Infection-modulating peptide for malaria prophylaxis and high-throughput screening of antimalarials

Abstract

The invention shows that a P. falciparum-specific interaction between a PfEMP1 adhesin and the endothelial receptor CD36 modulates sporozoite infectivity. Using a synthetic peptide to leverage this interaction, a robust high-throughput screening method has been developed to identify next-generation prophylactics against this deadly malaria parasite. The synthetic peptide is also used as a prophylactic medicament to prevent P. falciparum infection in a subject.

Description

INFECTION-MODULATING PEPTIDE FOR MALARIA PROPHYLAXIS AND HIGH-THROUGHPUT SCREENING OF ANTIMALARIALS BACKGROUND OF THE INVENTION

[0001] Despite the growing number of sporozoite surface proteins recognized as essential for host infection1, very few host-parasite protein-protein interactions (PPI) have been identified to date2, and their contribution to sporozoite infection remains unclear.

[0002] Thus, there is a need in the art for a more complete understanding of host- parasite interactions and compositions that can regulate these interactions. The invention fulfills this need. BRIEF SUMMARY OF THE INVENTION

[0003] The invention encompasses peptides and uses thereof. The invention encompasses an isolated peptide for use in modulating P. falciparum sporozoite infectivity, wherein the peptides are between 12 and 37 amino acids in size comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein X1, X2, and X3 are any amino acid. In some embodiments, X1 is N or Q, X2 is N or Q, and X3 is V, L, or I. In some embodiments, the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3). In some embodiments, the peptide comprises at least 21 amino acids; preferably the peptide comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the peptide consists of 27 amino acids. In some embodiments, the peptide comprises the amino acid sequence ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In some embodiments, the peptide consists of the amino acid sequence ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

[0004] The invention encompasses the use of the peptide as disclosed herein to increase P. falciparum sporozoite infectivity of cells in vitro. In some embodiments of the use, the cells are hepatic cells.

[0005] The invention encompasses a peptide as disclosed herein for use in the prophylactic treatment of P. falciparum infection in a subject.

[0006] The invention encompasses a cell culture medium comprising at least one peptide of the invention. In some embodiments, the cell culture media comprises hepatic cells. In some embodiments, the cells are a hepatocyte cell line. In some embodiments, the hepatic cells are infected with P. falciparum sporozoites.

[0007] The invention encompasses a method for screening for peptides that increase P. falciparum sporozoite infectivity. In some embodiments, the method comprises a) providing a peptide comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1,X2, and X3 are any amino acid; b) incubating the peptide with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; c) measuring the level of intracellular sporozoites; and d) detecting an increase in the level of intracellular sporozoites as compared to P. falciparum sporozoites not incubated with the peptide. In some embodiments, X1is N or Q, X2is N or Q, and X3is V, L, or I. In some embodiments, the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3). In some embodiments, the peptide is between 12 and 37 amino acids in size; preferably between 21 and 37 amino acids in size. In some embodiments, the cells are hepatocytes. In some embodiments, the cells are a hepatocyte cell line.

[0008] The invention encompasses a method comprising: a) incubating a peptide comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1, X2, and X3 are any amino acid, with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; and b) measuring the level of intracellular sporozoites. In some embodiments, X1 is N or Q, X2 is N or Q, and X3 is V, L, or I. In some embodiments, the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3). In some embodiments, the peptide is between 12 and 37 amino acids in size; preferably between 21 and 37 amino acids in size. In some embodiments, the cells are hepatocytes. In some embodiments, the cells are a hepatocyte cell line. In some embodiments, the method further comprises incubating the P. falciparum sporozoites and / or the cells permissive to infection by P. falciparum with a test compound and determining the effect on the levelof intracellular sporozoites. In some embodiments, the further incubating step comprises the peptide according to the invention.

[0009] The invention encompasses a method for the infection of cells with P. falciparum sporozoites comprising incubating P. falciparum sporozoites with cells in the presence of a peptide between 12 and 37 amino acids in size comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1, X2, and X3are any amino acid. In some embodiments, X1is N or Q, X2is N or Q, and X3is V, L, or I. In some embodiments, peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3). BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1A-I: A PfEMP1-binding motif in CD36 primes sporozoites for hepatocyte infection. (Fig. 1A) Representative scanning electron microscopy micrograph of a P. falciparum sporozoite stained with anti-SpzPfEMP1. The region delimited by the white rectangle is shown at higher magnification on the bottom panel. Scale bar, 1 µm. (Fig.1B) Quantification of sporozoite binding to recombinant protein coat of CD36 (rCD36) or ICAM1 (rICAM1) alone or in the presence of the soluble protein. Dotplots show the percentage of binding relative to a non-coated surface, n = 2-3 independent experiments. (Fig. 1C) Percentage of sporozoite binding to rCD36 or rICAM1 in the presence of anti-SpzPfEMP1 antibodies or pre-immune serum, n = 3-4 independent experiments. (Fig.1D) Amino acid sequence of CD36145-171 with residues known to make direct contact with PfEMP1 highlighted. A sequence alignment with the corresponding amino acids in the CD36 homologue SR-BI is shown (bottom). The SR- BI sequence was used as a control for CD36145-171. (Fig. 1E) Principal component analysis (PCA) of sporozoite bulk RNA-seq data. Salivary gland sporozoites were either left quiescent (SG) or activated by a temperature switch (37ºC) alone, or in combination with CD36145-171, 10% FBS, or both. PC1 and PC2 are the two first principal components and account for 80% and 7% of the total variance, respectively. Data points were obtained in n = 3-5 independent experiments. (Fig.1F) Representative images of HC- 04 cells infected with P. falciparum sporozoites exposed to vehicle (left panel) or 10 µM CD36145-171 (right panel). Extracellular (yellow) and intracellular (red) sporozoites weredetected by sequential staining with anti-PfCSP before and after HC-04 cell permeabilization. Cell nuclei were stained with Hoechst. Scale bar, 10 µm. (Fig. 1G) Effect of the indicated peptides on sporozoite attachment to and invasion of HC-04 cells. Both peptides were used at 10 µM. Sporozoite numbers in each well were first normalized to the number of HC-04 cells in the well and then expressed as a percentage of the vehicle control. For CD36145-171, n = 6 independent experiments; for SR-BI, n = 3 independent experiments. (Fig. 1H) Sporozoite attachment to and invasion of HC-04 cells following sporozoite pre-incubation with CD36145-171 (10 µM) with or without U73122 (15 µM). Both treatments were washed off prior to HC-04 cell infection. Data were normalized as in G. n = 2 independent experiments. (Fig. 1I) Quantification of P. falciparum liver-stage parasites 3 days after infection of micropatterned cocultures (MPCCs). CD36145-171was removed 3 h after infection. Parasites were detected with PfHSP70 antibody and quantified by microscopy in n = 2 independent experiments. Statistical significance was assessed using one-way ANOVA with Dunnett’s multiple comparisons test. (Fig.1B-C; G-H), or an unpaired t test (Fig.1I).

[0011] Figure 2A-E: Increased infectivity of CD36-primed P. falciparum sporozoites provides a robust in vitro platform for anti-sporozoite screening. (Fig.2A) Schematics depicting CSP domains and the binding profiles of anti-CSP human monoclonal antibodies (hmAbs) used in this study. (Fig.2B) Mean fluorescence intensity of P. falciparum sporozoites live-stained with the indicated anti-PfCSP antibodies after a 30-minute incubation at 37°C with or without CD36145-171. (Fig. 2C) Negative (no mAb) and positive (mAb317) sporozoite infection rates of HC-04 cells with or without 10 µM CD36145-171 supplementation. Imaging data were normalized as in Fig.1G, H. Replicates 1 through 6 correspond to n = 6 independent experiments. Statistical significance was assessed using two-way ANOVA with Tukey’s multiple comparisons test. (Fig.2D) Z’ values based on data from C. Z’ values within the shaded area (0.5 ≥ Z’ < 1) indicate a robust assay. (Fig.2E) Correlation between P. falciparum sporozoite entry inhibition assayed in vitro in the presence of CD36145-171and in vivo protection rates for the depicted antibodies. hmAbs were used at 5 ug / ml. The linear regression line, Pearson correlation coefficient r and respective P value are shown.

[0012] Figure 3A-I: CD36-dependent effects on Plasmodium sporozoites. (Fig.3A) Representative flow cytometry profiles showing SpzPfEMP1 surface expression on P. falciparum sporozoites. Sporozoites were left unstained (gray) or live stained with anti- SpzPfEMP1 (blue). (Fig.3B) SpzPfEMP1 immuno-localization in iRBC. Representative scanning electron microscopy micrograph of a human RBC infected with P. falciparum and immunolabelled with SpzPfEMP1 antibody. The parasite strain was selectively enriched for SpzPfEMP1 expression by 3 rounds of SpzPfEMP1 antibody panning. (Fig.3C) Venn diagram showing the intersection of differentially expressed genes induced by sporozoite activation with FBS alone or FBS combined with CD36145-171. Except for a small number of genes in each condition, the transcriptional response to the two stimuli largely overlaps. (Fig. 3D). Effect of the indicated peptides on P. berghei sporozoite invasion of HC-04 cells. Both peptides were used at 10 µM. n = 3 independent experiments. Statistical significance was assessed using one-way ANOVA with Dunnett’s multiple comparisons test. (Fig.3E) Effect of CD36145-171 (10 µM) on NF135 P. falciparum sporozoite invasion of HC-04 cells. Data were normalized as in Fig. 1. n = 2 independent experiments. (Fig.3F) Effect of initial CD36145-171 treatment on liver- stage parasite numbers 3 days after infection of MPCCs with NF135 P. falciparum sporozoites. Parasites were detected and quantified as in Fig. 1H. (Fig. 3G) Quantification of parasite size 72 h after MPCC infection. CD36145-171(10 µM) was removed 3 h post-infection. Developing NF54 parasites were detected and quantified by microscopy as in Fig. 1I. n = 2 independent experiments. Statistical significance was assessed using unpaired t tests (Fig. 3E-G). (Fig. 3H) Contour plot showing surface expression of CD36 and CD81 in primary human hepatocytes. The quadrants were defined based on unstained cells. (Fig.3I) Relative qPCR quantification of CD36 and CD81 mRNA expression in primary human hepatocytes and bone marrow (BM) cells. Gene expression was normalized to that of GAPDH.

[0013] Figure 4: Image-based detection of sporozoite invasion phenotypes. Representative images of HC-04 cells infected with P. falciparum sporozoites under the indicated conditions. CD36145-171 was used at 10 µM and mAb317 at 5 µg / ml. Extracellular and intracellular sporozoites were detected as in Fig. 1F. The panels onthe right zoom-in on the highlighted regions. The arrows indicate intracellular parasites. Sporozoites exposed to the neutralizing mAb317 CSP antibody exhibit shedding of the CSP coat (bottom panels). Scale bar, 10 µm.

[0014] Figure 5A-C: PfEMP1-binding motif in CD36 primes sporozoites for hepatocyte infection. A. Overlap between the X-ray structure of the PfEMP1-CD36 complex1(PDB 5LGD) and the PfEMP1-peptide AF3 model. The Root Mean Square Deviation (RMSD) between PfEMP1 in the AF3 model (not shown) and X-ray structure is equal to 0.6 Ang. The right panel shows a surface representation of the hydrophobic pocket of PfEMP1 with key CD36 amino acids highlighted. Predicted critical hot spots in the CD36 sequence (ΔΔGmutation-to-Alanine < -1.5kcal / mol) include ASN151, PHE153, and MET156, whereas warm hot spots (-1.5kcal / mol < ΔΔGmutation-to-Alanine < - 0.5kcal / mol) comprise VAL154 and ILE157. Loss of the indicated hotspots is expected to disrupt CD36 binding to PfEMP1. B. Effect of the indicated peptides on P. falciparum sporozoite (spz) attachment to and invasion of HC-04 cells. CD36145-171 comprises the PfEMP1 binding motif of CD36. CD363A includes alanine substitutions at ASN151, PHE153, and MET156. CD365A carries the same substitutions as CD36 3A, with two additional alanine substitutions at VAL154 and ILE157. AlphaFold2 models of the two mutant peptides in complex with PfEMP1 have low quality scores compared to the wild-type peptide (0.40 and 0.44 vs. 0.79), further confirming that the mutated residues are critical for binding. SR-BIpeptide was used as a negative control. Peptides were used at 10 µM. Sporozoite numbers in each well were first normalized to the number of HC-04 cells in the well and then expressed as a percentage of the vehicle control. For CD36145-171, n = 10 independent experiments; for the remaining peptides, n = 2 independent experiments. The amino acids ASN151, PHE153, and MET156 are critical for the infection priming effect of CD36145-171. C. Effect of CD36145-171 and the indicated mutants on the kinetics of HC-04 cell invasion. The PfEMP1-binding motif of CD36 acts to accelerate the rate of sporozoite entry into cells.

[0015] Figure 6: Infection priming effect of CD36145-171across host donors. Primary human hepatocytes from six different donors were infected with P. falciparumsporozoites (spz) with or without CD36145-171 supplementation (10 µM). CD36145-171 consistently enhanced infection across all donors, indicating a donor-independent effect.

[0016] Figure 7: CD36145-171 inhibits sporozoite binding to endothelial cells. Effect of CD36145-171 on sporozoite binding to a monolayer of primary human microvascular endothelial cells. Peptides used at 10 µM. The inhibitory effect was observed on two P. falciparum strains of different geographical origins (NF54 and NF135).

[0017] Figure 8: Effect of the indicated peptides on P. falciparum sporozoite (spz) attachment to and invasion of HC-04 cells. CD36149-160 increases sporozoite binding to and entry into hepatic cells. Peptides used at 10 µM. DETAILED DESCRIPTION OF THE INVENTION

[0018] PfEMP1 proteins are encoded by a polymorphic multigene family, the var genes, unique to Plasmodium falciparum (P. falciparum). Their monoallelic expression on the surface of infected erythrocytes contributes to immune evasion and serves as the major driver of the cellular interactions between parasitized cells and the microvasculature6, also known as cytoadhesion. The recent discovery that a member of the PfEMP1 family is expressed on the sporozoite surface and may be required for hepatocyte infection7(Fig.3A) challenges the understanding of this protein family, suggesting an unexpected role for PfEMP1-dependent host-parasite interactions in the transmissible sporozoite stage.8

[0019] PfEMP1 proteins bind to a number of host receptors through Duffy-binding like (DBL) and cysteine-rich interdomain region (CIDR) adhesive domains.6The sequence of these highly polymorphic domains determines the receptor specificity across the PfEMP1 protein family, with CD36 being the most common adhesive interaction involving the CIDR domain, and ICAM-1 acting as the receptor for a subset of DBL domains.9Sporozoites, the mosquito-transmitted form of Plasmodium, represent the primary target for malaria prophylaxis. Here the inventors sought to elucidate whether PfEMP1- mediated PPIs are conserved in the sporozoite stage and how they might impact sporozoite function and, ultimately, malaria transmission. Here is provided evidence thata conserved interaction between PfEMP1 and CD36 enhances P. falciparum sporozoite infectivity following vector transmission, marking the first example of a host-parasite PPI conserved across distinct stages of the life cycle. Based on the known tissue distribution of CD3626, the liver sinusoids appear as the most likely sites of sporozoite receptor binding, with endothelial and Kupffer cells acting as potential CD36 “donors”. Hepatocytes could potentially contribute to host-sporozoite CD36-PfEMP1 interactions, however, CD36 expression on the hepatocyte surface is typically very low26,27(Fig.3H, I), making this scenario less likely.

[0020] Taken together with the observation that PfEMP1-blocking antibodies reduce P. falciparum sporozoite infection7and that no additional surface adhesins appear to be involved in the CD36-induced sporozoite adhesive phenotype, the available evidence supports a model whereby SpzPfEMP1-CD36 interactions during sinusoid crossing may modulate the affinity of SpzPfEMP1 for a yet-unidentified hepatic receptor, perhaps by inducing a conformational shift in PfEMP1 itself. Hypothetically, an adhesion-enhancing conformational switch in SpzPfEMP1 could increase sporozoite infectivity by lowering the signaling threshold required for the discharge of the secretory organelles necessary for host cell invasion. Host-induced conformational changes have been described for an EPCR-interacting PfEMP1, with receptor binding causing major rearrangements across the CIDR1⍺ and DBL1⍺ domains28. Whether CD36 can similarly trigger conformational changes in SpzPfEMP1 and to what extent spatial rearrangements across the multiple PfEMP1 domains might modulate hepatic receptor affinity remain to be determined.

[0021] Although PfEMP1 proteins are considered poor candidates for prophylactic interventions due to the lack of sequence conservation in their host-binding domains13, the inventors successfully leveraged the conserved infection-boosting effect of the PfEMP1-CD36 interaction to develop a robust, HTS-compatible image-based assay for interrogating next generation malaria prophylactics. The assay primarily quantifies sporozoite invasion, but a more comprehensive multidimensional profiling of cell and parasite features could provide additional layers of information, allowing for a finer understanding of the mechanisms through which the compounds or biologicals beingtested exert their effects. For example, the most potent CSP monoclonal antibodies neutralize sporozoites through a dotty death mechanism, an early indicator of which is the shedding of the sporozoite CSP coat29. By profiling CSP in both extracellular and intracellular sporozoites, the assay can capture these antibody-induced changes in the 5 CSP coat, allowing to correlate an antibody’s efficacy in blocking host cell invasion with its mechanism of action (Fig. 4). In conclusion, the inventors propose that routinely leveraging the sporozoite priming effect of the CD36-PfEMP1 interaction for HTS could accelerate the discovery of much-needed malaria prophylactics. This can be achieved in particular using a synthetic peptide comprising the erythrocyte membrane protein 1 10 (PfEMP1)-binding motif of the endothelial class B scavenger receptor CD36, called herein CD36 synthetic peptide or synthetic peptide.

[0022] The inventors have also shown that the CD36 synthetic peptide competitively inhibits sporozoite binding to endothelial cells (Fig.7). Endothelial cells form a physical barrier that sporozoites must cross before infecting the liver2, and, unlike hepatocytes, 15 express CD36 on their surface3. These results suggest that the CD36 peptide could potentially act as a prophylactic to prevent liver infection and underscores its dual activity in modulating sporozoite interactions with endothelial cells (inhibitory) versus hepatocytes (activating). PEPTIDES 20

[0023] The invention encompasses isolated peptides that bind to PfEMP1 proteins expressed on the surface of P. falciparum sporozoites. The peptides can be for use in a culture media or pharmaceutically acceptable excipient. The peptides can be for use to modulate, which means increase or decrease, P. falciparum sporozoite infectivity of cells in vitro or in vivo. In some embodiments, the peptides are for use to increase P. 25 falciparum sporozoite infectivity of cells in vitro. In some other embodiments, the peptides are for use to decrease P. falciparum sporozoite infectivity of cells by inhibiting binding to endothelial cells in vivo. The invention further encompasses the use of the peptides of the invention to modulate (i.e. increase or decrease) P. falciparum sporozoite infectivity of cells in vitro or in vivo. Some embodiments relate to the use of the peptidesto increase P. falciparum sporozoite infectivity of cells in vitro. Other embodiments relate to the use of the peptides to decrease P. falciparum sporozoite infectivity of cells in vivo.

[0024] In preferred embodiments, the peptides are soluble peptides. The peptides can be modified to increase their solubility, for example, adding hydrophilic amino acids such 5 as lysine, arginine, and glutamic acid to the ends; N-terminal acetylation and / or C- terminal amidation, and adding tags such as polyethylene glycol (PEG) or biotin.

[0025] The terms “isolated or purified” mean modified “by the hand of humans” from the natural state; in other words, if an object exists in nature, it is said to be isolated or purified if it is modified or extracted from its natural environment or both. For example, a 10 polynucleotide or a protein / peptide naturally present in a living organism is neither isolated nor purified; on the other hand, the same polynucleotide or protein / peptide separated from coexisting molecules in its natural environment, obtained by cloning, amplification and / or chemical synthesis is isolated for the purposes of the present invention. Furthermore, a polynucleotide or a protein / peptide which is introduced into an 15 organism by transformation, genetic manipulation or by any other method, is “isolated” even if it is present in said organism. The term “purified” as used in the present invention means that the proteins / peptides according to the invention are essentially free of association with the other proteins or polypeptides, as is for example the product purified from the culture of recombinant host cells or the product purified from a non-recombinant 20 source. Various techniques can be used to obtain purified peptides according to the invention, for example, affinity chromatography or gel filtration.

[0026] In various embodiments, the peptide is chemically synthesized.

[0027] In one embodiment, the peptide is at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 25 45, 46, 47, 48, 49, or 50 amino acids in size. In one embodiment, the peptide is less than 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In various embodiments, the peptide is between 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, or 49 and 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. For example, the peptide may be between 12 and 27, 12 and 37, 15 and 27, 15 and 37, 20 and 37, 20 and 40, 21 and 27, 21 and 37 or 20 and 45 amino acids in size. In some embodiments, the peptide comprises at least 21 amino acids. In some embodiments, the peptide consists of 27 amino acids.

[0028] Preferably, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein X1, X2, and X3, are any amino acid that does not interfere with binding or activity.

[0029] In some embodiments, the peptide comprises the amino acids Y, Q, N, F, V, M, I, N, and S in an amino acid sequence of 12 consecutive amino acids.

[0030] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein I is replaced with G, A, V, or L.

[0031] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein S is replaced with C, T, or M. In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein M is replaced with C, T, or S.

[0032] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein Y is replaced with F or W.

[0033] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein F is replaced with Y or W.

[0034] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein N is replaced with D, E, or Q.

[0035] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO:2); wherein Q is replaced with D, E, or N.

[0036] In some embodiments, X1 is any amino acid, X2 is any amino acid, and X3 is any amino acid.

[0037] In some embodiments, X1 is glycine, alanine, asparagine, or glutamine, X2 is glycine, alanine, asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0038] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0039] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3is valine, leucine, or isoleucine.

[0040] In some embodiments, the peptide comprises or consists of the amino sequence YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In particular embodiments, the peptide comprises at least 21 amino acids; the peptide may be between 21 and 27 or 21 and 37 amino acids.

[0041] In some embodiments, the peptide comprises or consists of an amino sequence having at least 70,%, 75%, 80%, 85%, 90% or 95% identity to the amino acid sequence of YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

[0042] Also especially preferred in this regard are conservative substitutions where the properties of a peptide of the present invention are preserved in the variant form compared to the original form. An example of a variant of the present invention includes a peptide in which there is a substitution of one or more amino acids with one or more other amino acids. The skilled person is aware that various amino acids have similar properties. One or more such amino acids of a substance can often be substituted by one or more other such amino acids without interfering with or eliminating a desired activity of that substance. Such substitutions may be referred to as “conservative” amino acid substitutions.

[0043] Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine andisoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids which can often be substituted for one another include: phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); lysine, arginine and histidine (amino acids having basic side 5 chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulfur containing side chains). Substitutions of this nature are often referred to as “conservative” or “semi-conservative” amino acid substitutions. CELL CULTURES AND CULTURE MEDIA 10

[0044] The invention encompasses cell cultures and culture media comprising at least one isolated peptide of the invention. In some embodiments, the cell cultures or culture media comprise 2, 3, 4, 5, 6, or more peptides of the invention.

[0045] In some embodiments, the cell culture comprises hepatic cells, preferably a hepatocyte cell line, a human hepatocyte cell line, or primary human hepatocytes. 15

[0046] In some embodiments, the cell culture or culture media comprises P. falciparum sporozoites.

[0047] In some embodiments, the cell culture comprises feeder cells. In some embodiments, the feeder cells are a cell line. In some embodiments, the feeder cells are murine embryonic fibroblasts. 20

[0048] In some embodiments, the cell culture is in a collagen-micropatterned glass- bottom plate.

[0049] In some embodiments, the cell culture or culture media comprises Dulbecco’s Modified Eagle Medium (DMEM, Corning) supplemented with 10% fetal bovine serum (GIBCO), 1% ITS (insulin / transferrin / selenous acid and linoleic acid), 7 ng / mL glucagon, 25 40 ng / mL dexamethasone, 15 mM HEPES, and / or 100 mg / mL penicillin / streptomycin. In some embodiments, the cell culture is maintained at 37°C in a 5% CO2 environment.METHODS OF INFECTING CELLS

[0050] The invention encompasses methods for the infection of cells with sporozoites. These methods apply to cells that are permissive to infection by P. falciparum. Preferably, the cells are cultured cells, preferably hepatocytes, more preferably a 5 cultured hepatocyte cell line. In one embodiment, the cells are primary hepatocytes. In one embodiment, the cells are human cells. These methods do not apply to endothelial cells that are cells not permissive to P. falciparum infection.

[0051] In one embodiment, the method comprises incubating P. falciparum sporozoites with the cells, preferably hepatocyte cells, in the presence of a peptide of the invention. 10

[0052] In one embodiment the sporozoites are from a genetically attenuated P. falciparum parasite (GAP).

[0053] In one embodiment, the method comprises incubating P. falciparum sporozoites with the peptide of the invention in a first step, adding the cells and incubating P. falciparum with the peptide and the cells in a second step. 15

[0054] In one embodiment the method of infecting hepatocytes comprises optionally a subsequent step of culture of infected hepatocytes, and optionally a subsequent step of recovering parasites from the culture of infected parasites.

[0055] Preferably, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein X1, X2, and X3, are any amino acid that 20 does not interfere with binding or activity.

[0056] In some embodiments, the peptide comprises the amino acids Y, Q, N, F, V, M, I, N, and S in an amino acid sequence of 12 consecutive amino acids.

[0057] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein I is replaced with G, A, V, or L. 25

[0058] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein S is replaced with C, T, or M. In someembodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein M is replaced with C, T, or S.

[0059] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein Y is replaced with F or W.

[0060] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein F is replaced with Y or W.

[0061] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein N is replaced with D, E, or Q.

[0062] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein Q is replaced with D, E, or N.

[0063] In some embodiments, X1is any amino acid, X2is any amino acid, and X3is any amino acid.

[0064] In some embodiments, X1 is glycine, alanine, asparagine, or glutamine, X2 is glycine, alanine, asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0065] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0066] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3 is valine, leucine, or isoleucine.

[0067] In some embodiments, the peptide comprises or consists of the amino sequence YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In particular embodiments, the peptide comprises at least 21 amino acids; the peptide may be between 21 and 27 or 21 and 37 amino acids.

[0068] In some embodiments, the peptide comprises or consists of an amino sequence having at least 70%, 75%, 80%, 85%, 90% or 95% identity to the amino acid sequence of YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

[0069] The methods of infecting cells, particularly hepatocytes, of the invention improve the infection rate of cells, particularly hepatocytes, by P. falciparum parasite, quantity of infected cells, particularly hepatocytes, and optionally quantity of P. falciparum parasites recovered by the methods. 5 SCREENING METHODS

[0070] The invention encompasses screening methods employing the peptides of the invention.

[0071] The invention encompasses the use of the peptides of the invention to increase P. falciparum sporozoite infectivity of cells in vitro. 10

[0072] The invention encompasses a method for screening for peptides that increase P. falciparum sporozoite infectivity comprising providing a peptide of the invention, incubating the peptide with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; measuring the level of intracellular sporozoites, and detecting an increase in the level of intracellular sporozoites as compared to P. falciparum 15 sporozoites not incubated with the peptide.

[0073] The level of intracellular sporozoites not incubated with the peptide can be determined by performing a control experiment under the same experimental conditions, differing only in the presence versus absence of the peptide.

[0074] In one embodiment, invention encompasses a method for screening for peptides 20 that increase P. falciparum sporozoite infectivity comprising: a) providing a peptide of the invention, for example, one comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1 is any amino acid, wherein X2 is any amino acid, and wherein X3 is any amino acid; b) incubating the peptide with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; and c) 25 measuring the level of intracellular sporozoites; and d) detecting an increase in the level of intracellular sporozoites as compared to P. falciparum sporozoites not incubated with the peptide.

[0075] In some embodiments, the peptide comprises or consists of the amino sequence YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In particular embodiments, the peptide comprises at least 21 amino acids; the peptide may be between 21 and 27 or 21 and 37 amino acids. 5

[0076] In one embodiment, the peptide is at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In one embodiment, the peptide is less than 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In 10 various embodiments, the peptide is between 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 and 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. For example, the peptide may be between 12 and 27, 12 and 37, 15 and 15 27, 15 and 37, 20 and 37, 20 and 40, 21 and 27, 21 and 37 or 20 and 45 amino acids in size. In some embodiments, the peptide consists of 27 amino acids.

[0077] In some embodiments, the cells are hepatocytes, preferably a hepatocyte cell line, or primary human hepatocytes.

[0078] The invention encompasses methods comprising incubating a peptide of the 20 invention with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; and measuring the level of intracellular sporozoites.

[0079] In some embodiments, the method comprises a) incubating a peptide of the invention, for example, one comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1is any amino acid, wherein X2is any amino acid, and wherein 25 X3 is any amino acid; with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; and b) measuring the level of intracellular sporozoites.

[0080] In some embodiments, the cells are hepatocytes, preferably hepatocyte cell line, or primary human hepatocytes.

[0081] In some embodiments, the peptide comprises or consists of the amino sequence YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In particular embodiments, the peptide comprises at least 21 amino acids; the peptide may be between 21 and 27 or 21 and 37 amino acids. 5

[0082] In one embodiment, the peptide is at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In one embodiment, the peptide is less than 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In 10 various embodiments, the peptide is between 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 and 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. For example, the peptide may be between 12 and 27, 12 and 37, 15 and 15 27, 15 and 37, 20 and 37, 20 and 40, 21 and 27, 21 and 37 or 20 and 45 amino acids in size. In some embodiments, the peptide consists of 27 amino acids.

[0083] In some embodiments, a method of screening is used to test compounds for inhibition of P. falciparum infection. Compounds to be tested are preferably malaria prophylactics. 20

[0084] In some embodiments, a peptide of the invention is incubated with P. falciparum sporozoites and with cells permissive to infection by P. falciparum and with a test compound(s); and measuring the level of intracellular sporozoites. Measuring the level of intracellular sporozoites can be made by a sporozoite invasion assay as described in Examples, which measures the intracellular sporozoites and also the extracellular 25 sporozoites. Measuring the level of sporozoites (intracellular and / or extracellular) can be conducted by staining of sporozoites and image-based detection of stained sporozoites. The sporozoites are preferably immunostained, more preferably with monoclonal antibodies specific for a parasite coat protein and with a secondary antibody conjugated with a fluorophore.

[0085] In some embodiments, the method comprises incubating the P. falciparum sporozoites and / or the cells permissive to infection by P. falciparum with a test compound(s) and determining the effect on the level of intracellular sporozoites.

[0086] In some embodiments, the method comprises incubating the P. falciparum 5 sporozoites, the cells permissive to infection by P. falciparum and a peptide of the invention with a test compound(s), measuring the level of intracellular sporozoites, and in parallel incubating the P. falciparum sporozoites, the cells permissive to infection by P. falciparum and a peptide of the invention without test compound(s), and comparing the level of intracellular sporozoites with and without test compound(s). 10

[0087] In some embodiments, the method of screening is a high-throughput screening (HTS) assay, where many different test compounds are tested simultaneously, for example by using a 96 well culture plate. METHODS FOR MALARIA PROPHYLAXIS

[0088] The invention encompasses methods for preventing P. falciparum infection in a 15 subject, comprising administering to the subject a peptide as disclosed herein.

[0089] The peptides of the invention are particularly adapted to malaria prophylaxis since they target sporozoites, the mosquito-transmitted form of Plasmodium.

[0090] The invention relates to methods for the prophylactic or preventive treatment of P. falciparum infection in a subject. By preventing P. falciparum infection, the methods 20 of the invention prevent malaria. The peptide as disclosed herein is used as a prophylactic medicament.

[0091] Similarly, the invention encompasses a peptide as disclosed herein for use in preventing P. falciparum infection in a subject. The invention further encompasses the use of a peptide as disclosed herein for preventing P. falciparum infection in a subject. 25 The invention further encompasses the use of a peptide as disclosed in the manufacture of a medicament for preventing P. falciparum infection in a subject. In someembodiments, the subject is human. In some embodiments, the subject is not infected with P. falciparum or is at the initial stage of P. falciparum infection, before liver stage.

[0092] Preferably, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein X1, X2, and X3, are any amino acid that does not interfere with binding or activity.

[0093] In some embodiments, the peptide comprises the amino acids Y, Q, N, Q, F, V, M, I, N, and S in an amino acid sequence of 12 consecutive amino acids.

[0094] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein I is replaced with G, A, V, or L.

[0095] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein S is replaced with C, T, or M. In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein M is replaced with C, T, or S.

[0096] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein Y is replaced with F or W.

[0097] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein F is replaced with Y or W.

[0098] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein N is replaced with D, E, or Q.

[0099] In some embodiments, the peptide comprises the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein Q is replaced with D, E, or N.

[0100] In some embodiments, X1 is any amino acid, X2 is any amino acid, and X3 is any amino acid.

[0101] In some embodiments, X1 is glycine, alanine, asparagine, or glutamine, X2 is glycine, alanine, asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0102] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3 is glycine, alanine, valine, leucine, or isoleucine.

[0103] In some embodiments, X1 is asparagine or glutamine, X2 is asparagine or glutamine, and X3 is valine, leucine, or isoleucine.

[0104] In some embodiments, the peptide comprises or consists of the amino sequence YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1). In particular embodiments, the peptide comprises at least 21 amino acids; the peptide may be between 21 and 27 or 21 and 37 amino acids.

[0105] In some embodiments, the peptide comprises or consists of an amino sequence having at least 70%, 75%, 80%, 85%, 90% or 95% identity to the amino acid sequence of YQNQFVQMILNS (SEQ ID NO: 3) or ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

[0106] In one embodiment, the peptide is at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In one embodiment, the peptide is less than 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. In various embodiments, the peptide is between 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 and 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids in size. For example, the peptide may be between 12 and 27, 12 and 37, 15 and 27, 15 and 37, 20 and 37, 20 and 40, 21 and 27, 21 and 37 or 20 and 45 amino acids in size. In some embodiments, the peptide consists of 27 amino acids.

[0107] The peptide is administered in a therapeutically effective amount, which means a dose sufficient to block, at least in part, liver infection with P. falciparum sporozoites in the subject. Dosages of compounds are routine in the art.

[0108] The administration can be by conventional means including intravenous, oral, intramuscular, subcutaneous, and intranasal administration.

[0109] In some embodiments, the methods comprise administering a pharmaceutical composition comprising the peptide and a pharmaceutically acceptable excipient. The 5 excipients are those suitable for the particular mode of administration that are well-known in the art.

[0110] Sequence listing SEQUENCE SEQ ID NO ASHIYQNQFVQMILNSLINKSKSSMFQ SEQ ID NO: 1 YX1NQFVX2MIX3NS SEQ ID NO: 2 YQNQFVQMILNS SEQ ID NO: 3 GTCTCCTCTGACTTCAACAGCG SEQ ID NO: 4 ACCACCCTGTTGCTGTAGCCAA SEQ ID NO: 5 CAGGTCAACCTATTGGTCAAGCC SEQ ID NO: 6 GCCTTCTCATCACCAATGGTCC SEQ ID NO: 7 CTGCTTTGACCACCTCAGTGCT SEQ ID NO: 8 TGGCAGCAATGCCGATGAGGTA SEQ ID NO: 9 EXAMPLES MATERIALS AND METHODS 10 1. Cells

[0111] HC-04 (ATCC) cells were cultured under standard conditions in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 with GLUTAMAX (GIBCO) supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and 1% HEPES. Cryopreserved primary human hepatocytes (BIOIVT and Thermo) were co-cultured with 15 J2-3T3 murine embryonic fibroblasts on collagen-micropatterned glass-bottom 96-well plates, as described previously30. Hepatocyte co-cultures were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Corning) supplemented with 10% fetal bovine serum (GIBCO), 1% ITS (insulin / transferrin / selenous acid and linoleic acid, BD BIOSCIENCES), 7 ng / mL glucagon (SIGMA-ALDRICH), 40 ng / mL dexamethasone 20 (SIGMA-ALDRICH), 15 mM HEPES (GIBCO), and 100 mg / mL penicillin / streptomycin(CORNING). Cryopreserved human dermal microvascular endothelial cells (ScienCell) were expanded through 3 passages in complete Endothelial Cell Medium (ScienCell) before plating. All cells were maintained at 37°C in a 5% CO2 environment. 2. Sporozoite isolation

[0112] Anopheles stephensi mosquitoes infected with P. falciparum NF54 or P. berghei ANKA strains were obtained from the Center for Production of Infected Anopheles at Institut Pasteur Paris. Alternatively, NF54 and NF13520P. falciparum-infected mosquitoes were obtained from the Radboud University Medical Center insectary (Nijmegen, the Netherlands). The salivary glands of infected mosquitoes were dissected in Schneider’s insect medium (SIGMA-ALDRICH) and then homogenized to release their sporozoite content. The homogenates were spun down through a 20-µm cell strainer (PLURISELECT) and the sporozoites were collected in a small volume of Schneider’s medium. 3. Peptides and CSP human monoclonal antibodies

[0113] Peptides comprising amino acids 145 to 171 of human CD36, its alanine substitutions (see Fig.5B) and the homologous sequence of human SR-BI were custom synthesized and purified (≥ 98% purity) by GENSCRIPT. Both peptides were verified by high-performance liquid chromatography and electrospray ionization mass spectrometry (GENSCRIPT). CD36 peptides were diluted in H20 (SIGMA-ALDRICH), whereas DMSO (SIGMA-ALDRICH), was used for the SR-BI peptide. Human monoclonal antibodies against P. falciparum CSP have been previously described23–25. 4. Sporozoite binding assay

[0114] Recombinant human CD36 and ICAM-1 proteins (R&D SYSTEMS) were immobilized at 10 µg / mL on plastic flat-bottom 96-well plates (Greiner) overnight at 4°C. The wells were then washed 3 times in PBS and blocked with 1% Bovine Serum Albumin (BSA) for 30 minutes at 37°C. Freshly isolated P. falciparum sporozoites were diluted in binding media (RPMI without NaHCO3 supplemented with 25mM HEPES and 10% FBS, pH 6.8) and added to the coated wells (8-10, 000 per well). For competition experiments,the recombinant proteins (10 µg / mL) or antibody sera (1:100) were mixed with the sporozoite immediately before adding to the coated wells. Plates were centrifuged for 5 minutes at 3000 rpm and incubated for 1 hour at 37°C and 5% CO2. After 4 washes in PBS, the attached sporozoites were fixed in 4% paraformaldehyde (PFA) for 20 minutes 5 at room temperature. Attached parasites were detected by immunostaining with anti- PfCSP (clone 2A10) and ALEXAFLUOR 488-conjugated anti-mouse (Invitrogen, 1:1000) antibodies. Primary and secondary antibodies were diluted in 1% BSA blocking solution and incubated for 30-45 minutes at room temperature. Images were acquired on an OPERA PHENIX microscope (Perkin Elmer) with a 20x objective. Depending on the 10 experiment, 9 to 25 fields of view per well were quantified using the FIJI cell counter plugin (v 2.14.0 / 1.54f). The anti-SpzPfEMP1 antibody has been described previously7. 5. Sporozoite invasion assay

[0115] HC-04 cells were plated on glass-bottom 96-well plates (GREINER BIO-ONE) pre-coated with collagen (Gibco) at a seeding density of 40,000 cells per well. Primary 15 human hepatocytes were plated on pre-patterned 96-well plates at 10,000 cells per well. Freshly dissected P. falciparum or P. berghei sporozoites were added to cells (20,000 sporozoites per well) one day after seeding. The plates were spun down for 5 min at 3000 rpm (1920g) and placed at 37°C and 5% CO2. At the indicated time points, the cells were washed once with cell culture medium and fixed with 4% PFA. To measure 20 the effects of peptides and anti-PfCSP human monoclonal antibodies on sporozoite invasion, and unless indicated otherwise, sporozoites were exposed to the treatments for the duration of the assay, without pre-incubation. For immunostaining of extracellular sporozoites, samples were incubated with anti-PfCSP (2 µg / ml) diluted in 1% BSA for 1 hour, washed three times with PBS, incubated for 1 h with ALEXAFLUOR 647- 25 conjugated secondary antibody (Invitrogen, 1:1000) in 1% BSA, and washed again. For intracellular sporozoite detection, samples were blocked / permeabilized with 0.2% saponin-1% BSA and stained overnight at 4°C with anti-CSP (2 µg / ml) diluted in the same solution. After 3 washes with 0.2% saponin-1% BSA, samples were incubated for 1 hour with a solution of ALEXAFLUOR 488-conjugated anti-mouse antibody(INVITROGEN, 1:1000) and HOECHST 33342 (INVITROGEN) in 0.2% saponin-1% BSA and washed again. 2A10 and 3D11 monoclonal antibodies were used to detect PfCSP and PbCSP, respectively. Plates were imaged with a 20x objective on an Opera Phenix high-content system (Perkin Elmer) in non-confocal mode.49 fields of view were 5 acquired per well. The percentage of extracellular and intracellular sporozoites in each well was calculated by dividing the total number of double and single stained sporozoites, respectively, by the number of cell nuclei. Antibody-dependent infection inhibition was calculated by subtracting the % of intracellular parasites in the treatment condition from the control and dividing by the control % of intracellular parasites. Z’ values were 10 calculated according to the equation below, where σ is the standard deviation and µ is the mean.6. Intrahepatic development assay

[0116] Co-cultures of primary human hepatocytes and J2-3T3 cells (MPCCs) were 15 infected with 50,000 NF54 or NF135 sporozoites per well in the presence of CD36145-171 peptide or vehicle control. Treatments and extracellular sporozoites were washed off after 3 hours. Intracellular parasites were then allowed to develop for 3 with daily media changes, before cells were fixed with 4% PFA. For immunodetection of liver-stage parasites, cells were permeabilized with ice-cold methanol, blocked with 2% BSA, and 20 stained overnight with PfHSP70 antibody (1:200, ST-SPC-186D, STRESSMARQ BIOSCIENCES) diluted in blocking solution. In some experiments, cells were co-stained with anti-CD81 (Santa Cruz, 1:200) to visualize hepatocyte membranes. After 3 washes with PBS, cells were stained with ALEXAFLUOR 488-conjugated anti-rabbit (Invitrogen, 1:1000), ALEXAFLUOR 647-conjugated anti-mouse (Invitrogen, 1:1000), and Hoechst 25 33342 (Invitrogen) diluted in blocking solution. Plates were imaged on an Opera Phenix Plus microscope in confocal mode using a 20x objective (PERKIN ELMER).49 fields of view were acquired per well. The number and size of liver-stage parasites were quantified using Fiji to segment PfHSP70-positive objects in each well.7. Flow cytometry analysis

[0117] P. falciparum sporozoites isolated from mosquito salivary glands were incubated with vehicle or CD36145-171 in HC-04 medium for 1 hour at 37°C and 5% CO2. Following 1 wash with 1% BSA, sporozoites were incubated with 2 mg / ml of each CSP human 5 monoclonal antibody diluted in 1% BSA. After 1 hour at 4°C, sporozoites were washed twice with PBS and fixed with 4% PFA. Fixed sporozoites were first labeled with ALEXAFLUOR 647-conjugated anti-human IgG (JACKSON IMMUNORESEARCH LABORATORIES) for 30 minutes, followed by sequential staining with 2A10 PfCSP antibody and ALEXAFLUOR 488-conjugated anti-mouse (Invitrogen). Sporozoites were 10 analyzed on an LSRFORTESSA by gating on the 2A10-positive population. The same staining protocol was used to label sporozoites with anti-SpzPfEMP1, except that human anti-PfCSP (mAb317) was used to co-label sporozoites.

[0118] Primary human hepatocytes (BioIVT) were surface-stained immediately after thawing with APC-conjugated mouse anti-human CD36 (clone CB38, BD 15 BIOSCIENCES) and FITC-conjugated mouse anti-human CD81 (BIOLEGEND) diluted in 1% BSA. After 1 hour at 4°C, cells were washed once with 1% BSA, fixed with 4% PFA, and washed again, before analysis on an LSRFORTESSA. Cells from the bone marrow (BM) of a humanized BM mouse model31were used as a positive control for human CD36 expression. 20 8. Scanning electron microscopy

[0119] Human red blood cells infected with the NF54 strain previously panned 3 times on anti-SpzPfEMP17were collected after enrichment of late-stage parasites by plasmion treatment. For sporozoites samples, approximately 10,000 freshly dissected sporozoites were transferred into a dolphin tube and immunolabeling was performed on ice. For 25 immunogold detection with the anti-SpzPfEMP1 antibody, cells were washed twice in PBS before blocking for 30 minutes in PBS containing 1% BSA and incubation with anti- SpzPfEMP1 (dilution 1:50) for 1h. After three washes, cells were incubated with anti- mouse conjugated to 15-nm gold particles (dilution 1:50, BBI solutions) diluted in blocking buffer. After another three washes in PBS, the cells were transferred onto0.01% poly-L-lysine-coated coverslips and fixed overnight at 4°C with 2.5% glutaraldehyde in PBS. After washing, cells were post-fixed in OsO4 1% in 0.1 M cacodylate buffer (pH 7.2) and then. Following dehydration, samples were critical-point dried (BALZERS UNION CPD30) and coated with 10 nm carbon (GATAN ION BEAM COATER 681). Samples were imaged with a JEOL 7600F or JEOL IT1700 scanning microscope. 9. Quantitative RT-PCR

[0120] Primary human hepatocytes and bone marrow cells were lysed and homogenized in TRIZOL (THERMO FISHER SCIENTIFIC). Total RNA was isolated via chloroform extraction and purified using the RNEASY MINELUTE CLEANUP KIT (QIAGEN). cDNA synthesis was performed using SUPERSCRIPT IV (THERMO FISHER SCIENTIFIC) and quantitative PCR was carried out using POWERUP SYBR GREEN MASTER MIX (THERMO FISHER SCIENTIFIC) in a BIORAD CFX384 TOUCH REAL-TIME PCR DETECTION SYSTEM according to the manufacturer’s instructions. The primer sequences used to detect mRNA levels are listed in Table 1. Relative mRNA levels were calculated with the DDCt method, using gapdh as a housekeeping gene. Table 1. Primer sequences used for quantitative RT-PCR Gene ID Gene Symbol Forward primer (5’ > 3’) Reverse primer (5’ > 3’) ENSG00000111640 GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAG CCAA ENSG00000135218 CD36 CAGGTCAACCTATTGGTCAAGCC GCCTTCTCATCACCAATGG TCC ENSG00000110651 CD81 CTGCTTTGACCACCTCAGTGCT TGGCAGCAATGCCGATGA GGTA 10. RNA sequencing

[0121] P. falciparum sporozoites isolated from the salivary glands of infected mosquitoes were activated at 37°C in DMEM / F-12 medium supplemented with 10% FBS, 10 µM CD36145-171, or both, or kept at 4°C to prevent activation. Each sample contained approximately 250,000 to 500,000 sporozoites. After 1 hour, sporozoites were spun down for 3 minutes at 13,000 rpm and resuspended in TRIZOL reagent (THERMO FISHER SCIENTIFIC) for RNA extraction. Following chloroform extraction, total RNAwas treated with DNase and purified using the RNEASY MINELUTE CLEANUP KIT (QIAGEN). Sample quality control, library preparation and Illumina sequencing were performed by NOVOGENE (Cambridge, UK). 11. RNA sequencing data analysis

[0122] Reads were mapped to the PlasmoDB-65_Pfalciparum3D7 reference genome using the nf-core / rnaseq pipeline (v3.12.0)32,33with the star_rsem aligner and the following STAR arguments: --outFilterMultimapNmax 1 -- outFilterMismatchNoverReadLmax 0.04 --alignSJoverhangMin 8 -- alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --alignIntronMax 1000 -- outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM. Gene expression was quantified using RSEM34within the same nf-core pipeline. Differential gene expression analysis was performed using DESEQ2 (v 1.36.0)35on the raw counts after filtering out low expressed genes (less than 5 counts). Differences in gene expression were evaluated using the likelihood ratio test in DESEQ2, with condition + experimental batch as variables in the full model and experimental batch in the reduced model. For PCA analysis, the plotPCA function from the DESEQ2 package was run with the top 100 most variable genes. The Venn diagram showing the intersection of differentially expressed genes between experimental conditions was generated with the VENNDIAGRAM package (v 1.7.3). The DESeq2 pipeline was run in R (v 4.2.1). 12. Endothelial cell binding assay

[0123] Primary human dermal microvascular endothelial cells were plated at 20,000 cells per well on glass-bottom 96-well plates (Greiner Bio-One) pre-coated with poly-L- lysine (Cultrex). To assess sporozoite binding to the endothelial cell layer, 20,000 NF54 or NF135 sporozoites were added per well in the presence of the wild type CD36145-171peptide or its alanine substitutions. Treatments and non-attached sporozoites were washed off after 1 hour, before cells were fixed with 4% PFA. Surface-bound and intracellular sporozoites were immunostained as described above. Plates were imaged on an Opera Phenix Plus microscope in non-confocal mode using a 20x objective (Perkin Elmer).49 fields of view were acquired per well.RESULTS Example 1. Distribution of SpzPfEMP1

[0124] To elucidate how the distribution of SpzPfEMP1 differed between the sporozoite surface and iRBCs, P. falciparum parasites were stained with an antibody raised against the first DBL and CIDR domains of SpzPfEMP17and imaged at high resolution using scanning electron microscopy. Clusters of PfEMP1 could be observed on the sporozoite surface, however, unlike the PfEMP1-positive membrane protrusions observed in iRBCs (Fig.3B), the sporozoite surface appeared uniformly smooth (Fig.1A). This indicates that the underlying architecture of the putative PfEMP1 complex is fundamentally different between sporozoites and infected erythrocytes. Example 2. SpzPfEMP1 Binding to CD36 and ICAM-1

[0125] Based on the sequence of its head domains, SpzPfEMP1 is expected to bind to CD36 and ICAM-1.9To test whether SpzPfEMP1 could indeed mediate sporozoite binding to these receptors, recombinant human CD36 and ICAM-1 were immobilized on a plastic surface and sporozoite adhesiveness was measured in the presence of anti- SpzPfEMP1 or pre-immune serum. Consistent with sequence-based predictions, it was found that sporozoites bind to both receptors in a PfEMP1-dependent manner (Fig.1C, D). Example 3. Exposure of Sporozoites to CD36145-171

[0126] Given the abundant expression of CD36 in liver sinusoids11— a mandatory gateway for sporozoites entering the liver12— it was hypothesized that host-parasite interactions involving CD36 and PfEMP1 could play a pivotal role in initiating liver infection. To understand the functional implications of the PfEMP1-CD36 interaction in the sporozoite stage, a peptide tool spanning amino acids 145 to 171 of CD36 was synthesized. This peptide segment comprises the binding surface for PfEMP1 (Fig.1D)13and has been demonstrated to disrupt PfEMP1-CD36 interactions in vitro.14,15Sporozoites exposed to CD36145-171 under conditions that mimic vector-to-hosttransmission16showed a pattern of gene expression that essentially overlapped that of non-exposed sporozoites (Fig.1E, Fig.3C). While the effects on gene expression were minimal, CD36 binding was shown to have profound implications for critical sporozoite functions. Indeed, it was observed that sporozoite attachment to and entry into hepatic cells measured at 3 hours post-infection were significantly enhanced by CD36145-171 (Fig.1F-H). These effects were sequence-dependent, as a control peptide comprising the CD36145-171 homologous sequence in the related class B scavenger receptor SR-BI did not alter sporozoite attachment or invasion (Fig. 1G). Likewise, CD36145-171 had negligible effects on P. berghei sporozoites, which lack PfEMP1 altogether (Fig.3D). A minimal peptide, CD36149-160 (SEQ ID NO: 3) was also able to enhance sporozoite attachment to and entry into hepatic cells (Fig.8).

[0127] To validate sporozoites as the cellular target of CD36145-171, isolated sporozoites were briefly exposed to the peptide, then washed prior to cell infection. It was found that both sporozoite adhesiveness and infectivity were still augmented by CD36145-171 (Fig.1H), indicating that CD36 targets the sporozoite directly rather than the host cell. Importantly, CD36 did not seem to trigger the mobilization of additional adhesive molecules to the sporozoite surface, a process typically associated with the fusion of specialized secretory organelles known as micronemes to the sporozoite membrane1. Indeed, sporozoite adhesion to host cells was not affected by the phospholipase C (PLC)-targeting microneme secretion inhibitor U7312217(Fig. 1H, left panel). This contrasts with host cell invasion, which, as seen in other apicomplexans18,19, was found to be critically dependent on PLC-mediated microneme secretion even in CD36-primed sporozoites (Fig.1H, right panel).

[0128] To obtain further confirmation that CD36 sporozoite priming led to productive host cell invasion, the number of intracellular parasite forms was quantified several days after CD36145-171 exposure. Consistent with the enhanced invasion observed at 3 hours, the number of developing parasites detected on day 3 post-infection was significantly increased by CD36 priming (Fig.1I). Similar results were observed with the non-African P. falciparum NF135 strain20, suggesting functional conservation of the CD36-PfEMP1interaction across geographically diverse parasite strains (Fig.3E, F). On the other hand, parasite development remained unaffected by CD36145-171 (Fig. 3G). Taken together, these results demonstrate that PfEMP1 binding to host CD36 modulates P. falciparum sporozoite function to facilitate productive hepatic infection.

[0129] Sporozoites represent the primary target for malaria prophylaxis. The most promising prophylactic therapies under clinical development include pre-erythrocytic vaccines21and passive monoclonal antibody (mAb) transfer22, both of which target the circumsporozoite protein (CSP) of P. falciparum. A major bottleneck in expanding the malaria prophylaxis toolbox is the notoriously low infection rate of P. falciparum sporozoites in vitro, which complicates the development of robust high-throughput screening (HTS) assays. Because CD36 priming can enhance sporozoite infectivity up to tenfold (Fig.1G), it was postulated that CD36145-171 supplementation might improve the robustness of the sporozoite invasion assay for HTS. To conduct a quality control assessment of the inventor’s assay, six anti-CSP mAbs were probed with diverse CSP binding profiles and in vivo protection levels against a transgenic PfCSP-expressing P. berghei strain23–25(Fig. 2A). After obtaining confirmation that CD36145-171 does not modify mAb binding to P. falciparum sporozoites (Fig.2B), the impact of CD36145-171 on assay performance was evaluated by computing Z’ quality scores. For this, the dynamic range between positive (mAb317) and negative (no mAb) controls and the variability of sporozoite invasion rates was determined within each assay replicate (Fig.2C). CD36145-171supplementation consistently increased the assay’s dynamic range (Fig.2C, Fig.4), resulting in Z’ scores above the 0.5 quality threshold (Fig. 2D). In contrast, both the dynamic range and Z’ fared poorly without the CD36 infection-enhancing effect (Fig.2 C, D). To further validate the inventor’s assay, the percentage of sporozoite invasion inhibition under CD36 supplementation was computed for the CSP mAbs in Fig.2A and then the in vitro and in vivo efficacy data of each mAb was compared. It was found that in vitro and in vivo mAb potency were highly correlated (Fig. 2E), demonstrating that CD36 priming enables sensitive and robust sporozoite-targeted HTS.Example 4. PfEMP1-binding motif in CD36 primes sporozoites for hepatocyte infection

[0130] The synthetic peptide spanning amino acids 145 to 171 of CD36, corresponding to the binding surface for PfEMP113, mimics the interaction between full-length CD36 and PfEMP1 in an AlphaFold (AF3) model (Fig.5A). As disclosed in previous examples, it was observed that sporozoite attachment to and entry into hepatic cells, measured 3 hours post-infection, were both significantly enhanced by CD36145-171(Fig. 5B). It is shown here that these effects depend on key amino acids, as substitution of the predicted PfEMP1-binding hot spots (CD363A) or of all five critical PfEMP1-binding amino acids (CD365A) by alanine, completely abrogates the infection enhancing effect of the wild-type peptide. Likewise, a control peptide comprising the CD36145-171 homologous sequence in the related class B scavenger receptor SR-BI does not alter sporozoite function (Fig.5B). The effect of CD36145-171 on sporozoite infectivity is evident as early as 30 minutes post-infection and leads to sustained increments in infection, well beyond the early plateau observed under control conditions or with the alanine- substituted CD36 peptides (Fig.5C). In summary, the CD36 peptide must contain the amino acids ASN151, PHE153, and MET156 to enhance sporozoite infection of human hepatocytes. Importantly, these effects are reproducible across multiple primary hepatocyte donors (Fig. 6), indicating that they are not dependent on a specific host genotype. This further validates the CD36 peptide as a universal tool for enhancing HTS of malaria prophylactic interventions. Example 5. CD36145-171 inhibits sporozoite binding to endothelial cells

[0131] The inventors have explored the possibility that the CD36 synthetic peptide could competitively inhibit sporozoite binding to endothelial cells, which form a physical barrier that sporozoites must cross before infecting the liver36, and, unlike hepatocytes, express CD36 on their surface37. To test this hypothesis, sporozoite binding to CD36-expressing human dermal endothelial cells was quantified in the presence of CD36145-171 or its alanine-substituted versions. It was found that, compared to the inactive alanine mutants, the wild-type peptide effectively inhibited sporozoite binding to the surface of endothelialcells (Fig.7). This suggests that the CD36 peptide could potentially act as a prophylactic to prevent liver infection and underscores its dual activity in modulating sporozoite interactions with endothelial cells (inhibitory) versus hepatocytes (activating). References 5 1. Arredondo, S.A., Schepis, A., Reynolds, L., and Kappe, S.H.I. (2021). Secretory Organelle Function in the Plasmodium Sporozoite. Trends Parasitol.37, 651–663. 2. Dundas, K., Shears, M.J., Sinnis, P., and Wright, G.J. (2019). Important Extracellular Interactions between Plasmodium Sporozoites and Host Cells Required for Infection. Trends Parasitol.35, 129–139. 10 3. Dundas, K., Shears, M.J., Sun, Y., Hopp, C.S., Crosnier, C., Metcalf, T., Girling, G., Sinnis, P., Billker, O., and Wright, G.J. (2018). Alpha-v-containing integrins are host receptors for the Plasmodium falciparum sporozoite surface protein, TRAP. Proc. Natl. Acad. Sci. U. S. A.115, 4477–4482. 4. Steel, R.W.J., Vigdorovich, V., Dambrauskas, N., Wilder, B.K., Arredondo, S.A., 15 Goswami, D., Kumar, S., Carbonetti, S., Swearingen, K.E., Nguyen, T., et al. (2021). Platelet derived growth factor receptor β (PDGFRβ) is a host receptor for the human malaria parasite adhesin TRAP. Sci. Rep.11, 11328. 5. Segireddy, R.R., Belda, H., Yang, A.S.P., Dundas, K., Knoeckel, J., Galaway, F., Wood, L., Quinkert, D., Knuepfer, E., Treeck, M., et al. (2024). A screen for 20 Plasmodium falciparum sporozoite surface protein binding to human hepatocyte surface receptors identifies novel host-pathogen interactions. Malar. J.23, 151. 6. Smith, J.D., Rowe, J.A., Higgins, M.K., and Lavstsen, T. (2013). Malaria’s deadly grip: cytoadhesion of Plasmodium falciparum-infected erythrocytes. Cell. Microbiol. 15, 1976–1983. 25 7. Zanghì, G., Vembar, S.S., Baumgarten, S., Ding, S., Guizetti, J., Bryant, J.M., Mattei, D., Jensen, A.T.R., Rénia, L., Goh, Y.S., et al. (2018). A Specific PfEMP1 Is Expressed in P. falciparum Sporozoites and Plays a Role in Hepatocyte Infection. Cell Rep.22, 2951–2963.8. Real, E., Nardella, F., Scherf, A., and Mancio-Silva, L. (2022). Repurposing of Plasmodium falciparum var genes beyond the blood stage. Curr. Opin. Microbiol. 70, 102207. 9. Smith, J.D. (2014). The role of PfEMP1 adhesion domain classification in 5 Plasmodium falciparum pathogenesis research. Mol. Biochem. Parasitol.195, 82– 87. 10. Maier, A.G., Cooke, B.M., Cowman, A.F., and Tilley, L. (2009). Malaria parasite proteins that remodel the host erythrocyte. Nat. Rev. Microbiol.7, 341–354. 11. Shetty, S., Lalor, P.F., and Adams, D.H. (2018). Liver sinusoidal endothelial cells - 10 gatekeepers of hepatic immunity. Nat. Rev. Gastroenterol. Hepatol.15, 555–567. 12. Tavares, J., Formaglio, P., Thiberge, S., Mordelet, E., Van Rooijen, N., Medvinsky, A., Ménard, R., and Amino, R. (2013). Role of host cell traversal by the malaria sporozoite during liver infection. J. Exp. Med.210, 905–915. 13. Hsieh, F.-L., Turner, L., Bolla, J.R., Robinson, C.V., Lavstsen, T., and Higgins, M.K. 15 (2016). The structural basis for CD36 binding by the malaria parasite. Nat. Commun. 7, 12837. 14. Mo, M., Lee, H.C., Kotaka, M., Niang, M., Gao, X., Iyer, J.K., Lescar, J., and Preiser, P. (2008). The C-terminal segment of the cysteine-rich interdomain of Plasmodium falciparum erythrocyte membrane protein 1 determines CD36 binding 20 and elicits antibodies that inhibit adhesion of parasite-infected erythrocytes. Infect. Immun.76, 1837–1847. 15. Baruch, D.I., Ma, X.C., Pasloske, B., Howard, R.J., and Miller, L.H. (1999). CD36 peptides that block cytoadherence define the CD36 binding region for Plasmodium falciparum-infected erythrocytes. Blood 94, 2121–2127. 25 16. Vanderberg, J.P. (1974). Studies on the motility of Plasmodium sporozoites. J. Protozool.21, 527–537. 17. Singh, S., Alam, M.M., Pal-Bhowmick, I., Brzostowski, J.A., and Chitnis, C.E. (2010). Distinct external signals trigger sequential release of apical organelles during erythrocyte invasion by malaria parasites. PLoS Pathog.6, e1000746.18. Cova, M.M., Lamarque, M.H., and Lebrun, M. (2022). How Apicomplexa Parasites Secrete and Build Their Invasion Machinery. Annu. Rev. Microbiol.76, 619–640. 19. Bisio, H., and Soldati-Favre, D. (2019). Signaling Cascades Governing Entry into and Exit from Host Cells by Toxoplasma gondii. Annu. Rev. Microbiol. 73, 579– 5 599. 20. Teirlinck, A.C., Roestenberg, M., van de Vegte-Bolmer, M., Scholzen, A., Heinrichs, M.J.L., Siebelink-Stoter, R., Graumans, W., van Gemert, G.-J., Teelen, K., Vos, M.W., et al. (2013). NF135.C10: a new Plasmodium falciparum clone for controlled human malaria infections. J. Infect. Dis.207, 656–660. 10 21. Stanisic, D.I., and Good, M.F. (2023). Malaria Vaccines: Progress to Date. BioDrugs 37, 737–756. 22. Wells, T., and Donini, C. (2022). Monoclonal Antibodies for Malaria. N. Engl. J. Med.387, 462–465. 23. Kisalu, N.K., Idris, A.H., Weidle, C., Flores-Garcia, Y., Flynn, B.J., Sack, B.K., 15 Murphy, S., Schön, A., Freire, E., Francica, J.R., et al. (2018). A human monoclonal antibody prevents malaria infection by targeting a new site of vulnerability on the parasite. Nat. Med.24, 408–416. 24. Murugan, R., Scally, S.W., Costa, G., Mustafa, G., Thai, E., Decker, T., Bosch, A., Prieto, K., Levashina, E.A., Julien, J.-P., et al. (2020). Evolution of protective 20 human antibodies against Plasmodium falciparum circumsporozoite protein repeat motifs. Nat. Med.26, 1135–1145. 25. Oludada, O.E., Costa, G., Burn Aschner, C., Obraztsova, A.S., Prieto, K., Canetta, C., Hoffman, S.L., Kremsner, P.G., Mordmüller, B., Murugan, R., et al. (2023). Molecular and functional properties of human Plasmodium falciparum CSP C- 25 terminus antibodies. EMBO Mol. Med.15, e17454. 26. Karlsson, M., Zhang, C., Méar, L., Zhong, W., Digre, A., Katona, B., Sjöstedt, E., Butler, L., Odeberg, J., Dusart, P., et al. (2021). A single-cell type transcriptomics map of human tissues. Sci Adv 7.10.1126 / sci adv.abh 2169. 27. Maeno, Y., Fujioka, H., Hollingdale, M.R., Ockenhouse, C.F., Nakazawa, S., and 30 Aikawa, M. (1994). Ultrastructural localization of CD36 in human hepatic sinusoidallining cells, hepatocytes, human hepatoma (HepG2-A16) cells, and C32 amelanotic melanoma cells. Exp. Parasitol.79, 383–390. 28. Rajan Raghavan, S.S., Turner, L., Jensen, R.W., Johansen, N.T., Jensen, D.S., Gourdon, P., Zhang, J., Wang, Y., Theander, T.G., Wang, K., et al. (2023). 5 Endothelial protein C receptor binding induces conformational changes to severe malaria-associated group A PfEMP1. Structure 31, 1174–1183.e4. 29. Aliprandini, E., Tavares, J., Panatieri, R.H., Thiberge, S., Yamamoto, M.M., Silvie, O., Ishino, T., Yuda, M., Dartevelle, S., Traincard, F., et al. (2018). Cytotoxic anti- circumsporozoite antibodies target malaria sporozoites in the host skin. Nat 10 Microbiol 3, 1224–1233. 30. March, S., Ramanan, V., Trehan, K., Ng, S., Galstian, A., Gural, N., Scull, M.A., Shlomai, A., Mota, M.M., Fleming, H.E., et al. (2015). Micropatterned coculture of primary human hepatocytes and supportive cells for the study of hepatotropic pathogens. Nat. Protoc.10, 2027–2053. 15 31. Luiza-Batista, C., Thiberge, S., Serra-Hassoun, M., Nardella, F., Claës, A., Nicolete, V.C., Commère, P.-H., Mancio-Silva, L., Ferreira, M.U., Scherf, A., et al. (2022). Humanized mice for investigating sustained Plasmodium vivax blood-stage infections and transmission. Nat. Commun.13, 4123. 32. Ewels, P.A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M.U.,20 Di Tommaso, P., and Nahnsen, S. (2020). The nf-core framework for community- curated bioinformatics pipelines. Nat. Biotechnol.38, 276–278. 33. Patel, H., Ewels, P., Peltzer, A., Manning, J., Botvinnik, O., Sturm, G., Garcia, M.U., Moreno, D., Vemuri, P., Bot, N.-C., et al. (2024). nf-core / rnaseq: nf-core / rnaseq v3.14.0 - Hassium Honey Badger (Zenodo) 10.5281 / ZENODO.1400710. 25 34. Li, B., and Dewey, C.N. (2011). RSEM: accurate transcript quantification from RNA- Seq data with or without a reference genome. BMC Bioinformatics 12, 323. 35. Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol.15, 550. 36. Frischknecht, F. & Matuschewski, K. Plasmodium Sporozoite Biology. Cold Spring 30 Harb Perspect Med 7, a025478 (2017).37. Remmerie, A. et al. Osteopontin Expression Identifies a Subset of Recruited Macrophages Distinct from Kupffer Cells in the Fatty Liver. Immunity 53, 641- 657.e14 (2020). 5

Claims

Claims 1. An isolated peptide for use in modulating P. falciparum sporozoite infectivity, wherein the peptide is between 12 and 37 amino acids in size comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2); wherein X1, X2, and X3 are any amino acid.

2. The peptide of claim 1, wherein X1 is N or Q, X2 is N or Q, and X3 is V, L, or I.

3. The peptide of claim 1 or 2, comprising the amino sequence YQNQFVQMILNS (SEQ ID NO: 3).

4. The peptide of any of claims 1-3, wherein the peptide comprises at least 21 amino acids.

5. The peptide of any of claims 1-4, wherein the peptide consists of 27 amino acids.

6. The peptide of any of claims 3 to 5, wherein the peptide comprises the amino acid sequence ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

7. The peptide of claim 6, wherein the peptide consists of the amino acid sequence ASHIYQNQFVQMILNSLINKSKSSMFQ (SEQ ID NO: 1).

8. Use of the peptide as defined in any of claims 1 to 7 to increase P. falciparum sporozoite infectivity of cells in vitro.

9. The use according to claim 8, wherein the cells are hepatic cells.

10. A peptide as defined in any of claims 1 to 7 for use in the prophylactic treatment of P. falciparum infection in a subject.

11. A cell culture media comprising at least one peptide of any of claims 1-7.

12. The cell culture media of claim 11, wherein the cell culture comprises hepatic cells.

13. The cell culture media of claim 12, wherein the cells are a hepatocyte cell line.

14. The cell culture media of claim 12, wherein the hepatic cells are infected with P. falciparum sporozoites.

15. A method for screening for peptides that increase P. falciparum sporozoite infectivity comprising: a) providing a peptide comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1, X2, and X3 are any amino acid; b) incubating the peptide with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; c) measuring the level of intracellular sporozoites; and d) detecting an increase in the level of intracellular sporozoites as compared to P. falciparum sporozoites not incubated with the peptide.

16. The method of claim 15, wherein X1 is N or Q, X2 is N or Q, and X3 is V, L, or I.

17. The method of claim 15, wherein the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3).

18. The method of any of claims 15-17, wherein the peptide is between 12 and 37 amino acids in size; preferably between 21 and 37 amino acids in size.

19. The method of any of claims 15-18, wherein the cells are hepatocytes.

20. The method of claim 19, wherein the cells are a hepatocyte cell line.

21. A method comprising: a) incubating a peptide comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1,X2, and X3are any amino acid, with P. falciparum sporozoites and with cells permissive to infection by P. falciparum; andb) measuring the level of intracellular sporozoites.

22. The method of claim 21, wherein X1 is N or Q, X2 is N or Q, and X3 is V, L, or I.

23. The method of claim 21, wherein the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3).

24. The method of any of claims 21-23, wherein the peptide is between 12 and 37 amino acids in size; preferably between 21 and 37 amino acids in size.

25. The method of any of claims 21-24, wherein the cells are hepatocytes.

26. The method of claim 25, wherein the cells are a hepatocyte cell line.

27. The method of any of claims 21-26, further comprising incubating the P. falciparum sporozoites and / or the cells permissive to infection by P. falciparum with a test compound and determining the effect on the level of intracellular sporozoites.

28. A method for the infection of cells with P. falciparum sporozoites comprising incubating P. falciparum sporozoites with cells in the presence of a peptide between 12 and 37 amino acids in size comprising the amino acid sequence YX1NQFVX2MIX3NS (SEQ ID NO: 2), wherein X1,X2, and X3 are any amino acid.

29. The method of claim 28, wherein X1 is N or Q, X2 is N or Q, and X3 is V, L, or I.

30. The method of claim 28 or 29, wherein the peptide comprises the amino sequence YQNQFVQMILNS (SEQ ID NO: 3).

31. The method of claim 28, wherein the cells are a hepatocyte cell line.

Images