAi conjugate is the sequence as shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence as shown in sequence B.

[0383] Exemplarily, the siRNA conjugate as shown in N-ER-FY046108M2L96, the 3' end of the sense strand originally has overhanging nucleotides-smAsmU extending out of the double-stranded region, and the mUsmUsmGmGmAmGUfmGAfAfGfmAmGmAmCmCmAmAmA blunt end sequence formed after excluding the overhanging-smAsmU nucleotides at the 3' end of the sense strand is used as the nucleotide sequence for connecting the L96 conjugate group (i.e. connecting L96 through phosphodiester bond after sequence synthesis to the blunt end), thus, the sequence of the siRNA conjugate is: the sense strand is mUsmUsmGmGmAmGUfmGAfAfGfmAmGmAmCmCmAmAmAL96 (SEQ ID NO: 445), and the antisense strand is P1mUsUfsmUmGmGUfmCmUmCmUmUmCmACfmUCfmCmAmAsmAsmG (SEQ ID NO: 330).

[0384] In some alternative embodiments, the sense strand of the double-stranded RNAi conjugate has the structure as shown in any one of (d1)-(d 11 ) is:

[0385] (d1) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0386] (d2) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L96-3’,

[0387] (d3) 5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0388] (d4) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0389] (d5) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15-mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0390] (d6) 5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0391] (d7) 5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0392] (d8) 5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-L96-3’,

[0393] (d9) 5’-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN13-mN 14 -mN 15 -mN 16-mN 17 -mN 18 -mN 19 -(s)-(invAb)-L96-3’,

[0394] (d 10 )5’-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3’,

[0395] (d 11 )5’-mN 21 -mN 20 -mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3’,

[0396] (d 12 )5’-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 f-N 11 f-N 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3’,

[0397] wherein N1-N 21independently selected from the group consisting of ribonucleotides having bases A, U, C, or G, lower case letter m indicates that the ribonucleotide adjacent to the right of the letter m is a 2'-0-CH3 modified ribonucleotide, lower case letter f indicates that the ribonucleotide adjacent to the left of the letter f is a 2'-F modified ribonucleotide, (invAb): indicates an inverted abasic deoxyribose residue, -(s)- indicates that the two nucleotides adjacent to the front and back are linked by a phosphorothioate diester bond. L96 is a conjugate group of GalNAc as shown in Formula I.

[0398] In some alternative embodiments, the antisense strand of the double-stranded ribonucleic acid conjugate has a structure as shown in any one of (b1)-(b 32 ) above.

[0399] Further, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, wherein the siRNA molecule in the siRNA conjugate linked to the conjugate group can be an unmodified siRNA or an siRNA modification. The siRNA molecule modified by the conjugate group has better tissue and organ targeting and promotes endocytosis, while maintaining high inhibitory activity and stability, which can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, so as to achieve the purpose of reducing toxicity and reducing cost. Alternatively, any one of the siRNA molecules shown in Table 1, Table 1-1 or Table 2 is linked to the conjugate group to obtain a double-stranded ribonucleic acid conjugate.

[0400] The conjugation site of the siRNA to the conjugate group can be at the 3' end or 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugate group is at the 3' end of the sense strand of the siRNA.

[0401] In some embodiments, the conjugate group can be attached to the phosphate group, 2'-position hydroxyl group, or base of the nucleotide. In some embodiments, the conjugate group can also be attached to the 3'-position hydroxyl group, at which time the nucleotides are connected by 2', 5'-phosphodiester bonds. When the conjugate group is attached to the end of the siRNA chain, the conjugate group is usually attached to the phosphate group of the nucleotide; when the conjugate group is attached to the internal sequence of the siRNA, the conjugate group is usually attached to the ribose sugar ring or base. Various attachment methods can be referred to in the literature: Muthiah Manoharan et. al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

[0402] In the present disclosure, the conjugate group can be a ligand commonly used in the field of siRNA administration. In some embodiments, the conjugate group can be selected from one or more of the following targeting molecules or ligands formed by derivatives thereof: lipophilic molecules such as cholesterol, bile acid, vitamins (such as vitamin E), different chain length lipid molecules; polymers such as polyethylene glycol; polypeptides such as transmembrane peptides; aptamers; antibodies; quantum dots; sugars such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folate; receptor ligands expressed by liver parenchymal cells such as asialoglycoprotein, asialo sugar residues, lipoproteins (such as high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0403] In some specific embodiments, the conjugate group has a structure selected from Formula I, Formula III, Formula IV, Formula V, Formula VI, Formula VII, Formula VIII, and Formula IX.

[0404] The conjugate group shown in Formula I is GalNAc, which has liver targeting properties and can deliver siRNA molecules to liver tissue with high specificity, specifically inhibiting the high expression of INHBE gene in the liver.

[0405] In some specific embodiments, GalNAc is conjugated and connected to the 3' end of the sense strand through a phosphodiester bond, obtaining an siRNA conjugate with the structure shown below:

[0406] wherein the double helix structure is an unmodified siRNA or an siRNA modification.

[0407] In some embodiments, the double-stranded ribonucleic acid conjugate includes, but is not limited to, the siRNA conjugates as shown in Table 3.

[0408] In some specific embodiments, the siRNA conjugate of the present disclosure has an inhibition rate of at least about 20% on the INHBE gene, which can be at least about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between any two of these values.

[0409] Prodrugs

[0410] The fourth aspect of the present disclosure provides a prodrug. The double-stranded ribonucleic acid of the first aspect, the double-stranded ribonucleic acid modification of the second aspect, and the double-stranded ribonucleic acid conjugate of the third aspect can also exist in the form of a prodrug, which can be converted into the double-stranded ribonucleic acid, the double-stranded ribonucleic acid modification, or the double-stranded ribonucleic acid conjugate of the present disclosure in vivo or in vitro.

[0411] As used in the present specification, “prodrug” refers to a compound that is converted into a pharmacologically active compound after in vivo transformation. For example, the siRNA modification or conjugate with M6 mode modification in the present application is a prodrug of the siRNA modification or conjugate with M2 mode modification, because the difference between M2 mode modification and M6 mode modification is whether there is P1 at the 5' end of the antisense strand, and the same is true for the relationship between M7 mode modification and M3 mode modification. Therefore, the double-stranded ribonucleic acid herein includes its corresponding prodrug.

[0412] Pharmaceutical compositions

[0413] The fifth aspect of the present disclosure provides a pharmaceutical composition, which includes one or more of the double-stranded ribonucleic acid of the first aspect, the double-stranded ribonucleic acid modification of the second aspect, the double-stranded ribonucleic acid conjugate of the third aspect, and the prodrug of the fourth aspect.

[0414] In some embodiments, the pharmaceutical composition contains the siRNA or prodrug as described above as an active ingredient and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition further contains one or more additional therapeutic agents, for example, a therapeutic agent that is beneficial for preventing or treating a disease, disorder, or symptom that is mediated at least in part by the expression of the INHBE gene. In the present disclosure, the purpose of using the pharmaceutical composition is to facilitate the administration to an organism, to facilitate the absorption of the active ingredient, and to thereby exert a biological activity. The pharmaceutical composition of the present disclosure can be administered by any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid preparation, oral liquid preparation), rectal, inhalation, implantation, topical (e.g., ocular) administration, and the like. Non-limiting examples of the oral solid preparation include, but are not limited to, powder, capsule, tablet, granule, tablet, and the like. Non-limiting examples of the liquid preparation for oral or mucosal administration include, but are not limited to, suspension, tincture, elixir, solution, and the like. Non-limiting examples of the preparation for topical administration include, but are not limited to, emulsion, gel, ointment, cream, patch, paste, foam, lotion, drop, or serum preparation. Non-limiting examples of the preparation for parenteral administration include, but are not limited to, injection solution, injection dry powder, injection suspension, injection emulsion, and the like. The pharmaceutical composition of the present disclosure can also be prepared into a controlled release or delayed release dosage form (e.g., liposome or microsphere).

[0415] In the present disclosure, the administration route can be varied or adjusted in any applicable manner to meet the needs of the nature of the drug, the convenience of the patient and medical staff, and other relevant factors.

[0416] Pharmaceutical use

[0417] The sixth aspect of the present disclosure provides at least one use of the double-stranded ribonucleic acid, the double-stranded ribonucleic acid modifier, the double-stranded ribonucleic acid conjugate, the prodrug, and the pharmaceutical composition as follows:

[0418] (1) inhibiting the expression of the INHBE gene, or preparing a medicament for inhibiting the expression of the INHBE gene;

[0419] (2) for preventing or treating a disease associated with abnormal expression of the INHBE gene, or preparing a medicament for preventing or treating a disease associated with abnormal expression of the INHBE gene;

[0420] (3) for treating a subject having a disease that would benefit from a reduction in the expression of the INHBE gene, or preparing a medicament for treating a subject having a disease that would benefit from a reduction in the expression of the INHBE gene.

[0421] The present disclosure further provides use of the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), or prodrug or pharmaceutical composition thereof in at least one of (1)-(3) above.

[0422] In the present disclosure, the INHBE gene is abnormally expressed, which causes one or more of the following INHBE gene abnormal expression related diseases: obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, glucose intolerance, hyperglycemia, type II diabetes and metabolic syndrome, etc.

[0423] The siRNA molecule causes the expression of the INHBE gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, achieving treatment of the INHBE gene abnormal expression related disease.

[0424] In some embodiments, the present disclosure provides a method of inhibiting expression of an INHBE gene in a cell, comprising contacting the double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate, prodrug or pharmaceutical composition with the cell.

[0425] Further, the method of inhibiting expression of an INHBE gene in a cell is introducing the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug or pharmaceutical composition into the cell.

[0426] In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.

[0427] In some embodiments, the present disclosure provides a method of preventing or treating a disease, comprising administering the double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate, prodrug or pharmaceutical composition to a subject or patient.

[0428] Further, the method for preventing or treating a disease is administering the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug, or pharmaceutical composition to a subject or patient.

[0429] In the present disclosure, a "subject" includes or human or non-human animal, preferably a vertebrate, and more preferably a mammal. The subject can include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:

[0430] (1) abnormal expression of INHBE gene, more specifically, abnormally high expression of INHBE gene, in vivo;

[0431] (2) suffering from a disease associated with abnormal expression of INHBE gene;

[0432] (3) suffering from a disease that would benefit from a reduction in INHBE gene expression. For example, a human suffering from or predisposed to a disease associated with abnormal expression of INHBE gene.

[0433] The amount of the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug, or pharmaceutical composition of the present disclosure to be administered can be determined according to the body weight, age, gender, severity of disease, etc. of the patient. The administration dose of the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug, or pharmaceutical composition of the present disclosure is about 1-300 mg / kg of body weight, in terms of the amount of double-stranded ribonucleic acid contained therein.

[0434] The administration frequency can be once or more per day, week, two weeks, three weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or year.

[0435] The total number of times of administering the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug, or pharmaceutical composition of the present disclosure can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. For example, the siRNA molecule (including unmodified siRNA, siRNA modifier, siRNA conjugate), prodrug, or pharmaceutical composition of the present disclosure can be administered about 1, 2, 3, 4 times.

[0436] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates), prodrugs, pharmaceutical compositions, and optionally other therapeutic agents of the present disclosure can be packaged in a kit, in which the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates), prodrugs, pharmaceutically acceptable carriers, and optionally other therapeutic agents can be provided in liquid form or in dry form. In some embodiments, the kit comprises instructions for how to mix the siRNA molecules or prodrugs with the pharmaceutically acceptable carriers or other ingredients.

[0437] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates), prodrugs, pharmaceutical compositions of the present disclosure are used for the manufacture of a medicament for inhibiting the expression of INHBE gene.

[0438] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates), prodrugs, pharmaceutical compositions of the present disclosure are used for the manufacture of a medicament for preventing and / or treating a disease associated with overexpression of INHBE gene.

[0439] In some embodiments, the disease is obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, etc.

[0440] Table 1 siRNA sequence information

[0441] Table 1-1 siRNA sequence

[0442] Table 2 siRNA modifications

[0443] In the table above, the capital letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; mA, mU, mC, and mG indicate nucleotides modified with 2-methoxy groups; Af, Gf, Cf, and Uf indicate nucleotides modified with 2-fluoro groups; (invAb) indicates a reverse debasing deoxyribose residue; the lowercase letter s indicates that the two nucleotides adjacent to it are linked by a phosphothioester bond; the letter combination ss indicates that the two nucleotides adjacent to it are linked by a dithiophosphoester bond; P1 indicates that the nucleotide adjacent to it on the right is a 5'-phosphate nucleotide; EVP indicates that the nucleotide adjacent to it on the right is a 5'-trans-vinylphosphonate nucleotide (i.e., a 5'-trans-vinylphosphonate group); [GNA] indicates that the ribonucleotide adjacent to it on the right is a ribonucleotide modified with GNA.

[0444] Table 3 siRNA conjugates

[0445] In Table 3, L96 is also the conjugate group GalNAc shown in Formula I.

[0446] In Tables 1, 1-1, 2, and 3, if the 5' terminal nucleotide of the positive strand, the modified positive strand, and the modified positive strand with the connecting conjugate is not labeled with P1, EVP, or (invAb), it means that the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group, and its structure is shown in Formula X:

[0447] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0448] In Tables 1, 1-1, 2 and 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with P1 or EVP, it means that the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group, and its structure is as shown in Formula X.

[0449] In Table 1, Table 1-1 and Table 2, the 3' position of the 3' terminal nucleotide of the sense strand and the modified sense strand is hydroxyl (for the case that it is not invAb), and in Table 1, Table 1-1, Table 2 and Table 3, the 3' position of the 3' terminal nucleotide of the antisense strand and the modified antisense strand is hydroxyl.

[0450] Examples

[0451] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

[0452] The experimental techniques and experimental methods used in the present embodiment are all conventional techniques and methods, and for example, the experimental methods not specifically mentioned in the following examples are generally performed according to the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels, unless otherwise specified.

[0453] The siRNAs, siRNA modifications, and siRNA conjugates referred to in the following examples were synthesized by Tianlin Biotech (Shanghai) Co., Ltd.

[0454] Example 1: Synthesis of siRNA

[0455] 1.1 siRNA sequence design

[0456] According to the mRNA sequence of the human INHBE gene, a plurality of pairs of INHBE siRNAs were designed at different sites, and all the single siRNAs designed could target all transcripts of the target gene (as shown in Table 4). These multiple pairs of siRNAs have the lowest homology with the sequences of all other non-target genes after sequence similarity software comparison.

[0457] Table 4

[0458] The target sequences for designing siRNA are shown below, which are derived from the gene mRNA sequence of INHBE (see NM_031479.5). For the purpose of convenient alignment, the following target sequences are expressed in the DNA sequence corresponding to the mRNA. In the synthesis process of the present embodiment, T corresponds to uracil ribonucleotide U or modified U in the case of adding ribonucleotides.

[0459] Target sequence I: AGCACAGCTATCCATCAGATGATCTACTTTCAGC (SEQ ID NO: 1)

[0460] Target sequence I-1:

[0461] Target sequence I-2:

[0462] Target sequence II:

[0463] Target sequence II-1:

[0464] Target sequence II-2: ATGGGGAGGAGGTCATCAGCTTTGCTACTGTCACAGACTCC (SEQ ID NO: 10)

[0465] Target sequence II-3: ATCAGCTTTGCTACTGTCACA (SEQ ID NO: 11)

[0466] Target sequence III:

[0467] Target sequence III-1: CAGCACAGTTACTGGACAACCG (SEQ ID NO: 12)

[0468] Target sequence III-2: CAGCAGCCCTTCCTAGAGCTTAAGATCCGAGCCAATGA (SEQ ID NO: 13)

[0469] Target sequence IV:

[0470] Target sequence IV-1:

[0471] Target sequence IV-2: CTCTCCTCTACCTGGATCA (SEQ ID NO: 15)

[0472] Target sequence IV-3: GGCAATGTGGTCAAGACGG (SEQ ID NO: 16)

[0473] Target sequence IV-4: CTTTCCATTCTGCCGTCTTCAG (SEQ ID NO: 504)

[0474] Target sequence IV-5: TAATGGCAATGTGGTCAAGAC (SEQ ID NO: 505)

[0475] Target sequence IV-6: CCTCTTTCCATTCTGCCGTCTTC (SEQ ID NO: 506)

[0476] Target sequence V:

[0477] Target sequence V-1:

[0478] Target sequence V-2: GACTGGAGGCATCAGATTCCTGA (SEQ ID NO: 18)

[0479] Target sequence V-3:

[0480] Target sequence VI:

[0481] Target sequence VI-1: GCAGGCTTGAAGCAGGGTAAGCA (SEQ ID NO: 20)

[0482] Target sequence VI-2: GCTGAGGGAGGATGCTTAG (SEQ ID NO: 21)

[0483] Target sequence VI-3: CAGAAACAGGAGTCAGGAA (SEQ ID NO: 22)

[0484] Target sequence VI-4: CTAAGAAGTTCCCTGGTTTTTCC (SEQ ID NO: 23)

[0485] Target sequence VI-5: ACCCACTGGGAGACAAGCATTTATACTTTCTTTC (SEQ ID NO: 24)

[0486] Target sequence VII: GCCTGGCTTATACTTTCTTAATAA (SEQ ID NO: 507)

[0487] Target sequence VIII: TACTGTCACAGACTCCACTTCAG (SEQ ID NO: 508)

[0488] Target sequence IX: GCTAGCCAAGCAGCAAATCCTGGAT (SEQ ID NO: 509)

[0489] Target sequence X: CACTCTTTGCTTGAGGATCTTCCGATG (SEQ ID NO: 610)

[0490] Target sequence XI:

[0491] 1.2 Synthesis method description:

[0492] The nucleotide monomers are connected one by one in the order of nucleotide arrangement from 3'-5' direction by solid-phase phosphoramidite method. Each connection of a nucleotide monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and capping. When the two nucleotides are connected by a phosphate linkage, the connection of the next nucleotide monomer includes four steps of deprotection, coupling, oxidation, and capping. When the two nucleotides are connected by a phosphorothioate bond or a phosphorodithioate bond, the connection of the next nucleotide monomer includes four steps of deprotection, coupling, sulfurization, and capping. The present application selects nucleotide monomers according to the target sequence to be synthesized, and the selected nucleotide monomers are commonly used by those skilled in the art, for example, the nucleotide monomers for synthesizing A can be but are not limited to selecting adenosine-3-phosphate. It should be understood that these monomers are connected to each other by 5'-3' phosphodiester bonds or 5'-3' phosphorothioate bonds when they exist in an oligonucleotide, and when, for example, the last nucleotide at the 3' position is hydroxyl in the 5' to 3' direction, it is realized according to conventional means in the art.

[0493] 1.3 Synthesis conditions are given as follows:

[0494] The nucleotide monomers are provided in an acetonitrile solution with a concentration of 0.1 M, and the deprotection reaction conditions of each step are the same, i.e., the temperature is 25°C, the reaction time is 70 seconds, and the deprotection reagent is dichloroacetic acid in dichloromethane solution (3% V / V), and the molar ratio of dichloroacetic acid to 4,4'-dimethoxytrityl protecting group on the solid support is 5:1.

[0495] The coupling reaction conditions of each step are the same, including a temperature of 25°C, a molar ratio of the nucleic acid sequence connected on the solid support to the nucleotide monomer of 1:10, a molar ratio of the nucleic acid sequence connected on the solid support to the coupling reagent of 1:65, a reaction time of 600 seconds, and a coupling reagent of 5-ethylthio-1H-tetrazole in 0.5 M acetonitrile solution.

[0496] The conditions of each step of the oxidation reaction are the same, including a temperature of 25°C, a reaction time of 15 seconds, and an oxidizing reagent of 0.05 M iodine water. The molar ratio of iodine to the nucleic acid sequence attached to the solid support in the coupling step is 30:1. The reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[0497] The conditions of each step of the sulfuration reaction are the same, including a temperature of 25°C, a reaction time of 300 seconds, and a sulfuration reagent of hydrogenated xanthan. The molar ratio of the sulfuration reagent to the nucleic acid sequence attached to the solid support in the coupling step is 120:1. The reaction is carried out in a mixed solvent of acetonitrile:pyridine = 1:1.

[0498] The conditions of each step of the capping are the same, including a temperature of 25°C, and a reaction time of 15 seconds. The capping reagent solution is a mixed solution of CapA and CapB at a molar ratio of 1:1, and the molar ratio of the capping reagent to the nucleic acid sequence attached to the solid support is acetic anhydride:N-methylimidazole:nucleic acid sequence attached to the solid support = 1:1:1.

[0499] After the last nucleoside monomer is connected, the nucleic acid sequence attached to the solid support is subjected to amination, purification, desalting, and then freeze-drying to obtain the sense strand and the antisense strand; finally, the two strands are heated to anneal to obtain the product, which is freeze-dried to obtain a freeze-dried powder.

[0500] The synthesized siRNAs are shown in Table 1 and Table 1-1, and the synthesized siRNA modifiers are shown in Table 2.

[0501] Example 2: Synthesis of siRNA conjugates (GalNAc-siRNA)

[0502] Take the synthesis of L96 as an example:

[0503] 2.1 The siRNA conjugate has the structure shown in Formula II:

[0504] 2.2 Synthesis process of the siRNA conjugate

[0505] In the first step, compound L96-A is obtained by reacting DMTr-L96 and succinic anhydride:

[0506] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine, and diisopropylethylamine are added to dichloromethane, stirred at 25°C for 24 hours, then the reaction solution is washed with 0.5 M triethylamine phosphate, the aqueous phase is washed with dichloromethane three times, the organic phases are combined and evaporated under reduced pressure to obtain a crude product. Then, column chromatography is used to purify the product to obtain pure L96-A.

[0507] Second step, L96-A reacts with NH2-SPS to obtain L96-B:

[0508] Preparation process: L96-A, O-benzotriazol-tetramethylurea hexafluorophosphate (HBTU) and diisopropyl ethylamine (DIPEA) are mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to obtain a uniform solution, and then added to the reaction solution. Ammonia methyl resin (NH2-SPS, 100-200 mesh) is added to the reaction solution, and the shaking table reaction is started at 25°C. After 18 hours of reaction, filtration is performed, and the filter cake is washed with dichloromethane and acetonitrile in sequence to obtain the filter cake. The obtained filter cake is subjected to cap reaction with CapA / CapB mixed solution to obtain L96-B, which is a solid phase carrier containing a conjugated molecule.

[0509] Third step, synthesis of siRNA conjugate:

[0510] The L96-B is used as a solid phase carrier to synthesize the sense strand of the siRNA conjugate according to the siRNA synthesis method described above, and the antisense strand of the siRNA conjugate is synthesized by using the siRNA synthesis method described above, and annealing to generate the siRNA conjugate of the application.

[0511] The synthesized siRNA conjugate is shown in Table 3.

[0512] Example 3: siRNA, siRNA modifier and siRNA conjugate inhibit INHBE gene expression

[0513] 3.1 Experimental materials:

[0514] Huh7 cells, provided by Shanghai Pharmalink Biopharmaceutical Development Co., Ltd.;

[0515] RNA extraction kit, 96 Kit, item number QIAGEN-74182;

[0516] Transfection reagent, purchased from Invitrogen, item number 13778-150;

[0517] U+Probe Master Mix V2, purchased from Vazyme, item number Q513-03;

[0518] Dulbecco's Modified Eagle Medium (DMEM medium), purchased from Gibco, item number 11965-092;

[0519] MEM medium, purchased from Gibco, item number 41090036;

[0520] Reverse transcription kit (HiScript III RT SuperMix for qPCR(+gDNA wiper)) was purchased from Vazyme, product number R313-01;

[0521] Opti-MEM: reduced serum medium, purchased from Gibco, product number 31985070;

[0522] Target INHBE primer was synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.;

[0523] INHBE Probe was purchased from Thermo, product number Hs01106908_m1;

[0524] Target GAPDH primer was synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.;

[0525] GAPDH Probe was purchased from Thermo, product number 4326317E.

[0526] 3.2 Experimental method:

[0527] 3.2.1 Huh7 cells were cultured in fresh MEM medium in a 96-well plate for 24 hours, and the cultured cells were resuspended in DMEM medium containing 10% (V / V) FBS to prepare a cell suspension with a density of 2.22x105 / mL, and then 90 μL of the cell suspension was added to each well of a 96-well plate, i.e. 10000 cells / well.

[0528] 3.2.2 The dry powder of the siRNA, siRNA modifier and siRNA conjugate to be tested (for convenience of description, they are collectively referred to as siRNA in the description of the experimental process of this embodiment) was centrifuged at low temperature and high speed, and then dissolved with ultra-pure distilled water (ULtraPure Distilled Water) to prepare a 100 μM siRNA stock solution.

[0529] 3.2.3 Preparation of 20nM siRNA dilution solution Z and 2nM siRNA dilution solution W

[0530] (1) Preparation of 1 μM siRNA stock solution Y and 0.1 μM siRNA stock solution E:

[0531] a. Take 2 μL of the 100 μM siRNA stock solution prepared in step 3.2.2 above, add 18 μL of ultra-pure distilled water, and obtain a 10 μM siRNA stock solution Q;

[0532] b. Take 2 μL of the 10 μM siRNA stock solution prepared in step a, add 18 μL of ultrapure distilled water to obtain a 1 μM siRNA stock solution Y;

[0533] c. Take 2 μL of the 1 μM siRNA stock solution Y prepared in step b, add 18 μL of ultrapure distilled water to obtain a 0.1 μM siRNA stock solution E.

[0534] (2) Take 2 μL of the above prepared siRNA stock solution Y, add 98 μL of Opti-MEM to obtain a 20 nM siRNA dilution Z; take 2 μL of the above prepared siRNA stock solution E, add 98 μL of Opti-MEM to obtain a 2 nM siRNA dilution W.

[0535] 3.2.4 Transfection of Huh7 cells

[0536] (1) Take 3 μL of the transfection reagent, add 97 μL of Opti-MEM to obtain a transfection reagent dilution; mix the transfection reagent dilution with the 2 nM siRNA dilution W prepared in step 3.2.3 at a volume ratio of 1:1 to obtain a transfection mixture, stand for 5 minutes, and then add 10 μL of the transfection mixture to the Huh7 cells cultured in step 3.2.1 in a 96-well plate (final volume 100 μL, the concentration of siRNA in the system is 0.1 nM). (2) Take 3 μL of the transfection reagent, add 97 μL of Opti-MEM to obtain a transfection reagent dilution; mix the transfection reagent dilution with the 20 nM siRNA dilution Z prepared in step 3.2.3 at a volume ratio of 1:1 to obtain a transfection mixture, stand for 5 minutes, and then add 10 μL of the transfection mixture to the Huh7 cells cultured in step 3.2.1 in a 96-well plate (final volume 100 μL, the concentration of siRNA in the system is 1 nM). The above transfection is cultured for 48 hours; two repeats are set for each concentration (1 nM and 0.1 nM).

[0537] 3.2.5 Total RNA is extracted from the Huh7 cells obtained in step 3.2.4 according to the instructions of the RNA extraction kit. 3.2.6 Reverse transcription of the total RNA obtained in step 3.2.5 to cDNA is performed using a reverse transcription kit according to the following steps:

[0538] The above transfection is cultured for 48 hours; two repeats are set for each concentration (1 nM and 0.1 nM).

[0539] 3.2.5 Total RNA is extracted from the Huh7 cells obtained in step 3.2.4 according to the instructions of the RNA extraction kit.

[0540] 3.2.6 Reverse transcription of the total RNA obtained in step 3.2.5 to cDNA is performed using a reverse transcription kit according to the following steps: ​​​

[0541] a) gDNA was removed with gDNAase according to Table 5;

[0542] Table 5

[0543] 42°C, 2 min; 4°C, rest.

[0544] b) The reverse transcription procedure was performed as follows:

[0545] Table 6

[0546] 37°C, 15 min; 85°C, 5 s.

[0547] c) The reverse transcription product from step b) was stored at 4°C for real-time PCR analysis.

[0548] 3.2.7 Real-time PCR analysis

[0549] a) The qPCR reaction mix was prepared as shown in the table below, and all reagents were kept on ice throughout the procedure;

[0550] Table 7

[0551] Table 8

[0552] b) The qPCR procedure was performed as follows:

[0553] 95°C, 10 min;

[0554] 95°C, 15 s, 60°C, 1 min (this was repeated for 40 cycles).

[0555] 3.2.8 Results analysis

[0556] a) The Ct values were automatically calculated using the Quant Studio 6 Flex software with default settings;

[0557] b) The relative expression of the genes was calculated using the following formula:

[0558] ACt = Ct(INHBE gene) - Ct(GAPDH)

[0559] ΔΔCt = ACt (test sample group) - ACt (Mock group)

[0560] mRNA expression relative to Mock group = 2-ΔΔ C t.

[0561] Mock group: group without siRNA added compared to test sample group

[0562] Inhibition rate (%) = (Mock group mRNA relative expression - test sample group mRNA relative expression) / Mock group mRNA relative expression x 100%

[0563] 3.3 Silencing experiment results

[0564] The concentrations of 0.1 nM and 1 nM were selected for testing, and the results are shown in Tables 9, 10, and 11.

[0565] Table 9 Note: “--”: the result is not shown.

[0566] As can be seen from Table 9, in the Huh7 cell experiment, the siRNA provided by the present application has high INHBE gene inhibition activity, and the concentration of 1 nM generally shows higher inhibition rate on INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0567] Table 10 Note: “--”: the result is not shown.

[0568] As can be seen from Table 10, in the Huh7 cell experiment, the siRNA modifier of the present disclosure has good inhibition rate on INHBE gene, and the concentration of 1 nM generally shows higher inhibition rate on INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0569] Table 11

[0570] As can be seen from Table 11, in the Huh7 cell experiment, the siRNA conjugate of the present disclosure has good inhibition rate on INHBE gene, and the concentration of 1 nM generally shows higher inhibition rate on INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0571] Example 4: siRNA modifier and siRNA conjugate inhibit INHBE gene expression

[0572] Using a similar method as in Example 3, the inhibition rates of the following test siRNA modifiers and siRNA conjugates at concentrations of 1 nM and 0.1 nM were determined, and the results are shown in Table 12 and Table 12-1.

[0573] Table 12

[0574] Table 12-1

[0575] As can be seen from Table 12 and Table 12-1, the siRNA modifier and siRNA conjugate of the present disclosure have better inhibition rate on INHBE gene in Huh7 cell experiment.

[0576] Example 5: siRNA conjugate inhibits INHBE gene expression

[0577] 5.1 Test materials:

[0578] Human primary hepatocyte PHH cells were provided by Shanghai Drugmaker New Drug Development Co., Ltd.;

[0579] PHH culture solution: invitroGRO CP Medium, purchased from Bioreclamation, item number: S03316;

[0580] Transfection reagent, purchased from Invitrogen, item number: 13778-150;

[0581] 96 Kit, purchased from QIAGEN, item number: QIAGEN-74182;

[0582] FastQuant RT Kit (containing gDNase), purchased from TianGen, item number: KR116-02;

[0583] FastStart Universal Probe master, purchased from Roche, item number: 04914058001;

[0584] HiScript III RT SuperMix for qPCR (+gDNA wiper), purchased from Vazyme, item number R323-02.

[0585] 5.2 Test method

[0586] 5.2.1 siRNA conjugate (siRNA conjugate final concentration is 5nM and 1nM respectively, duplicate wells) was transfected into PHH cells, the process is as follows: take the frozen PHH cells, recover, count, adjust the cells to 6x10 5 cells / mL, and apply Transfection reagent to transfer siRNA conjugate into cells, seed into 96-well plates at a density of 54,000 cells per well, add 100 μL of PHH culture solution per well. Cells were incubated in a 5% CO2, 37°C incubator. After 48 hours, remove the culture medium and collect the cells for total RNA extraction. Use 96 Kit to extract total RNA according to the kit product instructions.

[0587] 5.2.2 siRNA conjugates (siRNA conjugate final concentrations of 200 nM and 10 nM, respectively, in duplicate) were taken up into PHH cells by free uptake, as follows: Frozen PHH cells were thawed, counted, and adjusted to 6 x 10 5 Cells were plated into 96-well plates at a density of 54,000 cells per well in 100 μL of PHH media, with siRNA conjugate added. Cells were incubated in a 5% C02, 37 °C incubator. After 48 hours, media was removed and cells were collected for total RNA extraction. Total RNA was extracted according to the kit manufacturer's instructions using the RNeasy® 96 Kit. 96 Kit.

[0588] Reverse transcription to cDNA was performed using the High Capacity cDNA Reverse Transcription Kit, according to the following procedure:

[0589] (1) gDNA was removed using gDNAase according to the following Table 13:

[0590] Table 13

[0591] 42 °C, 2 min.

[0592] (2) The second step reverse transcription reaction mix was prepared as described in Table 14 below and mixed well

[0593] Table 14

[0594] The qPCR procedure was performed as follows

[0595] 50 °C, 2 s;

[0596] 4 °C.

[0597] (3) 50 μL of nuclease-free sterile water was added and the qPCR reaction mix was prepared as shown in Table 15 below. All reagents were kept on ice throughout the procedure.

[0598] Table 15

[0599] Table 16

[0600] The qPCR procedure was performed as follows

[0601] 95 °C, 10 min;

[0602] 95 °C, 15 s, 60 °C, 1 min (for 40 cycles).

[0603] Results analysis:

[0604] a) Using Quant Studio 7 software, automatically calculate the Ct value using the default settings;

[0605] b) Calculate the relative expression of the gene using the following formula:

[0606] ΔCt = Ct (INHBE gene) - Ct (GAPDH)

[0607] ΔΔCt = ΔCt (test sample group) - ΔCt (Mock group), wherein the Mock group represents a group without the addition of siRNA conjugate compared with the test sample group;

[0608] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0609] Inhibition rate (%) = (Mock group mRNA relative expression - test sample group mRNA relative expression) / Mock group mRNA relative expression x 100%

[0610] The experimental results are shown in Table 17.

[0611] Table 17 Inhibition rate of siRNA conjugate inhibiting INHBE gene expression Note: “—”: the result is not shown.

[0612] As can be seen from Table 17, in the PHH cell experiment, the siRNA conjugate of the present disclosure has a good inhibition rate on the INHBE gene, and shows a dose-dependent effect in both transfection and free uptake.

[0613] Example 6: siRNA conjugate inhibiting INHBE gene expression

[0614] 6.1 Using a similar method to 5.2.2 in Example 5, the inhibition rate of the following to-be-tested siRNA conjugate at 200 nM and 10 nM concentrations in free uptake was determined, and the results are shown in Table 18.

[0615] Table 18

[0616] As can be seen from Table 18, in the PHH cell experiment, the siRNA conjugate of the present disclosure has a good inhibition rate on the INHBE gene, and shows a dose-dependent effect in free uptake.

[0617] 6.2 IC 50 Determination results

[0618] The determination concentration range of the following siRNA conjugate to be tested is set as follows: 500 nM, 4-fold dilution, 8 concentration gradients; the siRNA conjugate (the final concentration of siRNA conjugate is 500, 125, 31.25, 7.8125, 1.9531, 0.4883, 0.1221 and 0.03052 nM, respectively, in a duplicate well) is taken into PHH cells by free uptake, and then the IC50determination is performed according to the method similar to 5.2.2.

[0619] Result analysis:

[0620] a) The Ct value is automatically calculated using the default settings of Quant Studio 6 Flex software;

[0621] b) The relative expression of the gene is calculated using the following formula:

[0622] ΔCt = Ct(INHBE gene) - Ct(GAPDH)

[0623] ΔΔCt = ΔCt (test sample group) - ΔCt (Mock group), wherein the Mock group represents a group without the addition of siRNA conjugate compared with the test sample group;

[0624] mRNA expression relative to the Mock group = 2-ΔΔCt

[0625] Inhibition rate (%) = (relative mRNA expression of the Mock group - relative mRNA expression of the test sample group) / relative mRNA expression of the Mock group x 100%

[0626] Calculation process: taking the log value of the siRNA conjugate concentration as the X axis and the percentage inhibition rate as the Y axis, the “log(inhibitor) vs. response-variable slope” of the analysis software GraphPad Prism 8 is used to fit the dose-effect curve, so as to obtain the IC 50 value of each siRNA conjugate.

[0627] The fitting formula is: Y = Bottom + (Top-Bottom) / (1+10^((logIC 50 -X) x HillSlope))

[0628] Wherein: Top represents the percentage inhibition rate at the top platform, and the Top of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom platform, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0629] The results are shown in Table 19 below.

[0630] Table 19

[0631] As can be seen from Table 19, in the PHH cell experiment, the siRNA conjugate of the present disclosure has a good inhibition rate on the INHBE gene.

[0632] Example 7: siRNA and siRNA modifier inhibit INHBE gene expression

[0633] Using a similar method as in Example 3, the inhibition rates of the following siRNA and siRNA modifiers to be tested at 1 nM and 0.1 nM concentrations were determined, and the results are shown in Table 20 and Table 21.

[0634] Table 20

[0635] As can be seen from Table 20, in the Huh7 cell experiment, the siRNA provided by the present application has a high INHBE gene inhibition activity, and the 1 nM concentration generally shows a higher inhibition rate on the INHBE gene than the 0.1 nM concentration, showing a dose-dependent effect.

[0636] Table 21

[0637] As can be seen from Table 21, in the Huh7 cell experiment, the siRNA modifier of the present disclosure has a good inhibition rate on the INHBE gene, and the 1 nM concentration generally shows a higher inhibition rate on the INHBE gene than the 0.1 nM concentration, showing a dose-dependent effect.

[0638] Example 8: IC 50 Determination results

[0639] The determination concentration range (nM) of the following siRNA conjugate to be tested is set as 10 nM, 4-fold dilution, 8 concentration gradients; and the IC is determined according to a similar method as 3.2 50 Determination.

[0640] Result analysis:

[0641] a) Using Quant Studio 6Flex software, automatically calculate the Ct value using the default settings;

[0642] b) Calculate the relative expression of the gene using the following formula:

[0643] ΔCt = Ct (INHBE gene) - Ct (GAPDH)

[0644] ΔΔCt = ΔCt (test sample group) - ΔCt (Mock group), wherein the Mock group represents a group without the addition of siRNA conjugate compared with the test sample group;

[0645] mRNA expression relative to Mock group = 2-ΔΔ C t

[0646] Inhibition rate (%) = (Mock group mRNA relative expression - test sample group mRNA relative expression) / Mock group mRNA relative expression x 100%

[0647] Calculation process: take the log value of siRNA conjugate concentration as the X axis, and the percentage inhibition rate as the Y axis, use the analysis software GraphPad Prism 8 "log (inhibitor) vs. response - variable slope" to fit the dose-effect curve, and then obtain the IC 50 value of each siRNA conjugate.

[0648] The fitting formula is: Y = Bottom + (Top-Bottom) / (1 + 10^((logIC 50 -X) x HillSlope))

[0649] Where: Top represents the percentage inhibition rate at the top platform, and the Top standard of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom platform, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0650] The results are shown in Table 22 below.

[0651] Table 22

[0652] As can be seen from Table 22, in the Huh7 cell experiment, the siRNA conjugate of the present disclosure has a good inhibition rate on the INHBE gene.

[0653] Example 9: siRNA conjugate inhibits INHBE gene expression

[0654] 9.1 Using a similar method to 5.2.2 in Example 5, the inhibition rate of the following test siRNA conjugate at 200nM and 10nM concentrations under free uptake was determined, and the results are shown in Table 23.

[0655] Table 23

[0656] 9.2 IC 50 determination results

[0657] Using a similar method to 6.2 in Example 6, the IC 50 of the following test siRNA conjugate was determined, and the results are shown in Table 24.

[0658] Table 24

[0659] As can be seen from Table 24, the siRNA conjugate of the present disclosure has a good inhibition rate on the INHBE gene in the PHH cell experiment.

[0660] Example 10: Rat liver homogenate in vitro stability experiment of siRNA conjugate

[0661] 10.1 Experimental reagents and consumables

[0662] Table 25

[0663] 10.2 Experimental steps

[0664] 10.2.1 Preparation of liver homogenate

[0665] 10.2.1.1 Preparation of grinding fluid

[0666] Table 26

[0667] 10.2.1.2 Tissue homogenate

[0668] The rat liver tissue (from SD rats, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) was prepared into liver homogenate (concentration of 20 mg / mL) at a ratio of 100 mg:5 mL of grinding fluid. After preparation, the grinding beads were added and placed in the homogenizer. The grinding parameters were set as follows.

[0669] Table 27

[0670] 10.2.2 Sample preparation

[0671] The siRNA conjugate sample was prepared into a 1 mg / mL solution with enzyme-free water and was ready for use. The internal standard sample was prepared into a 0.125 mg / mL solution with enzyme-free water.

[0672] 10.2.3 Sample incubation

[0673] (1) Add 250 μL of prepared liver homogenate in a 2 mL enzyme-free tube,

[0674] (2) Add 50 μL of siRNA conjugate sample solution based on step (1);

[0675] (3) The system is 300 μL of biological sample solution, vortex, and stand for 5 min;

[0676] (4) Divide into 2 tubes, 100 μL each;

[0677] (5) Incubate the system at 37°C for 48h.

[0678] 10.2.4 Biological sample processing

[0679] Vortex each 100 μL biological sample system, mix well, add 300 μL clarity OTX lysis-loading buffer (purchased from Agilent- Finnigan, product number AL0-8579), vortex, stand for 30 min, add 100 μL internal standard solution, vortex, centrifuge at low speed for 5 min at 1500 rpm, and stand by (total sample volume is about 500 μL).

[0680] 10.2.5 Solid phase extraction

[0681] (1) Preparation of solid phase extraction reagent

[0682] Activator: take 200 mL methanol into the mobile phase bottle, and label it as activator;

[0683] Equilibration liquid: prepare 1 M phosphate buffer solution 【877 mL sodium dihydrogen phosphate (1.56 g / L) + 123 mL disodium hydrogen phosphate (3.58 g / L) 】, dilute 100 times, adjust pH to 5.5 with phosphoric acid, and label it as equilibration liquid;

[0684] Rinse liquid: take 500 mL equilibration liquid into a 1 L mobile phase bottle, add 500 mL acetonitrile, mix well, and label it as rinse liquid;

[0685] Elution liquid: weigh 7.9 g of ammonium bicarbonate into a 1 L mobile phase bottle, add 1 L water, adjust pH to 9 with sodium hydroxide, take 500 mL of the adjusted ammonium bicarbonate solution into a 1 L mobile phase bottle, add 500 mL acetonitrile, mix well, and label it as elution liquid;

[0686] (2) The extraction steps are as follows:

[0687] Table 28

[0688] 10.2.6 Post-processing

[0689] Take the elution liquid (take it in three times, 600 μL each time, a total of 1800 μL) into a 2 mL EP tube, vacuum concentrate (or nitrogen blow dry at 40°C) for 10 hours at a speed of 1800 rpm; add 100 μL mobile phase (initial ratio) to the concentrated sample for redissolution, centrifuge at a high speed of 12000 rpm at 15°C for 20 min, and inject 10 μL of the supernatant into high-resolution mass spectrometry. The antisense strand ratio of the siRNA conjugate of the application is detected by the LC-MS / MS method, and the calculation formula is: AS strand remaining percentage % = AS MS intensity / AS chain and all degradation products associated therewith sum MS intensity x 100%, wherein MS intensity is the mass spectrometry intensity signal value. The results of the metabolism after 48 hours of in vitro incubation in rat liver homogenate are shown in Table 29 below.

[0690] Table 29 Percentage of antisense strand remaining of siRNA conjugate

[0691] wherein AS represents the antisense strand of the siRNA conjugate, the greater the AS remaining amount, the better the stability of the drug, and the better the long-acting property of the drug. As can be seen from Table 29, the siRNA conjugate of the present disclosure has excellent in vitro stability in rat liver homogenate.

[0692] Example 11: Silencing effect of siRNA conjugate in vivo in mice expressing human INHBE (hINHBE) gene

[0693] 11.1 AAV8 construct overexpresses hINHBE gene mouse model

[0694] 6-8 week old C57BL / 6 male mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) enter the facility, and a single injection of hINHBE gene adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{INHBE part CDS+part 3UTR}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) is performed to target gene overexpression modeling, and the administration volume is 100 μL (10 x 10 11 vg) per mouse, and then normal feed is fed.

[0695] 11.2 In vivo silencing siRNA conjugate efficacy investigation for hINHBE mouse model

[0696] After 14 days of AAV8 virus injection, grouping (5 mice per group), the mice are administered a single 3 mg / kg (mpk) dose of siRNA conjugate of the present disclosure subcutaneously, and the administration volume is 5 μL / g, and the solvent is RNase-free sterile PBS. The SEAP protein expression (i.e., hINHBE protein expression) is detected at 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, 56 days, 63 days, and 70 days after administration, the gene expression inhibition rate is calculated, and the calculation formula is: inhibition rate % = (1 - average protein expression of administration group / average protein expression of blank group) * 100%, and the inhibition rate (%) results are shown in Table 30.

[0697] Table 30 Note: “--”: the results are not shown.

[0698] As can be seen from Table 30, the siRNA conjugate of the application has high inhibitory activity on the hINHBE gene in vivo, can reduce the expression level of hINHBE for a long time, and has long-term inhibition in vivo.

[0699] Example 12: Inhibition of INHBE gene expression by siRNA conjugate in wild-type mice

[0700] 6-8 week-old wild-type C57BL / 6 male mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into groups according to body weight, 5 mice per group, subcutaneously administered with 3 mg / kg or 10 mg / kg single dose of siRNA conjugate of the application and PBS (purchased from Gibco, item number 10010-023), injection volume 5 μL / g, mice were euthanized after 14 days of administration, 30 mg of left lobe tissue of mouse liver was rapidly frozen in liquid nitrogen, and then frozen ground into tissue homogenate, and then the tissue RNA was extracted and the target gene mRNA inhibition rate was detected.

[0701] 12.1 Experimental reagents:

[0702] RNA extraction kit, purchased from QIAGEN, item number: 74106;

[0703] Reverse transcription kit, purchased from Vazyme, item number R312-02;

[0704] Target INHBE probe, purchased from Thermo, item number Hs01033038-g1 (FAM);

[0705] ACTB probe, purchased from Thermo, item number Mm02619580-g1 (VIC);

[0706] TaqMan TM Gene expression premix, purchased from Applied Biosystems, item number 4369016.

[0707] 12.2 Experimental steps:

[0708] 12.2.1 Tissue homogenate

[0709] 1) Take the right half of the left lobe of the mouse liver tissue, add 1 mL of lysis solution;

[0710] 2) 60 Hz, homogenate for 30 s, pause for 15 s, repeat 10 times, and centrifuge briefly;

[0711] 3) Supplement the remaining RLT (lysis solution) to a uniform concentration according to the weight of the liver; vortex to mix well.

[0712] 12.2.2 RNA extraction

[0713] Total RNA was extracted from the tissue homogenate obtained in step 12.2.1 following the RNA extraction kit instructions.

[0714] 12.2.3 Reverse transcription to cDNA was performed on the total RNA obtained in step 12.2.2 using a reverse transcription kit following the steps below:

[0715] 1) The first step reverse transcription reaction mix was prepared as described in Table 31 and mixed well. All reagents were kept on ice throughout the procedure;

[0716] Table 31

[0717] 42°C, 2 min;

[0718] 2) The second step reverse transcription reaction mix was prepared as described in Table 32 and mixed well;

[0719] Table 32

[0720] The reverse transcription reaction program was as follows in Table 33:

[0721] Table 33

[0722] 12.2.4 Amplification and analysis

[0723] 1) The qPCR reaction mix was prepared as shown in Table 34 and Table 35. All reagents were kept on ice throughout the procedure.

[0724] Table 34

[0725] Table 35

[0726] 2) The qPCR program was performed as shown in Table 36:

[0727] Table 36

[0728] 3) Data analysis

[0729] Ct values were automatically calculated using the Quant Studio 6 Flex software using default settings;

[0730] The relative expression of the genes was calculated using the following formula:

[0731] ACt = Ct(INHBE gene) - Ct(ACTB)

[0732] ΔΔCt = ΔCt (test sample group) - ΔCt (Mock group)

[0733] mRNA expression relative to Mock group = 2 -ΔΔCt .

[0734] Mock group: group without siRNA conjugate added compared with the detection sample group.

[0735] Inhibition rate (%) = (Mock group mRNA relative expression - detection sample group mRNA relative expression) / Mock group mRNA relative expression x 100%

[0736] Table 37

[0737] As can be seen from Table 37, the siRNA conjugate of the application has high inhibitory activity on the INHBE gene in vivo, and can reduce the expression level of INHBE for a long time.

[0738] Example 13: Inhibition of siRNA conjugate on human INHBE gene expression in humanized mice

[0739] 6-8 week old C57BL / 6-hINHBE mice (provided by Shanghai South Model Organism Technology Co., Ltd.) were introduced into the feeding facility, and the mice were subcutaneously administered with the siRNA conjugate of the application (5 mice per group) at a single dose of 3 mg / kg. After 14 days of administration, the mice were euthanized, and 30 mg of left lobe tissue of the mouse liver was rapidly frozen in liquid nitrogen, and then frozen ground into tissue homogenate. The tissue RNA was extracted and the target gene mRNA inhibition rate was detected, and the detection method was the same as that of Example 12, and the results are shown in Table 38.

[0740] Table 38 siRNA conjugate INHBE mRNA inhibition rate

[0741] Wherein, the sequence of N-ER-FY046Y04L96 is shown in Table 39.

[0742] Table 39

[0743] Wherein, "dG", "dA", "dT" are deoxy modified nucleotides.

[0744] As can be seen from Table 38, the siRNA conjugate of the application has high inhibitory activity on the INHBE gene in vivo, and can reduce the expression level of INHBE for a long time.

[0745] Example 14: In vitro off-target experiment

[0746] 14.1 Main reagents and consumables

[0747] InvitroGRO CP Medium, serum-free, purchased from Bioreclamation, product number IVT-S03316.

[0748] Fetal bovine serum was purchased from ExCellBio, catalog number: FSP500.

[0749] Penicillin / streptomycin was purchased from Hyclone, catalog number: SV30010.

[0750] AO / PI staining solution was purchased from Countstar, catalog number: RE010212.

[0751] Nuclease-free water was purchased from Invitrogen, product number: AM9932.

[0752] The ribonucleic acid extraction kit (miRNeasy Tissue / Cells Advanced Mini Kit) was purchased from Qiagen, catalog number: 217604.

[0753] The Agilent RNA 6000 Nano Kit was purchased from Agilent, catalog number 5067-1511.

[0754] Transcriptome library construction kit The Universal V10RNA-seq Library Prep Kit for Illumina was purchased from Vazyme, catalog number: NR606-02.

[0755] The high-sensitivity double-stranded deoxyribonucleic acid concentration assay kit (Qubit 1X dsDNA HS Assay Kit) was purchased from Thermo Fisher Scientific, catalog number: Q33231.

[0756] The High Sensitivity D1000 ScreenTape pre-fabricated deoxyribonucleic acid electrophoresis strip was purchased from Agilent, catalog number: 5067-5584.

[0757] The NovaSeq 6000S4 Reagent Kit v1.5 (300 cycles) was purchased from Illumina, catalog number: 20028312.

[0758] Human primary hepatocytes (PHH) (batch: BXU) were provided by Shanghai WuXi AppTec New Drug Development Co., Ltd.

[0759] 14.2 Main instruments

[0760] Bio-safety cabinet (Hfsafe-1800LCA2, Shanghai Instruments Co., Ltd.), Micro UV-Vis spectrophotometer (NanoDrop One, Thermo Fisher Scientific), Agilent 2100 Bioanalyzer (Agilent), Thermal cycler (T100 thermal cycler, Bio-Rad), Fluorometer (Qubit 4 fluorometer, Thermo Fisher Scientific), Agilent 4200 TapeStation, Sequencer (NovaSeq 6000 (Illumina)), Automatic cell fluorescence analyzer (Rigel S2, Countstar).

[0761] 14.3 Medium formula

[0762] 20 mL cell culture medium configuration system containing 10% fetal bovine serum: 17.8 mL in vitro serum-free culture medium InvitroGRO CP Medium, serum-free (Bioreclamation IVT-S03316), 2 mL fetal bovine serum (ExCell Bio-FSP500), 0.2 mL penicillin / streptomycin (Hyclone-SV30010).

[0763] 14.4 Experimental process

[0764] 14.4.1 Cell plating

[0765] The conjugate N-ER-FY046149M47L96 enters human primary hepatocytes by free uptake, the process is as follows:

[0766] (1) Dilute the conjugate N-ER-FY046149M47L96 with nuclease-free water to 10 times the final concentration (20 nM and 100 nM).

[0767] (2) Take out one vial of cryopreserved human primary hepatocytes (PHH) from the liquid nitrogen tank, gently shake in a water bath to melt the cryopreservation solution, transfer the cells to cell culture medium containing 10% fetal bovine serum, adjust the final cell density to 6.7*10 5 cells / mL.

[0768] (3) Take 50 μL conjugate in step (1) to collagen-coated 24-well cell plates, then add 450 μL cell suspension in step (2), and the final cell density is 300,000 per well. The final concentration of N-ER-FY046149M47L96 is 20 nM and 100 nM, and each conjugate is tested in triplicate, and the wells without conjugate are used as controls.

[0769] (4) After 72 hours of culture, wash each well with PBS once, then add 260 μL lysis solution to lyse the cells for subsequent experiments.

[0770] 14.4.2 Second-generation sequencing

[0771] (1) Purify total RNA from cells according to the manufacturer's (Qiagen-217604_miRNeasy Tissue / Cells Advanced Mini Kit) instructions.

[0772] (2) Use NanoDrop One to detect the concentration of total RNA, and analyze the RNA integrity according to the manufacturer's (Agilent 2100 Bioanalyzer\Agilent-5067-1511_Agilent RNA 6000Nano Kit) instructions.

[0773] (3) Perform library preparation according to the manufacturer's (Illumina-20040523_StarSeq Library Prep Kit for Illumina\Illumina-20040523_StarSeq Library Prep Kit for Illumina) instructions. (4) Detect the library concentration according to the manufacturer's (Thermo Fisher Scientific-Qubit 4 fluorometer\Thermo Fisher Scientific-Q33231_Qubit 1X dsDNA HS Assay Kit) instructions, and analyze the library fragment size according to the manufacturer's (Agilent 4200TapeStation\Agilent-5067-5584_High Sensitivity D1000 ScreenTape) instructions.

[0774] (5) Perform library sequencing according to the manufacturer's (Illumina-NovaSeq 6000\Illumina-20028312_NovaSeq 6000S4 Reagent Kit v1.5(300cycles)) instructions.

[0775]

[0776] ​This experiment is based on the second-generation sequencing technology to study the effect of human hepatocyte free uptake of the test product (N-ER-FY046149M47L96) on the expression of the transcriptome. The screening criteria for differential genes are set as |log2(FoldChange)|>1 & padj<0.05.

[0777] 14.5 IC in PHH cells 50 Test

[0778] The N-ER-FY046149M47L96 determination concentration range (nM) of the siRNA conjugate to be tested is set as 500, 125, 31.25, 7.8125, 1.9531, 0.4883, 0.1221 and 0.03052 nM, and the IC is determined according to the same method as in Example 6. 50 The free uptake IC of N-ER-FY046149M47L96 in human hepatocytes is determined (free uptake in PHH cells) 50 is 0.397 nM. The inhibition rate results at each concentration are shown in FIG. 1.

[0779] After sequencing at 20 nM and 100 nM concentrations of N-ER-FY046149M47L96, it is found that the differential genes meeting |log2(FoldChange)|>1 & padj<0.05 are 0 and 4 (ENSG00000217702, ENSG00000260621, ENSG00000271984 and ENSG00000257303) at the two concentrations, respectively (as shown in FIG. 2 and FIG. 3), which indicates that the differential genes at the two concentrations do not overlap, and there is no dose-dependent effect of differential genes, i.e., no off-target genes are found in the in vitro PHH cell experiment of N-ER-FY046149M47L96. 50 The IC of N-ER-FY046149M47L96 in PHH cells is 0.397 nM, and the two concentrations of off-target selected are 50 times and 252 times of the IC, respectively. 50 It can be seen that the safety window of the conjugate reaches more than 50 times, so the risk of off-target in vivo is low, the safety is good, and the drugability is good.

[0780] Example 15: Silencing effect of siRNA conjugate in mice expressing human INHBE (hINHBE) gene

[0781] 15.1 AAV8 construct overexpresses hINHBE gene mouse model

[0782] 6-8 weeks old C57BL / 6 male mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) enter the facility, and a single injection of adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{hINHBE part CDS+3'UTR new}, the virus is provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) of hINHBE gene is used for target gene overexpression modeling, the administration volume is 100 μL (10 x 10 11 vg) per mouse, and ordinary feed is used for feeding.

[0783] 15.2 In vivo efficacy of siRNA conjugate silencing in hINHBE mouse model

[0784] After 14 days of AAV8 virus injection, the mice are grouped (5 mice per group), and a single 3 mg / kg (mpk) dose of siRNA conjugate of the application is administered subcutaneously, with a dosing volume of 5 μL / g and a solvent of RNase-free sterile PBS. The mice in the blank group are injected with the same volume of RNase-free sterile PBS. The SEAP protein expression (i.e., hINHBE protein expression) is detected at 7 days, 14 days, 21 days, 28 days, 35 days, and 42 days after administration, the gene expression inhibition rate is calculated, and the calculation formula is: inhibition rate % = (1 - average protein expression of the administration group / average protein expression of the blank group) * 100%, and the inhibition rate (%) results are shown in Table 40.

[0785] Table 40

[0786] As can be seen from Table 40, the siRNA conjugate of the application has high inhibitory activity on the hINHBE gene in vivo, can reduce the expression level of hINHBE for a long time, and has long-term inhibition in vivo.

[0787] Example 16: In vivo silencing effect of siRNA conjugate in mice expressing human INHBE (hINHBE) gene

[0788] 16.1 AAV8 construction of hINHBE gene overexpression mouse model

[0789] 6-8 weeks old C57BL / 6 male mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) enter the facility, and a single injection of adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{INHBE part CDS+part 3UTR}, the virus is provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) of hINHBE gene is used for target gene overexpression modeling, the administration volume is 100 μL (10 x 10 11 vg) per mouse, and ordinary feed is used for feeding.

[0790] 16.2 Pharmacodynamic study of siRNA conjugate silencing in vivo in hINHBE mouse model

[0791] AAV8 virus injection for 14 days, grouping (5 in each group), mice were subcutaneously administered a single 3 mg / kg (mpk) dose of siRNA conjugate of the application, the administration volume was 5 μL / g, and the solvent was RNase-free sterile PBS. The blank group was injected with the same volume of RNase-free sterile PBS. The SEAP protein expression (i.e. hINHBE protein expression) was detected on day 7, day 14 and day 21 after administration, the gene expression inhibition rate was calculated, and the calculation formula was: inhibition rate % = (1- average protein expression of administration group / average protein expression of blank group) * 100%, and the inhibition rate (%) results were as shown in Table 41.

[0792] Table 41

[0793] As can be seen from Table 41, the siRNA conjugate of the application has high inhibitory activity on hINHBE gene in vivo, and can reduce the expression level of hINHBE for a long time.

[0794] Example 17: Inhibition of human INHBE gene expression by siRNA conjugate in humanized mice

[0795] 6-8 week old C57BL / 6-hINHBE mice (provided by Bovogen Biologicals Co., Ltd.) were introduced into the feeding facility, and the mice were subcutaneously administered a single dose of 10 mg / kg siRNA conjugate of the application (5 mice in each group). The mice were euthanized 14 days after administration, and 30 mg of left lobe tissue of the mouse liver was rapidly frozen in liquid nitrogen, and then frozen ground into tissue homogenate. The tissue RNA was extracted and the target gene mRNA inhibition rate was detected, and the detection method was the same as that of Example 12, and the results were as shown in Table 42.

[0796] Table 42 siRNA conjugate INHBE mRNA inhibition rate

[0797] Wherein, the sequence of AC004285 is shown in Table 43.

[0798] Table 43

[0799] Wherein, the structure of (NAG37)s is as follows:

[0800] As can be seen from Table 42, the siRNA conjugate of the application has high inhibitory activity on hINHBE gene in vivo, and the inhibition capacity is better than that of the positive control AC004285.

[0801] Example 18: Silencing effect of siRNA conjugates in vivo in mice expressing human INHBE (hINHBE) gene

[0802] Using a similar method as in Example 15, the in vivo inhibition rate (%) of the following test siRNA conjugates against the hINHBE mouse model was determined, and the results are shown in Table 44.

[0803] Table 44

[0804] As can be seen from Table 44, the siRNA conjugates of the present application have high inhibitory activity on the hINHBE gene in vivo, and can reduce the expression level of hINHBE for a long time.

[0805] The above examples of the present disclosure are only examples for clearly illustrating the present disclosure, and are not intended to limit the embodiments of the present disclosure. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, it is not necessary and also impossible to exhaust all the embodiments. Any modification, equivalent replacement and improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the claims of the present disclosure.

Claims

1. A double-stranded ribonucleic acid inhibiting the expression of an INHBE gene, the double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand and the antisense strand being reverse complementary and / or substantially reverse complementary to form a double-stranded region of the double-stranded ribonucleic acid; wherein the sense strand comprising a sequence A which differs from at least 15 consecutive nucleotides of a target sequence by no more than 3 nucleotides, the antisense strand comprising a sequence B which differs from the reverse complement of at least 15 consecutive nucleotides of the target sequence by no more than 3 nucleotides; the target sequence being selected from the group consisting of the nucleotide sequence as set forth in any one of SEQ ID NOs: 1-6, 507-509, 610, 611 and a sequence comprising at least 15 consecutive nucleotides comprised in any one of SEQ ID NOs: 1-6, 507-509, 610, 611.

2. The double-stranded ribonucleic acid of claim 1, wherein, the target sequence being selected from the group consisting of the nucleotide sequence as set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, the sense strand comprising a sequence A consisting of at least 15 consecutive nucleotides of the nucleotide sequence as set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, the antisense strand comprising a sequence B which is the reverse complement and / or substantially reverse complement of a sequence consisting of at least 15 consecutive nucleotides of the nucleotide sequence as set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

3. The double-stranded ribonucleic acid of claim 1 or 2, wherein, the sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 20, 21 or 23 nucleotides.

4. The double-stranded ribonucleic acid of claim 3, wherein, the nucleotide sequence of the sense strand is a sequence A which differs from a sequence consisting of 15-28 consecutive nucleotides, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, more preferably 19, 20, 21 or 23 nucleotides, of the nucleotide sequence as set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611 by no more than 1 nucleotide.

5. The double-stranded ribonucleic acid of any of claims 1-4, wherein, the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

6. The double-stranded ribonucleic acid of claim 5, wherein, the nucleotide sequence of the antisense strand is a sequence B which differs from the reverse complement of a sequence consisting of 15-28 consecutive nucleotides, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides, of the nucleotide sequence as set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611 by no more than 1 nucleotide.

7. The double-stranded ribonucleic acid of any of claims 1-6, wherein, the double-stranded region has a length of 15-25 nucleotides, preferably 19-23 nucleotides, more preferably 19, 20, 21 or 23 nucleotides.

8. The double-stranded ribonucleic acid according to any one of claims 1-7, wherein, The positive and negative strands are complementary to form the double-stranded region, and the 3' end of the positive strand has 1-3 protruding nucleotides extending out of the double-stranded region, while the 3' end of the negative strand forms a blunt end; or, The sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand forms a blunt end; or, The sense strand and the antisense strand are complementary to form the double-stranded region, and both the sense strand and the antisense strand have 1-3 protruding nucleotides extending out of the double-stranded region at their 3' ends; or, The positive chain and the negative chain complement each other to form the double-chain region, and the 3' ends of both the positive chain and the negative chain form flat ends.

9. The double-stranded ribonucleic acid of any of claims 1-8, wherein, The justice chain and the antisense chain are selected from the following combinations: The sense strand includes the sense strand of any of the siRNAs shown in Tables 1 and 1-1 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA. Preferably, the justice chain and the antisense chain are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNAs shown in Tables 1 and 1-1 of this document: siRNA 15, siRNA 419, siRNA 421-siRNA 425, siRNA 434, siRNA 466, siRNA 480-siRNA 487, and siRNA 492. The antisense strand comprises the antisense strand of the corresponding siRNA.

10. The double-stranded ribonucleic acid of any of claims 1-9, wherein, Each nucleotide in the sense strand is independently a modified or unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified or unmodified nucleotide.

11. The double-stranded ribonucleic acid of any of claims 1-10, wherein, In the sense strand, any two nucleotides linked together are connected by a phosphodiester bond, a thiophosphate diester bond, or a dithiophosphate diester bond, and / or, in the antisense strand, any two nucleotides linked together are connected by a phosphodiester bond, a thiophosphate diester bond, or a dithiophosphate diester bond.

12. The double-stranded ribonucleic acid of any of claims 1-11, wherein, The 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

13. The double-stranded ribonucleic acid of any of claims 1-12, wherein, Neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end or the 3' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end and the 3' end nucleotide of the positive strand are each connected to a reverse debased deoxyribose residue.

14. The double-stranded ribonucleic acid of any of claims 1-13, wherein, The double-stranded ribonucleic acid is siRNA.

15. A double-stranded ribonucleic acid (BRNA) modifier, which is a BRNA modifier according to any one of claims 1-14, wherein the BRNA modifier comprises at least one of the following chemical modifications: (1) Modification of at least one nucleotide in the positive strand, (2) Modification of the phosphodiester bond at at least one position in the positive chain. (3) Modification of at least one nucleotide in the antisense strand, (4) Modification of the phosphodiester bond at at least one position in the antisense chain; Optionally, the nucleotide sequence of the sense strand of the double-stranded RNAi agent comprises sequence A and sequence D, the 3' end of sequence A in the sense strand is linked to sequence D consisting of 1-3 nucleotides, preferably sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded RNAi agent comprises sequence B and sequence E, the 3' end of sequence B in the antisense strand is linked to sequence E consisting of 1-3 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded RNAi agent comprises sequence A', the 3' end of sequence A in the sense strand is excluded 1-3 nucleotides to form the sequence A'; Optionally, the sense strand and the antisense strand of the double-stranded RNAi agent are selected from the following sequence combinations: the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A linked with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A linked with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E.

16. The double-stranded ribonucleic acid modification of claim 15, wherein, the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof; preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.

17. The double-stranded ribonucleic acid modification of claim 15 or 16, wherein, the nucleotide derivative in the nucleotide derivative modification is selected from iso-nucleotide, LNA, ENA, cET, UNA, or GNA.

18. The double stranded ribonucleic acid modification of any one of claims 15-17, wherein, from the 7th, 9th, 10thand 11thpositions in the 5' end to the 3' end direction, the ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides in the remaining positions are 2'-O-CH3 modified ribonucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 5, 7, 8, and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, 11, and 13 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 8, and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; 19. The double stranded ribonucleic acid modification of any one of claims 15-18, wherein, or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; 20. The double stranded ribonucleic acid modification of any one of claims 15-19, wherein, neither the 5' end nor the 3' end of the sense strand is connected to an inverted abasic deoxyribose residue, or the 5' end or the 3' end nucleotide of the sense strand is connected to an inverted abasic deoxyribose residue, or the 5' end and the 3' end nucleotides of the sense strand are respectively connected to inverted abasic deoxyribose residues. along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate linkage at a position selected from: between the 1st and 2nd nucleotides from the 5' end of the sense strand; between the 2nd and 3rd nucleotides from the 5' end of the sense strand; between the 1st and 2nd nucleotides from the 3' end of the sense strand; between the 2nd and 3rd nucleotides from the 3' end of the sense strand; or, along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate linkage at a position selected from: between the 1st and 2nd nucleotides from the 5' end of the sense strand; between the 2nd and 3rd nucleotides from the 5' end of the sense strand; or, when the 3' terminal nucleotide of the sense strand is linked to an inverted deoxyabasic deoxyribose residue, the sense strand comprises phosphorothioate linkages at positions: between the 1st and 2nd nucleotides from the 5' terminus of the sense strand; and between the 2nd and 3rd nucleotides from the 5' terminus of the sense strand; and between the inverted deoxyabasic deoxyribose residue from the 5' terminus of the sense strand and the 1st nucleotide; when the 5' and 3' terminal nucleotides of the sense strand are linked to inverted deoxyabasic deoxyribose residues, the sense strand comprises phosphorothioate linkages at positions: between the inverted deoxyabasic deoxyribose residue from the 5' terminus of the sense strand and the 1st nucleotide; between the 1st and 2nd nucleotides from the 5' terminus of the sense strand; and between the inverted deoxyabasic deoxyribose residue from the 3' terminus of the sense strand and the 1st nucleotide.

21. The double stranded ribonucleic acid modification of any one of claims 15-20, wherein, in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a ribonucleotide derivatized with a GNA modification, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a ribonucleotide derivatized with a GNA modification, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides.

22. The double stranded ribonucleic acid modification of any one of claims 15-21, wherein, The 5' end nucleotide of the antisense strand is not linked with a 5' phosphate group or a 5' phosphate derivative group, or the 5' end nucleotide of the antisense strand is linked with a 5' phosphate group or a 5' phosphate derivative group.

23. The double stranded ribonucleic acid modification of any one of claims 15-22, wherein, The antisense strand comprises a phosphorothioate bond or a phosphorodithioate bond at the following positions: The antisense strand comprises a phosphorothioate bond or a phosphorodithioate bond at the following positions: between the 1st and 2nd nucleotides from the 5' end of the antisense strand; between the 2nd and 3rd nucleotides from the 5' end of the antisense strand; between the 1st and 2nd nucleotides from the 3' end of the antisense strand; between the 2nd and 3rd nucleotides from the 3' end of the antisense strand; or, The antisense strand comprises a phosphorothioate bond and a phosphorodithioate bond at the following positions: between the 1st and 2nd nucleotides from the 5' end of the antisense strand; between the 2nd and 3rd nucleotides from the 5' end of the antisense strand; between the 1st and 2nd nucleotides from the 3' end of the antisense strand.

24. The double stranded ribonucleic acid modification of any one of claims 15-23, wherein, The sense strand of the double-stranded ribonucleic acid modifier has the structure as set forth in any one of (a1)-(a 14 ) above: (a1) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (a2) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (a3) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (a4) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3' (a5) 5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3' (a6) 5'-mN1- (s) -mN2- (s) -mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ', (a7) 5'-mN1- (s) -mN2- (s) -mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 - N 13 f-mN 14 - mN 15 - mN 16 - mN 17 - mN 18 - mN 19 -3 ', (a8) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ', (a9) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 - N 13 - N 14 - N 15 - N 16 - N 17 - N 18 - N 19 -3', (a 10 )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3', (a 11 )5'-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN13-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3', (a 12 )5’-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’, (a 13 )5’-mN 21 -(s)-mN 20 -(s)-mN 19 -mN 18 -N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’ (a 14 )5'-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 f-N 11 f-N 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3', wherein N1-N 23 are independently of each other selected from ribonucleotides having a base which is A, U, C or G, The capital letter T represents a deoxyribonucleotide with a base of thymine, the lower case letter m represents that the ribose nucleotide adjacent to the right of the letter m is a 2'-O-CH3 modified ribose nucleotide, the lower case letter f represents that the ribose nucleotide adjacent to the left of the letter f is a 2'-F modified ribose nucleotide, (invAb): represents an inverted dealkylated deoxyribose residue, -(s)- represents that the two nucleotides adjacent to the front and back are linked by a phosphorothioate bond, Optionally, the ribose group of the 5' end nucleotide of the sense strand has a 5' hydroxyl group.

25. The double stranded ribonucleic acid modification of any one of claims 15-24, wherein, The antisense strand of the double-stranded ribonucleic acid modification has a structure as set forth in any one of (b1)-(b 32 ) (b1)5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’, (b2) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3 ', (b3) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN10- 3' 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b4) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN10-N11f- 3 ', wherein 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3 ', (b5)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3', (b6) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 - (s)-mN 20 - (s)-mN 21 - 3 ', (b7) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN10- 3' (b8) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN10- 3' 10 f-mN 11 f-mN 12 f-mN 13 f-mN 14 f-mN 15 f-mN 16 f-mN 17 f-mN 18 f-mN 19 f-mN 20 f-mN 21 f-mN -3' (b8) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN10-N11f- 3 ', wherein 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 - (s)-mN 20 - (s)-mN 21 - 3 ', (b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3', (b 10 ) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3 ', (b 11 ) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3 ', (b 12 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 13 ) 5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 14 ) 5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 15 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 16 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 17 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 18 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 19 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 20 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 21 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 22 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 23 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 24 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 25 )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 26 )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 27 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 28 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 29 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 30 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 31 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 32 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -(ss)-mN 21 -3' wherein N1-N 23 are independently of each other selected from ribonucleotides having a base which is A, U, C or G, The capital letter T represents a deoxyribonucleotide with a base of thymine, the lower case letter m represents that the ribose nucleotide adjacent to the right of the letter m is a 2'-O-CH3 modified ribose nucleotide, lowercase letter f means the ribose nucleotide adjacent to the left of the letter f is a 2'-F modified ribose nucleotide, P1 means the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide, EVP means the nucleotide adjacent to the right of the letter combination is a 5'-trans-vinyl phosphonate nucleotide, -(s)- means the two nucleotides adjacent to the front and back are connected by a phosphorothioate bond, -(ss)- means the two nucleotides adjacent to the front and back are connected by a phosphorodithioate bond, [GNA] means the ribose nucleotide adjacent to the right of the letter is a ribose nucleotide with GNA modification, Optionally, the 5' terminal nucleotide of the antisense strand is not with P1 or EVP, which means the ribose group of the nucleotide has 5' hydroxyl.

26. The double stranded ribonucleic acid modification of any one of claims 15-25, wherein, The sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of the double-stranded ribonucleic acid modifiers shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding double-stranded ribonucleic acid modifier. Preferably, the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of siRNA 414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, siRNA 488-siRNA 489 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

27. A double-stranded ribonucleic acid modifier, which comprises the 3' terminal end of the sense strand of the double-stranded ribonucleic acid modifier of any one of claims 15-26 is modified to be a blunt end, optionally by excluding the overhanging nucleotide of the 3' end of the sense strand of the double-stranded ribonucleic acid modifier of any one of claims 15-26 extending out of the double-stranded region.

28. A double-stranded ribonucleic acid conjugate, wherein, The double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid of any one of claims 1-14, or the double-stranded ribonucleic acid modifier of any one of claims 15-27; and a conjugate group conjugated to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modifier.

29. The double-stranded ribonucleic acid conjugate of claim 28, wherein, The conjugating group has a structure according to any one of:

30. The double-stranded ribonucleic acid conjugate of claim 28 or 29, wherein, The conjugate group is conjugated to the 3' terminal end of the sense strand.

31. The double-stranded ribonucleic acid conjugate of any of claims 28-30, wherein, The conjugate group is conjugated to the 3' terminal end of the sense strand by a phosphodiester bond or a phosphorothioate bond. Preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' terminal end of the sense strand forms a blunt end, and the 3' terminal end of the antisense strand has 1-3 overhanging nucleotides extending out of the double-stranded region. Alternatively, The sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' terminal end of the sense strand forms a blunt end, and the 3' terminal end of the antisense strand forms a blunt end.

32. The double-stranded ribonucleic acid conjugate of any one of claims 28-31, wherein, The double-stranded ribonucleic acid conjugate has the structure shown below: The double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modifier.

33. The double-stranded ribonucleic acid conjugate of any one of claims 28-32, wherein, The double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting the expression of the INHBE gene.

34. The double-stranded ribonucleic acid conjugate of any one of claims 28-33, wherein, The double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 herein with a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 herein with a conjugate group; Preferably, the double-stranded ribonucleic acid conjugate, wherein the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate; More preferably, the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of siRNA 417, siRNA 451-siRNA 455, siRNA 464, siRNA 476, siRNA 490-siRNA 491 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

35. A prodrug of the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, or the double-stranded ribonucleic acid conjugate of any one of claims 28-34.

36. A pharmaceutical composition, wherein, The pharmaceutical composition comprises at least one of the following: the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, the double-stranded ribonucleic acid conjugate of any one of claims 28-34, or the prodrug of claim 35.

37. The pharmaceutical composition of claim 36, wherein, The pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, and optionally further comprises one or more additional therapeutic agents.

38. Use of the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, the double-stranded ribonucleic acid conjugate of any one of claims 28-34, the prodrug of claim 35, or the pharmaceutical composition of claim 36 or 37 in at least one of the following: (1) inhibiting INHBE gene expression in vivo or in vitro, or preparing a medicament for inhibiting INHBE gene expression; (2) for preventing or treating a disease associated with abnormal expression of INHBE gene, or preparing a medicament for preventing or treating a disease associated with abnormal expression of INHBE gene; (3) for treating a subject suffering from a disease that would benefit from reduction of INHBE gene expression, or preparing a medicament for treating a subject suffering from a disease that would benefit from reduction of INHBE gene expression.

39. The use of claim 38, wherein, The disease associated with abnormal expression of INHBE gene is selected from the group consisting of: obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome.

40. A method for inhibiting expression of an INHBE gene in a cell in vivo or in vitro, wherein, The method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of claims 1-14, the double-stranded ribonucleic acid modification according to any one of claims 15-27, the double-stranded ribonucleic acid conjugate according to any one of claims 28-34, the prodrug according to claim 35, or the pharmaceutical composition according to claim 36 or 37. The prodrug according to claim 35 or the pharmaceutical composition according to claim 36 or 37 is contacted.

41. The method of claim 40, wherein, The cell is an in vivo cell or an in vitro cell.

42. The method of claim 40 or 41, wherein, The cell is in a subject; Preferably, the subject is a mammal, more preferably a human; Preferably, the subject has at least one of the following characteristics: Abnormal expression of the INHBE gene in vivo, more specifically, abnormal high expression of the INHBE gene; Suffering from a disease associated with abnormal expression of the INHBE gene; Suffering from a disease that would benefit from a reduction in the expression of the INHBE gene.

43. The double-stranded ribonucleic acid according to any one of claims 1-14, the double-stranded ribonucleic acid modification according to any one of claims 15-27, the double-stranded ribonucleic acid conjugate according to any one of claims 28-34, the prodrug according to claim 35, or the pharmaceutical composition according to claim 36 or 37 for use in therapy.

Citation Information

Patent Citations

  • Metabolic disorder related target gene iRNA compositions and methods of use thereof

    CN117716032A

  • SiRNA, conjugate and pharmaceutical composition for reducing INHBE expression

    CN118086291A

  • Instatin subunit beta E (INHBE) modulator compositions and methods of use thereof

    CN118159654A

  • Inhibin subunit beta e-related double stranded oligonucleotide compositions and methods relating thereto

    WO2025054596A2

  • Inhibitor for inhibiting expression of inhibin beta e gene and use thereof

    WO2025082057A1