Methods and compositions for cooperative catalysis assisted selective nucleic acid deamination

CAM-seq addresses the limitations of existing nucleobase deamination methods by using carbonyl organocatalysts and Lewis acids to achieve accurate and sensitive detection of DNA and RNA modifications, particularly m6A and m4C, in low-input samples with minimal degradation.

WO2026060232A1PCT designated stage Publication Date: 2026-03-19UNIVERSITY OF CHICAGO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/046137
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-13
Filing Date
2025-09-12
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Existing nucleobase deamination methods for RNA and DNA sequencing suffer from low conversion efficiency, RNA degradation, and high levels of false positives, making them unsuitable for accurate detection and analysis of DNA and RNA modifications, particularly in low-input samples.

Method used

A mild chemical deamination reaction using carbonyl organocatalysts and Lewis acids under neutral to slightly basic conditions facilitates selective nucleobase deamination, preserving polynucleotide integrity and improving signal-to-noise ratios, enabling the detection of modifications such as m6A and m4C at base resolution.

Benefits of technology

The method, termed CAM-seq, provides sensitive and robust mapping of the methylome with extensive coverage, allowing for accurate quantification of modified nucleobases in low-input samples, reducing false positives and RNA degradation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046137_19032026_PF_FP_ABST
    Figure US2025046137_19032026_PF_FP_ABST
Patent Text Reader

Abstract

Aspects of the present disclosure are directed to methods, compositions, and kits for detection and analysis of DNA and RNA modifications, such as DNA and RNA nucleobase methylation. Certain aspects include methods, compositions and kits useful in sequencing of methylated nucleic acids, including methylated nucleic acids from low-input samples such as cell-free DNA and cell-free RNA. Certain aspects include novel N-nitrosation strategies for deamination of DNA and RNA biological macromolecules under mild conditions. In some aspects, provided are compositions, methods, and kits comprising means for cooperative catalysis of a carbonyl organocatalyst with a Lewis acid to facilitate the formation of a C-nitro intermediate from a primary amine, which, upon rearrangement into N-nitrosamine, leads to selective deamination of unsubstituted canonical DNA and RNA bases under mild conditions.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND COMPOSITIONS FOR COOPERATIVE CATALYSIS ASSISTED SELECTIVE NUCLEIC ACID DEAMINATIONCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U. S. Provisional Patent ApplicationSerial No. 63 / 694,681, filed 13 September 2024, the contents of which are hereby incorporated by reference in their entirety.STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under HG008935 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been submitted in ST26 format and is hereby incorporated by reference in its entirety. Said ST26 copy, created on September 13, 2024, is named ARCD_P0850US.Pl_Sequence_Listing.xml and is 32,001 bytes in size.BACKGROUNDI. Field of the Invention

[0004] Aspects of this invention relate to at least the fields of molecular biology, chemistry, biochemistry, chemistry, cell biology, and epigenetics. Certain aspects relate to methods and compositions for modification, detection, and analysis of methylated nucleic acids.II. Background

[0005] Chemical modifications in RNA and DNA play crucial roles in a wide range of biological processes including transcription regulation, RNA degradation, protein translation, and immune modulation (1-6). These modifications have been quantitatively mapped at singlebase resolutions by new sequencing methods (7-13), with nucleobase deamination being a highly effective strategy for the selective mapping of 5-methylcytosine (5mC) in DNA (9,10) and TV6-methyladenosine (m6A) in RNA (12,13).

[0006] Nitrite ion-based RNA sequencing methods (13-17) have been shown to deaminate A or C through a stepwise nitrosation and diazotization under acidic conditions (FIG. 1A). NO-seq and NT-seq are simple, cost-effective chemical methods, but their low conversion efficiencies and harsh acid treatment can compromise detection accuracy and RNA integrity- 1 -299224109.1through degradation (14,16). Recently, Wang et al. reported the chemical-based approach of GLORI for m6A sequencing, which uses a glyoxal protecting group on guanine (G) to significantly enhance deamination efficiency and selectivity for adenine (A) in mammalian transcriptomes (13,17). Despite being a major step forward, this method is still limited by RNA degradation under relatively harsh reaction conditions and reverse transcription stopping caused by incomplete glyoxal deprotection, necessitating a high RNA input requirement.

[0007] Several other existing methods have been developed to probe DNA and / or RNA methylomes; however, each of these suffer from limitations, such as but not limited to, low resolution, high levels of macromolecule degradation, site / motif bias / specificity, and / or high levels of false positives.

[0008] There exists a need for improved methods and compositions for detection and analysis of DNA and RNA nucleobase modifications, including improvements that allow the use of DNA and / or RNA from low-input samples, that preserve polynucleotide integrity, and / or that improve signal-to-noise ratios.SUMMARY

[0009] To address the aforementioned problems, the inventors created new methods and compositions that allow for more widespread applications in mapping / identification of DNA and / or RNA modifications, elucidating known disease biomarkers, and / or in detecting DNA and / or RNA modifications in low input clinical samples. In some aspects, the problems are solved, at least in part, through a reduction in polynucleotide damage, increased true positive modification identification, and / or decreased false positive modification identification.

[0010] As described herein, the inventors sought to overcome the limitations of all previous nitrite ion-mediated nucleobase deamination approaches by designing a mild chemical deamination reaction that operates at or close to neutral pH, critically preserving polynucleotide integrity and improving signal-to-noise ratio. In some aspects, disclosed herein are methods and compositions comprising carbonyl organocatalyst catalyzed N-nitrosation of secondary amines using nitrite ions under slightly acidic, neutral, or slightly basic mediums, where a Lewis acid is utilized to facilitate the N-nitrosation formation of the free amine (FIG. IB). In some aspects, provided herein are new chemical sequencing methods and compositions that mediate selective nucleobase deamination, such as A-to-I or C-to-U deamination, facilitating mapping of nucleobases comprising a modified nitrogen-comprising pendant group, such as for example m6A or m4C, at base resolution under mild conditions (FIG. 1C). As the deamination is facilitated by cooperative catalysis using a carbonyl organocatalyst and a Lewis- 2 -299224109.1acid as catalysts, and is at least effective for facilitating detection of modifications such as methylation, the technology is termed herein as Chemical cooperative catalysis-Assisted Methylome Sequencing (CAM-seq). As disclosed herein, CAM-seq promises a sensitive and robust mapping of the methylome, such as the m6A methylome, with extensive coverage by avoiding acidic harsh treatments of polynucleotides, allowing for more comprehensive and accurate quantification of modified nucleobases, such as m6A sites, using low-input samples. Furthermore, in some aspects, CAM-seq methods and compositions can be applied to detect other modified nucleobases, such as but not limited to DNA 6mA, DNA 4mC, DNA 5mC, RNA m6A, RNA m4C, RNA m5C, RNA m2G, RNA m22G, RNA m6’6A, RNA i6A, RNA ms2i5A, and / or RNA m4,4C. In some aspects, the technologies and strategies described here can be broadly applied to the comprehensive, accurate, and specific mapping other RNA and DNA modifications with appropriate methods, compositions (e.g., catalysts and / or caging agents), and reaction conditions.

[0011] In some aspects, disclosed herein are compositions and methods suitable for facilitating detection of modified nucleobases, particularly nucleobases that comprise a modified nitrogen-comprising pendant group (for example but not limited to, alkylation, such as methylation, or other substitution, of the free amine comprising pendant group; for example but not limited to m6A / 6mA, m4C / 4mC, and m2G / m22G / 2mG / 22mG), by selectively deaminating canonical nucleobases and / or analogues thereof that comprise a free amine pendant group. In some aspects, canonical nucleobases and / or analogues thereof that comprise a free amine pendant group may be protected from deamination through modification of the nitrogen-comprising pendant group.

[0012] The present disclosure provides various methods, compositions, systems, and kits for nucleic acid processing, and detection and / or analysis of DNA and / or RNA modifications, such as DNA and / or RNA methylation.

[0013] In some aspects, a composition comprises, consists of, or consists essentially of one or more carbonyl organocatalysts and one or more Lewis acid catalysts. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of one or more monocarbonyl compounds and / or excludes, comprises, consists essentially of, or consists of one or more dicarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of monocarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of dicarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of one or more- 3 -299224109.1of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2- pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a carbonyl organocatalyst described in FIG. 25E and / or Table 4. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 0.5 to 4 M. In some aspects, glyoxal is at a concentration of at least, of at most, or about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4 M (or any range derivable therein). In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of formaldehyde and / or trifluoroacetaldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of formaldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of furfural. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of BF3OEt2, H3BO3, SC(OTF)3, LUC13, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6Fs)3. In some aspects, one or more Lewis acid comprise, consist essentially of, or consist of non-metal Lewis acid(s). In some aspects, one or more Lewis acid comprise, consist essentially of, or consist of metal Lewis acid(s). In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2). In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal and / or furfural, and the one or more Lewis acid excludes, comprises, consists essentially of, or consists of boron trifluoride etherate (BF3 OEt2) and / or boric acid (H3BO3). In some aspects, a Lewis acid comprises, consists of, or consists essentially of EEBCh / NasBCh Buffer. In some aspects,- 4 -299224109.1a Lewis acid comprises, consists of, or consists essentially of 500 mM J BCh / NasBCh Buffer (pH of about 6.4). In some aspects, a composition of the disclosure further comprises nucleic acids. In some aspects, select nucleobases of one or more nucleic acids are protected by treatment with a caging agent. In some aspects, select nucleobases of a nucleic acid are protected by treatment with a caging agent prior to treatment with a composition of the disclosure. In some aspects, a caging agent exhibits relative specificity towards reacting with guanine or analogs thereof, adenosine or analogs thereof, or cytosine or analogs thereof. In some aspects, a caging agent exhibits relative specificity towards reacting with guanine and / or cytosine over adenosine. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of kethoxal, methylglyoxal, phenylglyoxal, or an a-keto aldehyde. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of kethoxal. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of N3-kethoxal and / or kethoxal. In some aspects, a caging agent is provided at a concentration of at least, of at most, or of about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 mM, or any range or value derivable therebetween, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM or 10-15 mM, or of at least, of at most, or of about 12.5 mM. In some aspects, a caging agent is comprised in the composition at a final concentration of at least, of at most, or of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein). In some aspects, kethoxal is provided at a concentration of at least, of at most, or of about 300, 400, 500, 600, or 700 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM or 10-15 mM, or of at least, at most, or of about 12.5 mM. In some aspects, kethoxal is comprised in the composition at a final concentration of at least, of at most, or of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein). In some aspects, N3-kethoxal is provided at a concentration of at least, of at most, or of about 300, 400, 500, 600, or 700 mM (or any range derivable therein), and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM or 10- 15 mM, or of or of about 12.5 mM. In some aspects, N3-kethoxal is comprised in the composition at a final concentration of at least, of at most, or of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein). In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, select nucleobases of one or more nucleic acids are protected by treatment with a modifying agent. In some aspects, select nucleobases of one or more nucleic acids are protected by treatment with a modifying agent prior to treatment with a composition of the disclosure. In some aspects,- 5 -299224109.1a modifying agent excludes, comprises, consists essentially of, or consists of methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane. In some aspects, a modifying agent excludes, comprises, consists essentially of, or consists of methylamine. In some aspects, a composition of the disclosure further comprises one or more source of nitrite ions. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of saturated sodium nitrite (~8 M). In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of ammonium nitrite. In some aspects, a source of nitrite ions is at a concentration of equal to or greater than about 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv., or any range derivable therein. In some aspects, one or more carbonyl organocatalyst is at a concentration of equal to or greater than about 0.3, 0.5, or 1.0 equiv., or any range derivable therein. In some aspects, one or more Lewis acid is at a concentration of equal to or greater than about 0.3, 0.5, or 1.0 equiv., or any range derivable therein. In some aspects, a composition is at a pH of at least, of at most, or of between about 6.0 and 7.3. In some aspects, a composition is at a pH of at least, of at most, or of between about 6.5 and 7.0. In some aspects, a composition is at a pH of at least, of at most, or of between about 6.6 and 6.9. In some aspects, a composition is at a pH of at least, of at most, or of between about 6.8 and 7.1. In some aspects, a composition is at a pH of about 6.9. In some aspects, a composition is at a pH of at least, of at most, or about 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, or any range derivable therein. In some aspects, a composition is at a pH of about 7.0. In some aspects, a composition comprises a mixed solvent comprising a DMSO to water ratio of greater than or equal to about 5: 1. In some aspects, a composition comprises a mixed solvent comprising a DMSO to water ratio of greater than or equal to about 9: 1. In some aspects, a composition comprises a mixed solvent comprising a DMSO to water ratio of 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, or any range derivable therein.

[0014] In some aspects, a composition comprises one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions. In some aspects, a composition comprises, consists of, or consists essentially of glyoxal, BF3 OEt2, and sodium nitrite. In some aspects, a composition comprises, consists of, or consists essentially of glyoxal, H3BO3, and sodium nitrite. In some aspects, a composition further comprises nucleic acids. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 0.5 to 4 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In- 6 -299224109.1some aspects, glyoxal is at a concentration of at least, of at most, or about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, or 4 M (or any range derivable therein). In some aspects, a composition comprises greater than or equal to about 1.0 M glyoxal, and DNA. In some aspects, a composition comprises greater than or equal to about 20 mM H3BO3, and DNA. In some aspects, a composition comprises greater than or equal to about 1.0 M sodium nitrite, and DNA. In some aspects, a composition comprises greater than or equal to about 0.8 M glyoxal, and RNA. In some aspects, a composition comprises greater than or equal to about 10 mM H3BO3, and RNA. In some aspects, a composition comprises greater than or equal to about 0.5 M sodium nitrite, and RNA. In some aspects, a composition further comprising one or more buffers. In some aspects, one or more buffers comprise, consist of, or consist essentially of NasBCh buffer, HEPES buffer, and / or PBS buffer. In some aspects, a buffer has a pH of at least, of at most, or of between about 6.0 and 7.5. In some aspects, one or more buffers exclude, comprise, consist of, or consist essentially of 1 OX PBS buffer at pH ~7.4, HsBCh / NasBCh buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0.

[0015] In some aspects, a method of deaminating nucleobases Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids comprises incubating the nucleic acids with a composition of the disclosure. In some aspects, a method of detecting modified Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids, comprises incubating the nucleic acids with a composition of the disclosure. In some aspects, a method of deaminating nucleobases Adenine (A) or analogs thereof in nucleic acids comprises incubating the nucleic acids with a composition of the disclosure. In some aspects, a method of detecting modified Adenine (A) in nucleic acids, comprises incubating the nucleic acids with a composition of the disclosure. In some aspects, a kit comprises reagents for making a composition of the disclosure. Some aspects relate to use of a composition of the disclosure for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids.

[0016] In some aspects, a method of deaminating primary amines in one or more nucleobases in a nucleic acid comprises, incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions for a deamination reaction, wherein the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid. In some aspects, nucleobases comprise, consist of, or consist essentially of adenine (A) or analogs thereof, guanine (G) or analogs thereof, and / or cytosine (C) or analogs thereof. In some- 7 -299224109.1aspects, nucleobases comprise or consist of adenine (A), guanine (G), and / or cytosine (C). In some aspects, a nucleobase comprises or consists of adenine (A) and / or analogs thereof. In some aspects, a nucleobase comprises or consists of guanine (G) and / or analogs thereof. In some aspects, a nucleobase comprises or consists of cytosine (C) and / or analogs thereof. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of monocarbonyl and / or dicarbonyl compounds. In some paragraphs, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of monocarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of dicarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2- pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a carbonyl organocatalyst described in FIG. 25E and / or Table 4. In some aspects, one or more carbonyl organocatalyst is at a concentration of at least, or at most, or of between about 0.5 M to 4 M. In some aspects, glyoxal is at a concentration of at least, or at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, or 4 M (or any range derivable therein). In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of formaldehyde and / or trifluoroacetaldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of formaldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of furfural. In some aspects, one or more Lewis acid- 8 -299224109.1excludes, comprises, consists essentially of, or consists of BF3 OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RUC13, Ln(OTf)3, CuCl2, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(0H)3, (CH3)2ASO2H, PhB(OH)2, MeB(0H)2, and / or B(C6F5)3. In some aspects, one or more Lewis acid comprise, consist essentially of, or consist of non- metal Lewis acid(s). In some aspects, one or more Lewis acid comprise, consist essentially of, or consist of metal Lewis acid(s). In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2). In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal and / or furfural, and the one or more Lewis acid excludes, comprises, consists essentially of, or consists of boron trifluoride etherate (BErOEt?) and / or boric acid (H3BO3). In some aspects, a Lewis acid comprises EEBCh / NasBCh Buffer. In some aspects, a Lewis acid comprises 500 mM EEBCh / NasBCh Buffer (pH of about 6.4). In some aspects, a method comprises protecting the nucleic acid by incubating the nucleic acid with one or more caging agents prior to incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions. In some aspects, a caging agent exhibits relative specificity towards reacting with adenosine or analogs thereof, or guanine or analogs thereof, or cytosine or analogs thereof. In some aspects, a caging agent exhibits relative specificity towards reacting with guanine and / or cytosine over adenosine. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, or an a-keto aldehyde. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of kethoxal. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of N3-kethoxal and / or kethoxal. In some aspects, a caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM or 10-15 mM, or of at least, at most, or of about 12.5 mM. In some aspects, a caging agent is comprised in a composition at a final concentration of at least, of at most, or of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein). In some aspects, kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM or 10-15 mM or at least, of at most, or of about 12.5 mM. In some aspects, N3-kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration- 9 -299224109.1of at least, of at most, or of about 5-20 mM, 10-15 mM or 12.5 mM. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, incubating of a nucleic acid with a caging agent comprises, consists of, or consists essentially of incubating for a first period of time at least, at most, or between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at least, at most, or between about 30-43 °C. In some aspects, a first period of time is at least, at most, or between about 0.5-3.5 minutes, optionally about 2 minutes. In some aspects, a second period of time is at least, at most, or between about 20-40 minutes, optionally about 30 minutes. In some aspects, a second period of time is at least, at most, or between about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 minutes (or any range derivable therein). In some aspects, protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of at least, of at most, or of about 6-8, optionally about 7-7.5. In some aspects, protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of at least, of at most, or of about 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8 (or any range derivable therein). In some aspects, a method comprises, prior to incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions, the step of protecting the nucleic acid by incubating the nucleic acid with one or more modifying agents. In some aspects, a modifying agent excludes, comprises, consists essentially of, or consists of methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane. In some aspects, a modifying agent excludes, comprises, consists essentially of, or consists of methylamine. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tertbutyl nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of saturated sodium nitrite (~8 M). In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of ammonium nitrite. In some aspects, a source of nitrite ions is at a concentration of at least, of at most, or of about 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv., or any range derivable therein. In some aspects, one or more carbonyl organocatalyst is at a concentration of at least, of at most, or of about 0.1, 0.2, 0.3, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 equiv. (or any range derivable therein), or any range derivable therein. In some aspects, one or more Lewis acid is at a concentration of at least, of at most, or of about 0.3, 0.5, or 1.0 equiv., or any range derivable therein. In some aspects, incubating a nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid- 10 -299224109.1catalyst, and one or more source of nitrite ions is at a pH of at least, of at most, or between about 6.0 and 7.3. In some aspects, incubating is at a pH of at least, of at most, or of between about 6.5 and 7.0. In some aspects, incubating is at a pH of at least, of at most, or of between about 6.6 and 6.9. In some aspects, incubating is at a pH of at least, of at most, or of between about 6.8 and 7.1. In some aspects, incubating a nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of at least, at most, or about 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, or any range derivable therein. In some aspects, incubating is at a pH of at least, of at most, or about 6.9. In some aspects, incubating is at a pH of at least, of at most, or of about 7.0. In some aspects, incubating is in a mixed solvent comprising DMSO and water. In some aspects, incubating is in a mixed solvent comprising a DMSO to water ratio of at least, of at most, or of about 1 :6, 1 :5, 1 :4, 1 :3, 1 :2, 1 : 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1 or 11 : 1, or any range derivable therein. In some aspects, a method further comprises incubating a nucleic acid with the one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions. In some aspects, a first period of time is at least, of at most, or of about 1 hour, 30 minutes, or 15 minutes, or any range derivable therein. In some aspects, incubation of a nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of at least, of at most, or of between about 30 and 70 °C, optionally about 50 °C. In some aspects, incubating for the deamination reaction comprises thermocycling of the one or more carbonyl organocatalyst, the one or more Lewis acid, the one or more source of nitrite ions, and the nucleic acids. In some aspects, thermocycling comprises temperature changes of at least, of at most, or of between about 15-25 °C to at least, at most, or between about 30-43 °C. In some aspects, thermocycling comprises temperature changes of at least, of at most, or of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43 °C (or any range derivable therein). In some aspects, thermocycling comprises 1, 2, 3, 4, 5, or more than 5 cycles of at least, of at most, or of about 37 °C for at least, at most, or at about 5 minutes and at least, at most, or at about 18 °C for at least, at most, or at about 30 minutes. In some aspects, following incubating for the deamination reaction, the deamination reaction is quenched using NH4CI and Tris-HCl buffer. In some aspects, a deamination reaction is quenched using at least, at most, or at about 100 pL NH4Q (at least, at most or about IM, in water) and at least, at most or about 100 pL Tris-HCl buffer (at least, at most or about IM, pH of about 8.0). In some aspects, one or more carbonyl organocatalyst- 11 -299224109.1comprises glyoxal, the one or more Lewis acid comprises BF3 OEt2, and the one or more source of nitrite ions comprises sodium nitrite. In some aspects, one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises H3BO3, and the one or more source of nitrite ions comprises sodium nitrite. In some aspects, one or more carbonyl organocatalyst comprises glyoxal at a concentration of at least, of at most, or of at about 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid comprises DNA. In some aspects, one or more Lewis acid excludes, comprises, consists of, or consists essentially of H3BO3 at greater than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM (or any range derivable therein), and the nucleic acid excludes, comprises, consists of, or consists essentially of DNA. In some aspects, one or more source of nitrite ions excludes, comprises, consists of, or consists essentially of sodium nitrite at greater than or equal to 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid excludes, comprises, consists of, or consists essentially of DNA. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists of, or consists essentially of glyoxal at a concentration of at least, of at most, or of about 0.6 M, 0.7 M, or 0.8 M, and the nucleic acid excludes, comprises, consists of, or consists essentially of RNA. In some aspects, one or more Lewis acid comprises H3BO3 at least, at most, or about 5, 6, 7, 8, 9, or 10 mM, and the nucleic acid excludes, comprises, consists of, or consists essentially of RNA. In some aspects, one or more source of nitrite ions excludes, comprises, consists of, or consists essentially of sodium nitrite of at least, of at most, or of about 0.3 M, 0.4 M, or 0.5 M, and the nucleic acid excludes, comprises, consists of, or consists essentially of RNA. In some aspects, a deamination reaction comprises incubating with one or more buffers. In some aspects, one or more buffers excludes, comprise, consist of, or consist essentially ofNasBCh buffer, HEPES buffer, and / or PBS buffer. In some aspects, a buffer has a pH of at least, of at most, or of between about 6.0 and 7.5. In some aspects, one or more buffers comprise, excludes, consists of, or consist essentially of 10X PBS buffer at pH ~7.4, HsBCh / NasBCh buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists of, or consists essentially of glyoxal, and the one or more Lewis acid excludes, comprises, consists of, or consists essentially of boron trifluoride, optionally wherein the glyoxal and boron trifluoride are at a ratio of 1 : 1. In some aspects, one or more Lewis acid excludes, comprises, consists of, or consists essentially of boric acid and one or more carbonyl organocatalyst is a dicarbonyl compound. In some aspects, a dicarbonyl compound excludes, comprises, consists of, or consists essentially of glyoxylic acid, trifluoropyruvic aldehyde, and / or glyoxal. In some aspects, a method does not result in significant nucleic acid degradation relative to previous nitrite based deamination reactions. In some aspects, a nucleic acid excludes, comprises,- 12 -299224109.1consists of, or consists essentially of RNA and the method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid cocatalyst to mediate the deamination reaction. In some aspects, nucleic acid degradation is measured by nucleic acid fragmentation. In some aspects, a nucleobase is guanine and the one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a monocarbonyl organocatalyst. In some aspects, a nucleobase is adenine and the one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a dicarbonyl organocatalyst. In some aspects, nucleic acids were protected by incubating with a caging agent prior to incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions; further comprising deprotecting of the nucleic acids following incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions. In some aspects, deprotecting excludes, comprises, consists essentially of, or consists of incubating with dNTPs, formamide, and TEAA buffer. In some aspects, deprotecting excludes, comprises, consists essentially of, or consists of incubating the nucleic acids at a temperature of at least, of at most, or of about 90 °C, optionally about 94 °C, for at least, at most, or about 1, 2, 3, 4, or 5 minutes. In some aspects, a deamination rate of cytosine (C) to uridine (U) is of at least, of at most, or of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%. In some aspects, a deamination rate of guanine (G) to xanthine is of at least, of at most, or of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%. In some aspects, a deamination rate of adenine (A) to inosine is of at least, of at most, or of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%. In some aspects, at least, at most, or about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%,43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%,75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any range or value derivable therebetween, of unmodified and / or modified cytosines are deaminated. In some aspects, at least, at most, or about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%,43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%,75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any range or value derivable- 13 -299224109.1therebetween, of unmodified and / or modified guanine are deaminated. In some aspects, at least, at most, or about o 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any range or value derivable therebetween, of unmodified and / or modified adenine are deaminated. In some aspects, the nucleic acid comprises RNA, and a method further comprises reverse transcription of the RNA. In some aspects, reverse transcription is mediated by SSIII RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes. In some aspects, reverse transcribing is not mediated by a DNA polymerase with limited reverse transcriptase activity. In some aspects, reverse transcribing is mediated by RevertAid RT. In some aspects, reverse transcribing occurs in the presence of a dTTP / dCTP ratio that is greater than about 1 : 1, optionally greater than or equal to about 1 :40. In some aspects, a concentration of RNA at the start of the deamination reaction comprises at least, at most, or about 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of polyA enriched RNA. In some aspects, a method further comprises sequencing a nucleic acid following deaminating. In some aspects, sequencing identifies non-deaminated adenine, non-deaminated guanine, and / or nondeaminated cytosine as modified adenine, modified guanine, and / or modified cytosine nucleobases. In some aspects, sequencing identifies 1, 2, 3, 4, 5, 6 or all 7 of the following modifications: DNA 6mA, DNA 4mC, DNA 5mC, RNA m4C, RNA m5C, RNA m2G, and / or RNA m22G. In some aspects, sequencing identifies modifications: DNA 6mA and / or RNA m6A. In some aspects, sequencing identifies modifications: DNA 4mC and / or RNA m4C. In some aspects, sequencing identifies modifications: DNA 5mC and / or RNA m5C. In some aspects, sequencing identifies modifications: RNA m2G and / or RNA m22G. In some aspects, a method excludes, comprises, consists of, or consists essentially of the steps as described in Example 10, CAM-seq for m6A detection in RNA exemplary version 1 Step 2, CAM-seq for m6A detection in RNA exemplary version 2 Step 2, or CAM-seq for 6mA detection in DNA version 1 Step 2. In some aspects, a method excludes, comprises, consists of, or consists essentially of the steps as described in Example 10, CAM-seq for m6A detection in RNA version 1 Step 3, CAM-seq for m6A detection in RNA version 2 Step 3, or CAM-seq for 6mA detection in DNA version 1 Step 3. In some aspects, a kit excludes, comprises, consists essentially of, or consists of reagents for performing a method of the disclosure. In some- 14 -299224109.1aspects, a kit excludes, comprises, consists essentially of, or consists of reagents and instructions for performing a method of the disclosure.

[0017] In some aspects, a method of detecting m6A or 6mA in a nucleic acid excludes, comprises, consists of, or consists essentially of: i) carbonyl organocatalyst and Lewis acid cocatalyst mediated adenine specific deamination, excluding, comprising, consisting of, or consisting essentially of: a) optionally protecting guanine and / or cytosine in the nucleic by incubating the nucleic acid with one or more caging agent prior to deaminating, b) deaminating the adenine nucleobases through one or more incubation steps comprising reaction with: 1) one or more carbonyl organocatalyst, 2) one or more Lewis acid cocatalyst, and 3) one or more source of nitrite ions, and c) terminating the deamination reaction by incubating with a quenching composition, ii) preparing a nucleic acid sequencing library using the deaminated nucleic acids, and iii) sequencing the nucleic acids, wherein non-methylated adenines are deaminated to hypoxanthine (inosine) and are read as guanine by reverse transcriptases and / or polymerases, while m6A or 6mAresist deamination and remain identified as adenine by reverse transcriptases and / or polymerases. In some aspects, one or more caging agent excludes, comprises, consists essentially of, or consists of kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, methylamine, or an a-keto aldehyde. In some aspects, one or more caging agent excludes, comprises, consists essentially of, or consists of kethoxal. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of N3-kethoxal and / or kethoxal. In some aspects, a caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM, 10-15 mM or 12.5 mM. In some aspects, kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM. In some aspects, N3-kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 5-20 mM, 10-15 mM or 12.5 mM. In some aspects, deaminating incubation step(s) are performed at a slightly acidic to neutral pH. In some aspects, a slightly acidic to neutral pH is a pH of about 6.0 to 7.2, and is maintained using one or more buffers. In some aspects, a slightly acidic to neutral pH can be a pH of about 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, or 7.2 (or any range derivable therein), and can be maintained using one or more buffers. In some aspects, a deaminating incubation step(s) comprise thermocycling. In some aspects, a quenching composition excludes, comprises, consists of, or consists essentially of NH4Q, (NHfkSCh, NH4OAC, an ammonium salt, Tris-HCl buffer, Guanidine-HCl buffer,- 15 -299224109.1Glycine buffer, or a combination thereof. In some aspects, a quenching composition excludes, comprises, consists of, or consists essentially of NH4Q and Tris-HCl buffer. In some aspects, a quenching composition excludes, comprises, consists of, or consists essentially of NH4Q (about IM, in water) and Tris-HCl buffer (about IM, pH of about 8.0). In some aspects, a method excludes, comprises, consists essentially of, or consists of a protecting step and further comprises a deprotecting step prior to step ii). In some aspects, a deprotecting step comprises incubating the nucleic acids with one or more of nucleotide triphosphates (NTPs), Guanidine- HC1, GTP, GDP, GMP, formamide, Triethylammonium bicarbonate buffer, Tris-HCl, and Triethylammonium acetate (TEAA) buffer. In some aspects, a deprotecting step excludes, comprises, consists essentially of, or consists of incubating the nucleic acids with NTPs. In some aspects, a deprotecting step excludes, comprises, consists essentially of, or consists of incubating the nucleic acids with NTPs, formamide, and Triethylammonium acetate (TEAA) buffer. In some aspects, a method excludes, comprises, consists essentially of, or consists of the use of formamide, TEAA buffer (IM, pH of about 7.0), and NTP mix (10 mM each). In some aspects, deprotecting excludes, comprises, consists essentially of, or consists of incubating the nucleic acids at temperature of at least, of at most, or of about 90, 91, 92, 93 °C, or optionally about 94 °C, for at least, at most, or about 1, 2, 3, 4, 5, or 6 minutes. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of monocarbonyl and / or dicarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of monocarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of dicarbonyl compounds. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2- pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a carbonyl organocatalyst described in FIG. 25E and / or Table 4. In some aspects, one or more carbonyl organocatalyst is at a concentration of at least, of at most, or of between about 0.5 M to 4 M. In some aspects, one or more carbonyl organocatalyst is at a concentration of at least, of at most, or of 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4 M (or any range derivable therein). In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most,- 16 -299224109.1or of 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 M (or any range derivable therein). In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of BF3 OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(CeFs)3. In some aspects, one or more Lewis acids comprise, consist essentially of, or consist of non-metal Lewis acid(s). In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2). In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal and / or furfural, and the one or more Lewis acid excludes, comprises, consists essentially of, or consists of boron trifluoride etherate (BF3 OEt2) and / or boric acid (H3BO3). In some aspects, a Lewis acid excludes, comprises, consists of, or consists essentially of H3BO3 / Na3BO3 Buffer. In some aspects, a Lewis acid excludes, comprises, consists of, or consists essentially of 500 mM FLBCh / NasBCh Buffer (pH of about 6.4). In some aspects, a method further comprises protecting a nucleic acid by incubating the nucleic acid with one or more caging agents. In some aspects, a caging agent exhibits relative specificity towards guanine or analogs thereof and cytosine or analogs thereof over adenine or analogs thereof. In some aspects, incubating of a nucleic acid with a caging agent excludes, comprises, consists essentially of, or consists of incubating for a first period of time at least, at most, or at between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at least, at most, or at between about 30-43 °C. In some aspects, incubating of a nucleic acid with a caging agent excludes, comprises, consists essentially of, or consists of incubating for a first- 17 -299224109.1period of time at least, at most, or at 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 °C, followed by incubating for a second period of time at least, at most, or at 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43 °C (or any range derivable therein). In some aspects, a first period of time is at least, at most, or at between about 0.5-3.5 minutes, optionally about 2 minutes. In some aspects, a first period of time is at least, at most, or at 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0,3.1, 3.2, 3.3, 3.4, or 3.5 minutes (or any range derivable therein). In some aspects, a second period of time is at least, at most, or at between about 20-40 minutes, optionally about 30 minutes. In some aspects, a second period of time is at least, at most, or at 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 minutes (or any range derivable therein). In some aspects, protecting of a nucleic acid by incubating with one or more caging agents occurs at a pH of at least, at most, or at about 6-8, optionally about 7-7.5. In some aspects, protecting of a nucleic acid by incubating with one or more caging agents occurs at a pH of at least, at most, or at 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5 (or any range derivable therein). In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of a saturated sodium nitrite (~8 M) solution. In some aspects, a source of nitrite ions excludes, comprises, consists essentially of, or consists of ammonium nitrite. In some aspects, a source of nitrite ions is at a concentration of at least, of at most, or of about 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv., or any range derivable therein. In some aspects, one or more carbonyl organocatalyst is at a concentration of at least, of at most, or of about 0.1, 0.2, 0.3, 0.5, or 1.0 equiv., or any range derivable therein. In some aspects, one or more Lewis acid is at a concentration of at least, of at most, or of about 0.3, 0.5, or 1.0 equiv., or any range derivable therein. In some aspects, one or more steps of incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of at least, of at most, or of between 6.0 and 7.3. In some aspects, incubating is at a pH of at least, of at most, or of between 6.5 and 7.0. In some aspects, incubating is at a pH of at least, of at most, or of between 6.6 and 6.9. In some aspects, incubating is at a pH of at least, of at most, or of between 6.8 and7.1. In some aspects, incubating is at a pH of about 6.9. In some aspects, incubating is at a pH of about 7.0. In some aspects, incubating is in a mixed solvent comprising DMSO and water.- 18 -299224109.1In some aspects, the incubating is in a mixed solvent comprising a DMSO to water ratio of greater than or equal to 1 :6, 1 :5, 1 :4, 1 :3, 1 :2, 1 : 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, or 11 : 1. In some aspects, a method further comprises incubating a nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions. In some aspects, a first period of time is at least, at most, or about 1 hour, 30 minutes or 15 minutes. In some aspects, a first period of time is at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 minutes (or any range derivable therein). In some aspects, incubation of a nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of at least, of at most, or of between 30 and 70 °C, optionally about 50 °C. In some aspects, one or more steps of incubation for a deamination reaction comprises thermocycling of one or more carbonyl organocatalyst, one or more Lewis acid, one or more source of nitrite ions, and nucleic acids. In some aspects, thermocycling comprises temperature changes of at least, at most, or at between about 15-25 °C to at least, at most, or at between about 30-43 °C. In some aspects, thermocycling comprises 1, 2, 3, 4, 5, or more than 5 cycles of about 37 °C for at least, at most, or about 5 minutes and at least, at most, or about 18 °C for at least, at most, or about 30 minutes. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, one or more Lewis acid excludes, comprises, consists essentially of, or consists of BF3 OEt2, and one or more sources of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, one or more Lewis acid excludes, comprises, consists essentially of, or consists of H3BO3, and one or more source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal at a concentration of at least, of at most, or of about 0.8 M, 0.9 M, or 1.0 M, and a nucleic acid excludes, comprises, consists essentially of, or consists of DNA. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of H3BO3 at a concentration of at least, of at most, or of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, and a nucleic acid excludes, comprises, consists essentially of, or consists of DNA. In some aspects, one or more source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite at- 19 -299224109.1concentration of at least, of at most, or of about 0.8 M, 0.9 M, or 1.0 M, and a nucleic acid excludes, comprises, consists essentially of, or consists of DNA. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal at a concentration of at least, of at most, or of about 0.6 M, 0.7 M, or 0.8 M, and a nucleic acid excludes, comprises, consists essentially of, or consists of RNA. In some aspects, one or more Lewis acid excludes, comprises, consists essentially of, or consists of H3BO3 at greater than or equal to about 5, 6, 7, 8, 9, or 10 mM, and a nucleic acid excludes, comprises, consists essentially of, or consists of RNA. In some aspects, one or more source of nitrite ions excludes, comprises, consists essentially of, or consists of sodium nitrite at greater than or equal to about 0.3 M, 0.4 M, or 0.5 M, and a nucleic acid excludes, comprises, consists essentially of, or consists of RNA. In some aspects, a deamination reaction excludes, comprises, consists essentially of, or consists of incubating with one or more buffers. In some aspects, one or more buffers excludes, comprises, consists essentially of, or consists of NasBCh buffer, HEPES buffer, and / or PBS buffer. In some aspects, a buffer has a pH of at least, of at most, or of between about 6.0 and 7.5. In some aspects, one or more buffers excludes, comprises, consists essentially of, or consists of 1 OX PBS buffer at pH ~7.4, HsBCh / NasBCh buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0. In some aspects, one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of glyoxal, and one or more Lewis acids excludes, comprises, consists essentially of, or consists of boron trifluoride, optionally wherein the glyoxal and boron trifluoride are at a ratio of about 1 : 1. In some aspects, one or more Lewis acids excludes, comprises, consists essentially of, or consists of boric acid and one or more carbonyl organocatalyst excludes, comprises, consists essentially of, or consists of a dicarbonyl compound. In some aspects, a dicarbonyl compound excludes, comprises, consists essentially of, or consists of glyoxylic acid, trifluoropyruvic aldehyde, and / or glyoxal. In some aspects, a method does not result in significant nucleic acid degradation relative to previous nitrite based deamination reactions. In some aspects, a nucleic acid excludes, comprises, consists essentially of, or consists of RNA and a method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid co-catalyst to mediate the deamination reaction. In some aspects, nucleic acid degradation is measured by nucleic acid fragmentation. In some aspects, a deamination rate of cytosine (C) to uridine (U) is of at least, of at most, or of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%. In some aspects, a deamination rate of guanine (G) to xanthine is of at least, of at most, or of about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%. In some aspects, at least, at most, or about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%,- 20 -299224109.132%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%,48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%,64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99%, or 99.5% of unmodified and / or modified adenine are deaminated. In some aspects, a nucleic acid comprises RNA, and preparing a nucleic acid sequencing library using the deaminated nucleic acids comprises reverse transcription of the RNA. In some aspects, reverse transcription is mediated by S Sill RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes. In some aspects, reverse transcribing is not mediated by a DNA polymerase with limited reverse transcriptase activity. In some aspects, reverse transcribing is mediated by RevertAid RT. In some aspects, reverse transcribing occurs in the presence of a dTTP / dCTP ratio that is greater than about 1 : 1, optionally greater than or equal to about 1 :40. In some aspects, a concentration of nucleic acids at the start of the deamination reaction excludes, comprises, consists essentially of, or consists of at least, of at most, or of about 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of DNA or poly A enriched RNA. In some aspects, a concentration of nucleic acids at the start of the deamination reaction excludes, comprises, consists essentially of, or consists of at least, of at most, or of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 ng (or any range derivable therein) of DNA or polyA enriched RNA. In some aspects, a kit comprises reagents and optionally instructions for performing a method of the disclosure.

[0018] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, comprises: a) one or more carbonyl organocatalysts, and b) one or more Lewis acids. In some aspects, a kit further excludes, comprises, consists essentially of, or consists of one or more sources of nitrite ions. In some aspects, a kit further excludes, comprises, consists essentially of, or consists of one or more buffers and / or enzymes. In some aspects, a kit further excludes, comprises, consists essentially of, or consists of sequencing reagents. In some aspects, sequencing reagents excludes, comprises, consists essentially of, or consists of one or more primers, one or more dNTPs, one or more probes, one or more adaptors, one or more fluorophores, one or more enzymes, one or more polymerases, or a combination thereof. In some aspects, a kit excludes, comprises, consists essentially of, or consists of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-- 21 -299224109.1formylquinoline. In some aspects, a kit excludes, comprises, consists essentially of, or consists of glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde. In some aspects, a kit excludes, comprises, consists essentially of, or consists of glyoxal. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 0.5 to 4 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of between about 1 to 2.5 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 1.55 M. In some aspects, glyoxal is at a concentration of at least, of at most, or of about 2.03 M. In some aspects, a kit excludes, comprises, consists essentially of, or consists of BF3OEt2, H3BO3, SC(OTF)3, LUC13, Y(OTF)3, FeCh, YbCl3, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6Fs)3. In some aspects, a kit excludes, comprises, consists essentially of, or consists of boric acid, boron trifluoride etherate (BF3'OEt2), methylboronic acid, phenylboronic acid, and / or cacodylic acid. In some aspects, a kit excludes, comprises, consists essentially of, or consists of boric acid (H3BO3) and / or boron trifluoride etherate (BF3-OEt2). In some aspects, a kit excludes, comprises, consists essentially of, or consists of EEBCh / NasBCh Buffer. In some aspects, a kit further excludes, comprises, consists essentially of, or consists of a caging agent. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of kethoxal. In some aspects, a caging agent excludes, comprises, consists essentially of, or consists of N3-kethoxal and / or kethoxal. In some aspects, a caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is provided at a concentration wherein a final concentration of at least, of at most, of at about, or of exactly 10-15 mM or 12.5 mM in a composition can be achieved. In some aspects, kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is provided at a concentration wherein a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM in a composition can be achieved. In some aspects, N3-kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or provided at a concentration wherein a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM in a composition can be achieved. In some aspects, a kit further excludes, comprises, consists essentially of, or consists of modifying agents. In some aspects, modifying agents excludes, comprises, consist essentially of, or consist of methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane. In some aspects, a modifying agent excludes, comprises, consists essentially of, or consists of methylamine.

[0019] In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, and a boron trifluoride (BF3»OEt3) / boric acid (H3BO3)- 22 -299224109.1buffer at a concentration at least, at most, or at between about 25-100 mM. In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, or of about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4 M (or any range derivable therein), and a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or at about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,95, 96, 97, 98, 99, or 100 mM (or any range derivable therein).

[0020] In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M and boric acid (H3BO3) at a concentration at least, at most, or at between about 10-20 mM.

[0021] In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 25-100 mM, and sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M.

[0022] In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration at least, at most, or between about 10-20 mM, and sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M.

[0023] In some aspects, a composition comprises glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 25-100 mM, sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, and kethoxal and / or N3-kethoxal at a concentration at least, at most, or between about 10-15 mM.

[0024] In some aspects, a composition comprises glyoxal at a concentration of at least, or at most, or of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration at least, at most, or between about 10-20 mM, sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, and kethoxal and / or N3-kethoxal at a concentration at least, at most, or between about 10-15 mM.

[0025] In some aspects, a method of deaminating primary amines in one or more nucleobases in a nucleic acid comprises: incubating the nucleic acid with glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about- 23 -299224109.125-100 mM, and sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, wherein the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

[0026] In some aspects, a method of deaminating primary amines in one or more nucleobases in a nucleic acid comprises: incubating the nucleic acid with glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration at least, at most, or between about 10-20 mM, and sodium nitrite at a concentration at least, at most, or between about 0.5- 1.0 M, wherein the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

[0027] In some aspects, a method of detecting m6A or 6mA in a nucleic acid excludes, comprises, consists essentially of, or consists of: i) carbonyl organocatalyst and Lewis acid cocatalyst mediated adenine specific deamination, excluding, comprising, consisting essentially of, or consisting of: a) optionally protecting guanine and / or cytosine in the nucleic by incubating the nucleic acid kethoxal and / or N3-kethoxal at a concentration at least, at most, or between about 10-15 mM prior to deaminating, b) deaminating the adenine nucleobases through one or more incubation steps excluding, comprising, consisting essentially of, or consisting of reaction with: 1) glyoxal at a concentration of at least, of at most, or of between about 0.5 to 4 M, 2) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 25-100 mM, and 3) sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, and c) terminating the deamination reaction by incubating with a quenching composition, ii) preparing a nucleic acid sequencing library using the deaminated nucleic acids, and iii) sequencing the nucleic acids, wherein non-methylated adenines are deaminated to hypoxanthine (inosine) and are read as guanine by reverse transcriptases and / or polymerases, while m6A or 6mA resist deamination and remain identified as adenine by reverse transcriptases and / or polymerases.

[0028] In some aspects, a method of detecting m6A or 6mA in a nucleic acid excludes, comprises, consists essentially of, or consists of: i) carbonyl organocatalyst and Lewis acid cocatalyst mediated adenine specific deamination, excluding, comprising, consisting essentially of, or consisting of: a) optionally protecting guanine and / or cytosine in the nucleic by incubating the nucleic acid kethoxal and / or N3 -kethoxal at a concentration at least, at most, or between about 10-15 mM prior to deaminating, b) deaminating the adenine nucleobases through one or more incubation steps excluding, comprising, consisting essentially of, or consisting of reaction with: 1) glyoxal at a concentration of at least, of at most, or of between- 24 -299224109.1about 0.5 to 4 M, 2) boric acid (H3BO3) at a concentration at least, at most, or between about 10-20 mM, and 3) sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, and c) terminating the deamination reaction by incubating with a quenching composition, ii) preparing a nucleic acid sequencing library using the deaminated nucleic acids, and iii) sequencing the nucleic acids, wherein non-methylated adenines are deaminated to hypoxanthine (inosine) and are read as guanine by reverse transcriptases and / or polymerases, while m6A or 6mA resist deamination and remain identified as adenine by reverse transcriptases and / or polymerases.

[0029] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, and b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM. In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of a) glyoxal at a concentration at least, at most, or at about 7 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6,7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7,9.8, 9.9, or 10.0 M (or any range derivable therein), and b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or about 250, 300, 350, 400, 450, 500, 550, 650, 700, or 750 mM (or any range derivable therein).

[0030] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, and b) boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM.

[0031] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM, and c) sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M. In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, b) a boron- 25 -299224109.1trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or 750 mM (or any range derivable therein), and c) sodium nitrite at a concentration at least, at most, or between about 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 M (or any range derivable therein).

[0032] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of: a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, b) boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM, and c) sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M.

[0033] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of: a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM, c) sodium nitrite at a concentration at least, at most, or between about 0.5-1.0 M, and d) kethoxal and / or N3-kethoxal at a concentration at least, at most, or between about 10-15 mM.

[0034] In some aspects, a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, excludes, comprises, consists essentially of, or consists of: a) glyoxal at a concentration at least, at most, or between about 7.0-10.0 M, b) boric acid (H3BO3) buffer at a concentration at least, at most, or between about 250-750 mM, c) sodium nitrite at a concentration at least, at most, or between about 0.5- 1.0 M, and d) kethoxal and / or N3-kethoxal at a concentration at least, at most, or between about 10-15 mM.

[0035] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the measurement or quantitation method.

[0036] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0037] The phrase “and / or” means “and” or “or”. To illustrate, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and / or” operates as an inclusive or.- 26 -299224109.1

[0038] The terms "comprise" (and any form of comprise, such as "comprises" and "comprising"), "have" (and any form of have, such as "has" and "having"), and "include" (and any form of include, such as "includes" and "including") are open-ended linking verbs. As a result, a composition that "comprises," "has," or "includes" one or more elements possesses those one or more elements, but is not limited to possessing only those elements. Likewise, a method that "comprises," "has," or "includes" one or more steps possesses those one or more steps, but is not limited to possessing only those one or more steps.

[0039] Any configuration of any of compositions or methods can consist of or consist essentially of - rather than comprise / include / have - any of the described steps, elements, and / or features. Thus, in any of the claims, the term "consisting of or "consisting essentially of can be substituted for any of the open-ended linking verbs recited above, in order to change the scope of a given claim from what it would otherwise be using the open-ended linking verb. The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of’ any of the ingredients or steps disclosed throughout the specification. Compositions and methods “consisting essentially of’ any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed invention.

[0040] A person of ordinary skill in the art would understand that a solution that is recites absence of (e.g., does not contain) a particular chemical (e.g., a metallic Lewis acid, a monocarbonyl organocatalyst, a caging agent, etc.), said solution does not contain an added quantity of that chemical. The term added means that the chemical is exogenously supplied, i.e. supplied in amounts greater than what would be considered trace or minute amounts.

[0041] As understood by the skilled artisan, a solution of the present disclosure may be described in terms of molarity (M), percent by weight (also “weight percent”; w / w), or any other units. When described in terms of one unit (e.g., w / w) equivalent solutions expressed by other units (e.g., M) are also contemplated herein.

[0042] As used herein, the term “equivalent” refers to an amount of a substance that reacts with (or is equivalent to) an arbitrary amount of another substance in a given chemical reaction. A non-limiting example of an equivalent is a molar equivalent, where a molar equivalent of a substance B is based on a number of moles of a substance A, and is the same number of moles of substance B as the number of moles of substance A. Other non-limiting examples of equivalents include a mass equivalent and a volume equivalent.

[0043] As utilized herein, “added” has a traditional meaning, to include, put in, or join, a component to another component, e.g., a chemical can be added to a composition or method.- 27 -299224109.1A component that is added can be described as being included in a form substantially as described through an active step. A component that is added may also occur without specific inclusion, for example, a component may come into existence through an in situ chemical reaction without being specifically added. A component that arises through a passive in situ chemical reaction is not considered added.

[0044] As used herein, “carbonyl organocatalyst(s)”, also referred to as “organocatalyst(s)”, are small organic molecules (such as but not necessarily limited to aldehydes and ketones) that accelerate reactions when used in sub stoichiometric amounts. In methods of the disclosure, carbonyl organocatalysts are used to lower the energy of the least occupied molecular orbital (LUMO) associated with the 7t-system, thereby facilitating reactions at the carbon site adjacent to the nitrogen of the iminium intermediate.

[0045] As used herein, a “Lewis acid” is a chemical species with an empty orbital capable of accepting an electron pair from a Lewis base to form a Lewis adduct.

[0046] As used herein, an “unmodified nucleobase(s)” or “unmodified nucleotide(s)” or “canonical nucleobase(s)” or “canonical nucleotide(s)” refers to a cytosine (4-Amino-2- hydroxypyrimidine), guanine (2-Amino-6-hydroxypurine), adenine (6-Aminopurine), thymine (5 -methyluracil), and uracil (2,4-Dihydroxypyrimidine).

[0047] As used herein, a “modified nucleobase(s)” or “modified nucleotide(s)” refers to a nucleobase with any modification, for example but not limited to, dehydroxylation, methylation, oxidation, or isomerization, or the like, whether naturally occurring or synthesized, in any position of a nucleobase, such as a carbon, nitrogen, or pendant group.

[0048] As used herein, the term “modified nitrogen-comprising pendant group” refers to a pendant group comprising nitrogen in a nucleobase, wherein the pendant group is not a free amine. For example, a modified nitrogen-comprising pendant group may comprise a nucleic with a methylated pendant group comprising nitrogen, such as but not limited to 4- methylcytosine in the case of cytosine, 2-methylguanine in the case of guanine, or 6- methyladenine in the case of adenine.

[0049] As used herein, the term “free amine in the pendant group” refers to a pendant group comprising a free amine. For example, cytosine (4-Amino-2-hydroxypyrimidine) comprises a free amine at position C4.

[0050] As used herein, “slightly acidic pH” refers to a pH between about 5.5 to 6.5. That is, a slightly acidic pH can comprise, consist of, or consist essentially of a pH of 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, or any range derivable therein.- 28 -299224109.1

[0051] As used herein, “nearly neutral pH” refers to a pH between about 6.51 to 7.49. That is, a nearly neutral pH can comprise, consist of, or consist essentially of a pH of 6.51, 6.52, 6.53, 6.54, 6.55, 6.56, 6.57, 6.58, 6.59, 6.60, 6.61, 6.62, 6.63, 6.64, 6.65, 6.66, 6.67, 6.68, 6.69,6.70, 6.71, 6.72, 6.73, 6.74, 6.75, 6.76, 6.77, 6.78, 6.79, 6.80, 6.81, 6.82, 6.83, 6.84, 6.85, 6.86,6.87, 6.88, 6.89, 6.90, 6.91, 6.92, 6.93, 6.94, 6.95, 6.96, 6.97, 6.98, 6.99, 7.00, 7.01, 7.02, 7.03,7.04, 7.05, 7.06, 7.07, 7.08, 7.09, 7.10, 7.11, 7.12, 7.13, 7.14, 7.15, 7.16, 7.17, 7.18, 7.19, 7.20,7.21, 7.22, 7.23, 7.24, 7.25, 7.26, 7.27, 7.28, 7.29, 7.30, 7.31, 7.32, 7.33, 7.34, 7.35, 7.36, 7.37,7.38, 7.39, 7.40, 7.41, 7.42, 7.43, 7.44, 7.45, 7.46, 7.47, 7.48, or 7.49.

[0052] As used herein, “slightly basic pH” refers to a pH between about 7.5 to 8.5. That is, a slightly basic pH can comprise, consist of, or consist essentially of a pH of 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, or any range derivable therein.

[0053] As used herein, “harsh acidic condition(s)” refers to a pH less than or equal to 5.0.

[0054] Certain aspects of the present invention are characterized through the following enumerated aspects.

[0055] Aspect 1 is a composition comprising one or more carbonyl organocatalysts and one or more Lewis acid catalysts.

[0056] Aspect 2 is the composition of aspect 1, wherein the one or more carbonyl organocatalyst comprises one or more monocarbonyl compounds and / or comprises one or more dicarbonyl compounds.

[0057] Aspect 3 is the composition of any one of aspects 1 or 2, wherein the one or more carbonyl organocatalyst comprises monocarbonyl compounds.

[0058] Aspect 4 is the composition of any one of aspects 1 or 2, wherein the one or more carbonyl organocatalyst comprises dicarbonyl compounds.

[0059] Aspect 5 is the composition of any one of aspects 1-4, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8- formylquinoline.

[0060] Aspect 6 is the composition of any one of aspects 1-5, wherein the one or more carbonyl organocatalyst comprises a carbonyl organocatalyst described in FIG. 25E and / or Table 4.

[0061] Aspect 7 is the composition of any one of aspects 1-6, wherein the one or more carbonyl organocatalyst comprises glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde.- 29 -299224109.1

[0062] Aspect 8 is the composition of any one of aspects 1-7, wherein the one or more carbonyl organocatalyst comprises glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0063] Aspect 9 is the composition of any one of aspects 1-8, wherein the one or more carbonyl organocatalyst comprises glyoxal.

[0064] Aspect 10 is the composition of aspect 9, wherein the glyoxal is at a concentration of between about 0.5 to 4 M.

[0065] Aspect 11 is the composition of aspect 10, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0066] Aspect 12 is the composition of aspect 10, wherein the glyoxal is at a concentration of or of about 1.55 M.

[0067] Aspect 13 is the composition of aspect 10, wherein the glyoxal is at a concentration of or of about 2.03 M.

[0068] Aspect 14 is the composition of any one of aspects 1-13, wherein the one or more carbonyl organocatalyst comprises formaldehyde and / or trifluoroacetaldehyde.

[0069] Aspect 15 is the composition of any one of aspects 1-14, wherein the one or more carbonyl organocatalyst comprises formaldehyde.

[0070] Aspect 16 is the composition of any one of aspects 1-15, wherein the one or more carbonyl organocatalyst comprises furfural.

[0071] Aspect 17 is the composition of any one of aspects 1-16, wherein the one or more Lewis acid comprises BF3OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2ASO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F 5)3.

[0072] Aspect 18 is the composition of any one of aspects 1-17, wherein the one or more Lewis acid comprise non-metal Lewis acid(s).

[0073] Aspect 19 is the composition of any one of aspects 1-18, wherein the one or more Lewis acid comprise metal Lewis acid(s).

[0074] Aspect 20 is the composition of any one of aspects 1-19, wherein the one or more Lewis acid comprises boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid.

[0075] Aspect 21 is the composition of any one of aspects 1-20, wherein the one or more Lewis acid comprises boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2).

[0076] Aspect 22 is the composition of any one of aspects 1-21, wherein the one or more carbonyl organocatalyst comprises glyoxal and / or furfural, and the one or more Lewis acid comprises boron trifluoride etherate (BF3 OEt2) and / or boric acid (H3BO3).- 30 -299224109.1

[0077] Aspect 23 is the composition of any one of aspects 1-22, wherein the Lewis acid comprises H3BO3 / Na3BO3 Buffer.

[0078] Aspect 24 is the composition of aspect 23, wherein the Lewis acid comprises 500 mM H3BO3 / Na3BO3 Buffer (pH = 6.4).

[0079] Aspect 25 is the composition of any one of aspects 1-24, further comprising nucleic acids.

[0080] Aspect 26 is the composition of aspect 25, wherein select nucleobases of the nucleic acids were previously protected by treatment with a caging agent.

[0081] Aspect 27 is the composition of aspect 26, wherein the caging agent exhibits relative specificity towards reacting with guanine or analogs thereof, adenosine or analogs thereof, or cytosine or analogs thereof.

[0082] Aspect 28 is the composition of aspect 27, wherein the caging agent exhibits relative specificity towards reacting with guanine and / or cytosine over adenosine.

[0083] Aspect 29 is the composition of any one of aspects 26-28, wherein the caging agent comprises kethoxal, methylglyoxal, phenylglyoxal, or an a-keto aldehyde.

[0084] Aspect 30 is the composition of any one of aspects 26-29, wherein the caging agent comprises kethoxal.

[0085] Aspect 31 is the composition of any one of aspects 26-30, wherein the caging agent comprises N3-kethoxal and / or kethoxal.

[0086] Aspect 32 is the composition of any one of aspects 26-31, wherein the caging agent is provided at a concentration of about 500 mM, or is comprised in the composition at a final concentration of about 10-15 mM, or about 12.5 mM.

[0087] Aspect 33 is the composition of any one of aspects 29-32, wherein the kethoxal is provided at a concentration of about 500 mM, or is comprised in the composition at a final concentration of about 10-15 mM, or about 12.5 mM.

[0088] Aspect 34 is the composition of any one of aspects 29-33, wherein the N3-kethoxal is provided at a concentration of about 500 mM, or is comprised in the composition at a final concentration of about 10-15 mM, or about 12.5 mM.

[0089] Aspect 35 is the composition of any one of aspects 26-34, wherein the caging agent consists of glyoxal.

[0090] Aspect 36 is the composition of any one of aspects 25-35, wherein select nucleobases of the nucleic acids were previously protected by treatment with a modifying agent.- 31 -299224109.1

[0091] Aspect 37 is the composition of aspect 36, wherein the modifying agent comprises methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

[0092] Aspect 38 is the composition of aspect 36, wherein the modifying agent comprises methylamine.

[0093] Aspect 39 is the composition of any one of aspects 1-38, further comprising one or more source of nitrite ions.

[0094] Aspect 40 is the composition of aspect 39, wherein the source of nitrite ions comprises sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.

[0095] Aspect 41 is the composition of any one of aspects 39-40, wherein the source of nitrite ions comprises sodium nitrite.

[0096] Aspect 42 is the composition of any one of aspects 39-41, wherein the source of nitrite ions comprises saturated sodium nitrite (~8 M).

[0097] Aspect 43 is the composition of any one of aspects 39-40, wherein the source of nitrite ions comprises ammonium nitrite.

[0098] Aspect 44 is the composition of any one of aspects 39-43, wherein the source of nitrite ions is at a concentration of equal to or greater than 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv, or any range derivable therein.

[0099] Aspect 45 is the composition of any one of aspects 1-44, wherein the one or more carbonyl organocatalyst is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0100] Aspect 46 is the composition of any one of aspects 1-45, wherein the one or more Lewis acid is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0101] Aspect 47 is the composition of any one of aspects 1-46, wherein the composition is at a pH of between 6.0 and 7.3.

[0102] Aspect 48 is the composition of any one of aspects 1-46, wherein the composition is at a pH of between 6.5 and 7.0.

[0103] Aspect 49 is the composition of any one of aspects 1-46, wherein the composition is at a pH of between 6.6 and 6.9.

[0104] Aspect 50 is the composition of any one of aspects 1-47, wherein the composition is at a pH of between 6.8 and 7.1.

[0105] Aspect 51 is the composition of any one of aspects 1-50, wherein the composition is at a pH of 6.9.- 32 -299224109.1

[0106] Aspect 52 is the composition of any one of aspects 1-50, wherein the composition is at a pH of 7.0.

[0107] Aspect 53 is the composition of any one of aspects 1-52, wherein the composition comprises a mixed solvent comprising a DMSO to water ratio of greater than or equal to 5:1.

[0108] Aspect 54 is the composition of any one of aspects 1-53, wherein the composition comprises a mixed solvent comprising a DMSO to water ratio of greater than or equal to 9:1.

[0109] Aspect 55 is a composition comprising one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

[0110] Aspect 56 is the composition of aspect 55, comprising glyoxal, BF3 OEt2, and sodium nitrite.

[0111] Aspect 57 is the composition of aspect 55, comprising glyoxal, H3BO3, and sodium nitrite.

[0112] Aspect 58 is the composition of any one of aspects 55-57, further comprising nucleic acids.

[0113] Aspect 59 is the composition of any one of aspects 55-58, wherein the glyoxal is at a concentration of between about 0.5 to 4 M.

[0114] Aspect 60 is the composition of aspect 59, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0115] Aspect 61 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 1.0 M glyoxal, and DNA.

[0116] Aspect 62 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 20 mM H3BO3, and DNA.

[0117] Aspect 63 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 1.0 M sodium nitrite, and DNA.

[0118] Aspect 64 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 0.8 M glyoxal, and RNA.

[0119] Aspect 65 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 10 mM H3BO3, and RNA.

[0120] Aspect 66 is the composition of any one of the preceding aspects, wherein the composition comprises greater than or equal to 0.5 M sodium nitrite, and RNA.

[0121] Aspect 67 is the composition of any one of the preceding aspects, further comprising one or more buffers.

[0122] Aspect 68 is the composition of aspect 66, wherein the one or more buffers comprise Na3BO3 buffer, HEPES buffer, and / or PBS buffer.- 33 -299224109.1

[0123] Aspect 69 is the composition of aspect 67 or 68, wherein the buffer has a pH of between about 6.0 and 7.5.

[0124] Aspect 70 is the composition of any one of aspects 67-69, wherein the one or more buffers comprise 10X PBS buffer at pH ~7.4, H3BO3 / Na3BO3 buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0.

[0125] Aspect 71 is a method of deaminating nucleobases Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids by incubating the nucleic acids with the composition of any one of aspects 1-70.

[0126] Aspect 72 is a method of detecting modified Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids, the method comprising incubating the nucleic acids with the composition of any one of aspects 1- 70.

[0127] Aspect 73 is a method of deaminating nucleobases Adenine (A) or analogs thereof in nucleic acids by incubating the nucleic acids with the composition of any one of aspects 1- 70.

[0128] Aspect 74 is a method of detecting modified Adenine (A) in nucleic acids, comprising incubating the nucleic acids with the composition of any one of aspects 1-70.

[0129] Aspect 75 is a kit comprising reagents for making the composition of any one of aspects 1-66.

[0130] Aspect 76 is use of the composition of any one of aspects 1-70 for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids.

[0131] Aspect 77 is a method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising incubating the nucleic acid with one or more carbonyl organocatalysts, one or more Lewis acid catalysts, and one or more source of nitrite ions in a deamination reaction, wherein the deamination reaction causes the primary amines in the one or more nucleobases to form C-nitro intermediates then rearrange into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

[0132] Aspect 78 is the method of aspect 77, wherein the nucleobases comprise adenine (A) or analogs thereof, guanine (G) or analogs thereof, and / or cytosine (C) or analogs thereof.

[0133] Aspect 79 is the method of aspect 77, wherein the nucleobases comprise or consist of adenine (A), guanine (G), and / or cytosine (C).

[0134] Aspect 80 is the method of any one of aspects 77-79, wherein the nucleobase comprises or consists of adenine (A) and / or analogs thereof.- 34 -299224109.1

[0135] Aspect 81 is the method of any one of aspects 77-79, wherein the nucleobase comprises or consists of guanine (G) and / or analogs thereof.

[0136] Aspect 82 is the method of any one of aspects 77-79, wherein the nucleobase comprises or consists of cytosine (C) and / or analogs thereof.

[0137] Aspect 83 is the method of any one of aspects 77-82, wherein the one or more carbonyl organocatalyst comprises monocarbonyl and / or dicarbonyl compounds.

[0138] Aspect 84 is the method of any one of aspects 77-83, wherein the one or more carbonyl organocatalyst comprises monocarbonyl compounds.

[0139] Aspect 85 is the method of any one of aspects 77-83, wherein the one or more carbonyl organocatalyst comprises dicarbonyl compounds.

[0140] Aspect 86 is the method of any one of aspects 77-85, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8- formylquinoline.

[0141] Aspect 87 is the method of any one of aspects 77-86, wherein the one or more carbonyl organocatalyst comprises a carbonyl organocatalyst described in FIG. 25E and / or Table 4.

[0142] Aspect 88 is the method of any one of aspects 77-87, wherein the one or more carbonyl organocatalyst is at a concentration of between about 0.5 M to 4 M.

[0143] Aspect 89 is the method of any one of aspects 77-88, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0144] Aspect 90 is the method of any one of aspects 77-89, wherein the glyoxal is at a concentration of at least, of at most, or of about 1.55 M.

[0145] Aspect 91 is the method of any one of aspects 77-89, wherein the glyoxal is at a concentration of at least, of at most, or of about 2.03 M.

[0146] Aspect 92 is the method of any one of aspects 77-91, wherein the one or more carbonyl organocatalyst comprises glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0147] Aspect 93 is the method of any one of aspects 77-92, wherein the one or more carbonyl organocatalyst comprises glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0148] Aspect 94 is the method of any one of aspects 77-93, wherein the one or more carbonyl organocatalyst comprises glyoxal.- 35 -299224109.1

[0149] Aspect 95 is the method of aspect 94, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0150] Aspect 96 is the method of aspect 94, wherein the glyoxal is at a concentration of at least, of at most, or of about 1.55 M.

[0151] Aspect 97 is the method of aspect 94, wherein the glyoxal is at a concentration of at least, of at most, or of about 2.03 M.

[0152] Aspect 98 is the method of any one of aspects 77-97, wherein the one or more carbonyl organocatalyst comprises formaldehyde and / or trifluoroacetaldehyde.

[0153] Aspect 99 is the method of any one of aspects 77-98, wherein the one or more carbonyl organocatalyst comprises formaldehyde.

[0154] Aspect 100 is the method of any one of aspects 77-99, wherein the one or more carbonyl organocatalyst comprises furfural.

[0155] Aspect 101 is the method of any one of aspects 77-100, wherein the one or more Lewis acid comprises BF3OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2ASO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F 5)3.

[0156] Aspect 102 is the method of any one of aspects 77-101, wherein the one or more Lewis acid comprises non-metal Lewis acid(s).

[0157] Aspect 103 is the method of any one of aspects 77-102, wherein the one or more Lewis acid comprises metal Lewis acid(s).

[0158] Aspect 104 is the method of any one of aspects 77-103, wherein the one or more Lewis acid comprises boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid.

[0159] Aspect 105 is the method of any one of aspects 77-104, wherein the one or more Lewis acid comprises boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2).

[0160] Aspect 106 is the method of any one of aspects 77-105, wherein the one or more carbonyl organocatalyst comprises glyoxal and / or furfural, and the one or more Lewis acid comprises boron trifluoride etherate (BF3 OEt2) and / or boric acid (H3BO3).

[0161] Aspect 107 is the method of any one of aspects 77-106, wherein the Lewis acid comprises H3BO3 / Na3BO3 buffer.

[0162] Aspect 108 is the method of aspect 107, wherein the Lewis acid comprises 500 mM H3BO3 / Na3BO3 buffer (pH = 6.4).

[0163] Aspect 109 is the method of any one of aspects 77-106, comprising protecting the nucleic acid by incubating the nucleic acid with one or more caging agents prior to incubating- 36 -299224109.1the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions.

[0164] Aspect 110 is the method of aspect 109, wherein the caging agent exhibits relative specificity towards reacting with adenosine or analogs thereof, or guanine or analogs thereof, or cytosine or analogs thereof.

[0165] Aspect 111 is the method of aspect 110, wherein the caging agent exhibits relative specificity towards reacting with guanine and / or cytosine over adenosine.

[0166] Aspect 112 is the method of any one of aspects 109-111, wherein the caging agent comprises kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, glyoxal, or an a-keto aldehyde.

[0167] Aspect 113 is the method of any one of aspects 109-111, wherein the caging agent comprises kethoxal.

[0168] Aspect 114 is the method of any one of aspects 109-111, wherein the caging agent comprises N3-kethoxal and / or kethoxal.

[0169] Aspect 115 is the method of any one of aspects 109-114, wherein the caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM, or of or of about 12.5 mM.

[0170] Aspect 116 is the method of aspect 113, wherein the kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM.

[0171] Aspect 117 is the method of aspect 114, wherein the N3-kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM.

[0172] Aspect 118 is the method of any one of aspects 109-112, wherein the caging agent comprises glyoxal.

[0173] Aspect 119 is the method of any one of aspects 109-118, wherein the incubating of the nucleic acid with the caging agent comprises incubating for a first period of time at between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at between about 30-43 °C.

[0174] Aspect 120 is the method of aspect 119, wherein the first period of time is between about 0.5-3.5 minutes, optionally about 2 minutes.

[0175] Aspect 121 is the method of aspect 119 or 120, wherein the second period of time is between about 20-40 minutes, optionally about 30 minutes.- 37 -299224109.1

[0176] Aspect 122 is the method of any one of aspects 109-121, wherein the protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of about 6-8, optionally about 7-7.5.

[0177] Aspect 123 is the method of any one of aspects 66-122, comprising protecting the nucleic acid by incubating the nucleic acid with one or more caging agents prior to incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions.

[0178] Aspect 124 is the method of aspect 123, wherein the modifying agent comprises methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

[0179] Aspect 125 is the method of aspect 123, wherein the modifying agent comprises methylamine.

[0180] Aspect 126 is the method of any one of aspects 77-125, wherein the source of nitrite ions comprises sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.

[0181] Aspect 127 is the method of any one of aspects 77-126, wherein the source of nitrite ions comprises sodium nitrite.

[0182] Aspect 128 is the method of any one of aspects 77-127, wherein the source of nitrite ions comprises saturated sodium nitrite (~8 M).

[0183] Aspect 129 is the method of any one of aspects 77-128, wherein the source of nitrite ions comprises ammonium nitrite.

[0184] Aspect 130 is the method of any one of aspects 77-129, wherein the source of nitrite ions is at a concentration of equal to or greater than 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv, or any range derivable therein.

[0185] Aspect 131 is the method of any one of aspects 77-130, wherein the one or more carbonyl organocatalyst is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0186] Aspect 132 is the method of any one of aspects 77-131, wherein the one or more Lewis acid is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0187] Aspect 133 is the method of any one of aspects 77-132, wherein incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of between 6.0 and 7.3.

[0188] Aspect 134 is the method of aspect 133, wherein the incubating is at a pH of between 6.5 and 7.0.- 38 -299224109.1

[0189] Aspect 135 is the method of aspect 133, wherein the incubating is at a pH of between 6.6 and 6.9.

[0190] Aspect 136 is the method of aspect 133, wherein the incubating is at a pH of between 6.8 and 7.1.

[0191] Aspect 137 is the method of aspect 133, wherein the incubating is at a pH of 6.9.

[0192] Aspect 138 is the method of aspect 133, wherein the incubating is at a pH of 7.0.

[0193] Aspect 139 is the method of any one of aspects 104-138, wherein the incubating is in a mixed solvent comprising DMSO and water.

[0194] Aspect 140 is the method of any one of aspects 104-139, wherein the incubating is in a mixed solvent comprising a DMSO to water ratio of greater than or equal to 1 :4, 1 :3, 1 :2, 1 : 1, 2: 1, 3: 1, 4: 1, 5: 1, 6:1, 7: 1, 8: 1, or 9: 1.

[0195] Aspect 141 is the method of any one of aspects 104-140, further comprising incubating the nucleic acid with the one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

[0196] Aspect 142 is the method of aspect 141, wherein the first period of time is less than or equal to 1 hour, 30 minutes, or 15 minutes.

[0197] Aspect 143 is the method of aspect 141 or 142, wherein the incubation of the nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of between 30 and 70 °C, optionally about 50 °C.

[0198] Aspect 144 is the method of any one of aspects 104-143, wherein the incubating for the deamination reaction comprises thermocycling of the one or more carbonyl organocatalyst, the one or more Lewis acid, the one or more source of nitrite ions, and the nucleic acids.

[0199] Aspect 145 is the method of aspect 144, wherein the thermocycling comprises temperature changes of between about 15-25 °C to between about 30-43 °C.

[0200] Aspect 146 is the method of aspect 144 or 145, wherein the thermocycling comprises 1, 2, 3, 4, 5, or more than 5 cycles of about 37 °C for about 5 minutes and about 18 °C for about 30 minutes.

[0201] Aspect 147 is the method of any one of aspects 104-146, wherein following incubating for the deamination reaction, the deamination reaction is quenched using NH4CI and Tris-HCl buffer.- 39 -299224109.1

[0202] Aspect 148 is the method of aspect 147, wherein the deamination reaction is quenched using 100 pL NH4CI (IM, in water) and 100 pL Tris-HCl buffer (IM, pH = 8.0).

[0203] Aspect 149 is the method of any one of aspects 77-148, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises BF3 OEt2, and the one or more source of nitrite ions comprises sodium nitrite.

[0204] Aspect 150 is the method of any one of aspects 77-148, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises H3BO3, and the one or more source of nitrite ions comprises sodium nitrite.

[0205] Aspect 151 is the method of any one of aspects 77-150, wherein the one or more carbonyl organocatalyst comprises glyoxal at a concentration of at least 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid comprises DNA.

[0206] Aspect 152 is the method of any one of aspects 77-151, wherein the one or more Lewis acid comprises H3BO3 at greater than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, and the nucleic acid comprises DNA.

[0207] Aspect 153 is the method of any one of aspects 77-152, wherein the one or more source of nitrite ions comprises sodium nitrite at greater than or equal to 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid comprises DNA.

[0208] Aspect 154 is the method of any one of aspects 77-150, wherein the one or more carbonyl organocatalyst comprises glyoxal at a concentration of at least 0.6 M, 0.7 M, or 0.8 M, and the nucleic acid comprises RNA.

[0209] Aspect 155 is the method of any one of aspects 77-150 or 154, wherein the one or more Lewis acid comprises H3BO3 at greater than or equal to 5, 6, 7, 8, 9, or 10 mM, and the nucleic acid comprises RNA.

[0210] Aspect 156 is the method of any one of aspects 77-150 or 154-155, wherein the one or more source of nitrite ions comprises sodium nitrite at greater than or equal to 0.3 M, 0.4 M, or 0.5 M, and the nucleic acid comprises RNA.

[0211] Aspect 157 is the method of any one of aspects 77-156, wherein the deamination reaction comprises incubating with one or more buffers.

[0212] Aspect 158 is the method of aspect 157, wherein the one or more buffers comprise NasBCh buffer, HEPES buffer, and / or PBS buffer.

[0213] Aspect 159 is the method of aspect 157 or 158, wherein the buffer has a pH of between about 6.0 and 7.5.- 40 -299224109.1

[0214] Aspect 160 is the method of any one of aspects 157-159, wherein the one or more buffers comprise 10X PBS buffer at pH 7.4, HsBCh / NasBCh buffer at pH 6.4, and / or HEPES buffer at pH 6.0.

[0215] Aspect 161 is the method of any one of aspects 77-160, wherein the one or more carbonyl organocatalyst comprises glyoxal, and the one or more Lewis acid comprises boron trifluoride, optionally wherein the glyoxal and boron trifluoride are at a ratio of 1 : 1.

[0216] Aspect 162 is the method of any one of aspects 77-161, wherein the one or more Lewis acid comprises boric acid and the one or more carbonyl organocatalyst is a dicarbonyl compound.

[0217] Aspect 163 is the method of aspect 162, wherein the dicarbonyl compound comprises glyoxylic acid, trifluoropyruvic aldehyde, and / or glyoxal.

[0218] Aspect 164 is the method of any one of aspects 77-163, wherein the method does not result in significant nucleic acid degradation relative to previous nitrite-based deamination reactions.

[0219] Aspect 165 is the method of any one of aspects 77-164, wherein the nucleic acid comprises RNA and the method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid co-catalyst to mediate the deamination reaction.

[0220] Aspect 166 is the method of aspect 164 or 165, wherein nucleic acid degradation is measured by nucleic acid fragmentation.

[0221] Aspect 167 is the method of any one of aspects 77-166, wherein the nucleobase is guanine and the one or more carbonyl organocatalyst comprises or consists of a monocarbonyl organocatalyst.

[0222] Aspect 168 is the method of any one of aspects 77-167, wherein the nucleobase is adenine and the one or more carbonyl organocatalyst comprises or consists of a dicarbonyl organocatalyst.

[0223] Aspect 169 is the method of any one of aspects 77-168, wherein the nucleic acids were protected by incubating with a caging agent prior to incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions; wherein the method further comprises deprotecting of the nucleic acids following incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

[0224] Aspect 170 is the method of aspect 169, wherein the deprotecting comprises incubating with dNTPs, formamide, and TEAA buffer.- 41 -299224109.1

[0225] Aspect 171 is the method of aspect 169 or 170, wherein the deprotecting comprises incubating the nucleic acids at greater than or equal to 90 °C, optionally about 94 °C, for greater than or equal to 1, 2, 3, 4, or 5 minutes.

[0226] Aspect 172 is the method of any one of aspects 77-171, wherein the deamination rate of cytosine (C) to uridine (U) is less than or equal to about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%.

[0227] Aspect 173 is the method of any one of aspects 77-172, wherein the deamination rate of guanine (G) to xanthine is less than or equal to about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%.

[0228] Aspect 174 is the method of any one of aspects 77-173, wherein the deamination rate of adenine (A) to inosine is less than or equal to about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%.

[0229] Aspect 175 is the method of any one of aspects 77-174, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of unmodified and / or modified cytosines are deaminated.

[0230] Aspect 176 is the method of any one of aspects 77-175, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of unmodified and / or modified guanine are deaminated.

[0231] Aspect 177 is the method of any one of aspects 77-176, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of unmodified and / or modified adenine are deaminated.- 42 -299224109.1

[0232] Aspect 178 is the method of any one of aspects 77-177, wherein the nucleic acid comprises RNA, and further comprising reverse transcription of the RNA.

[0233] Aspect 179 is the method of aspect 178, wherein the reverse transcription is mediated by S Sill RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes.

[0234] Aspect 180 is the method of any one of aspects 178-179, wherein the reverse transcribing is not mediated by a DNA polymerase with limited reverse transcriptase activity.

[0235] Aspect 181 is the method of any one of aspects 178-180, wherein the reverse transcribing is mediated by RevertAid RT.

[0236] Aspect 182 is the method of any one of aspects 178-181, wherein the reverse transcribing occurs in the presence of a dTTP / dCTP ratio that is greater than 1 : 1, optionally greater than or equal to 1 :40.

[0237] Aspect 183 is the method of any one of aspects 178-182, wherein the concentration of RNA at the start of the deamination reaction comprises less than or equal to 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of poly A enriched RNA.

[0238] Aspect 184 is the method of any one of aspects 77-183, further comprising sequencing the nucleic acid following the deaminating.

[0239] Aspect 185 is the method of aspect 184, wherein the sequencing identifies nondeaminated adenine, non-deaminated guanine, and / or non-deaminated cytosine as modified adenine, modified guanine, and / or modified cytosine nucleobases.

[0240] Aspect 186 is the method of aspect 185, wherein the sequencing identifies modifications: DNA 6mA, DNA 4mC, DNA 5mC, RNA m4C, RNA m5C, RNA m2G, and / or RNA m22G.

[0241] Aspect 187 is the method of aspect 186, wherein the sequencing identifies modifications: DNA 6mA and / or RNA m6A.

[0242] Aspect 188 is the method of aspect 186, wherein the sequencing identifies modifications: DNA 4mC and / or RNA m4C.

[0243] Aspect 189 is the method of aspect 186, wherein the sequencing identifies modifications: DNA 5mC and / or RNA m5C.

[0244] Aspect 190 is the method of aspect 186, wherein the sequencing identifies modifications: RNA m2G and / or RNA m22G.

[0245] Aspect 191 is the method of any one of aspects 77-187, comprising the steps as described in Example 10, CAM-seq for m6A detection in RNA exemplary version 1 Step 2, CAM-seq for m6A detection in RNA exemplary version 2 Step 2, or CAM-seq for 6mA detection in DNA version 1 Step 2.- 43 -299224109.1

[0246] Aspect 192 is the method of any one of aspects 77-187, comprising the steps as described in Example 10, CAM-seq for m6A detection in RNA version 1 Step 3, CAM-seq for m6A detection in RNA version 2 Step 3, or CAM-seq for 6mA detection in DNA version 1 Step 3.

[0247] Aspect 193 is a kit comprising reagents for performing the method of any one of aspects 104-192.

[0248] Aspect 194 is a kit comprising reagents and instructions for performing the method of any one of aspects 104-193.

[0249] Aspect 195 is a method of detecting m6A or 6mA in a nucleic acid, the method comprising: deaminating one or more adenine nucleobases in the nucleic acid by incubating the nucleic acid with: 1) one or more carbonyl organocatalysts, 2) one or more Lewis acid cocatalysts, and 3) one or more sources of nitrite ions, in a deamination reaction thereby deaminating one or more non-methylated adenines in the nucleic acid to hypoxanthine (inosine); terminating the deamination reaction by incubating the nucleic acid with a quenching composition thereby generating deaminated nucleic acids; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

[0250] Aspect 195.1 is the method of aspect 195, further comprising the step of protecting a guanine and / or a cytosine in the nucleic by incubating the nucleic acid with one or more caging agents prior to deaminating, wherein the step of protecting the guanine and / or cytosine occurs prior to the deamination step.

[0251] Aspect 196 is the method of aspect 195.1, wherein the one or more caging agents comprise kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, methylamine, or an a-keto aldehyde.

[0252] Aspect 197 is the method of aspect 195 or 196, wherein the one or more caging agent comprises kethoxal.

[0253] Aspect 198 is the method of any one of aspects 195-197, wherein the caging agents comprise N3 -kethoxal and / or kethoxal.

[0254] Aspect 199 is the method of any one of aspects 195.1-198, wherein the caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM.

[0255] Aspect 200 is the method of aspect 197, wherein the kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM.- 44 -299224109.1

[0256] Aspect 201 is the method of aspect 198, wherein the N3-kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is comprised in the composition at a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM.

[0257] Aspect 202 is the method of any one of aspects 195-198, wherein the deaminating incubation step(s) are performed at a slightly acidic to neutral pH.

[0258] Aspect 203 is the method of aspect 202, wherein the slightly acidic to neutral pH is a pH of about 6.0 to 7.2, and is maintained using one or more buffers.

[0259] Aspect 204 is the method of any one of aspects 195-203, wherein the deaminating incubation step(s) comprise thermocycling.

[0260] Aspect 205 is the method of any one of aspects 195-204, wherein the quenching composition comprises NH4Q, (NHf^SCh, NH4OAC, an ammonium salt, Tris-HCl buffer, Guanidine-HCl buffer, Glycine buffer, or a combination thereof.

[0261] Aspect 206 is the method of any one of aspects 195-205, wherein the quenching composition comprises NH4Q and Tris-HCl buffer.

[0262] Aspect 207 is the method of aspect 206, wherein the quenching composition comprises NH4CI (IM, in water) and Tris-HCl buffer (IM, pH = 8.0).

[0263] Aspect 208 is the method of any one of aspects 195-207, comprising the protecting step and further comprising a deprotecting step prior to step ii.

[0264] Aspect 209 is the method of aspect 208, wherein the deprotecting step comprises incubating the nucleic acids with one or more of nucleotide triphosphates (NTPs), Guanidine- HCl, GTP, GDP, GMP, formamide, Triethylammonium bicarbonate buffer, Tris-HCl, and Triethylammonium acetate (TEAA) buffer.

[0265] Aspect 210 is the method of aspect 208 or 209, wherein the deprotecting step comprises incubating the nucleic acids with NTPs.

[0266] Aspect 211 is the method of any one of aspects 208-210, wherein the deprotecting step comprises incubating the nucleic acids with NTPs, formamide, and Triethylammonium acetate (TEAA) buffer.

[0267] Aspect 212 is the method of aspect 211, comprising formamide, TEAA buffer (IM, pH = 7.0), and NTP mix (10 mM each).

[0268] Aspect 213 is the method of any one of aspects 208-210, wherein the deprotecting comprises incubating the nucleic acids at greater than or equal to 90 °C, optionally about 94 °C, for greater than or equal to 1, 2, 3, 4, or 5 minutes.

[0269] Aspect 214 is the method of any one of aspects 195-211, wherein the one or more carbonyl organocatalyst comprises monocarbonyl and / or dicarbonyl compounds.- 45 -299224109.1

[0270] Aspect 215 is the method of any one of aspects 195-214, wherein the one or more carbonyl organocatalyst comprises monocarbonyl compounds.

[0271] Aspect 216 is the method of any one of aspects 195-215, wherein the one or more carbonyl organocatalyst comprises dicarbonyl compounds.

[0272] Aspect 217 is the method of any one of aspects 195-216, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8- formylquinoline.

[0273] Aspect 218 is the method of any one of aspects 195-217, wherein the one or more carbonyl organocatalyst comprises a carbonyl organocatalyst described in FIG. 25E and / or Table 4.

[0274] Aspect 219 is the method of any one of aspects 195-218, wherein the one or more carbonyl organocatalyst is at a concentration of between about 0.5 M to 4 M.

[0275] Aspect 220 is the method of any one of aspects 195-219, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0276] Aspect 221 is the method of any one of aspects 195-220, wherein the glyoxal is at a concentration of at least, of at most, or of about 1.55 M.

[0277] Aspect 222 is the method of any one of aspects 195-221, wherein the glyoxal is at a concentration of at least, of at most, or of about 2.03 M.

[0278] Aspect 223 is the method of any one of aspects 195-222, wherein the one or more carbonyl organocatalyst comprises glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0279] Aspect 224 is the method of any one of aspects 195-223, wherein the one or more carbonyl organocatalyst comprises glyoxal, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0280] Aspect 225 is the method of any one of aspects 195-224, wherein the one or more carbonyl organocatalyst comprises glyoxal.

[0281] Aspect 226 is the method of aspect 225, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0282] Aspect 227 is the method of aspect 225, wherein the glyoxal is at a concentration of at least, of at most, or of about 1.55 M.

[0283] Aspect 228 is the method of aspect 225, wherein the glyoxal is at a concentration of at least, of at most, or of about 2.03 M.- 46 -299224109.1

[0284] Aspect 229 is the method of any one of aspects 195-228, wherein the one or more Lewis acid comprises BF3OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCb, C0CI2, MnCb, AlCb, Sm(OTF)3, InCb, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2ASO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F5)3.

[0285] Aspect 230 is the method of any one of aspects 195-229, wherein the one or more Lewis acid comprises non-metal Lewis acid(s).

[0286] Aspect 231 is the method of any one of aspects 195-230, wherein the one or more Lewis acid comprises boric acid, methylboronic acid, phenylboronic acid, and / or cacodylic acid.

[0287] Aspect 232 is the method of any one of aspects 195-231, wherein the one or more Lewis acid comprises boric acid (FbBO3) and / or boron trifluoride etherate (BF3OEt2).

[0288] Aspect 233 is the method of any one of aspects 195-232, wherein the one or more carbonyl organocatalyst comprises glyoxal and / or furfural, and the one or more Lewis acid comprises boron trifluoride etherate (BF3OEt2) and / or boric acid (H3BO3).

[0289] Aspect 234 is the method of any one of aspects 195-233, wherein the Lewis acid comprises H3BO3 / Na3BO3buffer.

[0290] Aspect 235 is the method of aspect 234, wherein the Lewis acid comprises 500 mM H3BO3 / Na3BO3buffer (pH = 6.4).

[0291] Aspect 236 is the method of any one of aspects 195-235, comprising protecting the nucleic acid by incubating the nucleic acid with one or more caging agents.

[0292] Aspect 237 is the method of aspect 236, wherein the caging agent exhibits relative specificity towards guanine or analogs thereof and cytosine or analogs thereof over adenine or analogs thereof.

[0293] Aspect 238 is the method of any one of aspects 236-237, wherein the incubating of the nucleic acid with the caging agent comprises incubating for a first period of time at between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at between about 30-43 °C.

[0294] Aspect 239 is the method of aspect 238, wherein the first period of time is between about 0.5-3.5 minutes, optionally about 2 minutes.

[0295] Aspect 240 is the method of aspect 238 or 239, wherein the second period of time is between about 20-40 minutes, optionally about 30 minutes.

[0296] Aspect 241 is the method of any one of aspects 236-240, wherein the protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of about 6-8, optionally about 7-7.5.- 47 -299224109.1

[0297] Aspect 242 is the method of any one of aspects 195-241, wherein the source of nitrite ions comprises sodium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.

[0298] Aspect 243 is the method of any one of aspects 195-242, wherein the source of nitrite ions comprises sodium nitrite.

[0299] Aspect 244 is the method of any one of aspects 195-242, wherein the source of nitrite ions comprises a saturated sodium nitrite (~8 M) solution.

[0300] Aspect 245 is the method of any one of aspects 195-243, wherein the source of nitrite ions comprises ammonium nitrite.

[0301] Aspect 246 is the method of any one of aspects 195-245, wherein the source of nitrite ions is at a concentration of equal to or greater than 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv, or any range derivable therein.

[0302] Aspect 247 is the method of any one of aspects 195-246, wherein the one or more carbonyl organocatalyst is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0303] Aspect 248 is the method of any one of aspects 195-247, wherein the one or more Lewis acid is at a concentration of equal to or greater than 0.3, 0.5, or 1.0 equiv, or any range derivable therein.

[0304] Aspect 249 is the method of any one of aspects 195-248, wherein the one or more steps of incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of between 6.0 and 7.3.

[0305] Aspect 250 is the method of aspect 249, wherein the incubating is at a pH of between 6.5 and 7.0.

[0306] Aspect 251 is the method of aspect 249, wherein the incubating is at a pH of between 6.6 and 6.9.

[0307] Aspect 252 is the method of aspect 249, wherein the incubating is at a pH of between 6.8 and 7.1.

[0308] Aspect 253 is the method of aspect 249, wherein the incubating is at a pH of 6.9.

[0309] Aspect 254 is the method of aspect 249, wherein the incubating is at a pH of 7.0.

[0310] Aspect 255 is the method of any one of aspects 195-254, wherein the incubating is in a mixed solvent comprising DMSO and water.

[0311] Aspect 256 is the method of any one of aspects 195-255, wherein the incubating is in a mixed solvent comprising a DMSO to water ratio of greater than or equal to 1 :4, 1 :3, 1 :2, 1 : 1, 2: 1, 3: 1, 4: 1, 5: 1, 6:1, 7: 1, 8: 1, or 9: 1.- 48 -299224109.1

[0312] Aspect 257 is the method of any one of aspects 195-256, further comprising incubating the nucleic acid with the one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

[0313] Aspect 258 is the method of aspect 257, wherein the first period of time is less than or equal to 1 hour, 30 minutes, or 15 minutes.

[0314] Aspect 259 is the method of aspect 257 or 258, wherein the incubation of the nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of between 30 and 70 °C.

[0315] Aspect 260 is the method of any one of aspects 195-259, wherein the one or more steps of incubation for the deamination reaction comprises thermocycling of the one or more carbonyl organocatalyst, the one or more Lewis acid, the one or more source of nitrite ions, and the nucleic acids.

[0316] Aspect 261 is the method of aspect 260, wherein the thermocycling comprises temperature changes of between about 15-25 °C to between about 30-43 °C.

[0317] Aspect 262 is the method of aspect 260 or 261, wherein the thermocycling comprises 1, 2, 3, 4, 5, or more than 5 cycles of about 37 °C for about 5 minutes and about 18 °C for about 30 minutes.

[0318] Aspect 263 is the method of any one of aspects 195-262, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises BFs OEt?, and the one or more source of nitrite ions comprises sodium nitrite.

[0319] Aspect 264 is the method of any one of aspects 195-263, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises LLBCh, and the one or more source of nitrite ions comprises sodium nitrite.

[0320] Aspect 265 is the method of any one of aspects 195-264, wherein the one or more carbonyl organocatalyst comprises glyoxal at a concentration of at least 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid comprises DNA.

[0321] Aspect 266 is the method of any one of aspects 195-265, wherein the one or more Lewis acid comprises LLBCh at greater than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, and the nucleic acid comprises DNA.

[0322] Aspect 267 is the method of any one of aspects 195-266, wherein the one or more source of nitrite ions comprises sodium nitrite at greater than or equal to 0.8 M, 0.9 M, or 1.0 M, and the nucleic acid comprises DNA.- 49 -299224109.1

[0323] Aspect 268 is the method of any one of aspects 195-267, wherein the one or more carbonyl organocatalyst comprises glyoxal at a concentration of at least 0.6 M, 0.7 M, or 0.8 M, and the nucleic acid comprises RNA.

[0324] Aspect 269 is the method of any one of aspects 195-268, wherein the one or more Lewis acid comprises H3BO3 at greater than or equal to 5, 6, 7, 8, 9, or 10 mM, and the nucleic acid comprises RNA.

[0325] Aspect 270 is the method of any one of aspects 195-269, wherein the one or more source of nitrite ions comprises sodium nitrite at greater than or equal to 0.3 M, 0.4 M, or 0.5 M, and the nucleic acid comprises RNA.

[0326] Aspect 271 is the method of any one of aspects 195-270, wherein the deamination reaction comprises incubating with one or more buffers.

[0327] Aspect 272 is the method of aspect 271, wherein the one or more buffers comprise NasBCh buffer, HEPES buffer, and / or PBS buffer.

[0328] Aspect 273 is the method of aspect 271, wherein the buffer has a pH of between about 6.0 and 7.5.

[0329] Aspect 274 is the method of any one of aspects 271-273, wherein the one or more buffers comprise 10X PBS buffer at pH ~7.4, HsBCh / NasBCL buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0.

[0330] Aspect 275 is the method of any one of aspects 195-274, wherein the one or more carbonyl organocatalyst comprises glyoxal, and the one or more Lewis acid comprises boron trifluoride, optionally wherein the glyoxal and boron trifluoride are at a ratio of 1 : 1.

[0331] Aspect 276 is the method of any one of aspects 195-275, wherein the one or more Lewis acid comprises boric acid and one or more carbonyl organocatalyst is a dicarbonyl compound.

[0332] Aspect 277 is the method of aspect 276, wherein the dicarbonyl compound comprises glyoxylic acid, trifluoropyruvic aldehyde, and / or glyoxal.

[0333] Aspect 278 is the method of any one of aspects 195-277, wherein the method does not result in significant nucleic acid degradation relative to previous nitrite-based deamination reactions.

[0334] Aspect 279 is the method of any one of aspects 195-278, wherein the nucleic acid comprises RNA and the method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid co-catalyst to mediate the deamination reaction.- 50 -299224109.1

[0335] Aspect 280 is the method of aspect 278 or 279, wherein nucleic acid degradation is measured by nucleic acid fragmentation.

[0336] Aspect 281 is the method of any one of aspects 195-280, wherein the deamination rate of cytosine (C) to uridine (U) is less than or equal to about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%.

[0337] Aspect 282 is the method of any one of aspects 195-281, wherein the deamination rate of guanine (G) to xanthine is less than or equal to about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5%.

[0338] Aspect 283 is the method of any one of aspects 195-282, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%,46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%,62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99%, or 99.5% of unmodified and / or modified adenine are deaminated.

[0339] Aspect 284 is the method of any one of aspects 195-283, wherein the nucleic acid comprises RNA, and the preparing a nucleic acid sequencing library using the deaminated nucleic acids comprises reverse transcription of the RNA.

[0340] Aspect 285 is the method of aspect 284, wherein the reverse transcription is mediated by S Sill RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes.

[0341] Aspect 286 is the method of any one of aspects 284-285, wherein the reverse transcribing is not mediated by a DNA polymerase with limited reverse transcriptase activity.

[0342] Aspect 287 is the method of any one of aspects 284-286, wherein the reverse transcribing is mediated by RevertAid RT.

[0343] Aspect 288 is the method of any one of aspects 284-287, wherein the reverse transcribing occurs in the presence of a dTTP / dCTP ratio that is greater than 1 : 1, optionally greater than or equal to 1 :40.

[0344] Aspect 289 is the method of any one of aspects 195-288, wherein the concentration of nucleic acid at the start of the deamination reaction comprises less than or equal to 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of DNA or polyA-enriched RNA.

[0345] Aspect 290 is a kit comprising reagents and optionally instructions for performing the method according to any one of aspects 195-289.- 51 -299224109.1

[0346] Aspect 291 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) one or more carbonyl organocatalysts, and b) one or more Lewis acids.

[0347] Aspect 292 is the kit of aspect 291, further comprising one or more sources of nitrite ions.

[0348] Aspect 293 is the kit of aspect 291 or 292, further comprising one or more buffers and / or enzymes.

[0349] Aspect 294 is the kit of any one of aspects 291-293, further comprising sequencing reagents.

[0350] Aspect 295 is the kit of aspect 294, wherein the sequencing reagents comprise one or more primers, one or more dNTPs, one or more probes, one or more adaptors, one or more fluorophores, one or more enzymes, one or more polymerases, or a combination thereof.

[0351] Aspect 296 is the kit of any one of aspects 291-295, comprising glyoxal, formaldehyde, furfural, trifluoroacetaldehyde, trifluoropyruvaldehyde, 2- pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline.

[0352] Aspect 297 is the kit of any one of aspects 291-296, comprising glyoxal, formaldehyde, trifluoroacetaldehyde, glyoxylic acid, and / or trifluoropyruvic aldehyde.

[0353] Aspect 298 is the kit of any one of aspects 291-297, comprising glyoxal.

[0354] Aspect 299 is the kit of any one of aspects 291-298, wherein the glyoxal is at a concentration of between about 0.5 to 4 M.

[0355] Aspect 300 is the kit of any one of aspects 291-299, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

[0356] Aspect 301 is the kit of any one of aspects 291-300, wherein the glyoxal is at a concentration of at least, of at most, or of about 1.55 M.

[0357] Aspect 302 is the kit of any one of aspects 291-301, wherein the glyoxal is at a concentration of at least, of at most, or of about 2.03 M.

[0358] Aspect 303 is the kit of any one of aspects 291-298, comprising BF3 OEt2, H3BO3, SC(OTF)3, LuCk, Y(OTF)3, FeCk, YbCk, RuCk, Ln(OTf)3, CuCh, NiCk, C0CI2, MnCk, AICk, Sm(OTF)3, InCk, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6Fs)3.

[0359] Aspect 304 is the kit of any one of aspects 291-303, comprising boric acid, boron trifluoride etherate (BF3 OEt2), methylboronic acid, phenylboronic acid, and / or cacodylic acid.- 52 -299224109.1

[0360] Aspect 305 is the kit of any one of aspects 291-304, comprising boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt?).

[0361] Aspect 306 is the kit of any one of aspects 291-305, comprising EEBCE / NasBCh buffer.

[0362] Aspect 307 is the kit of any one of aspects 291-306, further comprising a caging agent.

[0363] Aspect 308 is the kit of aspect 307, wherein the caging agent excludes, comprises, consists essentially of, or consists of kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, or an a-keto aldehyde.

[0364] Aspect 309 is the kit of aspect 307 or 308, wherein the caging agent comprises kethoxal.

[0365] Aspect 310 is the kit of aspect 307 or 308, wherein the caging agent comprises N3- kethoxal and / or kethoxal.

[0366] Aspect 311 is the kit of any one of aspects 307-310, wherein the caging agent is provided at a concentration of at least, of at most, or of about 500 mM, and / or is provided at a concentration wherein a final concentration of or of exactly 10-15 mM or 12.5 mM in a composition can be achieved.

[0367] Aspect 312 is the kit of aspect 309, wherein the kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or is provided at a concentration wherein a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM in a composition can be achieved.

[0368] Aspect 313 is the kit of aspect 310, wherein the N3 -kethoxal is provided at a concentration of at least, of at most, or of about 500 mM, and / or provided at a concentration wherein a final concentration of at least, of at most, or of about 10-15 mM or 12.5 mM in a composition can be achieved.

[0369] Aspect 314 is the kit of any one of aspects 291-313, further comprising modifying agents.

[0370] Aspect 315 is the kit of aspect 314, wherein the modifying agents comprise methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

[0371] Aspect 316 is the kit of aspect 314, wherein the modifying agent comprises methylamine.

[0372] Aspect 317 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M, and a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM.- 53 -299224109.1

[0373] Aspect 318 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M and boric acid (H3BO3) at a concentration between or between about 10-20 mM.

[0374] Aspect 319 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM, and sodium nitrite at a concentration between or between about 0.5-1.0 M.

[0375] Aspect 320 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration between or between about 10-20 mM, and sodium nitrite at a concentration between or between about 0.5-1.0 M.

[0376] Aspect 321 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM, sodium nitrite at a concentration between about or between 0.5-1.0 M, and kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.

[0377] Aspect 322 is a composition comprising glyoxal at a concentration of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration between or between about 10-20 mM, sodium nitrite at a concentration between or between about 0.5-1.0 M, and kethoxal and / or N3 -kethoxal at a concentration between or between about 10-15 mM.

[0378] Aspect 323 is a method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising: incubating the nucleic acid with glyoxal at a concentration of between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM, and sodium nitrite at a concentration between or between about 0.5-1.0 M, wherein the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

[0379] Aspect 324 is a method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising: incubating the nucleic acid with glyoxal at a concentration of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration between or between about 10-20 mM, and sodium nitrite at a concentration between or between about 0.5- 1.0 M, wherein the primary amines form C-nitro intermediates are rearranged into N- nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

[0380] Aspect 325 is a method of detecting m6A or 6mA in a nucleic acid, the method comprising: protecting one or more guanines and / or cytosines in the nucleic by incubating the nucleic acid with kethoxal and / or N3-kethoxal at a concentration between about 10-15 mM;- 54 -299224109.1deaminating one or more adenine nucleobases in the nucleic acid by incubating the nucleic acid with: 1) glyoxal at a concentration between about 0.5 to 4 M, 2) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between about 25-100 mM, and 3) sodium nitrite at a concentration between or between about 0.5-1.0 M, in a deamination reaction thereby deaminating one or more non-methylated adenines in the nucleic acid to hypoxanthine (inosine); terminating the deamination reaction by incubating with a quenching composition thereby generating deaminated nucleic acids; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

[0381] Aspect 326 is a method of detecting m6A or 6mA in a nucleic acid, the method comprising: protecting one or more guanines and / or cytosines in the nucleic by incubating the nucleic acid with kethoxal and / or N3-kethoxal at a concentration between about 10-15 mM; deaminating one or more adenines through one or more incubation steps with: 1) glyoxal at a concentration between about 0.5 to 4 M, 2) boric acid (H3BO3) at a concentration between about 10-20 mM, and 3) sodium nitrite at a concentration between about 0.5-1.0 M, in a deamination reaction thereby deaminating one or more non-methylated adenines in the nucleic acid to hypoxanthine (inosine); terminating the deamination reaction by incubating with a quenching composition; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

[0382] Aspect 327 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, and b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM.

[0383] Aspect 328 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, and b) boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM.

[0384] Aspect 329 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, and c) sodium nitrite at a concentration between or between about 0.5-1.0 M.

[0385] Aspect 330 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a)- 55 -299224109.1glyoxal at a concentration between or between about 7.0-10.0 M, b) boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, and c) sodium nitrite at a concentration between or between about 0.5- 1.0 M.

[0386] Aspect 331 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, c) sodium nitrite at a concentration between or between about 0.5-1.0 M, and d) kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.

[0387] Aspect 332 is a kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, b) boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, c) sodium nitrite at a concentration between or between about 0.5-1.0 M, and d) kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.

[0388] It is specifically contemplated that any limitation discussed with respect to one aspect of the invention may apply to any other aspect of the invention. Furthermore, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or to utilize any composition of the invention. Any aspect discussed with respect to one aspect of the disclosure applies to other aspects of the disclosure as well and vice versa. For example, any step in a method described herein can apply to any other method. Moreover, any method described herein may have an exclusion of any step or combination of steps. Aspects of an aspect set forth in the Examples are also aspects that may be implemented in the context of aspects discussed elsewhere in a different Example or elsewhere in the application, such as in the Summary, Detailed Description, Claims, and Brief Description of the Drawings.

[0389] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific aspects of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.- 56 -299224109.1BRIEF DESCRIPTION OF THE DRAWINGS

[0390] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific aspects presented herein.

[0391] FIGs. 1A-1C | Deamination of primary amines can be catalyzed by cooperation of carbonyl organocatalysts and Lewis acids. FIG. 1A Shows how nitrite ions mediate deamination through a sequential process of nitrosation and diazotization under acidic conditions. FIG. IB Outlines a cooperative deamination catalyzed by carbonyl organocatalyst and Lewis acids as described herein. FIG. 1C Presents an exemplary schematic of an m6A- CAM-seq method for whole transcriptome m6A sequencing. RNA samples were fragmented and treated under optimized conditions, followed by purification and sequencing library preparation (see Examples).

[0392] FIGs. 2A-2D | Deamination of nucleobases catalyzed by organocatalyst combined with Lewis acid. FIG. 2A Outlines exemplary condition A, substrate scope with cytidine and analogues. FIG. 2B Outlines exemplary condition B, substrate scope with adenosine and analogues. FIG. 2C Outlines exemplary condition C, substrate scope with guanosine and analogues using 1.0 eq furfural. FIG. 2D Describes methylated nucleosides investigated under catalytic conditions described herein. "Isolated yields without specific notation. Mhe decarboxylation products after deamination have not been included.c2- aminoadenosine as the starting material.rfisoguanosine as the starting material. ^Guanosine deamination with condition A. ^Guanosine deamination with condition C. (See Examples for details).

[0393] FIGs. 3A-3B | Mechanistic investigations & proposed catalytic cycle. FIG. 3A provides ID15N NMR spectrum. FIG. 3B Provides a proposed catalytic cycle. "15N NMR spectrum of157V6-adenosine.M5N NMR spectrum of the condensation between157V6-adenosine and organocatalyst.cl5N NMR spectrum of the condensation between1’-adenosine and organocatalyst under Lewis acid catalysis.

[0394] FIGs. 4A-4K | Exemplary deamination of oligonucleotides. FIG. 4A Provides the results of testing of a series of Lewis acid catalysts by measuring the mutation ratio at adenine sites on an oligonucleotide. FIG. 4B Provides the results of testing a series of carbonyl organocatalysts by measuring the mutation ratio at adenine sites on an oligonucleotide. FIG. 4C Is a comparison of the catalytic deamination efficiency of A and C under various types of- 57 -299224109.1carbonyl organocatalysts. The results showed that dicarbonyl catalysts led to higher deamination ratios on A sites than C sites. FIG. 4D Shows the conversion ratio of a 6-mer DNA oligo CTCAGC with an exemplary condition resulted in high reactivity in both protection and deamination. Protected G sites were marked byA, and deaminated A site were highlighted in bold. FIG. 4E Show the conversion ratio of a 5-mer m6A RNA oligo probe (ACm6AGU) that was used to demonstrate the selectivity between A and m6A; conditions were otherwise similar to those depicted in FIG. 4D. FIGs. 4F-4H Show results of testing concentrations of glyoxal and boronic acid, along with the appropriate nitrite concentration for the deamination reaction of a DNA oligo (detected by monitoring nucleotide composition using LC-MS / MS). The increased use of glyoxal and boric acid did not affect the selectivity between A and G / C; however, a higher concentration of nitrite ions dramatically increased the conversion of C. FIGs. 4I-4K Are results from experiments with similar conditions to FIGs. 4F-4H, but with an RNA oligo probe used to demonstrate the selectivity between A and G / C.

[0395] FIGs. 5A-5J | Exemplary CAM-seq protocols. FIG. 5A Provides results of reverse transcription (RT) stop tested on oligonucleotides with guanine (G) sites protected by glyoxal (on oligonucleotide GACTGAACGNNGNNTTCCCAGTACGTGATGCCAAT (SEQ ID NO: 1). The RT stop ratio reached approximately 75% at the first glyoxal-protected G site. FIG. 5B Provides results of a similar RT stop test condition as FIG. 5 A, but kethoxal-protected RNA oligo probe was used to demonstrate the RT stop ratio. The RT stop ratio reached only 40% at the first kethoxal-protected G site. FIGs. 5C-5D Provide comparisons of the caging kinetics of the DNA oligo using kethoxal and glyoxal under neutral conditions. FIGs. 5E-5F Provide comparisons of the decaging kinetics of the DNA oligo using kethoxal and glyoxal under neutral conditions. FIG. 5G Provides results of competition of kethoxal-fully-caged DNA oligo by glyoxal under neutral conditions. FIG. 5H Provides results of an RNA degradation assay by using both full-length (left) and 200-nt fragmented RNA (right). Followed chemical treatment, full-length mRNA showed partial degradation into 500-nt polynucleotides, while fragmented RNA did not show significant degradation. FIG. 5J Elucidation of reverse transcriptase conditions was achieved through spike-in oligo sequencing data. A standout condition (#14, RevertedAid RT at a 1 :40 dTTP to dCTP ratio) exhibited a background noise level below 0.36%.

[0396] FIGs. 6A-6K | Accurate quantification of m6A modification revealed m6A deposition at the motif level. FIG. 6A Provides the m6A modification level of all-A sites with sufficient coverage (>20), and the distribution of detected m6A sites along the transcripts. The GAC motif (top row) and UAG motif (bottom row) were used as examples. The frequency- 58 -299224109.1distribution of methylation levels of all A sites is provided in the left panels, with sites passing the -value cutoff (<0.001) in black and those not passing in gray. The total number of A-sites and filtered m6A sites are labeled and the distribution of A-sites and filtered m6A sites along the transcripts are displayed. 670,202 GAC motifs located in the exonic region of the transcripts were detected, occupying 4.6% of all the A-sites. 152,249 GAC motifs showed significant enrichment of m6A modification, which occupied 52.9% of all detected m6A sites. m6A sites were highly enriched in the 3’ untranslated region (UTR) near the stop codon. A similar analysis cutoff detected only 178 m6A sites out of 554,840 UAG motifs on the transcript. FIG. 6B Is a comparison of detected m6A sites and estimated background noise with previously reported m6A sequencing methods. In the bar plot, m6A sites with GAC / AAC motifs are colored in red, and other m6A motifs in purple. The total number of m6A sites reported is labeled at the top of each bar. In the line plot, the ratio of UAG motifs to GAC motifs was used as a rough estimation of the upper bound of the false positive rate (FP%). The ratios of 3 demethylation-based methods were calculated and are shown as a black line. Surprisingly, FP% in CAM-seq was as low as 0. l%-0.2%; with RT condition #14 showing an especially low FP% of lower than 0.1%. FIG. 6C Provides a direct comparison of the m6A levels as measured by CAM-seq or GLORI-seq. The results showed overestimation of m6A level in the GLORI-seq method, which are highlighted with a red frame (top left). The number of overlapping sites (N = 126,362) and the correlation (r = 0.883) between the two assays are indicated on the panel. FIG. 6D The fraction of AAC motifs was calculated by the sum of (m6A ratio x site coverage of m6A sites on the AAC motif) over the sum (m6A ratio x site coverage of all m6A sites). The numbers from 3 deamination-based methods are shown. FIG. 6E The average methylation level of each motif versus the relative frequency of motifs in the human transcriptome for all A sites without applying the filters is shown. UAG / UAA / CAG / CAA motifs, which are relatively rare in methylation, and the methylation level of these 4 motifs were used as the level of average background noise, labeled with a dotted line in the figure. GAC / AAC motifs were colored in red, and other motifs in purple. The overall m6A level was calculated by (sum of (m6A ratio - average background noise) x site coverage) over (sum of site coverage), and the average level was labeled on the upper left comer of the figure (0.41%). FIG. 6F Is similar to FIG. 6E, but the data for n Arabidopsis sample is shown and the average m6A level was 0.77%. FIG. 6G Similar to FIG. 6E, but the data for maize is shown and the average m6A level was 0.69%. FIG. 6H The relationship between motif frequency and the average methylation level of detected sites in human, Arabidopsis, and maize samples was analyzed and the results provided. Motif frequency was calculated as the number of detected m6A sites passing the filter- 59 -299224109.1divided by the number of A sites with sufficient coverage in the sequencing data. Detected m6A sites in 3 species (human, Arabidopsis and maize) were grouped by 3-letter motifs (N = 16). FIG. 61 The importance score of nucleotides at different locations relative to the m6A sites was calculated. Scores for A, C, G, and T were colored in red, blue, orange, and green, respectively, and the total importance score for all bases at each position shown with a dotted black line, for human samples, the results showed an enrichment of C at the 1 position, and G at the -1 and - 2 positions. FIG. 6J Similar to FIG. 61, but the data for an Arabidopsis sample is shown, the results showed an enrichment of C at the 1 position and to a lesser extent G at the -1 and -2 positions. FIG. 6K Similar to panel FIG. 61, but the data for maize is shown, the results showed an enrichment of C at the 1 position and to a lesser extent G at the -1 and -2 positions.

[0397] FIGs. 7A-7I | Factors affecting m6A variation. FIG. 7A Is an illustration showing how the regional and gene distribution of A sites may affect the variance of m6A modification level on genes. FIG. 7B The region from -20 to +180 nt near the stop codon was identified as an m6A deposition hotspot based on metagene analysis. All A-sites were divided into two categories: those within this window and those outside. The variance of m6A sites between and within these regions was compared, followed by an one-way ANOVA test. The F-statistic represents the ratio of variance between groups to variance within groups, with the - value indicating the significance of this comparison. ** denotes a - value <10'10, * indicates a p- value <10'2, and NS. signifies insignificance. Major m6A motifs in the human transcriptome are highlighted in bold. FIG. 7C Provides results of an analysis similar to panel B, this analysis compared the variance between genes or within a single gene. As most regions on the genes were minimally modified, only A sites within the m6A hotspot (-20 to +180) were considered for this analysis. FIG. 7D Shows Logio gene expression level versus the average m6A level of detected m6A sites along the gene. A contour plot indicates the density of genes, with a trend line shown as a black dotted line. FIG. 7E Shows distribution of max m6A modification levels of all the genes. FIG. 7F Shows the correlation between the average and maximum m6A modification levels within genes. FIG. 7G Shows Logio gene expression level versus the average m6A level for lowly modified genes only. FIG. 7H Shows Logio gene expression level versus the average m6A level for highly modified genes only. FIG. 71 Provides an overview of the overall relationship between m6A level and gene expression level across all genes (black), genes without m6A modification (blue), genes with low m6A modification (yellow), and genes with high m6A modification (red).

[0398] FIGs. 8A-8C | Side products of deamination FIG. 8A Describes formation of a major side product, a guanine-glyoxal adduct, which can inhibit guanosine deamination. FIG.- 60 -299224109.18B Describes side products of 2-aminoadenosine deamination. Deamination of 2- aminoadenosine at the 2-position occurs more rapidly than at the 6-position. The majority of initial deamination events form guanosine, which then produces the guanosine-glyoxal adduct, inhibiting further deamination. A minority of initial deamination events result in isoguanine, leading to the formation of the isoguanine-glyoxal adduct and subsequent deamination product 14 (bottom right). FIG. 8C15A-labeled adenosine reacted with157V-labeled sodium nitrite resulting in doubleJH-15N Heteronuclear Multiple Bond Correlation (HMBC) signals (top). Conversely, normal adenosine reacting with15A-labeled sodium nitrite produced only a singleJH-15N HMBC signal (bottom).

[0399] FIGs. 9A-9C | 2D1H-15N HMBC spectra of15A6-adenosine condensation with glyoxal in DMSO-d6 / HiO at room temperature. FIG. 9A Provides results ofHMBC analysis of starting materials residues during the condensation of1Af6-adenosine and glyoxal without Lewis acid catalysis. FIG. 9B Provides results ofJH-15N HMBC analysis of the condensation intermediate. FIG. 9C Provides results ofJH-15N HMBC analysis of potential stereoisomeric condensation intermediates.

[0400] FIGs. 10A-10C | Mechanism study. FIG. 10A Show results ofXH-15N HMBC experiments investigating the condensation betweenl 5M’-adenosine and glyoxal under Lewis acid catalysis. FIG. 10B Show results ofJH-15N HMBC experiments investigating the deamination of the15 / ’-adenosine with Na15NO2 solution. The imine intermediates vanished immediately after the addition of nitrite ions to the reaction system, indicating a purportedly fast rate of reaction. Subsequent reactions were dependent on the formation of the imine intermediates. FIG. 10C Show results ofJH-15N HMBC experiments of the deamination of the adenosine with Na15NO2 solution.

[0401] FIGs. 11A-11C | CAM-seq reactions on DNA oligos. FIG. HA The effect of different Lewis acid catalyst on the mutation ratio of A-to-G in DNA is shown with Sanger sequencing (of oligonucleotide comprising TTGTGGTTGTATACAGGTACTCCCGGTGT [SEQ ID NO: 2); identified as SEQ ID NOs: 3 and 4 for Methylboronic acid and Boric acid conditions, respectively). Methyl and phenyl groups decreased the capability of accepting an electron pair, thereby relatively reducing catalyst efficiency. The four A sites within this oligo region were marked by vertical lines for ease of reference. FIG. 11B Shows effects of various carbonyl organocatalysts on the mutation ratio of A-to-G in DNA as shown with Sanger sequencing (of SEQ ID NO: 2; identified as SEQ ID NO: 5 for Trifluoroacetaldehyde conditions, SEQ ID NOs: 6 for Glyoxylic acid conditions, and 7 for Trifluoropyruvic aldehyde and Glyoxal conditions . FIG. 11C Are LC-MS / MS results indicating the conversion ratio and- 61 -299224109.1selectivity of A under various carbonyl organocatalysts conditions. In DNA, the dicarbonyl organocatalysts (e.g., glyoxal, trifluoropyruvic aldehyde and glyoxylic acid) exhibited higher selectivity in converting A compared to C relative to the monocarbonyl organocatalysts (e.g., formaldehyde, trifluoroacetaldehyde).

[0402] FIG. 12 | CAM-seq mediated A-to-I mutation ratios analyzed with a 35-mer RNA probe. FIG. 12 Shows the mutation ratio of all nucleotides on a 35-mer RNA probe (TATCTGTCTCGACGTNNANNGGCCTTTGCAACTAG (SEQ ID NO: 8) upon treatment with various carbonyl organocatalysts (formaldehyde, trifluoroacetaldehyde, glyoxylic acid, trifluoropyruvic aldehyde, and glyoxal, respectively). The resulting sequences identified by Sanger sequencing are identified as SEQ ID NOs: 9-14. The monocarbonyl catalysts (formaldehyde, trifluoroacetaldehyde) achieved a higher deamination ratio at C sites compared to A sites, demonstrating the potential utility of C / 4mC specific detection using these catalysts. The dicarbonyl organocatalyst exhibited greater selectivity in converting A over C, aligning with the LC-MS / MS results reported herein.

[0403] FIGs. 13A-13C | Determination of CAM-seq deamination conversion conditions using RNA oligos. FIG. 13A Shows the results of different ramping temperatures tested during an RNA oligo(TATCTGTCTCGACGTNNANNGGCGATGGTTTCTAGAATTACACCATAATTGCT;SEQ ID NO: 15) deamination reaction comprising use of boric acid and glyoxal, with the conversion ratio of A remaining unchanged from 4 °C to 25 °C. FIG. 13B Shows how different buffers with varying pH values were used during the deamination step. The conversion of A remained unchanged from pH 3 to pH 9 when deaminating RNA oligos using boric acid and glyoxal. FIG. 13C Deamination rates were tested using RNA oligos (SEQ ID NO: 15) trialed with different nitrite salts with boric acid and glyoxal deamination conditions. Ammonium nitrite and sodium nitrite showed the greatest conversion ratios, with ammonium nitrite exhibiting a lower deamination ratio at C sites, while sodium nitrite achieved a higher conversion ratio at A sites (Sanger sequencing results SEQ ID NOs: 16-20 for conversion utilizing tert-butyl nitrite, tetrabutylammonium nitrite, ammonium nitrite, or sodium nitrite, respectively).

[0404] FIGs. 14A-14L | Protection and deprotection reaction of guanine on a FAM labeled oligo. FIGs. 14A-14C Show results of glyoxal caging assays on 100 pmol of a FAM labeled DNA oligo. FIG. 14A Caging kinetics were monitored by treating 100 pmol of a FAM- labeled DNA substrate with 1.0 pmol glyoxal (103equiv.) in lx sodium cacodylate buffer at 37 °C. At the indicated time points, reactions were analyzed using 20% denaturing- 62 -299224109.1polyacrylamide gel electrophoresis (PAGE). FIG. 14B Caging kinetics were monitored by treating 100 pmol of a FAM-labeled DNA substrate with glyoxal (103, 2*103, 4*103, 8*103, 16* 103, 32* 103, 64* 103, 128* 103equiv.) in lx PBS buffer at 37 °C for 20 minutes and analyzed using 20% denaturing PAGE. FIG. 14C Caging kinetics were monitored by treating 100 pmol of a FAM-labeled DNA substrate with 0.2 M glyoxal in different PBS buffers (pH = 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0.) at 37 °C for 20 minutes and analyzed using 20% denaturing PAGE. FIGs. 14D-14E Show results of kinetic assays for decaging glyoxal from a fully caged DNA oligo; where 20 pmol of a fully glyoxal-caged DNA strand was incubated at 70 °C at noted pH (6.5, 7, or 7.5) for indicated times and then immediately loaded into 20% polyacrylamide gels for electrophoresis. Densitometric quantification of caging was measured as a function of time. FIG. 14D Shows representative images of the decaging of glyoxal using a pH = 6.5 reaction buffer for the indicated times. FIG. 14E Shows representative images of the decaging of glyoxal under pH = 7.0 reaction buffer for the indicated times. FIG. 14F Shows representative images of the decaging of glyoxal under pH = 7.5 reaction buffer for the indicated times. FIGs. 14G-14I show results of Kethoxal caging assays using a FAM labeled DNA oligo. FIG. 14G Caging kinetics were monitored by treating 100 pmol of a FAM-labeled DNA substrate with 1.0 pmol glyoxal (103equiv.) in lx sodium cacodylate buffer at 37 °C. Reactions were analyzed using 20% denaturing PAGE at the indicated time points. FIG. 14H Caging kinetics were monitored by treating 100 pmol of a FAM-labeled DNA substrate with 0.2 M glyoxal in different PBS buffers (pH = 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0.) at 37 °C for 20 minutes and analyzed using 20% denaturing PAGE. FIG. 141 Provides results of testing of fully kethoxal- caged DNA oligo by glyoxal under neutral conditions. 20 pmol of a kethoxal fully caged DNA strand was incubated with glyoxal (32* 103, 64* 103, or 128* 103equiv.) in lx PBS buffer at 37 °C for 20 minutes and analyzed by using 20% denaturing PAGE. FIGs. 14J-14L Show results of decaging assays of fully kethoxal-caged DNA oligos; where 20 pmol of a fully kethoxal- caged DNA strand was incubated at 70 °C at noted pH (6.5, 7, or 7.5) for indicated times and then immediately loaded into 20% polyacrylamide gels for electrophoresis. Densitometric quantification of caging was measured as a function of time. FIG. 14J Shows representative images of the decaging of kethoxal under pH = 6.5 reaction buffer for the indicated times. FIG. 14K Shows representative images of the decaging of kethoxal under pH = 7.0 reaction buffer for the indicated times. FIG. 14L Shows representative images of the decaging of kethoxal under pH = 7.5 reaction buffer for the indicated times.

[0405] FIG. 15 | Elucidating efficacy of RNA CAM-seq reverse transcriptase conditions using a 100% m6A-modified RNA oligo. Eleven reverse transcriptase enzymes- 63 -299224109.1(maxima H- RT; SSIII RT; SSIV RT; SSII RT; RevertAid RT; AMW RT; WarmStart RTx; Bst 2.0; MMLv RT; HIV RT; and Marathon RT), with variable dTTP / dCTP ratios (1 : 1, 1 :40, or 1 :400), were used in sequencing library preparation. The data for a 100% m6A-modified oligo (SEQ ID NO: 21) is shown. The x-axis displays the actual modification levels, while the y-axis shows the unconverted ratio observed in sequencing data. The average signal on m6A site (green) and noise on A sites (red) is marked on each panel. A “100% m6A-modified oligo" refers to the proportion of oligos with an m6A site in proportion to oligos without an m6A site. That is, an RNA oligonucleotide (a) was synthesized by artificial solid-phase synthesis in which one base site was modified to m6A. Another RNA oligonucleotide (b) was synthesized with a sequence identical to (a), except that at position m6A relative to (a) the corresponding site in (b) was synthesized as adenine (A). In essence, (a) and (b) were identical oligos in sequence but (a) had at least one methylated adenine whereas (b) did not. Thus, mixing (a) and (b) in a 1 : 1 ratio would result in 50% m6A-modified oligos, while mixing (a) and (b) in a 1 :0 ratio would result in 100% m6A-modified oligos. The “x-axis displays the actual modification levels” refers to the location of a specific adenine (a) site(s) on the oligo relative to the sequence rUrArUrCrUrGrUrCrUrCrGrArCrGrUrNrN / iN6Me- rA / rNrNrGrGrCrGrArUrGrGrUrUrUrCrUrArGrArArUrUrArCrArCrCrArUrArArUrUrGrCr U (SEQ ID NO: 21). For example, m6A is displayed on the x-axis at the 18thposition of the SEQ ID NO: 21, and all other A sites were also depicted.

[0406] FIG. 16 | Elucidating efficacy of reverse transcriptase conditions using spikein oligo sequencing data. Eleven reverse transcriptase enzymes, with variable dTTP / dCTP ratios (1 : 1, 1 :40, or 1 :400), were used in sequencing library preparation. Libraries were spiked with 0.1% RNA oligonucleotides (SEQ ID NO: 21) at modification levels of 0%, 25%, 50%, 75%, and 100%. The x-axis displays the actual modification levels, while the y-axis shows the modification levels observed in sequencing data. The difference between observed and actual modification levels is indicated on each datapoint. Positive values indicated an overestimation of methylation levels, whereas negative values suggested underestimation. Background noise for the 0% oligonucleotide is highlighted in red.

[0407] FIG. 17 | Elucidating efficacy of reverse transcriptase conditions via human mRNA sequencing data. Eleven reverse transcriptase enzymes, combined with varying ratios of dTTP / dCTP (1 : 1, 1 :40, or 1 :400), were utilized to process human mRNA. The proportion of unconverted adenines (A) in GAC or AAC motifs was considered a true positive signal, while the frequency of unconverted As in UAG motifs and other motifs known for low methylation levels served as an approximate upper limit for false positive signals. Different motifs (A=16)- 64 -299224109.1were analyzed and represented in various colors. The table within the figure displays the average ratios of unconverted A sites in GAC and UAG motifs. The relative ratio between these values approximates the signal-to-noise ratio. An exemplary standout condition (#14, RevertedAid RT at a 1 :40 ratio) demonstrated a background noise level below 0.36%, with a signal-to-noise ratio reaching 15.9.

[0408] FIGs. 18A-18F | Comparison of deamination-based methods in m6A sequencing using rRNA. FIGs. 18A-18C Show the ratio for unconverted adenine (A) sites with sequencing coverage exceeding 20 on nuclear ribosomal RNA (nuc-rRNA), distinguishing sites modified by m6A (green), nfA (blue), m6>6A (orange), and other A sites (red) for eTAM-seq (FIG. 18A), GLORI-seq (FIG. 18B), and CAM-seq (FIG. 18C). The x- axis represents rRNA unit locations, including the 18S, 5.8S, and 28S ribosomal RNA genes, while the y-axis depicts each site's unconverted ratio. Similarly, FIGs. 18D-18F depict the unconverted ratios for mitochondrial rRNA (mito-rRNA). The eTAM-seq (FIG. 18D) analysis involved reanalyzing poly A RNA from the FTO- sample replicate 1, sourced from GSE201064, utilizing the same pipeline as for CAM-seq (FIG. 18F). Likewise, for GLORI- seq (FIG. 18E), data from HEK293T was source from GSE210563.

[0409] FIG. 19 | Exemplary CAM-seq workflow. Fragmented RNAs were initially treated with kethoxal to protect guanine (yellow), which prevented caging by glyoxal during the subsequent deamination step. The protected RNA products then underwent treatment where adenine (blue) was catalyzed by a carbonyl organocatalyst to form N-nitroso-A, which subsequently transformed into hypoxanthine through diazotization and deamination. Following the deprotection of guanine, the RNA was purified and prepared for sequencing. Chemical conversion of adenine to guanine mutations was analyzed in sequencing reads to identify unchanged m6A sites. Protected G sites were marked byA.

[0410] FIGs. 20A-20D | Analysis of m6A sites in human sample across 16 motifs. FIG. 20A With a sequencing depth cutoff of >20 and p-value <0.001, a total of 331,399 m6A sites were identified in the HEK293T cell (human) transcriptome. Applying detection thresholds of >10% and >20% m6A levels resulted in 272,477 and 200,550 sites, respectively. The total adenine (A) sites with adequate sequencing coverage (>20) were denoted for each motif. The frequency distributions of m6A levels at these sites are presented in individual panels, with sites meeting the p-value threshold (p < 0.001) in black and those not meeting the threshold in gray. The number of detected m6A sites per motif is also indicated. FIG. 20B For tri -nucleotide motifs (e.g., GAC), average m6A levels and site counts were aggregated by their corresponding pentanucleotide motifs (e.g., GGACT, N=16), illustrating the relationship between m6A levels- 65 -299224109.1and site counts for these extended motifs. The total number of m6A sites for each motif is labeled. FIG. 20C A-sites with sufficient sequencing depth (> 20) were plotted relative to their positions within the exonic region of transcripts. This mapping showed the distribution bias of motifs (with or without m6A modifications) along the transcript, with motif abundance and proportions detailed for each panel. FIG. 20D The distribution density of m6A sites along transcripts is shown. The number and relative proportions of m6A sites within these regions are specified.

[0411] FIGs. 21A-21D | Analysis of m6A sites across 16 motifs in human sample prepared with select RT conditions. FIGs. 21A-21D Are similar to FIGs. 20A-20D, except the data are presented exclusively from RT condition #14 (RevertedAid RT, 1 :40 dTTP / dCTP ratio).

[0412] FIGs. 22A-22D | Analysis of m6A sites in Arabidopsis sample across 16 motifs. FIGs. 22A-22D Are similar to FIGs. 20A-20D, except data for Arabidopsis samples are shown.

[0413] FIGs. 23A-23D | Analysis of m6A sites in maize sample across 16 motifs. FIGs. 23A-23D Are similar to FIGs. 20A-20D, except data for maize samples are shown.

[0414] FIGs. 24A-24C| Saturation analysis of m6A sites and classification of m6A- modified genes by maximum modification level. FIG. 24A Saturation analysis by subsampling m6A sequencing data. Sites with - value < 0.001 were defined as high confidential m6A sites, and sites with additional 10% and 20% of m6A modification levels were shown as highly modified sites. FIG. 24B Distribution of m6A modification level of each m6A site from the HEK293T cell line. FIG. 24C Distribution of average m6A modification level of all the genes.

[0415] FIGs. 25A-25E | Screening of reaction conditions. FIG. 25A Is associated with Table 1 and is an example of standard reaction conditions comprising 1 (e.g., cytidine, 0.10 mmol, 1.0 equiv.), organocatalyst (e.g., formaldehyde, 1.0 equiv.), Lewis acid catalyst (e.g., Sc(OTf)3, 1.0 equiv.), and Sodium nitrite in DMSO (0.5 mL). FIG. 25B Is associated with Table 2 and is an example of reaction conditions for screening Lewis acids; shown are standard conditions comprising 1 (e.g., cytidine, 0.10 mmol, 1.0 equiv.), organocatalyst (e.g., formaldehyde, 0.1 mmol, 1.0 equiv.), Lewis acid catalyst (0.1 mmol, 1.0 equiv.), and sodium nitrite (2.0 equiv.) in DMSO (0.5 mL). FIG. 25C Is associated with Table 3 and is an example of reaction conditions for screening organocatalysts; shown are standard conditions: 1 (e.g., cytidine, 0.10 mmol, 1.0 equiv.), organocatalyst (0.1 mmol, 1.0 equiv.), Lewis acid catalyst (e.g., BF3*Et2O, 0.1 mmol, 1.0 equiv.), and sodium nitrite (2.0 equiv.) in DMSO (0.5 mL). FIG. 25D Is associated with Table 3 and displays the chemical structures of exemplary- 66 -299224109.1organocatalysts. FIG. 25E Is associated with Table 4 and displays the chemical structures of exemplary organocatalysts.

[0416] FIGs. 26A-26E | Nuclear magnetic resonance (NMR) elucidation of reactions, procedures, and detection of side products. FIG. 26A Provides a general procedure schematic outlining exemplary ^-methylcytidine deamination side product detection. FIG. 26B Provides a general procedure schematic outlining exemplary / U-methyladenosine deamination side product detection. FIG. 26C Provides a schematic outlining exemplary cytidine analog deamination reactions. FIG. 26D Provides a schematic outlining exemplary adenosine analog deamination reactions. FIG. 26E Provides a schematic outlining exemplary guanosine analog deamination reactions.

[0417] FIGs. 27A-27Y | Compound structures that underwent nuclear magnetic resonance (NMR) isolation and characterization. FIG. 27A Uridine (2). FIG. 27B 3- Methyluridine (3). FIG. 27C 6-Azauridine (4). FIG. 27D Pseudouridine (5). FIG. 27E 2’Deoxyluridine (6). FIG. 27F 5-Fluoro-2’-deoxyluridine (7). FIG. 27G, 5-Methyl-2’- deoxyluridine (8). FIG. 27H 5-Hydroxymethyl-2’-deoxyluridine (9). FIG. 271 5-formyl-2'- deoxyuridine (10). FIG. 27J 5-Carboxyuracil (11). FIG. 27K Inosine (12). FIG. 27L 1- Methylinosine (13). FIG. 27M Xanthosine (14). FIG. 27N 2'-Deoxyinosine (15). FIG. 270 3 '-deoxyinosine (16). FIG. 27P 9-(4-ASScetoxy-3 -acetoxymethylbutyl)- 2-hydroxypurine (17). FIG. 27Q 9-Methylhypoxanthine (18). FIG. 27R l-Methyl-l,5-dihydro-pyrazolo[3,4- d]pyrimidin-4-one (19). FIG. 27S 3-Methyl-3H-[l,2,3]triazolo[4,5-d]pyrimidine-7(6H)-one (20). FIG. 27T 3 -Methylhypoxanthine (21). FIG. 27U 2'-Deoxyxanthosine (22). FIG. 27V Uric acid (23). FIG. 27W Paraxanthine (24). FIG. 27X Theobromine (25). FIG. 27Y Caffeine (26).DETAILED DESCRIPTION

[0418] Aspects of the present disclosure relate to compositions, methods, and kits for detection and analysis of modified nucleobases (e.g., DNA and / or RNA modifications), such as, but not necessarily limited to, methylated DNA and / or methylated RNA. Disclosed herein are compositions and methods suitable for facilitating detection of modified nucleobases, particularly nucleobases that comprise a modified nitrogen-comprising pendant group (for example but not limited to, alkylation, such as methylation, or other substitution, of the free amine comprising pendant group; for example but not limited to m6A / 6mA, m4C / 4mC, m2G / m22G / 2mG / 22mG, m6,6A, i6A, and / or m4,4C), by selectively deaminating nucleobases comprising a free amino group, such as unmodified nucleobases and / or analogues thereof. As- 67 -299224109.1described herein, aspects of the present disclosure relate at least in part to methods and / or compositions for facilitating detection of a modified nucleobase by selectively deaminating nucleobases with a free amine in the pendant group (“deaminated nucleobases”), while nucleobases with a modified nitrogen-comprising pendant group are not deaminated. In some aspects, a protein, such as a polymerase, will recognize a deaminated nucleobase differently than what it would be for the equivalent non-deaminated nucleobase, thereby allowing differentiation of modified and unmodified nucleobases using single-base detection methods, such as sequencing. For example, adenine is recognized as adenine by a polymerase, but deaminated adenine (inosine) is recognized as a guanine.

[0419] In some aspects, nucleobases that comprise a free amine in a pendant group may be protected from deamination through caging and / or modification of the nitrogen-comprising pendant group, and this protection may be nucleobase selective based on the specificity of the protective agent utilized. In some aspects, a first modified nucleobase that does not comprise a modified nitrogen-comprising pendant group, such as 5mC or m5C, may be identified by selectively converting unmodified nucleobases or a second modified nucleobase, which comprises a modification different than the first modified nucleobase, to a nucleobase comprising a modified nitrogen-comprising pendant group; the first modified nucleobase remains capable of deamination, whereas all the other converted nucleobases are not, allowing differentiation of the first modified nucleobase from all other modified or unmodified nucleobases using single-base detection methods, such as sequencing.

[0420] Deamination, a fundamental organic chemistry and biochemistry reaction process, has been extensively researched for decades. Traditional chemical methods of deamination rely on aryldiazonium salts under harsh acidic conditions, which notably limit the application scope to most biological substrates. Here, the inventors present a novel -nitrosation strategy for deamination capable of tolerating DNA / RNA biological macromolecules under mild conditions, a cooperative catalysis combining a carbonyl organocatalyst with a Lewis acid cocatalyst to facilitate the formation of a C-nitro intermediate from a primary amine, which, upon rearrangement into -nitrosamine, leads to selective deamination of canonical DNA / RNA bases (and in some aspects, their analogues) under mild conditions.

[0421] As described herein, in some aspects, the inventors have utilized this new approach for deamination of canonical nucleobases, such as A, C, and / or G, or analogues thereof (e.g., such as but not limited those depicted in FIGs. 2A-2C). During nucleic acid replication and / or extension, deaminated nucleobases are “read” by polymerases as different bases than the original non-deaminated nucleobase, thereby creating a mutation in the complementary strand.- 68 -299224109.1In contrast, modified nucleobases, such as methylated nucleobases, remain non-deaminated or are only modified at very low ratios and are read by polymerases as the original nondeaminated nucleobase. Using this principle, the abundance of modified (e.g., methylated) and / or unmodified nucleobases can be quantified. Furthermore, using single-base detection methods, such as sequencing, the position and relative abundance of modified nucleobases can be accurately identified. In illustrative aspects, deamination of adenine into hypoxanthine (comprised in the nucleoside inosine), is read as guanine by reverse transcriptases or DNA polymerases, while 7V6-methyladenosine (m6A) sites resist deamination and remain identified as adenine.

[0422] Reported herein, in some aspects, are chemically mild, low-input detection methods for identification of nucleobase modifications, such as methylation of adenosine, cytidine, and / or guanosine, with sequencing at base resolution. This process has been named herein as Chemical cooperative catalysis- Assisted for methylome sequencing (CAM-seq). In illustrative aspects, as disclosed herein, exemplary m6A-CAM-seq can identify -200,000 m6A sites using as little as -10 ng of input mRNA, with background noise as low as 0.5%, allowing for precise quantification of m6A stoichiometry transcriptome wide.

[0423] In some aspects, also provided herein are methods, compositions, and kits, directed to identification of methylation of guanosines, adenosines, and / or cytidines in DNA and / or RNA. In some aspects, methods, compositions, and / or kits are specific and / or otherwise suitable for identification of 6mA in DNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m6A in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m6,6A in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of i6A in RNA. In some aspects, CAM- seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of ms2i5A in RNA. In some aspects, CAM-seq methods, compositions, and / or kits that are specific and / or otherwise suitable for identification of m6A and / or 6mA, and / or other A modifications, are referred to as CAMA-seq. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m4C in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m5C in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m4,4C in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of 4mC in DNA. In some aspects, CAM-seq methods,- 69 -299224109.1compositions, and / or kits are specific and / or otherwise suitable for identification of 5mC in DNA. In some aspects, CAM-seq methods, compositions, and / or kits that are specific and / or otherwise suitable for identification of m4C and / or m5C in RNA, 4mC and / or 5mC in DNA, and / or other C modifications, are referred to as CAMC-seq. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m2G in RNA. In some aspects, CAM-seq methods, compositions, and / or kits are specific and / or otherwise suitable for identification of m22G in RNA. In some aspects, CAM-seq methods, compositions, and / or kits that are specific and / or otherwise suitable for identification of m2G and / or m22G in RNA and / or other G modifications, are referred to as CAMG-seq.I. Nucleic Acid Processing Methods

[0424] Aspects of the present disclosure relate to compositions and methods for processing nucleic acids, such as DNA and / or RNA. Aspects of the present disclosure are directed to methods for modification of canonical nucleobases and / or their analogues (e.g., nonmethylated nucleobases). In some aspects, such methods comprise incubating one or more nucleic acids with reagents that selectively deaminate canonical nucleobases and / or their analogues (e.g., non-methylated nucleobases).

[0425] As discovered by the inventors and demonstrated herein, selective and highly efficient deamination of a nucleobase can be achieved using at least a carbonyl organocatalyst, a Lewis acid, and a nitrite source. As discovered by the inventors and demonstrated herein, and without wishing to be bound by theory, deamination of a nucleobase using one or more carbonyl organocatalyst and one or more Lewis acid first involves a carbon-catalyzed N- nitrosation of a nucleobase. In this reaction, a nucleobase and a carbonyl organocatalyst react to form a hemiaminal intermediate, a reaction that can be substantially accelerated by inclusion of a Lewis acid catalyst. Thereafter, dehydration produces an imine intermediate. An imine intermediate produced by a carbonyl-catalyzed N-nitrosation can be reacted with a nitrite ion for further diazotization and deamination. In this process, a nitrite ion interacts with the imine's LUMO to form a C-NO2 intermediate, which rearranges to form an N-NO bond, culminating in the formation of A-nitrosamine and the release of the organocatalyst and Lewis acid (see e.g., FIGs. 1C, 2D, and 3B). In the case of deamination of adenosine, this reaction produces inosine. As shown herein, the inventors have tested a multitude of conditions and reagent combinations to discover compositions and methods that can lead to selective, consistent, and fast deamination of select desired nucleobases without inducing significant nucleic acid damage (e.g., fragmentation). In some aspects, additional steps, such as protection (or caging)- 70 -299224109.1of specific nucleobases, are also performed to improve the selectivity of the deamination reaction.

[0426] Certain aspects of the present disclosure are directed to methods for selective deamination of cytosine, cytidine, adenine, adenosine, guanosine, and / or guanine through a deamination reaction. In certain aspects, a deamination reaction comprises N-nitrosation, diazotization, and / or deamination. In certain aspects, a deamination reaction comprises N- nitrosation, followed by diazotization, itself followed by deamination. In some aspects, a deamination reaction comprise incubating a nucleic acid molecule comprising a modified and / or canonical nucleobase, and / or a population of nucleic acid molecules comprising a modified and / or canonical nucleobase with a composition of the disclosure.

[0427] In some aspects, a composition of the disclosure comprises one or more carbonyl organocatalysts, one or more Lewis acids, one or more sources of nitrite ions, one or more caging agents, one or more buffers, one or more solvents, or a combination thereof. In some aspects, a deaminated nucleobase is generated after treatment of a canonical nucleobase with one or more carbonyl organocatalysts, one or more Lewis acids, one or more sources of nitrite ions, one or more caging agents, one or more buffers, one or more solvents, or a combination thereof. Particular aspects relate to compositions comprising a carbonyl organocatalyst, a Lewis acid, a nitrite ion source, and optionally a caging agent, or a combination thereof and methods for use of such compositions in deamination of a nucleic acid, including nucleobase specific deamination (e.g., adenosine and / or adenosine analogue specific, cytidine and / or cytidine analogue specific, or guanosine and / or guanosine analogue specific deamination). In some aspects, more than one carbonyl organocatalyst, more than one Lewis acid, more than one nitrite ion source, and / or more than one caging agent may be utilized in a deamination reaction. Accordingly, disclosed herein, in some aspects, are methods for processing of a nucleic acid comprise incubating a solution comprising a nucleic acid molecule and a carbonyl organocatalyst, a Lewis acid, a nitrite ion source, a caging agent, or a combination thereof under conditions sufficient to deaminate a nucleobase, such as cytosine, adenine, and / or guanine, of the nucleic acid molecule. Such methods may comprise subjecting the nucleic acid molecule to neutral and / or slightly acidic pH conditions during the deamination reaction. These relatively mild pH conditions reduce the degradation of biomacromolecules compared to other methods known in the art that require stringent conditions, such as acidic conditions. Methods may comprise subjecting nucleic acid molecules to only slightly acidic, nearly neutral, or slightly basic pH conditions, which reduces the degradation of biomacromolecules compared to other methods known in the art that require stringent, such as acidic, conditions. As disclosed- 71 -299224109.1herein, incubating a nucleic acid molecule in illustrative deamination conditions described herein results in extremely rapid and selective deamination of nucleobases with low degradation of the nucleic acid molecule while preserving modified nucleobases (e.g., methylated nucleobases), and thus facilitating identification of modified nucleobases with very low false positive rates and / or very high signal-to-noise ratio. In some aspects, nucleic acid processing methods of the disclosure include incubating a nucleic acid molecule in a deamination solution comprising, consisting of, or consisting essentially of a carbonyl organocatalyst, a Lewis acid, a source of nitrite ions, a caging agent, a buffer, a solvent, or a combination thereof.

[0428] In some aspects, one or more carbonyl organocatalysts may comprise, consist essentially of, or consist of formaldehyde, trifluoracetaldehyde, trifluoropyruvaldehyde, glyoxal, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, 8- formylquinoline, furfural, a compound of FIG. 25E as described in Table 4, or a combination thereof. In some aspects, a carbonyl organocatalyst may comprise, consist essentially of, or consist of glyoxal. In some aspects, glyoxal is used in a deamination reaction composition at a concentration of at least, of at most, or of about between 0.5 to 4 M. In some aspects, a carbonyl organocatalyst in a deamination reaction composition is comprised at a concentration of between about 0.5 M to 4.0 M. In some aspects, the concentration of a carbonyl organocatalyst is , is at least, is at most, or of about 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, 2.5 M,2.6 M, 2.7 M, 2.8 M, 2.9 M, 3.0 M, 3.1 M, 3.2 M, 3.3 M, 3.4 M, 3.5 M, 3.6 M, 3.7 M, 3.8 M, 3.9 M, or 4.0 M (or any range derivable therein). In some aspects, the concentration of a carbonyl organocatalyst in a deamination reaction composition is between about 0.1 eq. to 2.0 eq. In some aspects, a carbonyl organocatalyst in a deamination reaction composition is comprised at a concentration of at least, of at most, or of about 0.1 eq., 0.2 eq., 0.3 eq., 0.4 eq., 0.5 eq., 0.6 eq., 0.7 eq., 0.8 eq., 0.9 eq., 1.0 eq., 1.1 eq., 1.2 eq., 1.3 eq., 1.4 eq., 1.5 eq., 1.6 eq.,1.7 eq., 1.8 eq., 1.9 eq., 2.0 eq.

[0429] In some aspects, a Lewis acid can be metal-based, including main group metals like aluminum, early transition elements like scandium and titanium, late transition elements like iron and copper from the d-block, as well as non-metal-based acids containing boron and silicon. In some aspects, one or more Lewis acid co-catalyst(s) may comprise, consist essentially of, or consist of BF3 OEt2, H3BO3, Sc(OTF)3, LuCh, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2ASO2H, PhB(OH)2, MeB(OH)2, B(CeFs)3, or a combination thereof. In some- 72 -299224109.1aspects, the concentration of a Lewis acid in a deamination reaction composition is between about 0.1 eq. to 2.0 eq. In some aspects, the concentration of a Lewis acid in a deamination reaction is at least, of at most, or of about 0.1 eq., 0.2 eq., 0.3 eq., 0.4 eq., 0.5 eq., 0.6 eq., 0.7 eq., 0.8 eq., 0.9 eq., 1.0 eq., 1.1 eq., 1.2 eq., 1.3 eq., 1.4 eq., 1.5 eq., 1.6 eq., 1.7 eq., 1.8 eq., 1.9 eq., 2.0 eq (or any range derivable therein). In some aspects, a Lewis acid in a deamination reaction composition is provided at, or is comprised at, a concentration of at least, of at most, or of about 200-800 mM, 300-700 mM, 400-600 mM, or 500 mM, or any range derivable therein.

[0430] In some aspects, a source of a nitrite ion may comprise, consist essentially of, or consist of sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, tert-butyl nitrite, or a combination thereof. In some aspects, a source of a nitrite ion in a deamination reaction composition is comprised at a concentration between about 0.1 eq. to 2.0 eq. In some aspects, a source of a nitrite ion in a deamination reaction composition is comprised at a concentration of at least, of at most, or of about 0.1 eq., 0.2 eq., 0.3 eq., 0.4 eq., 0.5 eq., 0.6 eq., 0.7 eq., 0.8 eq., 0.9 eq., 1.0 eq., 1.1 eq., 1.2 eq., 1.3 eq., 1.4 eq., 1.5 eq., 1.6 eq., 1.7 eq., 1.8 eq., 1.9 eq., 2.0 eq. In some aspects, a source of a nitrite ion in a deamination reaction composition is comprised at a concentration of at least, of at most, or of about 0.1 M to 1.0 M. In some aspects, a source of a nitrite ion in a deamination reaction composition is comprised at a concentration of at least, of at most, or of about 0.1 M, 0.2 M, 0.3 M, 0.4 M, 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M. In some aspects, a source of a nitrite ion comprises a solution of saturated sodium nitrite at a concentration of at least, of at most, or of about 6.0 M to 9.0 M. In some aspects, a source of a nitrite ion comprises a solution of saturated sodium nitrite at a concentration of at least, of at most, or of about 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0 M, or any range or value derivable thereof. In some aspects, a source of a nitrite ion comprises a solution of saturated sodium nitrite at a concentration of at least, of at most, or of about 8.0 M.

[0431] In some aspects, one or more specific nucleobases in a nucleic acid are protected from nitrosation, diazotization, deamination, or a combination thereof via modification and / or caging of one or more nucleobase(s) with a modifying agent and / or a caging agent. As used herein, the term “caging agent(s)”, refers to compounds that act by forming reversible adducts with nucleophilic groups in biomolecules, which can be used for temporary modification or protection of these groups against other chemical reaction. In some aspects, a caging agent may be one that protects a specific nucleobase from deamination. Caging agents may include methylglyoxal, phenylglyoxal, a-keto aldehydes, kethoxal and / or kethoxal derivative. In some- 73 -299224109.1aspects, methylglyoxal, phenylglyoxal, a-keto aldehydes, kethoxal, and / or a kethoxal derivative, may be used to preferentially protect guanine. In some aspects, methylamine may be used to preferentially protect cytosine. In some aspects, a caging agent is kethoxal or a kethoxal derivative (e.g., Ns-kethoxal). As used herein, the term “modifying agent(s)”, refers to compounds that can protect a free amine in a nucleobase from deamination through modification thereof, such as but no limited to, alkylation thereof. In some aspects, nucleobases may be protected from deamination through modification of the nitrogen-comprising pendant group. In some aspects, a free amine in a nucleobase may be protected from deamination through modification of the nitrogen-comprising pendant group through treatment with a modifying agent, such as methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane. In some aspects, a modifying agent for protecting canonical cytosine from deamination excludes, comprises, consists essentially of, or consists of methylamine.

[0432] Kethoxal (l,l-dihydroxy-3-ethoxy-2-butanone), is known to react with guanines specifically at N1 and N2 position at the Watson-Crick interface (Shapiro et al., Biochemistry 8:238-45, 1969). A kethoxal may be Ns-kethoxal, which inherits the reactivity towards guanines from its parent molecule and contains an azido group that can act as a bio-orthogonal handle to be further functionalization. A kethoxal may be a derivative of kethoxal or s- kethoxal.FORMULA I: N3-KETHOXAL

[0433] Ns-kethoxal and / or derivatives (such as those disclosed in the inventors PCT international application PCT / US2019 / 031287, represented by publication WO 2019 / 217533 Al, which is incorporated herein by reference in its entirety) can react selectively with guanines of a nucleic acid, such as DNA and / or RNA. Ns-kethoxal is highly cell-permeable and can also react with DNA and RNA in living cells under mild normal cell culture condition or directly with tissues. Ns-kethoxal can also be efficiently applied to isolated nucleic acids, such as DNA and / or RNA. A kethoxal mediated nucleobase caging reaction can be optimized based on temperature, pH, concentration, reaction time, or a combination thereof. A nucleobase caging reaction can be optimized based on temperature, pH, concentration, reaction time, or a combination thereof. In some aspects, a kethoxal mediated nucleobase (e.g., guanosine) caging reaction proceeds for or for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,- 74 -299224109.120, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 minute(s), or longer, or any range or value derivable therein. In some aspects, a kethoxal mediated nucleobase caging reaction proceeds for or for about 30 minutes. In some aspects, a kethoxal mediated nucleobase caging reaction proceeds for or for about 32 minutes. In some aspects, a kethoxal mediated nucleobase caging reaction is performed at or at about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 °C, or any range derivable therein. In some aspects, a kethoxal mediated nucleobase caging reaction proceeds for 30 minutes at 37 °C . In some aspects, a kethoxal mediated nucleobase caging reaction first comprises incubation at 70 °C for 2 minutes, followed by incubation at 37 °C for 30 minutes. In some aspects, a kethoxal mediated nucleobase caging reaction is performed at a neutral or nearly neutral pH (e.g., a pH of about 6.51 to about 7.49 pH). In some aspects, a kethoxal mediated nucleobase caging reaction is performed at a pH of or of about 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, or 7.8. In some aspects, a kethoxal mediated nucleobase caging reaction is performed at a pH of or of about 7.4. In some aspects, a kethoxal mediated nucleobase caging reaction is performed at a pH of or of about 7.0. In some aspects, a nucleobase caging reaction proceeds for or for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 minute(s), or longer, or any range derivable therein. In some aspects, a nucleobase caging reaction proceeds for or for about 30 minutes. In some aspects, a nucleobase caging reaction proceeds for or for about 32 minutes. In some aspects, a nucleobase caging reaction is performed at or at about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 °C, or any range derivable therein. In some aspects, a nucleobase caging reaction proceeds for 30 minutes at 37 °C . In some aspects, a nucleobase caging reaction first comprises incubation at 70 °C for 2 minutes, followed by incubation at 37 °C for 30 minutes. In some aspects, a kethoxal caging reaction is performed at a neutral or nearly neutral pH (e.g., a pH of about 6.51 to about 7.49 pH). In some aspects, a nucleobase caging reaction is performed at a pH of or of about 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, or 7.8. In some aspects, a nucleobase caging reaction is performed at a pH of or of about 7.4. In some aspects, a nucleobase caging reaction is performed at a pH of or of about 7.0.

[0434] In some aspects, a composition for performing a nucleobase caging reaction comprises a caging agent (e.g., Ns-kethoxal), a nucleic acid, optionally an input nucleic acid (e.g., an internal control), a buffer, nuclease-free water, or a combination thereof. In some- 75 -299224109.1aspects, a nucleic acid concentration comprises between or between about 0.1 to 10 ng, or 0.1 to 100 ng. In some aspects, a nucleic acid is DNA or RNA. In some aspects, an input nucleic acid is included to estimate background noise and may be modified at know sites. In some aspects, an input nucleic acid is not included. In some aspects, a caging agent in a deamination reaction is provided at, or is comprised at, a concentration between about 10-500 pM. In some aspects, a caging agent in a deamination reaction is provided at, or is comprised at, a concentration of at least, of at most, or of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 pM, or any range derivable therein. In some aspects, a caging agent in a deamination reaction is provided at, or is comprised at, a concentration between about 0.1 eq. to 2.0 eq. In some aspects, a caging agent in a deamination reaction is provided at, or is comprised at, a concentration of at least, of at most, or of about 0.1 eq., 0.2 eq., 0.3 eq., 0.4 eq., 0.5 eq., 0.6 eq., 0.7 eq., 0.8 eq., 0.9 eq., 1.0 eq., 1.1 eq., 1.2 eq., 1.3 eq., 1.4 eq., 1.5 eq., 1.6 eq., 1.7 eq., 1.8 eq., 1.9 eq., 2.0 eq. In some aspects, a buffer comprises between about 5% to about 50% of a total deamination reaction composition volume. In some aspects, the a buffer comprises or comprises about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%,19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%,35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,51%, 52%, 53%, 54%, 55% of the total deamination reaction composition volume. In some aspects, a caging agent, such as Ns-kethoxal, is used at a final concentration of between about 10-500 pM. In some aspects, a caging agent, such as Ns-kethoxal, is used at a final concentration of at least, of at most, or of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 pM. In some aspects, a caging agent, such as Ns-kethoxal, is used at a final concentration of at least, of at most, or of about 25 pM. In some aspects, a caging agent, such as Ns-kethoxal, is used at a final concentration of at least, of at most, or of about 500 pM. In some aspects, a caging reaction is optimized to selectively protect a cytosine, guanine, adenine, thymine, uracil, any analogues therein, or a combination thereof. In some aspects, a caging reaction is optimized to selectively protect a guanine. In some aspects, a caging reaction is optimized to selectively protect a cytosine, guanine, adenine, thymine, uracil, any analogues therein, or a combination thereof from N-nitrosation, diazotization, and / or deamination. In some aspects, a caging reaction is optimized to selectively protect a guanine from N-nitrosation, diazotization, and / or- 76 -299224109.1deamination. In some aspects, a caging reaction, such as a kethoxal reaction with a guanine, is performed in a suitable buffer. A buffer may include, for example, phosphate buffered saline (such as one consisting of 137 mM NaCl, 2.7 mM KC1, 8 mM Na2HPO4, and 2 mM KH2PO4) adjusted to a pH of or of about 6.5, 7.0, 7.5, or a range therein.

[0435] In some aspects, caging of a nucleobase with a caging agent can be reversed and / or made unstable under certain conditions, making the reaction reversible. In some aspects, a kethoxal-guanine adduct is unstable under alkaline conditions making the reaction reversible. In some aspects, a nucleic acid, such as DNA or RNA, is protected / caged by a caging agent (e.g., kethoxal, etc.) prior to nitrosation and / or deamination (e.g., as described herein utilizing a carbonyl organocatalyst, a Lewis acid, and a source of nitrite ions). Once a nucleic acid has been sufficiently deaminated, caging agent adducts (e.g., kethoxal adduct groups, etc.) may be removed by adding excessive nucleic acid monomers, such as nucleic acid triphosphates (NTPs), to trap dissociated caging agents and shift the equilibrium from caging agent-nucleic acid adducts to uncaged nucleic acids. In some aspects, once a nucleic acid has had its adenosines sufficiently deaminated, caging agent adducts (e.g., kethoxal adduct groups, etc.) may be removed by adding excessive guanine monomers, such as guanine triphosphates (GTPs), to trap dissociated Ns-kethoxal, which will shift the equilibrium from Ns-kethoxal- nucleic acid adducts to uncaged nucleic acids. In some aspects, reaction conditions, such as temperature, pH, concentration, and reaction time may be optimized to facilitate the removal of caging agents and / or caging agent-nucleic acid adducts from deaminated nucleic acids (i.e., deprotection). In some aspects, deprotection comprises incubating caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer for or for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 minutes, or any range derivable therein. In some aspects, deprotection comprises incubating caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer for or for about 5 minutes. In some aspects, deprotection comprises incubating caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer for or for about 8 minutes. In some aspects, deprotection comprises incubating caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer at 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 °C or any range derivable therein. In some aspects, deprotection comprises incubating the caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer at 94 °C. In some aspects, deprotection comprises incubating the caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer at a pH of or of about 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0, or any range derivable therein. In some- 77 -299224109.1aspects, deprotection comprises incubating the caging agent-nucleic acid adducts (e.g., kethoxal -nucleic acid adducts) in a deprotection buffer at a pH of or of about 7.0. In some aspects, a deprotection buffer comprises an NTP mix. In some aspects, a deprotection buffer comprises an NTP mix, a formamide and TEAA buffer, and nuclease-free water. In some aspects, an NTP mix excludes, comprises, consists essentially of, or consists of dNTPs. In some aspects, an NTP mix excludes, comprises, consists essentially of, or consists of rNTPs. In some aspects, an NTP mix comprises or comprises about 10 mM of each dATP, dGTP, dCTP, dTTP, or a combination thereof. In some aspects, an NTP mix comprises or comprises about 10 mM of each of rATP, rGTP, rCTP, rTTP, or a combination thereof. In some aspects a formamide and TEAA buffer comprise or comprises about 100 pL of formamide and 100 pL of TEAA buffer (IM, pH about 7.0). In some aspects, formamide may be substituted for Guanidine-HCl, GTP, GDP, GMP, or a combination thereof, or other similar agents. In some aspects, TEAA buffer may be substituted for Triethylammonium bicarbonate buffer, Tris-HCl, or other similar buffers.

[0436] In some aspects, the disclosed methods comprise incubating a nucleic acid molecule with a deamination reaction composition at a slightly acidic pH, a nearly neutral pH, or a slightly basic pH. In some aspects, the disclosed methods comprise incubating a nucleic acid molecule with a deamination reaction composition at a pH between 5.5 and 8.5. In some aspects, the disclosed methods comprise incubating a nucleic acid molecule with a deamination reaction composition at a pH of or of about 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, or 8.5, or any range or value derivable therein. In some aspects, the disclosed methods comprise incubating a nucleic acid molecule with a deamination reaction composition at a pH of or of about 6.51, 6.52, 6.53, 6.54, 6.55, 6.56, 6.57, 6.58, 6.59, 6.60, 6.61, 6.62, 6.63, 6.64, 6.65, 6.66, 6.67, 6.68, 6.69, 6.70, 6.71, 6.72, 6.73, 6.74, 6.75, 6.76,6.77, 6.78, 6.79, 6.80, 6.81, 6.82, 6.83, 6.84, 6.85, 6.86, 6.87, 6.88, 6.89, 6.90, 6.91, 6.92, 6.93,6.94, 6.95, 6.96, 6.97, 6.98, 6.99, 7.00, 7.01, 7.02, 7.03, 7.04, 7.05, 7.06, 7.07, 7.08, 7.09, 7.10,7.11, 7.12, 7.13, 7.14, 7.15, 7.16, 7.17, 7.18, 7.19, 7.20, 7.21, 7.22, 7.23, 7.24, 7.25, 7.26, 7.27,7.28, 7.29, 7.30, 7.31, 7.32, 7.33, 7.34, 7.35, 7.36, 7.37, 7.38, 7.39, 7.40, 7.41, 7.42, 7.43, 7.44,7.45, 7.46, 7.47, 7.48, or 7.49, or any range or value derivable therein. In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 5.5. In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 6.0. In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 6.4. In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 7.0.- 78 -299224109.1In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 7.4. In some aspects, a nucleic acid molecule is incubated with a deamination reaction composition at a pH of or of about 8.0.

[0437] In some aspects, a nucleic acid processing method comprises incubating a nucleic acid molecule in one or more deamination reaction compositions of the disclosure at a set temperature for a set period of time. In some aspects, the method comprises incubating a nucleic acid molecule in a deamination reaction composition at a temperature of, of at least, of at most, or about 20.0 °C, 20.1 °C, 20.2 °C, 20.3 °C, 20.4 °C, 20.5 °C, 20.6 °C, 20.7 °C, 20.8 °C, 20.9 °C, 21.0 °C, 21.1 °C, 21.2 °C, 21.3 °C, 21.4 °C, 21.5 °C, 21.6 °C, 21.7 °C, 21.8 °C,21.9 °C, 22.0 °C, 22.1 °C, 22.2 °C, 22.3 °C, 22.4 °C, 22.5 °C, 22.6 °C, 22.7 °C, 22.8 °C, 22.9°C, 23.0 °C, 23.1 °C, 23.2 °C, 23.3 °C, 23.4 °C, 23.5 °C, 23.6 °C, 23.7 °C, 23.8 °C, 23.9 °C, 24.0 °C, 24.1 °C, 24.2 °C, 24.3 °C, 24.4 °C, 24.5 °C, 24.6 °C, 24.7 °C, 24.8 °C, 24.9 °C, 25.0 °C, 25.1 °C, 25.2 °C, 25.3 °C, 25.4 °C, 25.5 °C, 25.6 °C, 25.7 °C, 25.8 °C, 25.9 °C, 26.0 °C,26.1 °C, 26.2 °C, 26.3 °C, 26.4 °C, 26.5 °C, 26.6 °C, 26.7 °C, 26.8 °C, 26.9 °C, 27.0 °C, 27.1 °C, 27.2 °C, 27.3 °C, 27.4 °C, 27.5 °C, 27.6 °C, 27.7 °C, 27.8 °C, 27.9 °C, 28.0 °C, 28.1 °C,28.2 °C, 28.3 °C, 28.4 °C, 28.5 °C, 28.6 °C, 28.7 °C, 28.8 °C, 28.9 °C, 29.0 °C, 29.1 °C, 29.2 °C, 29.3 °C, 29.4 °C, 29.5 °C, 29.6 °C, 29.7 °C, 29.8 °C, 29.9 °C, 30.0 °C, 30.1 °C, 30.2 °C,30.3 °C, 30.4 °C, 30.5 °C, 30.6 °C, 30.7 °C, 30.8 °C, 30.9 °C, 31.0 °C, 31.1 °C, 31.2 °C, 31.3 °C, 31.4 °C, 31.5 °C, 31.6 °C, 31.7 °C, 31.8 °C, 31.9 °C, 32.0 °C, 32.1 °C, 32.2 °C, 32.3 °C,32.4 °C, 32.5 °C, 32.6 °C, 32.7 °C, 32.8 °C, 32.9 °C, 33.0 °C, 33.1 °C, 33.2 °C, 33.3 °C, 33.4 °C, 33.5 °C, 33.6 °C, 33.7 °C, 33.8 °C, 33.9 °C, 34.0 °C, 34.1 °C, 34.2 °C, 34.3 °C, 34.4 °C,34.5 °C, 34.6 °C, 34.7 °C, 34.8 °C, 34.9 °C, 35.0 °C, 35.1 °C, 35.2 °C, 35.3 °C, 35.4 °C, 35.5 °C, 35.6 °C, 35.7 °C, 35.8 °C, 35.9 °C, 36.0 °C, 36.1 °C, 36.2 °C, 36.3 °C, 36.4 °C, 36.5 °C,36.6 °C, 36.7 °C, 36.8 °C, 36.9 °C, 37.0 °C, 37.1 °C, 37.2 °C, 37.3 °C, 37.4 °C, 37.5 °C, 37.6 °C, 37.7 °C, 37.8 °C, 37.9 °C, 38.0 °C, 38.1 °C, 38.2 °C, 38.3 °C, 38.4 °C, 38.5 °C, 38.6 °C,38.7 °C, 38.8 °C, 38.9 °C, 39.0 °C, 39.1 °C, 39.2 °C, 39.3 °C, 39.4 °C, 39.5 °C, 39.6 °C, 39.7 °C, 39.8 °C, 39.9 °C, 40.0 °C, 40.1 °C, 40.2 °C, 40.3 °C, 40.4 °C, 40.5 °C, 40.6 °C, 40.7 °C,40.8 °C, 40.9 °C, 41.0 °C, 41.1 °C, 41.2 °C, 41.3 °C, 41.4 °C, 41.5 °C, 41.6 °C, 41.7 °C, 41.8 °C, 41.9 °C, 42.0 °C, 42.1 °C, 42.2 °C, 42.3 °C, 42.4 °C, 42.5 °C, 42.6 °C, 42.7 °C, 42.8 °C,42.9 °C, 43.0 °C, 43.1 °C, 43.2 °C, 43.3 °C, 43.4 °C, 43.5 °C, 43.6 °C, 43.7 °C, 43.8 °C, 43.9 °C, 44.0 °C, 44.1 °C, 44.2 °C, 44.3 °C, 44.4 °C, 44.5 °C, 44.6 °C, 44.7 °C, 44.8 °C, 44.9 °C, 45.0 °C, 45.1 °C, 45.2 °C, 45.3 °C, 45.4 °C, 45.5 °C, 45.6 °C, 45.7 °C, 45.8 °C, 45.9 °C, 46.0 °C, 46.1 °C, 46.2 °C, 46.3 °C, 46.4 °C, 46.5 °C, 46.6 °C, 46.7 °C, 46.8 °C, 46.9 °C, 47.0 °C, 47.1 °C, 47.2 °C, 47.3 °C, 47.4 °C, 47.5 °C, 47.6 °C, 47.7 °C, 47.8 °C, 47.9 °C, 48.0 °C, 48.1- 79 -299224109.1°C, 48.2 °C, 48.3 °C, 48.4 °C, 48.5 °C, 48.6 °C, 48.7 °C, 48.8 °C, 48.9 °C, 49.0 °C, 49.1 °C,49.2 °C, 49.3 °C, 49.4 °C, 49.5 °C, 49.6 °C, 49.7 °C, 49.8 °C, 49.9 °C, 50.0 °C, 50.1 °C, 50.2 °C, 50.3 °C, 50.4 °C, 50.5 °C, 50.6 °C, 50.7 °C, 50.8 °C, 50.9 °C, 51.0 °C, 51.1 °C, 51.2 °C,51.3 °C, 51.4 °C, 51.5 °C, 51.6 °C, 51.7 °C, 51.8 °C, 51.9 °C, 52.0 °C, 52.1 °C, 52.2 °C, 52.3 °C, 52.4 °C, 52.5 °C, 52.6 °C, 52.7 °C, 52.8 °C, 52.9 °C, 53.0 °C, 53.1 °C, 53.2 °C, 53.3 °C,53.4 °C, 53.5 °C, 53.6 °C, 53.7 °C, 53.8 °C, 53.9 °C, 54.0 °C, 54.1 °C, 54.2 °C, 54.3 °C, 54.4 °C, 54.5 °C, 54.6 °C, 54.7 °C, 54.8 °C, 54.9 °C, 55.0 °C, 55.1 °C, 55.2 °C, 55.3 °C, 55.4 °C,55.5 °C, 55.6 °C, 55.7 °C, 55.8 °C, 55.9 °C, 56.0 °C, 56.1 °C, 56.2 °C, 56.3 °C, 56.4 °C, 56.5 °C, 56.6 °C, 56.7 °C, 56.8 °C, 56.9 °C, 57.0 °C, 57.1 °C, 57.2 °C, 57.3 °C, 57.4 °C, 57.5 °C,57.6 °C, 57.7 °C, 57.8 °C, 57.9 °C, 58.0 °C, 58.1 °C, 58.2 °C, 58.3 °C, 58.4 °C, 58.5 °C, 58.6 °C, 58.2 °C, 58.3 °C, 58.4 °C, 58.5 °C, 58.6 °C, 58.7 °C, 58.8 °C, 58.9 °C, 59.0 °C, 59.1 °C,59.2 °C, 59.3 °C, 59.4 °C, 59.5 °C, 59.6 °C, 59.7 °C, 59.8 °C, 59.9 °C, 60.0 °C, 60.1 °C, 60.2 °C, 60.3 °C, 60.4 °C, 60.5 °C, 60.6 °C, 60.7 °C, 60.8 °C, 60.9 °C, 61.0 °C, 61.1 °C, 61.2 °C,61.3 °C, 61.4 °C, 61.5 °C, 61.6 °C, 61.7 °C, 61.8 °C, 61.9 °C, 62.0 °C, 62.1 °C, 62.2 °C, 62.3°C, 62.4 °C, 62.5 °C, 62.6 °C, 62.7 °C, 62.8 °C, 62.9 °C, 63.0 °C, 63.1 °C, 63.2 °C, 63.3 °C,63.4 °C, 63.5 °C, 63.6 °C, 63.7 °C, 63.8 °C, 63.9 °C, 64.0 °C, 64.1 °C, 64.2 °C, 64.3 °C, 64.4°C, 64.5 °C, 64.6 °C, 64.7 °C, 64.8 °C, 64.9 °C, 65.0 °C, 65.1 °C, 65.2 °C, 65.3 °C, 65.4 °C,65.5 °C, 65.6 °C, 65.7 °C, 65.8 °C, 65.9 °C, 66.0 °C, 66.1 °C, 66.2 °C, 66.3 °C, 66.4 °C, 66.5 °C, 66.6 °C, 66.7 °C, 66.8 °C, 66.9 °C, 67.0 °C, 67.1 °C, 67.2 °C, 67.3 °C, 67.4 °C, 67.5 °C,67.6 °C, 67.7 °C, 67.8 °C, 67.9 °C, 68.0 °C, 68.1 °C, 68.2 °C, 68.3 °C, 68.4 °C, 68.5 °C, 68.6 °C, 68.7 °C, 68.8 °C, 68.9 °C, 69.0 °C, 69.1 °C, 69.2 °C, 69.3 °C, 69.4 °C, 69.5 °C, 69.6 °C,69.7 °C, 69.8 °C, 69.9 °C, 70.0 °C, 70.1 °C, 70.2 °C, 70.3 °C, 70.4 °C, 70.5 °C, 70.6 °C, 70.7°C, 70.8 °C, 70.9 °C, 71 °C, 71.1 °C, 71.2 °C, 71.3 °C, 71.4 °C, 71.5 °C, 71.6 °C, 71.7 °C, 71.8°C, 71.9 °C, 72 °C, 72.1 °C, 72.2 °C, 72.3 °C, 72.4 °C, 72.5 °C, 72.6 °C, 72.7 °C, 72.8 °C, 72.9°C, 73 °C, 73.1 °C, 73.2 °C, 73.3 °C, 73.4 °C, 73.5 °C, 73.6 °C, 73.7 °C, 73.8 °C, 73.9 °C, 74°C, 74.1 °C, 74.2 °C, 74.3 °C, 74.4 °C, 74.5 °C, 74.6 °C, 74.7 °C, 74.8 °C, 74.9 °C, 75 °C, 75.1°C, 75.2 °C, 75.3 °C, 75.4 °C, 75.5 °C, 75.6 °C, 75.7 °C, 75.8 °C, 75.9 °C, 76 °C, 76.1 °C, 76.2°C, 76.3 °C, 76.4 °C, 76.5 °C, 76.6 °C, 76.7 °C, 76.8 °C, 76.9 °C, 77 °C, 77.1 °C, 77.2 °C, 77.3°C, 77.4 °C, 77.5 °C, 77.6 °C, 77.7 °C, 77.8 °C, 77.9 °C, 78 °C, 78.1 °C, 78.2 °C, 78.3 °C, 78.4°C, 78.5 °C, 78.6 °C, 78.7 °C, 78.8 °C, 78.9 °C, 79 °C, 79.1 °C, 79.2 °C, 79.3 °C, 79.4 °C, 79.5°C, 79.6 °C, 79.7 °C, 79.8 °C, 79.9 °C, 80 °C, 80.1 °C, 80.2 °C, 80.3 °C, 80.4 °C, 80.5 °C, 80.6°C, 80.7 °C, 80.8 °C, 80.9 °C, 81 °C, 81.1 °C, 81.2 °C, 81.3 °C, 81.4 °C, 81.5 °C, 81.6 °C, 81.7°C, 81.8 °C, 81.9 °C, 82 °C, 82.1 °C, 82.2 °C, 82.3 °C, 82.4 °C, 82.5 °C, 82.6 °C, 82.7 °C, 82.8°C, 82.9 °C, 83 °C, 83.1 °C, 83.2 °C, 83.3 °C, 83.4 °C, 83.5 °C, 83.6 °C, 83.7 °C, 83.8 °C, 83.9- 80 -299224109.1°C, 84 °C, 84.1 °C, 84.2 °C, 84.3 °C, 84.4 °C, 84.5 °C, 84.6 °C, 84.7 °C, 84.8 °C, 84.9 °C, 85 °C, 85.1 °C, 85.2 °C, 85.3 °C, 85.4 °C, 85.5 °C, 85.6 °C, 85.7 °C, 85.8 °C, 85.9 °C, 86 °C, 86.1 °C, 86.2 °C, 86.3 °C, 86.4 °C, 86.5 °C, 86.6 °C, 86.7 °C, 86.8 °C, 86.9 °C, 87 °C, 87.1 °C, 87.2 °C, 87.3 °C, 87.4 °C, 87.5 °C, 87.6 °C, 87.7 °C, 87.8 °C, 87.9 °C, 88 °C, 88.1 °C, 88.2 °C, 88.3 °C, 88.4 °C, 88.5 °C, 88.6 °C, 88.7 °C, 88.8 °C, 88.9 °C, 89 °C, 89.1 °C, 89.2 °C, 89.3 °C, 89.4 °C, 89.5 °C, 89.6 °C, 89.7 °C, 89.8 °C, 89.9 °C, 90 °C, 90.1 °C, 90.2 °C, 90.3 °C, 90.4 °C, 90.5 °C, 90.6 °C, 90.7 °C, 90.8 °C, 90.9 °C, 91 °C, 91.1 °C, 91.2 °C, 91.3 °C, 91.4 °C, 91.5 °C, 91.6 °C, 91.7 °C, 91.8 °C, 91.9 °C, 92 °C, 92.1 °C, 92.2 °C, 92.3 °C, 92.4 °C, 92.5 °C, 92.6 °C, 92.7 °C, 92.8 °C, 92.9 °C, 93 °C, 93.1 °C, 93.2 °C, 93.3 °C, 93.4 °C, 93.5 °C, 93.6 °C, 93.7 °C, 93.8 °C, 93.9 °C, 94 °C, 94.1 °C, 94.2 °C, 94.3 °C, 94.4 °C, 94.5 °C, 94.6 °C, 94.7 °C, 94.8 °C, 94.9 °C, 95 °C, 95.1 °C, 95.2 °C, 95.3 °C, 95.4 °C, 95.5 °C, 95.6 °C, 95.7 °C, 95.8 °C, 95.9 °C, 96 °C, 96.1 °C, 96.2 °C, 96.3 °C, 96.4 °C, 96.5 °C, 96.6 °C, 96.7 °C, 96.8 °C, 96.9 °C, 97 °C, 97.1°C, 97.2 °C, 97.3 °C, 97.4 °C, 97.5 °C, 97.6 °C, 97.7 °C, 97.8 °C, 97.9 °C, 98 °C, 98.1 °C, 98.2°C, 98.3 °C, 98.4 °C, 98.5 °C, 98.6 °C, 98.7 °C, 98.8 °C, 98.9 °C, 99 °C, 99.1 °C, 99.2 °C, 99.3°C, 99.4 °C, 99.5 °C, 99.6 °C, 99.7 °C, 99.8 °C, 99.9 °C (or any range or value derivable therein) for at most or about 600, 570, 540, 510, 480, 450, 420, 390, 360, 330, 300, 270, 240, 210, 180, 150, 120, 90, 75, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 44, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14.9, 14.8, 14.7, 14.6, 14.5, 14.4, 14.3, 14.2, 14.1, 14, 13.9, 13.8, 13.7, 13.6,13.5, 13.4, 13.3, 13.2, 13.1, 13, 12.9, 12.8, 12.7, 12.6, 12.5, 12.4, 12.3, 12.2, 12.1, 12, 11.9,11.8, 11.7, 11.6, 11.5, 11.4, 11.3, 11.2, 11.1, 11, 10.9, 10.8, 10.7, 10.6, 10.5, 10.4, 10.3, 10.2, 10.1, 10, 9.9, 9.8, 9.7, 9.6, 9.5, 9.4, 9.3, 9.2, 9.1, 9, 8.9, 8.8, 8.7, 8.6, 8.5, 8.4, 8.3, 8.2, 8.1, 8,7.9, 7.8, 7.7, 7.6, 7.5, 7.4, 7.3, 7.2, 7.1, 7, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6, 5.9, 5.8,5.7, 5.6, 5.5, 5.4, 5.3, 5.2, 5.1, 5, 4.9, 4.8, 4.7, 4.6, 4.5, 4.4, 4.3, 4.2, 4.1, 4, 3.9, 3.8, 3.7, 3.6,3.5, 3.4, 3.3, 3.2, 3.1, 3, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4,1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 minutes (or any range or value derivable therein). Any combination of the preceding incubation times and temperatures may be used in a nucleic acid processing method of the present disclosure. In some aspects, methods disclosed herein comprise incubating a nucleic acid in a deamination reaction composition at about 10-40 °C, about 15-35 °C, or about 20-30 °C. In some aspects, methods disclosed herein comprise incubating a nucleic acid in a deamination reaction composition for less than about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0.5 hours. Any combination of the preceding incubation times and temperatures may be expressly excluded from a nucleic acid processing method of the present disclosure.- 81 -299224109.1

[0438] In some aspects, a nucleic acid processing method comprises incubating a nucleic acid molecule in a deamination reaction solution of the disclosure at a temperature: of or of about 70 °C for, or for about or for at most 2 minutes; of or of about 37 °C for, or for about, or for at most 5 minutes; 18 °C for, or for about, or for at most 30 minutes; of or of about 4 °C for, or for about, or for at least 120 minutes; of or of about 94 °C for, or for about, or for at most 5 minutes; of or of about 95 °C for, or for about, or for at most 2 minutes; of or of about 37 °C for, or for about, or for at most 30 minutes; of or of about 50 °C for, or for about, or for at most 30 minutes; of or of about 25 °C for, or for about, or for at most 5 minutes; of or of about 26 °C for, or for about, or for at most 5 minutes; of or of about 27 °C for, or for about, or for at most 5 minutes; of or of about 28 °C for, or for about, or for at most 5 minutes; of or of about 29 °C for, or for about, or for at most 5 minutes; of or of about 30 °C for, or for about, or for at most 5 minutes; of or of about 31 °C for, or for about, or for at most 5 minutes; of or of about 32 °C for, or for about, or for at most 5 minutes; of or of about 33 °C for, or for about, or for at most 5 minutes; of or of about 34 °C for, or for about, or for at most 5 minutes; of or of about 35 °C for, or for about, or for at most 5 minutes; of or of about 36 °C for, or for about, or for at most 5 minutes; of or of about 37 °C for, or for about, or for at most 5 minutes; of or of about 38 °C for, or for about, or for at most 5 minutes; of or of about 39 °C for, or for about, or for at most 5 minutes; of or of about 40 °C for, or for about, or for at most 5 minutes; of or of about 41 °C for, or for about, or for at most 5 minutes; of or of about 42 °C for, or for about, or for at most 5 minutes; of or of about 43 °C for, or for about, or for at most 5 minutes; of or of about 44 °C for, or for about, or for at most 5 minutes; of or of about 45 °C for, or for about, or for at most 5 minutes; of or of about 46 °C for, or for about, or for at most 5 minutes; of or of about 47 °C for, or for about, or for at most 5 minutes; of or of about 48 °C for, or for about, or for at most 5 minutes; of or of about 49 °C for, or for about, or for at most 5 minutes; of or of about 50 °C for, or for about, or for at most 5 minutes; or of or of about 94 °C for, or for about, or for at most 8 minutes.

[0439] In some aspects, methods provided herein facilitate conversion of a canonical nucleobase and / or analogues thereof to a deaminated nucleobase at greater rate relative to methods currently known in the art. In some aspects methods provided herein quantitatively deaminates a canonical nucleobase and / or analogues thereof. In some aspects, methods provided herein facilitate deamination of canonical nucleobases and / or analogues thereof at an efficiency of greater than about or equal to about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any range derivable therein. In some aspects, canonical cytidine and its analogues- 82 -299224109.1are deaminated at an efficiency of greater than about or equal to about 80% to 100%. In some aspects, canonical cytidine and its analogues are deaminated at an efficiency of greater than about or equal to about 82%, 87%, or 91%. In some aspects, canonical adenosine and its analogues are deaminated at an efficiency of greater than about or equal to about 80% to 100%. In some aspects, canonical adenosine and its analogues are deaminated at an efficiency of greater than about or equal to about 82%, 86%, or 99%. In some aspects, canonical guanosine and its analogues are deaminated at an efficiency of greater than about or equal to about 80% to 100%. In some aspects, unmodified guanosine and its analogues are deaminated at an efficiency of greater than about or equal to about 44%.

[0440] In some aspects, the deaminated nucleobase is cytosine, cytidine, adenine, adenosine, guanosine, and / or guanine. In some aspects, a deaminated nucleobase is not 6mA, 4mC, 5mC, m6A, m4C, m5C, m2G, and / or m22G. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of 5-methylcytosine in a nucleic acid, such as DNA (5mC). Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of 5-methylcytidine in a nucleic acid, such as RNA (m5C). Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N6-methyladenine (6mA) in a nucleic acid, such as DNA. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N6-Methyladenosine (m6A) in a nucleic acid, such as RNA. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N4-methylcytosine (4mC) in a nucleic acid, such as DNA. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N4-m ethylcytidine (m4C) in a nucleic acid, such as RNA. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N2-methylguanosine (m2G) in a nucleic acid, such as RNA. Some aspects of the present disclosure relate to compositions and methods for detection, quantification, and analysis of N2,N2-dimethylguanosine (m22G) in a nucleic acid, such as RNA. Accordingly, disclosed herein, in certain aspects, are methods for analysis of at least DNA 6mA, DNA 4mC, DNA 5mC, RNA m6A, RNA m4C, RNA m5C, RNA m2G, and / or RNA m22G comprising incubating a nucleic acid molecule in a composition of the disclosure (e.g., a solution comprising a carbonyl organocatalyst, and a co-catalyst Lewis acid) under sufficient conditions, followed by subjecting the nucleic acid molecule to a nitrite ion source, thereby deaminating a canonical nucleobase that causes a mutation upon amplification and / or detection, e.g., C-to-U mutation. A deaminated nucleic acid produced according to methods of- 83 -299224109.1the disclosure may be subjected to sequencing and the sequences compared to identify at least 6mA, 4mC, and / or 5mC residues from the original DNA molecule(s), and / or m6A, m4C, m5C, m2G, and / or RNA m22G residues from the original RNA molecule(s).

[0441] In some aspects, varied specific deamination efficiencies of A, C, and / or G are tunable through employing different carbonyl organocatalyst co-catalysts, Lewis acids, source of nitrite ions, and / or caging agents, optionally at varied temperatures, pH, and / or incubation times. Any combination of carbonyl organocatalyst co-catalysts, Lewis acids, source of nitrite ions, caging agents, concentrations, temperatures, pH, and incubation times disclosed herein is contemplated.II. Assay MethodsA. Detection and analysis of modified nucleic acids

[0442] Aspects of the methods include assaying nucleic acids to determine nucleobase modification levels, expression levels, and / or methylation levels of nucleic acids (e.g., DNA, RNA). Certain illustrative methods for detection and analysis of methylated nucleobases are described herein.

[0443] Further aspects of the disclosure are directed to methods for detection and / or quantification of modified and / or canonical nucleobases. Such methods may include, for example, determining the position of a modified or canonical nucleobase in a nucleic acid molecule and quantifying the amount of modified or canonical nucleobases in a population of nucleic acid molecules. Various types of nucleic acid molecules are known in the art and contemplated herein including, for example, DNA, cDNA, ssDNA, dsDNA, B-DNA, A-DNA, Z-DNA, mtDNA, circular DNA, plasmid DNA, recombinant DNA, RNA, mRNA, tRNA, rRNA, snRNA, miRNA, siRNA, piRNA, and IncRNA. In some aspects, the disclosed methods comprise generating a modified nucleobase in an RNA molecule, followed by subjecting the RNA molecule to reverse transcription. As disclosed herein, reverse transcription of an RNA molecule comprising a modified nucleobase (e.g., a deaminated adenosine) may result in a mutation in the resulting complementary DNA molecule. The mutation may be a one nucleotide mutation, where the one nucleotide corresponds to the modified nucleobase in the original RNA molecule. The mutation may be a mutation of two or more nucleobases, where the mutations correspond to the modified nucleobases in the original RNA molecule. In some aspects, the disclosed methods comprise generating a modified nucleobase in a DNA molecule, followed by subjecting the DNA molecule to amplification. As disclosed herein, amplification of a DNA molecule comprising a modified nucleobase (e.g., a deaminated adenine) may result- 84 -299224109.1in a mutation in the resulting complementary DNA molecule. The mutation may be a one nucleotide mutation, where the one nucleotide corresponds to the modified nucleobase in the original DNA molecule. The mutation may be a mutation of two or more nucleobases, where the mutations correspond to the modified nucleobases in the original DNA molecule.

[0444] Further aspects of the disclosure are directed to methods for detection and / or quantification of a modified or canonical nucleobase in an RNA and / or DNA molecule. Such methods may include, for example, determining the position of a modified or canonical nucleobase in an RNA or DNA molecule and quantifying the amount of modified or canonical nucleobases in a population of RNA molecules or DNA molecules. In some aspects, the disclosed methods comprise deaminating a canonical nucleobase, amplifying a nucleic acid comprising a deaminated nucleobase, and sequencing the amplified nucleic acid. Nucleic acid processing methods of the disclosure may be useful in, at least for example, preparing nucleic acid molecules for sequencing in order to detect, quantify, and / or analyze nucleobase modifications, such as, but not limited to cytosine methylation, adenosine methylation, and / or guanine methylation. In some aspects, DNA processing methods of the disclosure provide nucleic acid molecules for sequencing analysis that result in a reduced level of false positives, increased level of true positives, reduced level of false negatives, and / or increased level of true negatives relative to current nucleic acid deamination methods known in the art. In some aspects, RNA processing methods of the disclosure provide nucleic acid molecules for sequencing analysis that result in a reduced level of false positives, increased level of true positives, reduced level of false negatives, and / or increased level of true negatives relative to current nucleic acid deamination methods known in the art.

[0445] In certain aspects, methods provided herein facilitate generation of deaminated nucleic acid for sequencing libraries using low and / or ultralow DNA inputs. In certain aspects, methods provided herein facilitate generation of sequencing libraries from deaminated nucleic acids using low and / or ultralow RNA inputs. In some aspects, methods provided herein reduce levels of background in assays comprising low and / or ultralow DNA inputs relative to canonical-deamination treatments. In some aspects, methods provided herein reduce levels of background in assays comprising low and / or ultralow RNA inputs relative to canonical- deamination treatments. In some aspects, methods provided herein reduce false positive rates by equal to about or greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,- 85 -299224109.183, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 fold, or any range derivable therein, when compared to canonical-deamination treatments. In some aspects, methods provided herein increase the rate of true positive detection by equal to about or greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent, or any range derivable therein, when compared to canonical-deamination treatments.

[0446] In some aspects, methods provided herein reduce the rate of unconverted A relative to canonical-deamination treatments. In some aspects, methods provided herein reduce the rate of unconverted A by equal to about or greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52,53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent, or any range derivable therein, when compared to canonical-deamination treatments. In some aspects, an A is converted to I by deamination treatments.

[0447] In some aspects, methods provided herein substantially reduce background noise from unmodified nucleobase sites during sequencing. In some aspects, methods provided herein produce background noise of unmodified nucleobase sites to lower than 0.5%. In some aspects, methods provided herein produce background noise of unmodified nucleobase sites about, or less than 0.1, 0.2, 0.3, 0.4 or 0.5%, or any range or value derivable therein. In some aspects, methods provided herein produce background noise of unmodified A-sites about, or less than 0.5%. In some aspects, methods provided herein produce background noise of unmodified A-sites about, or less than 0.1, 0.2, 0.3, 0.4 or 0.5%.

[0448] In some aspects, conventional methods known in the art for unmodified nucleobase deamination comprise use of harsh conditions, such as harsh acidic conditions. Such methods commonly used in RNA sequencing methods include, for example, NO-seq, NT-seq, eTAM- seq, and / or GLORI-seq. In some aspects, GLORI-seq and / or NO-seq, as commonly used, comprises incubation of nucleic acids at a harsh acidic pH. In some aspects, GLORI-seq and / or NO-seq, as commonly used, results in degradation proportions of nucleic acids as high as 70%. In some aspects, GLORI-seq and / or NO-seq, as commonly used, result in deamination proportions less than about 30%. In some aspects, GLORI-seq, as commonly used, comprises- 86 -299224109.13 steps of chemical reactions requiring a cumulative reaction time of about 10 hours. In some aspects, GLORI-seq, as commonly used, requires about 200 ng or more of starting material, such as DNA or RNA. In some aspects, GLORI-seq, as commonly used, produces a background level of about 2%. In some aspects, methods and / or compositions of the disclosure comprise deamination reactions at a slightly acidic, neutral, or nearly neutral pH reducing degradation of nucleic acids compared to other methods currently used in the art. In some aspects, methods of the disclosure comprise chemical reactions occurring at a pH of about 5.5- 6.0. In some aspects, methods of the disclosure may yield background levels less than about 0.5%. In some aspects, methods of the disclosure comprise less chemical steps than methods currently used in the art. In some aspects, methods of the disclosure comprise 2 chemical steps. In some aspects, methods of the disclosure comprise use of about 10 ng of starting material, such as DNA or RNA. In some aspects, methods of the present disclosure enable a signal-to- noise level of nucleobase modification through deamination that is, is at least, is at most, is about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times, or any range derivable therein, higher than deamination-based identification methods known in the art.

[0449] In some aspects, methods provided herein provide deamination treatments suitable for accurately distinguishing methylated nucleobases from un-methylated nucleobases. In some aspects, the methylated nucleobases may be DNA 6mA, DNA 4mC, DNA 5mC, RNA m6A, RNA m4C, RNA m5C, RNA m2G, and / or RNA m22G.1. HPLC-UV

[0450] The technique of HPLC-UV (high performance liquid chromatography -ultraviolet), developed by Kuo and colleagues in 1980 (described further in Kuo K.C. et al., Nucleic Acids Res. 1980;8:4763-4776, which is herein incorporated by reference) can be used to quantify the amount of deoxycytidine (dC) and methylated cytosines (5mC) present in a hydrolyzed DNA sample. The method includes hydrolyzing the DNA into its constituent nucleoside bases, the 5mC and dC bases are separated chromatographically and, then, the fractions are measured. Then, the 5mC / dC ratio can be calculated for each sample, and this can be compared between the experimental and control samples.2. LC-MS / MS

[0451] Liquid chromatography coupled with tandem mass spectrometry (LC-MS / MS) is an high-sensitivity alternative to HPLC-UV, which requires much smaller quantities of a hydrolyzed DNA sample. In the case of mammalian DNA, of which ~2%-5% of all cytosine- 87 -299224109.1residues are methylated, LC-MS / MS has been validated for detecting levels of methylation levels ranging from 0.05%-10%, and it can confidently detect differences between samples as small as -0.25% of the total cytosine residues, which corresponds to -5% differences in global DNA methylation. The procedure routinely requires 50-100 ng of DNA sample, although much smaller amounts (as low as 5 ng) have been successfully profiled.3. MALDI TOF-Based Methods

[0452] MALDI mass spectrometry can be attractive when a time-of-flight (TOF) configuration is used as a mass analyzer (see, Hillenkamp et al. (1990) pp 49-60 in “Matrix Assisted UV-Laser Desorption / Ionization: A New Approach to Mass Spectrometry of Large Biomolecules,” Biological Mass Spectrometry, Burlingame and McCloskey, editors, Elsevier Science Publishers, Amsterdam). In most cases, MALDLTOF does not produce multiple molecular ion peaks, and the mass spectra, in principle, look simpler compared to other types mass spectrometry. MALDI TOF MS can be used for determining oligonucleotide identity (e.g., nucleobase deamination, and / or nucleobase caging).4. ELISA-Based Methods

[0453] There are several commercially available kits, all enzyme-linked immunosorbent assay (ELISA) based, that enable the quick assessment of DNA methylation status, for example. Illustrative, but not limiting assays include Global DNA Methylation ELISA, available from Cell Biolabs; Imprint Methylated DNA Quantification kit (sandwich ELISA), available from Sigma-Aldrich; Epi Seeker methylated DNA Quantification Kit, available from abeam; Global DNA Methylation Assay — LINE-1, available from Active Motif; 5-mC DNA ELISA Kit, available from Zymo Research; MethylFlash Methylated DNA5-mC Quantification Kit and MethylFlash Methylated DNA5-mC Quantification Kit, available from Epigentek.

[0454] Briefly, a nucleic acid sample, e.g, DNA or RNA sample, is captured on an ELISA plate, and the modified nucleobases, e.g., methylated cytosines, are detected through sequential incubations steps with: (1) a primary antibody raised against the modified nucleobase, e.g., 5mC; (2) a labelled secondary antibody; and then (3) colorimetric / fluorometric detection reagents.

[0455] The Global DNA Methylation Assay — LINE-1 specifically determines the methylation levels of LINE-1 (long interspersed nuclear elements- 1) retrotransposons, of which -17% of the human genome is composed. These are well established as a surrogate for- 88 -299224109.1global DNA methylation. Briefly, fragmented DNA is hybridized to biotinylated LINE- 1 probes, which are then subsequently immobilized to a streptavidin-coated plate. Following washing and blocking steps, methylated cytosines are quantified using an anti-5 mC antibody, HRP-conjugated secondary antibody and chemiluminescent detection reagents. Samples are quantified against a standard curve generated from standards with known LINE-1 methylation levels.5. LINE-1 Pyrosequencing

[0456] Levels of LINE-1 methylation can alternatively be assessed by another method that involves the deamination of unmethylated nucleobases in DNA, followed by the PCR amplification of LINE-1 conservative sequences. The methylation status of the amplified fragments is then quantified by pyrosequencing, which is able to resolve differences between DNA samples as small as ~5%. Even though the technique assesses LINE-1 elements and therefore relatively few CpG sites, this has been shown to reflect global DNA methylation changes very well. The method is particularly well suited for high throughput analysis of cancer samples, where hypomethylation is very often associated with poor prognosis. This method is particularly suitable for human DNA, but there are also versions adapted to rat and mouse genomes.6. AFLP and RFLP

[0457] Detection of fragments that are differentially modified, e.g., methylated, could be achieved by traditional PCR-based amplification fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP) or protocols that employ a combination of both. For example, a deaminated nucleic acid molecule, such as DNA or RNA, may be amplified by a reverse transcriptase or a polymerase. Deaminated sites will be identified by the amplifying enzyme differently than the non-deaminated sites producing a mutation in the replicated strand. Thereafter, primers or restriction enzymes that would specifically recognize a non-mutated or mutated strand can be used to assess presence of the mutation as a surrogate of modification in the original nucleic acid.7. LUMA

[0458] The LUMA (luminometric methylation assay) technique utilizes a combination of two DNA restriction digest reactions performed in parallel and subsequent pyrosequencing reactions to fill-in the protruding ends of the digested DNA strands. One digestion reaction is performed with the CpG methylation-sensitive enzyme Hpall; while the parallel reaction uses- 89 -299224109.1the methylation-insensitive enzyme MspI, which will cut at all CCGG sites. The enzyme EcoRI is included in both reactions as an internal control. Both MspI and Hpall generate 5'-CG overhangs after DNA cleavage, whereas EcoRI produces 5'-AATT overhangs, which are then filled in with the subsequent pyrosequencing-based extension assay. Essentially, the measured light signal calculated as the Hpall / MspI ratio is proportional to the amount of unmethylated DNA present in the sample. As the sequence of nucleotides that are added in pyrosequencing reaction is known, the specificity of the method is very high and the variability is low, which is essential for the detection of small changes in global methylation. LUMA requires only a relatively small amount of DNA (250-500 ng), demonstrates little variability and has the benefit of an internal control to account for variability in the amount of DNA input.8. Methods that exclude deamination

[0459] In some aspects, direct detection of modified bases without deamination may be used to detect modified nucleobases, e.g., methylation. For example, Pacific Biosciences company has developed a way to detect methylated bases directly by monitoring the kinetics of polymerase during single molecule sequencing and offers a commercial product for such sequencing (further described in Flusberg B.A., et al., Nat. Methods. 2010;7:461-465, which is herein incorporated by reference). Other methods include nanopore-based single-molecule real-time sequencing technology (SMRT), which is able to detect modified bases directly (described in Laszlo A.H. etal., Proc. Natl. Acad. Sci. USA. 2013 and Schreiber J., etal., Proc. Natl. Acad. Sci. USA. 2013, which are herein incorporated by reference).9. Array or Bead Hybridization

[0460] Modified nucleic acids, e.g., methylated DNA or RNA, can be enriched by immunoprecipitation and used for hybridization with microarrays. Currently available examples of arrays that quantify commonly methylated loci include: the Human CpG Island Microarray Kit (Agilent®), the GeneChip Human Promoter LOR Array and the GeneChip Human Tiling 2. OR Array Set (Affymetrix®).

[0461] The search for differentially-methylated regions using deaminated nucleic acids, e.g., DNA, could be done with the use of different techniques. Some of them are easier to perform and analyze than others, because only a fraction of the genome is used, for example. The most pronounced functional effect of DNA methylation occurs within gene promoter regions, enhancer regulatory elements and 3' untranslated regions (3'UTRs). Assays that focus on these specific regions, such as the Infmium HumanMethylation450 Bead Chip array by- 90 -299224109.1Illumina™, can be used. The arrays can be used to detect methylation status of genes, including miRNA promoters, 5' UTR, 3' UTR, coding regions (~17 CpG per gene) and island shores (regions ~2 kb upstream of the CpG islands).

[0462] Briefly, deaminated genomic DNA can be mixed with assay oligos, one of which is complimentary to inosine (converted from original unmethylated adenosine), and another is complimentary to the adenosine of the methylated (and therefore protected from conversion) site. Following hybridization, primers are extended and ligated to locus-specific oligos to create a template for universal PCR. Finally, labelled PCR primers are used to create detectable products that are immobilized to bar-coded beads, and the signal is measured. The ratio between two types of beads for each locus (individual CpG) is an indicator of its methylation level.

[0463] It is possible to purchase kits that utilize the extension of methylation-specific primers for validation studies. In the VeraCode Methylation assay from Illumina™, 96 or 384 user-specified CpG loci are analysed with the GoldenGate® Assay for Methylation. Differently from the BeadChip assay, the VeraCode assay requires the BeadXpress® Reader for scanning.10. Methyl-Sensitive Cut Counting: Endonuclease Digestion Followed by Sequencing

[0464] As an alternative to sequencing a substantial amount of methylated (or unmethylated) DNA, one could generate snippets from these regions and map them back to the genome after sequencing. Moreover, coverage in NGS could be good enough to quantify the methylation level for particular loci. The technique of serial analysis of gene expression (SAGE) has been adapted for this purpose and is known as methylation-specific digital karyotyping, as well as a similar technique, called methyl-sensitive cut counting (MSCC).

[0465] In summary, in all of these methods, methylation-sensitive endonuclease(s), e.g., Hpall can be used for initial digestion of genomic DNA in unmethylated sites followed by adaptor ligation that contains the site for another digestion enzyme that is cut outside of its recognized site, e.g., EcoP15I or Mmel. These ways, small fragments are generated that are located in close proximity to the original Hpall site. Then, NGS and mapping to the genome are performed. The number of reads for each Hpall site correlates with its methylation level.

[0466] Recently, a number of restriction enzymes have been discovered that use methylated DNA as a substrate (methylation-dependent endonucleases). These include, for example: BisI, BlsI, Glal. Glul, Krol, Mtel, Pcsl, PkrI. The unique ability of these enzymes to cut only methylated sites has been utilized in the method that achieved selective amplification- 91 -299224109.1of methylated DNA. Three methylation-dependent endonucleases that are available from New England Biolabs (FspEI, MspJI and LpnPI) are type IIS enzymes that cut outside of the recognition site and, therefore, are able to generate snippets of 32bp around the fully- methylated recognition site that contains CpG. These short fragments could be sequences and aligned to the reference genome. The number of reads obtained for each specific 32-bp fragment could be an indicator of its methylation level. Similarly, short fragments could be generated from methylated CpG islands with Escherichia coli’s methyl-specific endonuclease McrBC, which cuts DNA between two half-sites of (G / A) mC that are lying within 50 bp-3000 bp from each other.B. Sequencing1. DNA Sequencing

[0467] In some aspects, DNA may be analyzed by sequencing. The DNA may be prepared for sequencing by any method known in the art, such as library preparation, hybrid capture, sample quality control, product-utilized ligation-based library preparation, or a combination thereof. The DNA may be prepared for any sequencing technique. In some aspects, a unique genetic readout for each sample may be generated by genotyping one or more highly polymorphic SNPs. In some aspects, sequencing, such as base pair and / or paired-end sequencing, may be performed to cover approximately 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater percentage of target oligonucleotides at, or at more than 20x, 25x, 30x, 35x, 40x, 45x, 50x, or greater than 50x coverage (or any range derivable therein). In certain aspects, mutations, SNPS, INDELS, copy number alterations (somatic and / or germline), nucleobase modifications (e.g., methylation), or other genetic differences may be identified from the sequencing using at least one bioinformatics tool, including but not limited to, VarScan2, any R package (including CopywriteR) and / or Annovar.2. RNA Sequencing

[0468] In some aspects, RNA may be analyzed by sequencing. The RNA may be prepared for sequencing by any method known in the art, such as but not limited to, poly-A selection, cDNA synthesis, stranded or nonstranded library preparation, or a combination thereof. The RNA may be prepared for any type of RNA sequencing technique, including but not limited to, stranded specific RNA sequencing. In some aspects, sequencing may be performed to generate approximately 10M, 15M, 20M, 25M, 30M, 35M, 40M or more reads, including- 92 -299224109.1paired reads. In some aspects, the sequencing may be performed at a read length of approximately 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85 bp, 90 bp, 95 bp, 100 bp, 105 bp, 110 bp, or longer (or any range derivable therein). In some aspects, raw sequencing data may be converted to estimated read counts (RSEM), fragments per kilobase of transcript per million mapped reads (FPKM), and / or reads per kilobase of transcript per million mapped reads (RPKM).3. Example Sequencing Methods

[0469] DNA and / or RNA (including DNA and / or RNA treated with compositions and / or methods described herein) may be used for amplification of one or more regions of interest followed by sequencing. Accordingly, aspects of the disclosure may include sequencing nucleic acids to detect and / or quantify nucleobase modifications, e.g., methylation of nucleic acids biomarkers. In some aspects, the methods of the disclosure include a sequencing method. Sequencing may be excluded from certain methods of the disclosure. Example sequencing methods include, but are not limited to, those described below. a. Massively parallel signature sequencing (MPSS).

[0470] The first of the next-generation sequencing technologies, massively parallel signature sequencing (or MPSS), was developed in the 1990s at Lynx Therapeutics. MPSS was a bead-based method that used a complex approach of adapter ligation followed by adapter decoding, reading the sequence in increments of four nucleotides. This method made it susceptible to sequence-specific bias or loss of specific sequences. b. Polony sequencing.

[0471] The Polony sequencing method, developed in the laboratory of George M. Church at Harvard, was among the first next-generation sequencing systems and was used to sequence a full genome in 2005. It combined an in vitro paired-tag library with emulsion PCR, an automated microscope, and ligation-based sequencing chemistry to sequence an A. coli genome at an accuracy of >99.9999% and a cost approximately 1 / 9 that of Sanger sequencing. c. 454 pyrosequencing™.

[0472] A parallelized version of pyrosequencing was developed by 454 Life Sciences™, which has since been acquired by Roche Diagnostics™. The method amplifies DNA inside water droplets in an oil solution (emulsion PCR), with each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony. The- 93 -299224109.1sequencing machine contains many picoliter-volume wells each containing a single bead and sequencing enzymes. Pyrosequencing uses luciferase to generate light for detection of the individual nucleotides added to the nascent DNA, and the combined data are used to generate sequence read-outs. This technology provides intermediate read length and price per base compared to Sanger sequencing on one end and Solexa and SOLiD™ on the other. d. Illumina™ (Solexa) sequencing.

[0473] Solexa developed a sequencing method based on reversible dye-terminators technology, and engineered polymerases, that it developed internally. The terminated chemistry was developed internally at Solexa and the concept of the Solexa system was invented by Balasubramanian and Klennerman from Cambridge University's chemistry department. In 2004, Solexa acquired the company Manteia Predictive Medicine in order to gain a massively parallel sequencing technology based on "DNA Clusters", which involves the clonal amplification of DNA on a surface. The cluster technology was co-acquired with Lynx Therapeutics of California. Solexa Ltd. later merged with Lynx to form Solexa Inc.

[0474] In this method, DNA molecules and primers are first attached on a slide and amplified with polymerase so that local clonal DNA colonies, later coined "DNA clusters", are formed. To determine the sequence, four types of reversible terminator bases (RT -bases) are added and non-incorporated nucleotides are washed away. A camera takes images of the fluorescently labeled nucleotides, then the dye, along with the terminal 3' blocker, is chemically removed from the DNA, allowing for the next cycle to begin. Unlike pyrosequencing, the DNA chains are extended one nucleotide at a time and image acquisition can be performed at a delayed moment, allowing for very large arrays of DNA colonies to be captured by sequential images taken from a single camera.

[0475] Decoupling the enzymatic reaction and the image capture allows for optimal throughput and theoretically unlimited sequencing capacity. With an optimal configuration, the ultimately reachable instrument throughput is thus dictated solely by the analog-to-digital conversion rate of the camera, multiplied by the number of cameras and divided by the number of pixels per DNA colony required for visualizing them optimally (approximately 10 pixels / colony). In 2012, with cameras operating at more than 10 MHz A / D conversion rates and available optics, fluidics and enzymatics, throughput can be multiples of 1 million nucleotides / second, corresponding roughly to one human genome equivalent at lx coverage per hour per instrument, and one human genome re-sequenced (at approx. 3 Ox) per day per instrument (equipped with a single camera).- 94 -299224109.1e. SOLiD™ sequencing.

[0476] SOLiD™ technology employs sequencing by ligation. Here, a pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. Oligonucleotides are annealed and ligated; the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR. The resulting beads, each containing single copies of the same DNA molecule, are deposited on a glass slide. The result is sequences of quantities and lengths comparable to Illumina™ sequencing. f. Ion Torrent™ semiconductor sequencing.

[0477] Ion Torrent™ Systems Inc. developed a system based on using standard sequencing chemistry, but with a novel, semiconductor-based detection system. This method of sequencing is based on the detection of hydrogen ions that are released during the polymerization of DNA, as opposed to the optical methods used in other sequencing systems. A microwell containing a template DNA strand to be sequenced is flooded with a single type of nucleotide. If the introduced nucleotide is complementary to the leading template nucleotide it is incorporated into the growing complementary strand. This causes the release of a hydrogen ion that triggers a hypersensitive ion sensor, which indicates that a reaction has occurred. If homopolymer repeats are present in the template sequence multiple nucleotides will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. g. DNA Nanoballs™ sequencing.

[0478] DNA Nanoballs™ sequencing is a type of high throughput sequencing technology used to determine the entire genomic sequence of an organism. The company Complete Genomics® uses this technology to sequence samples submitted by independent researchers. The method uses rolling circle replication to amplify small fragments of genomic DNA into DNA nanoballs. Unchained sequencing by ligation is then used to determine the nucleotide sequence. This method of DNA sequencing allows large numbers of DNA nanoballs to be sequenced per run and at low reagent costs compared to other next generation sequencing platforms. However, only short sequences of DNA are determined from each DNA nanoball which can make mapping the short reads to a reference genome difficult. This technology has been used for multiple genome sequencing projects.- 95 -299224109.1h. Heliscope single molecule sequencing.

[0479] Heliscope sequencing is a method of single-molecule sequencing developed by Helicos Biosciences. It uses DNA fragments with added poly-A tail adapters which are attached to the flow cell surface. The next steps involve extension-based sequencing with cyclic washes of the flow cell with fluorescently labeled nucleotides (one nucleotide type at a time, as with the Sanger method). The reads are performed by the Heliscope sequencer. The reads are short, up to 55 bases per run, but recent improvements allow for more accurate reads of stretches of one type of nucleotides. This sequencing method and equipment were used to sequence the genome of the Ml 3 bacteriophage. i. Single molecule real time (SMRT) sequencing.

[0480] SMRT sequencing is based on the sequencing by synthesis approach. The DNA is synthesized in zero-mode wave-guides (ZMWs) - small well-like containers with the capturing tools located at the bottom of the well. The sequencing is performed with use of unmodified polymerase (attached to the ZMW bottom) and fluorescently labelled nucleotides flowing freely in the solution. The wells are constructed in a way that only the fluorescence occurring by the bottom of the well is detected. The fluorescent label is detached from the nucleotide at its incorporation into the DNA strand, leaving an unmodified DNA strand. According to Pacific Biosciences, the SMRT technology developer, this methodology allows detection of nucleotide modifications (such as cytosine methylation). This happens through the observation of polymerase kinetics. This approach allows reads of 20,000 nucleotides or more, with average read lengths of 5 kilobases.C. Additional Assay Methods

[0481] In some aspects, methods involve amplifying and / or sequencing one or more target genomic regions using at least one pair of primers specific to the target genomic regions. In certain aspects, the primers are heptamers. In certain aspects, enzymes are added such as primases or primase / polymerase combination enzyme to the amplification step to synthesize primers.

[0482] In some aspects, arrays can be used to detect nucleic acids of the disclosure. An array comprises a solid support with nucleic acid probes attached to the support. Arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, U.S. Pat. Nos.- 96 -299224109.15,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186 and FodoreZa / ., 1991), each of which is incorporated by reference in its entirety for all purposes. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Pat. No. 5,384,261, incorporated herein by reference in its entirety for all purposes. Although a planar array surface is used in certain aspects, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety for all purposes.

[0483] In addition to the use of arrays and microarrays, it is contemplated that a number of difference assays could be employed to analyze nucleic acids. Such assays include, but are not limited to, nucleic amplification, polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization, digital PCR, ddPCR (droplet digital PCR), nCounter® (nanoString®), BEAMing (Beads, Emulsions, Amplifications, and Magnetics) (Inostics), ARMS (Amplification Refractory Mutation Systems), RNA-Seq, TAm-Seg (Tagged- Amplicon deep sequencing), PAP (Pyrophosphorolysis-activation polymerization), next generation RNA sequencing, northern hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and / or Bridge Litigation Assay (Genaco).

[0484] Amplification primers or hybridization probes can be prepared to be complementary to a genomic region, biomarker, probe, or oligo described herein. The term "primer" as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process and / or pairing with a single strand of an oligo of the disclosure, or portion thereof. Typically, primers are oligonucleotides from ten to twenty and / or thirty nucleic acids in length, but longer sequences can be employed. Primers may be provided in double-stranded and / or single-stranded form, although the singlestranded form is preferred.

[0485] The use of a primer of between 13 and 100 nucleotides, particularly between 17 and 100 nucleotides in length, or in some aspects up to 1-2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length may be used to increase stability and / or selectivity of the hybrid molecules obtained. One may design nucleic acid molecules for hybridization having one or more complementary sequences of 20- 97 -299224109.1to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.

[0486] In some aspects, each probe / primer comprises at least 15 nucleotides. For instance, each probe can comprise at least or at most 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 400 or more nucleotides (or any range derivable therein). They may have these lengths and have a sequence that is identical or complementary to a gene described herein. Particularly, each probe / primer has relatively high sequence complexity and does not have any ambiguous residue (undetermined "n" residues). The probes / primers can hybridize to the target gene, including its RNA transcripts, under stringent or highly stringent conditions. It is contemplated that probes or primers may have inosine or other design implementations that accommodate recognition of more than one human sequence for a particular biomarker.

[0487] For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50 °C to about 70 °C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

[0488] In some aspects, quantitative RT-PCR (such as but not limited to TaqMan™, AB I) is used for detecting and comparing the levels or abundance of nucleic acids in samples. The concentration of the target DNA in the linear portion of the PCR process is proportional to the starting concentration of the target before the PCR was begun. By determining the concentration of the PCR products of the target DNA in PCR reactions that have completed the same number of cycles and are in their linear ranges, it is possible to determine the relative concentrations of the specific target sequence in the original DNA mixture. This direct proportionality between the concentration of the PCR products and the relative abundances in the starting material is true in the linear range portion of the PCR reaction. The final concentration of the target DNA in the plateau portion of the curve is determined by the availability of reagents in the reaction mix and is independent of the original concentration of target DNA. Therefore, the sampling and quantifying of the amplified PCR products may be carried out when the PCR reactions are in the linear portion of their curves. In addition, relative concentrations of the amplifiable DNAs may be normalized to some independent- 98 -299224109.1standard / control, which may be based on either internally existing DNA species or externally introduced DNA species. The abundance of a particular DNA species may also be determined relative to the average abundance of all DNA species in the sample.

[0489] In some aspects, the PCR amplification utilizes one or more internal PCR standards. The internal standard may be an abundant housekeeping gene in the cell or it can specifically be GAPDH, GUSB and P-2 microglobulin. These standards may be used to normalize expression levels so that the expression levels of different gene products can be compared directly. A person of ordinary skill in the art would know how to use an internal standard to normalize expression levels.

[0490] A problem inherent in some samples is that they are of variable quantity and / or quality. This problem can be overcome if the RT-PCR is performed as a relative quantitative RT-PCR with an internal standard in which the internal standard is an amplifiable DNA fragment that is similar or larger than the target DNA fragment and in which the abundance of the DNA representing the internal standard is roughly 5-100 fold higher than the DNA representing the target nucleic acid region.

[0491] In some aspects, the relative quantitative RT-PCR uses an external standard protocol. Under this protocol, the PCR products are sampled in the linear portion of their amplification curves. The number of PCR cycles that are optimal for sampling can be empirically determined for each target DNA fragment. In addition, the nucleic acids isolated from the various samples can be normalized for equal concentrations of amplifiable DNAs.

[0492] A nucleic acid array can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250 or more different polynucleotide probes, which may hybridize to different and / or the same biomarkers. Multiple probes for the same gene can be used on a single nucleic acid array. Probes for other disease genes can also be included in the nucleic acid array. The probe density on the array can be in any range. In some aspects, the density may be or may be at least 50, 100, 200, 300, 400, 500 or more probes / cm2(or any range derivable therein).

[0493] Specifically contemplated are chip-based nucleic acid technologies such as those described by Hacia et al. (1996) and Shoemaker et al. (1996). Briefly, these techniques involve quantitative methods for analyzing large numbers of genes rapidly and accurately. By tagging genes with oligonucleotides or using fixed probe arrays, one can employ chip technology to segregate target molecules as high density arrays and screen these molecules on the basis of hybridization (see also, Pease et al., 1994; and Fodor et al, 1991). It is contemplated that this- 99 -299224109.1technology may be used in conjunction with evaluating the expression level of one or more cancer biomarkers with respect to diagnostic, prognostic, and treatment methods.

[0494] Certain aspects may involve the use of arrays or data generated from an array. Data may be readily available. Moreover, an array may be prepared in order to generate data that may then be used in correlation studies.

[0495] In some aspects, the deamination rate or caging rate of a nucleobase, e.g., A-to-I conversion, can be quantified by comparing the product yield, e.g., MS peak from deaminated nucleic acids, with the starting material yield, e.g., MS peak from a nucleic acid sample before deamination. In some aspects, the MS peak height of the product is divided by the height of the starting material MS peak to quantify the conversion rate.III. Methods of UseA. Identification of DNA and RNA Methylation Variants

[0496] The field of DNA and RNA methylation analysis has expanded recently with the identification of multiple cytosine, adenine, and guanine modifications. Nucleic acid methylation can have effects at least in DNA replication, gene expression, RNA stability, and / or RNA function. As such, identification of DNA and RNA methylation patterns is necessary for a thorough understanding of cell biology. In addition, many cancers and other disorders have been shown to be associated with unique methylation patterns that can be used to determine prognosis, disease progression, and response to therapy.

[0497] Cytosine and cytidine can be methylated at different positions. 5 -Methylcytosine (5mC) is a DNA modification that results from the transfer of a methyl group from S-adenosyl methionine (also known as AdoMet or SAM) to the carbon 5 position of a cytosine residue. This transfer is catalyzed by DNA methyltransferase enzymes (DNMTs). 5-Methylcytosine is the most common and widely studied form of DNA methylation. It usually occurs within CpG dinucleotide motifs, although non-CpG methylation has been identified in embryonic stem cells. DNA cytosine methylation (e.g., 5mC) has been widely studied and characterized. 5mC is involved in a wide range of biological processes in mammalian cells. It is deposited by DNA methyltransferases (DNMT) and constitutes -2-6% of the total cytosines in human genomic DNA. Additional DNA methylation markers, such as 4-methylcytosine (4mC) are less well studied modifications, but these nonetheless appear to have important roles in gene expression and cell function. The discovery of compositions and methodologies that can aid in the accurate and quantifiable detection of 4mC and / or 5mC, such as methods and compositions disclosed- 100 -299224109.1herein, are useful for advancing the field and further elucidate the importance of these markers in cell function.

[0498] The most abundant internal mRNA modification is TV6-methyladenosine (m6A), which affects almost all the aspects of RNA metabolism, including splicing, translation, and / or degradation. Similarly, N6-methyldeoxyadenosine (6mA) in DNA has been shown to regulate gene expression and its dysregulation has been associated with cancer progression, tumorigenesis, and aging. The discovery of compositions and methodologies that can aid in the accurate and quantifiable detection of 6mA and / or m6A, such as methods and compositions disclosed herein, are useful for advancing the field and further elucidate the importance of these markers in cell function.

[0499] N2-methylguanosine (m2G) and N2,N2 - dimethylguanosine (m22G) have been found in a variety of RNAs, such as tRNAs, rRNAs, and snRNAs. These modification can regulate gene expression, cell proliferation, protein synthesis, mRNA splicing, and / or RNA stability. These modifications may be dysregulated in some neurological disorders, such as Alzheimer’s disease, and cancer. The discovery of compositions and methodologies that can aid in the accurate and quantifiable detection of m2G and / or m22G, such as methods and compositions disclosed herein, are useful for advancing the field and further elucidate the importance of these markers in cell function.B. Clinical and diagnostic applications

[0500] The methods of the disclosure may be useful for evaluating DNA and / or RNA for clinical and / or diagnostic purposes. Certain aspects relate to methods for evaluating DNA. Certain aspects relate to methods for evaluating RNA. Certain aspects relate to a method for evaluating a sample comprising DNA molecules and / or RNA molecules. The evaluation may be the detection or determination of a particular cytosine, guanine, or adenine modification, such as 5mC, m5C, 6mA, m6A, m4C, 4mC, m2G, m22G, or the differential detection or determination of a particular modification.

[0501] The sample may be from a biopsy such as from fine needle aspiration, core needle biopsy, vacuum assisted biopsy, incisional biopsy, excisional biopsy, punch biopsy, shave biopsy or skin biopsy. In certain aspects, the sample is obtained from a biopsy from cancerous tissue by any of the biopsy methods previously mentioned. In certain aspects, the sample may be obtained from any of the tissues provided herein that include but are not limited to gall bladder, skin, heart, lung, breast, pancreas, liver, muscle, kidney, smooth muscle, bladder, colon, intestine, brain, prostate, esophagus, or thyroid tissue. Alternatively, the sample may be- 101 -299224109.1obtained from any other source including but not limited to blood, sweat, hair follicle, buccal tissue, tears, menses, feces, or saliva. In certain aspects the sample is obtained from cystic fluid or fluid derived from a tumor or neoplasm. In certain aspects, the cyst, tumor or neoplasm is colorectal. In certain aspects of the current methods, any medical professional such as a doctor, nurse or medical technician may obtain a biological sample for testing. Yet further, in certain aspects the biological sample can be obtained without the assistance of a medical professional.

[0502] A sample may include but is not limited to, tissue, cells, or biological material from cells or derived from cells of a subject. In some aspects, the sample comprises cell-free DNA. In some aspects, the sample comprises a fertilized egg, a zygote, a blastocyst, or a blastomere. The biological sample may be a heterogeneous or homogeneous population of cells or tissues. The biological sample may be obtained using any method known to the art that can provide a sample suitable for the analytical methods described herein. The sample may be obtained by non-invasive methods including but not limited to: scraping of the skin or cervix, swabbing of the cheek, saliva collection, urine collection, feces collection, collection of menses, tears, or semen.

[0503] In some aspects, the methods of the disclosure can be used in the discovery of novel biomarkers for a disease or condition. In some aspects, the methods of the disclosure can performed on a sample from a patient to provide a prognosis for a certain disease or condition in the patient. In some aspects, the methods of the disclosure can be performed on a sample from a patient to predict the patient’s response to a particular therapy. In some aspects, the disease comprises a cancer. For example, the cancer may be pancreatic cancer, colon cancer, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, childhood cerebellar or cerebral basal cell carcinoma, bile duct cancer, extrahepatic bladder cancer, bone cancer, osteosarcoma / malignant fibrous histiocytoma, brainstem glioma, brain tumor, cerebellar astrocytoma brain tumor, cerebral astrocytoma / malignant glioma brain tumor, ependymoma brain tumor, medulloblastoma brain tumor, supratentorial primitive neuroectodermal tumors brain tumor, visual pathway and hypothalamic glioma, breast cancer, lymphoid cancer, bronchial adenomas / carcinoids, tracheal cancer, Burkitt lymphoma, carcinoid tumor, childhood carcinoid tumor, gastrointestinal carcinoma of unknown primary, central nervous system lymphoma, primary cerebellar astrocytoma, childhood cerebral astrocytoma / malignant glioma, childhood cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer,- 102 -299224109.1Ewing's, childhood extragonadal Germ cell tumor, extrahepatic bile duct cancer, eye Cancer, intraocular melanoma eye Cancer, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor: extracranial, extragonadal, or ovarian, gestational trophoblastic tumor, glioma of the brain stem, glioma, childhood cerebral astrocytoma, childhood visual pathway and hypothalamic glioma, gastric carcinoid, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, childhood intraocular melanoma, islet cell carcinoma (endocrine pancreas), kaposi sarcoma, kidney cancer (renal cell cancer), laryngeal cancer, leukemia, acute lymphoblastic (also called acute lymphocytic leukemia) leukemia, acute myeloid (also called acute myelogenous leukemia) leukemia, chronic lymphocytic (also called chronic lymphocytic leukemia) leukemia, chronic myelogenous (also called chronic myeloid leukemia) leukemia, hairy cell lip and oral cavity cancer, liposarcoma, liver cancer (primary), non-small cell lung cancer, small cell lung cancer, lymphomas, AIDS-related lymphoma, Burkitt lymphoma, cutaneous T-cell lymphoma, Hodgkin lymphoma, Non-Hodgkin (an old classification of all lymphomas except Hodgkin's) lymphoma, primary central nervous system lymphoma, Waldenstrom macroglobulinemia, malignant fibrous histiocytoma of bone / osteosarcoma, childhood medulloblastoma, melanoma, intraocular (eye) melanoma, merkel cell carcinoma, adult malignant mesothelioma, childhood mesothelioma, metastatic squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases, chronic myelogenous leukemia, adult acute myeloid leukemia, childhood acute myeloid leukemia, multiple myeloma, chronic myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma / malignant, fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (surface epithelial- stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, islet cell paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, childhood pituitary adenoma, plasma cell neoplasia / multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma, childhood Salivary gland cancer Sarcoma, Ewing family of tumors, Kaposi sarcoma, soft tissue sarcoma, uterine- 103 -299224109.1sezary syndrome sarcoma, skin cancer (nonmelanoma), skin cancer (melanoma), skin carcinoma, Merkel cell small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer with occult primary, metastatic stomach cancer, supratentorial primitive neuroectodermal tumor, childhood T-cell lymphoma, testicular cancer, throat cancer, thymoma, childhood thymoma, thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, endometrial uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, childhood vulvar cancer, and Wilms’ tumor (kidney cancer). In some aspects, a cancer originated in tissue from bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus in a patient. In some aspects, the cancer comprises ovarian, prostate, colon, or lung cancer. In some aspects, the method is for determining novel biomarkers for ovarian, prostate, colon, or lung cancer by evaluating cell-free DNA using methods of the disclosure. In some aspects, the methods of the disclosure may be used on fetal DNA isolated from a pregnant female. In some aspects, the methods of the disclosure may be used for prenatal diagnostics using fetal DNA isolated from a pregnant female. In some aspects, the methods of the disclosure may be used for the evaluation of a fertilized embryo, such as a zygote or a blastocyst for the determination of embryo quality or for the presence or absence of a particular disease marker.

[0504] In some aspects, methods disclosed herein are performed on DNA and / or RNA that is at a low input concentration. In some aspects, a low input DNA and / or RNA concentration is at about or below about 0.01, 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, or 15 nanograms (ng), or any range derivable therein. In some aspects, a low input DNA and / or RNA concentration is at about 1 to 10 ng, 5 to 10 ng, 10 to 50 ng, 10 to 100, or 100 to 200 ng total DNA and / or RNA. In some aspects, a low input concentration of DNA and / or RNA is obtained from about or less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 500 cells.

[0505] In some aspects, the methods of the disclosure can be used in the discovery of novel biomarkers for a disease or condition. In some aspects, the methods of the disclosure can performed on a sample from a patient to provide a prognosis for a certain disease or condition in the patient. In some aspects, provided herein are compositions and / or kits for preforming- 104 -299224109.1methods of the disclosure. In some aspects, the methods of the disclosure can be performed on a sample from a patient to predict the patient’ s response to a particular therapy. In some aspects, a disease comprises cancer. In some aspects, a cancer comprises ovarian, prostate, colon, or lung cancer. In some aspects, methods provided herein are suitable for determining novel biomarkers for ovarian, prostate, colon, and / or lung cancer by evaluating cell-free nucleic acid (e.g., cell-free DNA and / or cell-free RNA) using methods of the disclosure. In some aspects, methods of the disclosure may be used on fetal DNA and / or RNA isolated from a pregnant female. In some aspects, methods of the disclosure may be used for prenatal diagnostics using fetal DNA and / or RNA isolated from a pregnant female.IV. Detecting a Genetic Signature

[0506] Particular aspects concern the methods of detecting a genetic signature in an individual. In some aspects, the method for detecting the genetic signature may include selective oligonucleotide probes, arrays, allele-specific hybridization, molecular beacons, restriction fragment length polymorphism analysis, enzymatic chain reaction, flap endonuclease analysis, primer extension, 5 ’-nuclease analysis, oligonucleotide ligation assay, single strand conformation polymorphism analysis, temperature gradient gel electrophoresis, denaturing high performance liquid chromatography, high-resolution melting, DNA mismatch binding protein analysis, surveyor nuclease assay, sequencing, or a combination thereof, for example. The method for detecting the genetic signature may include fluorescent in situ hybridization, comparative genomic hybridization, arrays, polymerase chain reaction, sequencing, or a combination thereof, for example. The detection of the genetic signature may involve using a particular method to detect one feature of the genetic signature and additionally use the same method or a different method to detect a different feature of the genetic signature. Multiple different methods independently or in combination may be used to detect the same feature or a plurality of features.A. Single Nucleotide Polymorphism (SNP) Detection

[0507] Particular aspects of the disclosure concern methods of detecting a SNP in an individual. One may employ any of the known general methods for facilitating detection of SNPs using compositions, kits, and / or of this disclosure, for example. Such methods include, but are not limited to, selective oligonucleotide probes, arrays, allele-specific hybridization, molecular beacons, restriction fragment length polymorphism analysis, enzymatic chain reaction, flap endonuclease analysis, primer extension, 5'-nuclease analysis, oligonucleotide- 105 -299224109.1ligation assay, single strand conformation polymorphism analysis, temperature gradient gel electrophoresis, denaturing high performance liquid chromatography, high-resolution melting, DNA mismatch binding protein analysis, surveyor nuclease assay, sequencing, or a combination thereof.

[0508] In some aspects of the disclosure, methods used to detect the SNP comprise sequencing nucleic acid material from the individual and / or using selective oligonucleotide probes. Sequencing the nucleic acid material from the individual may involve obtaining the nucleic acid material from the individual in the form of genomic DNA, complementary DNA that is reverse transcribed from RNA, or RNA, for example. Any standard sequencing technique may be employed, including Sanger sequencing, chain extension sequencing, Maxam-Gilbert sequencing, shotgun sequencing, bridge PCR sequencing, high-throughput methods for sequencing, next generation sequencing, RNA sequencing, or a combination thereof. After sequencing the nucleic acid from the individual, one may utilize any data processing software or technique to determine which particular nucleotide is present in the individual at the particular SNP.

[0509] In some aspects, the nucleotide at the particular SNP is detected by selective oligonucleotide probes. The probes may be used on nucleic acid material from the individual, including genomic DNA, complementary DNA that is reverse transcribed from RNA, or RNA, for example. Selective oligonucleotide probes preferentially bind to a complementary strand based on the particular nucleotide present at the SNP. For example, one selective oligonucleotide probe binds to a complementary strand that has an A nucleotide at the SNP on the coding strand but not a G nucleotide at the SNP on the coding strand, while a different selective oligonucleotide probe binds to a complementary strand that has a G nucleotide at the SNP on the coding strand but not an A nucleotide at the SNP on the coding strand. Similar methods could be used to design a probe that selectively binds to the coding strand that has a C or a T nucleotide, but not both, at the SNP. Thus, any method to determine binding of one selective oligonucleotide probe over another selective oligonucleotide probe could be used to determine the nucleotide present at the SNP.

[0510] One method for detecting SNPs using oligonucleotide probes comprises the steps of analyzing the quality and measuring quantity of the nucleic acid material by a spectrophotometer and / or a gel electrophoresis assay; processing the nucleic acid material into a reaction mixture with at least one selective oligonucleotide probe, PCR primers, and a mixture with components needed to perform a quantitative PCR (qPCR), which could comprise a polymerase, deoxynucleotides, and a suitable buffer for the reaction; and cycling the processed- 106 -299224109.1reaction mixture while monitoring the reaction. In one aspect of the method, the polymerase used for the qPCR will encounter the selective oligonucleotide probe binding to the strand being amplified and, using endonuclease activity, degrade the selective oligonucleotide probe. The detection of the degraded probe determines if the probe was binding to the amplified strand.

[0511] Another method for determining binding of the selective oligonucleotide probe to a particular nucleotide comprises using the selective oligonucleotide probe as a PCR primer, wherein the selective oligonucleotide probe binds preferentially to a particular nucleotide at the SNP position. In some aspects, the probe is generally designed so the 3’ end of the probe pairs with the SNP. Thus, if the probe has the correct complementary base to pair with the particular nucleotide at the SNP, the probe will be extended during the amplification step of the PCR. For example, if there is a T nucleotide at the 3' position of the probe and there is an A nucleotide at the SNP position, the probe will bind to the SNP and be extended during the amplification step of the PCR. However, if the same probe is used (with a T at the 3' end) and there is a G nucleotide at the SNP position, the probe will not fully bind and will not be extended during the amplification step of the PCR.

[0512] In some aspects, the SNP position is not at the terminal end of the PCR primer, but rather located within the PCR primer. The PCR primer should be of sufficient length and homology in that the PCR primer can selectively bind to one variant, for example the SNP having an A nucleotide, but not bind to another variant, for example the SNP having a G nucleotide. The PCR primer may also be designed to selectively bind particularly to the SNP having a G nucleotide but not bind t...

Claims

WHAT IS CLAIMED IS:

1. A composition comprising glyoxal at a concentration of between about 0.5 to 4 M, boric acid (H3BO3) at a concentration between or between about 10-20 mM, sodium nitrite at a concentration between or between about 0.5-1.0 M, and kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.

2. A composition comprising glyoxal at a concentration of between or between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM, sodium nitrite at a concentration between about or between 0.5- 1.0 M, and kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.

3. A composition comprising one or more carbonyl organocatalysts and one or more Lewis acid catalysts.

4. The composition of claim 3, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8- formylquinoline.

5. The composition claim 3, wherein the one or more carbonyl organocatalyst comprises glyoxal.

6. The composition of claim 5, wherein the glyoxal is at a concentration of between about 0.5 to 4 M.

7. The composition of claim 3, wherein the one or more Lewis acid comprises BF3 OEt2, H3BO3, SC(OTF)3, LUC13, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCl2, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F5)3.

8. The composition of claim 3, wherein the one or more Lewis acid comprises boric acid (H3BO3) and / or boron trifluoride etherate (BErOEte).

9. The composition of claim 3, wherein the Lewis acid comprises HsBCh / NasBCh Buffer.177299224109.

110. The composition of claim 3, further comprising nucleic acids.

11. The composition of claim 10, wherein select nucleobases of the nucleic acids were previously protected by treatment with a caging agent.

12. The composition of claim 11, wherein the caging agent comprises kethoxal, methylglyoxal, phenylglyoxal, or an a-keto aldehyde.

13. The composition of claim 11, wherein the caging agent comprises N3-kethoxal and / or kethoxal.

14. The composition of claim 11, wherein the caging agent is provided at a concentration of or of about 500 mM, and / or is comprised in the composition at a final concentration of or of about 10-15 mM, or of or of about 12.5 mM.

15. The composition of claim 10, wherein select nucleobases of the nucleic acids were previously protected by treatment with a modifying agent comprising methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

16. The composition of claim 3, further comprising one or more source of nitrite ions, comprising sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.

17. The composition of claim 16, wherein the source of nitrite ions comprises saturated sodium nitrite (~8 M).

18. The composition of claim 16, wherein the source of nitrite ions is at a concentration of equal to or greater than 0.3 equiv, 0.5 equiv, 1.0 equiv, 1.2 equiv, 2.0 equiv, or 3.0 equiv.

19. The composition of claim 3, wherein the composition is at a pH of between 6.0 and 7.3.

20. The composition of claims 3, wherein the composition comprises a mixed solvent comprising a DMSO to water ratio of greater than or equal to 5 : 1 or 9: 1.

21. A composition comprising one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

22. The composition of claim 21, comprising glyoxal, BF3 OEt2, and sodium nitrite.178299224109.

123. The composition of claim 21, comprising glyoxal, H3BO3, and sodium nitrite.

24. The composition of claim 21, further comprising nucleic acids.

25. The composition of claim 22 or 23, wherein the glyoxal is at a concentration of between about 0.5 to 4 M.

26. The composition of claim 3 or 21, wherein the composition comprises greater than or equal to 20 mM H3BO3, and DNA.

27. The composition of claim 3 or 21, wherein the composition comprises greater than or equal to 1.0 M sodium nitrite, and DNA.

28. The composition of claim 3 or 21, wherein the composition comprises greater than or equal to 0.8 M glyoxal, and RNA.

29. The composition of claim 3 or 21, wherein the composition comprises greater than or equal to 10 mM H3BO3, and RNA.

30. The composition of claim 3 or 21, wherein the composition comprises greater than or equal to 0.5 M sodium nitrite, and RNA.

31. The composition of claim 3 or 21, further comprising one or more buffers.

32. The composition of claim 31, wherein the one or more buffers comprise NasBCh buffer, HEPES buffer, and / or PBS buffer.

33. The composition of claim 31, wherein the one or more buffers comprise 10X PBS buffer at pH ~7.4, HiBCh / NasBCh buffer at pH ~6.4, and / or HEPES buffer at pH ~6.0.

34. A method of deaminating nucleobases Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids by incubating the nucleic acids with the composition of any one of claims 3-33.

35. A method of detecting modified Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids, the method comprising incubating the nucleic acids with the composition of any one of claims 3-33.

36. A kit comprising reagents for making the composition of any one of claims 3-33.179299224109.

137. Use of the composition of any one of claims 3-33 for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof, in nucleic acids.

38. A method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising, incubating the nucleic acid with one or more carbonyl organocatalysts, one or more Lewis acid catalysts, and one or more source of nitrite ions in a deamination reaction, wherein the deamination reaction causes the primary amines in the one or more nucleobases to form C-nitro intermediates then rearrange into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

39. The method of claim 38, wherein the nucleobases comprise adenine (A) or analogs thereof, guanine (G) or analogs thereof, and / or cytosine (C) or analogs thereof.

40. The method of claim 38, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline.

41. The method of claim 38, wherein the one or more carbonyl organocatalyst is at a concentration of between about 0.5 M to 4 M.

42. The method of claim 38, wherein the one or more carbonyl organocatalyst comprises glyoxal.

43. The method of claim 42, wherein the glyoxal is at a concentration of between about 1 to 2.5 M.

44. The method of claim 38, wherein the one or more Lewis acid comprises BF3 OEt2, H3BO3, SC(OTF)3, LUC13, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F5)3.

45. The method of claim 38, wherein the one or more Lewis acid comprises boric acid (H3BO3) and / or boron trifluoride etherate (BF3 OEt2).

46. The method of claim 38, wherein the Lewis acid comprises EEBCh / NasBCh Buffer.180299224109.

147. The method of claim 38, wherein the Lewis acid comprises 500 mM J BCh / NasBCh Buffer (pH=6.4).

48. The method of claim 38, comprising protecting the nucleic acid by incubating the nucleic acid with one or more caging agents prior to incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions.

49. The method of claim 48, wherein the caging agent comprises kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, glyoxal, or an a-keto aldehyde.

50. The method of claim 48, wherein the caging agent is provided at a concentration of or of about 500 mM, and / or is comprised in the composition at a final concentration of or of about 10-15 mM, or of or of about 12.5 mM.

51. The method of claim 48, wherein the incubating of the nucleic acid with the caging agent comprises incubating for a first period of time at between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at between about 30-43 °C.

52. The method of claim 51, wherein the first period of time is between about 0.5-3.5 minutes, optionally about 2 minutes.

53. The method of claim 51, wherein the second period of time is between about 20-40 minutes, optionally about 30 minutes.

54. The method of claim 48, wherein the protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of about 6-8, optionally about 7-7.5.

55. The method of claim 38, comprising protecting the nucleic acid by incubating the nucleic acid with one or more modifying agents prior to incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions.

56. The method of claim 55, wherein the modifying agent comprises methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

57. The method of claim 38, wherein the source of nitrite ions comprises sodium nitrite, potassium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.181299224109.

158. The method of claim 38, wherein incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of between 6.0 and 7.3.

59. The method of claim 38, wherein the incubating is in a mixed solvent comprising DMSO and water.

60. The method of claim 38, further comprising incubating the nucleic acid with the one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

61. The method of claim 60, wherein the first period of time is less than or equal to 1 hour, 30 minutes, or 15 minutes.

62. The method of claim 38, wherein the incubation of the nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of between 30 and 70 °C, optionally about 50 °C.

63. The method of claim 38, wherein following incubating for the deamination reaction, the deamination reaction is quenched using NH4Q and Tris-HCl buffer.

64. The method of claim 38, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises BF3 OEt2, and the one or more source of nitrite ions comprises sodium nitrite.

65. The method of claim 38, wherein the one or more carbonyl organocatalyst comprises glyoxal, the one or more Lewis acid comprises H3BO3, and the one or more source of nitrite ions comprises sodium nitrite.

66. The method of claim 38, wherein the deamination reaction comprises incubating with one or more buffers.

67. The method of claim 66, wherein the one or more buffers comprise NasBCh buffer, HEPES buffer, and / or PBS buffer.182299224109.

168. The method of claim 38, wherein the nucleic acid comprises RNA and the method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid co-catalyst to mediate the deamination reaction.

69. The method of claim 38, wherein the nucleobase is guanine and the one or more carbonyl organocatalyst comprises or consists of a monocarbonyl organocatalyst.

70. The method of claim 38, wherein the nucleobase is adenine and the one or more carbonyl organocatalyst comprises or consists of a dicarbonyl organocatalyst.

71. The method of claim 38, wherein the nucleic acids were protected by incubating with a caging agent prior to incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions; wherein the method further comprises deprotecting of the nucleic acids following incubating with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

72. The method of claim 71, wherein the deprotecting comprises incubating with dNTPs, formamide, and TEAA buffer.

73. The method of claim 71, wherein the deprotecting comprises incubating the nucleic acids at greater than or equal to 90 °C, optionally about 94 °C, for greater than or equal to 1, 2, 3, 4, or 5 minutes.

74. The method of claim 38, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%,20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%,36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of unmodified and / or modified adenine are deaminated.

75. The method of claim 38, wherein the nucleic acid comprises RNA, and further comprising reverse transcription of the RNA.

76. The method of claim 75, wherein the reverse transcription is mediated by SSIII RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes.183299224109.

177. The method of claim 75, wherein the concentration of RNA at the start of the deamination reaction comprises less than or equal to 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of polyA enriched RNA.

78. The method of claim 38, further comprising sequencing the nucleic acid following the deaminating.

79. The method of claim 78, wherein the sequencing identifies non-deaminated adenine, non-deaminated guanine, and / or non-deaminated cytosine as modified adenine, modified guanine, and / or modified cytosine nucleobases.

80. The method of claim 78, wherein the sequencing identifies modifications: DNA 6mA, DNA 4mC, DNA 5mC, RNA m4C, RNA m5C, RNA m2G, and / or RNA m22G.

81. A kit comprising reagents for performing the method of any one of claims 38-80.

82. A method of detecting m6A or 6mA in a nucleic acid, the method comprising: deaminating one or more adenine nucleobases in the nucleic acid by incubating the nucleic acid with: i) one or more carbonyl organocatalysts, ii) one or more Lewis acid cocatalysts, and iii) one or more sources of nitrite ions, in a deamination reaction thereby deaminating one or more non-methylated adenines in the nucleic acid to hypoxanthine (inosine); terminating the deamination reaction by incubating the nucleic acid with a quenching composition thereby generating deaminated nucleic acids; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

83. The method of claim 82, further comprising the step of protecting a guanine and / or a cytosine in the nucleic by incubating the nucleic acid with one or more caging agents prior to deaminating, wherein the step of protecting the guanine and / or cytosine occurs prior to the deamination step.

84. The method of claim 83, wherein the one or more caging agent comprises kethoxal, N3-kethoxal, methylglyoxal, phenylglyoxal, methylamine, or an a-keto aldehyde.184299224109.

185. The method of claim 82, wherein the caging agent is provided at a concentration of or of about 500 mM, and / or is comprised in the composition at a final concentration of or of about 10-15 mM or 12.5 mM.

86. The method of claim 82, wherein the deaminating incubation step(s) are performed at a slightly acidic to neutral pH that is a pH of about 6.0 to 7.2, and is maintained using one or more buffers.

87. The method of claim 82, wherein the quenching composition comprises NH4Q, (NHfhSCh, NH4OAC, an ammonium salt, Tris-HCl buffer, Guanidine-HCl buffer, Glycine buffer, or a combination thereof.

88. The method of claim 82, comprising the protecting step and further comprising a deprotecting step prior to step ii).

89. The method of claim 82, wherein the deprotecting step comprises incubating the nucleic acids with one or more of nucleotide triphosphates (NTPs), Guanidine-HCl, GTP, GDP, GMP, formamide, Triethylammonium bicarbonate buffer, Tris-HCl, and Triethylammonium acetate (TEAA) buffer.

90. The method of claim 82, wherein the deprotecting comprises incubating the nucleic acids at greater than or equal to 90 °C, optionally about 94 °C, for greater than or equal to 1, 2, 3, 4, or 5 minutes.

91. The method of claim 82, wherein the one or more carbonyl organocatalyst comprises one or more of glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2-thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8-formylquinoline.

92. The method of claim 82, wherein the one or more carbonyl organocatalyst is at a concentration of between about 0.5 M to 4 M.

93. The method of claim 82, wherein the one or more Lewis acid comprises BF3 OEt2, H3BO3, SC(OTF)3, LUC13, Y(OTF)3, FeCh, YbCh, RuCh, Ln(OTf)3, CuCl2, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2AsO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F5)3.185299224109.

194. The method of claim 82, comprising protecting the nucleic acid by incubating the nucleic acid with one or more caging agents.

95. The method of claim 94, wherein the incubating of the nucleic acid with the caging agent comprises incubating for a first period of time at between about 50-90 °C, optionally about 70 °C, followed by incubating for a second period of time at between about 30-43 °C.

96. The method of claim 95, wherein the first period of time is between about 0.5-3.5 minutes, optionally about 2 minutes, and / or wherein the second period of time is between about 20-40 minutes, optionally about 30 minutes.

97. The method of claim 94, wherein the protecting of the nucleic acid by incubating with one or more caging agents occurs at a pH of about 6-8.

98. The method of claim 82, wherein the source of nitrite ions comprises sodium nitrite, ammonium nitrite, tetrabutylammonium nitrite, and / or tert-butyl nitrite.

99. The method of claim 82, wherein the one or more steps of incubating the nucleic acid with one or more carbonyl organocatalyst, one or more Lewis acid catalyst, and one or more source of nitrite ions is at a pH of between 6.0 and 7.3.

100. The method of claim 82, wherein the incubating is in a mixed solvent comprising DMSO and water.

101. The method of claim 82, further comprising incubating the nucleic acid with the one or more carbonyl organocatalyst and one or more Lewis acid for a first period of time, prior to incubation of the nucleic acid with the one or more carbonyl organocatalyst, one or more Lewis acid, and one or more source of nitrite ions.

102. The method of claim 101, wherein the first period of time is less than or equal to 1 hour, 30 minutes, or 15 minutes.

103. The method of claim 101, wherein the incubation of the nucleic acid with one or more carbonyl organocatalyst and one or more Lewis acid prior to incubation with one or more sources of nitrite ions is at a temperature of between 30 and 70 °C.

104. The method of claim 82, wherein the deamination reaction comprises incubating with one or more buffers.186299224109.1105. The method of claim 104, wherein the one or more buffers comprise NasBCh buffer, HEPES buffer, and / or PBS buffer.

106. The method of claim 82, wherein the one or more carbonyl organocatalyst comprises glyoxal, and the one or more Lewis acid comprises boron trifluoride, optionally wherein the glyoxal and boron trifluoride are at a ratio of 1 : 1.

107. The method of claim 82, wherein the nucleic acid comprises RNA and the method results in a reduced level of RNA damage relative to methods that do not utilize a carbonyl organocatalyst and Lewis acid co-catalyst to mediate the deamination reaction.

108. The method of claim 82, wherein greater than or equal to 15%, 16%, 17%, 18%, 19%,20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%,36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% of unmodified and / or modified adenine are deaminated.

109. The method of claim 82, wherein the nucleic acid comprises RNA, and the preparing a nucleic acid sequencing library using the deaminated nucleic acids comprises reverse transcription of the RNA.

110. The method of claim 109, wherein the reverse transcription is mediated by SSIII RT, RevertAid RT, AMV RT, WarmStart RT, and / or Bst 2.0 enzymes.

111. The method of claim 82, wherein the concentration of nucleic acid at the start of the deamination reaction comprises less than or equal to 50 ng, 40 ng, 30 ng, 20 ng, or 10 ng of DNA or polyA enriched RNA.

112. A kit comprising reagents and optionally instructions for performing the method according to any one of claims 82-111.

113. A kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) one or more carbonyl organocatalysts, and b) one or more Lewis acids.187299224109.1114. The kit of claim 113, further comprising one or more sources of nitrite ions.

115. The kit of claim 113, further comprising one or more buffers and / or enzymes.

116. The kit of claim 113, further comprising sequencing reagents.

117. The kit of claim 113, comprising glyoxal, formaldehyde, furfural, trifluoracetaldehyde, trifluoropyruvaldehyde, 2-pyridinecarboxaldehyde, 2-formylpyrrole, 2- thiophenecarboxaldehyde, heterocyclic aldehyde compounds, glyoxylic acid, and / or 8- formylquinoline.

118. The kit of claim 113, comprising BF3OEt2, H3BO3, Sc(OTF)3, LUC13, Y(OTF)3, FeCl3, YbCh, RuCh, Ln(OTf)3, CuCh, NiCh, C0CI2, MnCh, AICI3, Sm(OTF)3, InCl3, AuCl, B(OCH2CF3)3, B(OH)3, (CH3)2ASO2H, PhB(OH)2, MeB(OH)2, and / or B(C6F5)3.

119. The kit of claim 113, further comprising a caging agent, comprising kethoxal, N3- kethoxal, methylglyoxal, phenylglyoxal, and / or an a-keto aldehyde.

120. The kit of claim 119, wherein the caging agent is provided at a concentration of or of about 500 mM, and / or is provided at a concentration wherein a final concentration of about 10- 15 mM or 12.5 mM in a composition can be achieved.

121. The kit of claim 113, further comprising modifying agents, comprising methylamine, dimethylamine, hydroxylamine, methoxamine, and / or iodomethane.

122. A method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising: incubating the nucleic acid with glyoxal at a concentration of between or between about 0.5 to 4 M, a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 25-100 mM, and sodium nitrite at a concentration between or between about 0.5-1.0 M, wherein the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

123. A method of deaminating primary amines in one or more nucleobases in a nucleic acid, the method comprising: incubating the nucleic acid with glyoxal at a concentration of between or between about 0.5 to 4 M, boric acid (H3BO3) at a concentration between or between about 10-20 mM, and sodium nitrite at a concentration between or between about 0.5-1.0 M, wherein188299224109.1the primary amines form C-nitro intermediates are rearranged into N-nitrosamine leading to selective deamination of the primary amines in the nucleic acid.

124. A method of detecting m6A or 6mA in a nucleic acid, the method comprising: protecting one or more guanines and / or cytosines in the nucleic by incubating the nucleic acid with kethoxal and / or N3-kethoxal at a concentration between about 10-15 mM; deaminating one or more adenine nucleobases in the nucleic acid by incubating the nucleic acid with: i) glyoxal at a concentration between about 0.5 to 4 M, ii) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between about 25-100 mM, and iii) sodium nitrite at a concentration between about 0.5-1.0 M, in a deamination reaction thereby deaminating one or more non-methylated adenines in the nucleic acid to hypoxanthine (inosine); terminating the deamination reaction by incubating with a quenching composition thereby generating deaminated nucleic acids; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

125. A method of detecting m6A or 6mA in a nucleic acid, the method comprising: protecting one or more guanines and / or cytosines in the nucleic by incubating the nucleic acid with kethoxal and / or N3 -kethoxal at a concentration between about 10-15 mM; deaminating one or more adenines through one or more incubation steps with: 1) glyoxal at a concentration between about 0.5 to 4 M, 2) boric acid (H3BO3) at a concentration between about 10-20 mM, and 3) sodium nitrite at a concentration between about 0.5- 1.0 M; terminating the deamination reaction by incubating with a quenching composition; preparing a nucleic acid sequencing library using the deaminated nucleic acids; and sequencing the library.

126. A kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, b) a boron trifluoride (BF3»OEt3) / boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, c) sodium189299224109.1nitrite at a concentration between or between about 0.5-1.0 M, and d) kethoxal and / or N3- kethoxal at a concentration between or between about 10-15 mM.

127. A kit for deaminating Adenine (A) or analogs thereof, Guanine (G) or analogs thereof, and / or Cytosine (C) or analogs thereof in nucleic acids, the kit comprising: a) glyoxal at a concentration between or between about 7.0-10.0 M, b) boric acid (H3BO3) buffer at a concentration between or between about 250-750 mM, c) sodium nitrite at a concentration between or between about 0.5-1.0 M, and d) kethoxal and / or N3-kethoxal at a concentration between or between about 10-15 mM.190299224109.1