Novel double-stranded RNA based on rsv p protein RNA sequence and use thereof
Double-stranded RNA targeting the RSV P protein effectively inhibits RSV infection by inducing RNA interference, addressing the need for a cost-effective and uniformly quality-controlled therapeutic drug.
Patent Information
- Application Number
- PCT/JP2025/032434
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2025-09-16
- Publication Date
- 2026-03-26
AI Technical Summary
There is a need for an effective therapeutic drug to suppress respiratory syncytial virus (RSV) infection, particularly in immunodeficient individuals or infants, as existing treatments like oxygen administration and intravenous drips are costly and lack uniform quality, and antibody pharmaceuticals are difficult to maintain quality consistency.
Development of double-stranded RNA comprising specific sequences targeting the RSV P protein, which suppresses RSV infection by inducing RNA interference, reducing viral copy numbers, and inhibiting protein expression.
The double-stranded RNA effectively inhibits RSV infection by reducing RSV viral copy numbers and suppressing RSV P protein expression, offering a promising therapeutic option with minimal side effects.
Smart Images

Figure JP2025032434_26032026_PF_FP_ABST
Abstract
Description
Novel double-stranded RNA based on the RSV P protein RNA sequence and its use
[0001] The present disclosure relates to double-stranded RNA that suppresses the growth of respiratory syncytial virus (RSV) and its use. This application claims priority based on Japanese Patent Application No. 2024-163804 filed on September 20, 2024, and the entire contents of that application are incorporated herein by reference.
[0002] RSV is a virus that infects humans. RSV causes symptoms such as fever, runny nose, and cough, and when it worsens, it develops into bronchitis, pneumonia, asthma, etc. RSV is distributed worldwide with little geographical or climatic bias. Infectious diseases caused by RSV have a low risk of severe illness in older children and adults. However, in cases of immunodeficiency or during infancy, the risk of severe illness is high.
[0003] RSV repeatedly infects and causes illness. It is said that most children are infected with RSV during infancy. There is no specific medicine for RSV infection. Therefore, generally, treatment methods such as oxygen administration, intravenous drip (or blood transfusion), or respiratory management are carried out. Therefore, there is a need for an effective therapeutic drug for infectious diseases caused by RSV. For example, Japanese Patent Laid-Open No. 2022-065140 discloses an antibody pharmaceutical composition for RSV.
[0004] Japanese Patent Laid-Open No. 2022-065140
[0005] By the way, antibody pharmaceuticals and the like are costly and it is difficult to maintain uniform quality. In contrast, nucleic acid pharmaceuticals can be mass-produced by organic synthesis and it is easy to manage the uniformity of quality.
[0006] Therefore, an object of the present disclosure is to provide double-stranded RNA that suppresses RSV infection.
[0007] The double-stranded RNA disclosed herein comprises a first strand and a second strand. The first strand comprises a main sequence consisting of 19 to 23 bases, the 5' end of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence. Here, the main sequence is determined from the base sequence encoding the P protein of respiratory syncytial virus and consists of one of the following base sequences: GAAUGCUUCACACAUAGU (SEQ ID NO: 3); GCUUCACACAUAGUAGUA (SEQ ID NO: 4); GAGUGCAGGAACCUACAUCU (SEQ ID NO: 6).
[0008] In another preferred embodiment of the double-stranded RNA disclosed herein, the double-stranded RNA comprises a first strand and a second strand. The first strand comprises a main sequence containing a portion of the nucleotide sequence encoding the P protein of RSL. The second strand comprises a complementary main sequence that binds to the main sequence. Here, the main sequence is a nucleotide sequence of 19 to 23 nucleotides and includes any of the following nucleotide sequences: GAAUGCUUCACACAUAGU (SEQ ID NO: 3); GCUUCACACAUAGUAGUA (SEQ ID NO: 4); and GAGUGCAGGACCCUACAUCU (SEQ ID NO: 6).
[0009] The double-stranded RNA described above suppresses the expression of the RSV P protein. In addition, it reduces the RSV viral copy number. This effect can suppress RSV infection.
[0010] In one embodiment of the double-stranded RNA disclosed herein, the first strand includes an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence. In addition, the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases attached to the 3' end of the complementary main sequence. Such double-stranded RNA can suitably function as siRNA. This makes it possible to more reliably suppress RSV infection.
[0011] In one embodiment of the double-stranded RNA disclosed herein, at least three of the five bases at the 3' end of the main sequence are adenine (A) and / or uracil (U). This more effectively suppresses P protein expression and thus more reliably inhibits RSV infection.
[0012] In one embodiment of double-stranded RNA disclosed herein, the base sequence constituting the above-mentioned additional sequence is thymine-thymine (TT). This makes it possible to improve the stability of the double-stranded RNA.
[0013] This disclosure provides a composition for inhibiting the proliferation of RSV. In other words, one embodiment of the composition disclosed herein includes the double-stranded RNA disclosed herein.
[0014] This disclosure provides a method for treating RSV infection in animals other than humans. In other words, one aspect of the treatment method disclosed herein includes the step of administering the composition disclosed herein to an animal other than a human.
[0015] Figure 1 is a graph showing the amount of interferon-α gene RNA contained in RSV-infected cell extracts after transfection with siRNA, a preferred embodiment of the double-stranded RNA disclosed herein. Figure 2 is a graph showing the amount of N gene RNA contained in RSV-infected cell extracts after transfection with siRNA, a preferred embodiment of the double-stranded RNA disclosed herein. Figure 3 is a graph showing the viral copy number after 3 days in RSV-infected cells after transfection with siRNA, a preferred embodiment of the double-stranded RNA disclosed herein.
[0016] <Definitions> The technologies disclosed herein will be described in detail below. Matters other than those specifically mentioned herein (e.g., the structure of double-stranded RNA) that are necessary for carrying out the technologies (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, constructs mainly composed of peptides and nucleic acids, etc.) can be understood as design matters of those skilled in the art based on prior art in fields such as cell engineering, physiology, medicine, pharmacy, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, and genetics. The technologies disclosed herein can be carried out based on the content disclosed herein and common technical knowledge in the art.
[0017] In this specification, "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphate diester bonds, and is not limited by the number of nucleotides. For example, a polymer containing both deoxyribonucleotides and nucleotides is also included in the definition of "polynucleotide" in this specification. Furthermore, in this specification, "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (total length) does not exist naturally on its own, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).
[0018] In this specification, "first chain" and "second chain" refer to a sense chain (or code chain or passenger chain) and an antisense chain (or template chain, non-code chain or guide chain) respectively. That is, if the first chain is a sense chain, the second chain is an antisense chain. The first and second chains may be completely complementary to each other, or at least partially complementary. That is, they may be hybridizable, at least under physiological conditions.
[0019] In this specification, unless otherwise indicated by "5'" and "3'", the left side of a nucleotide sequence is always the 5' end and the right side is always the 3' end. Furthermore, in this specification, "amino acid residue" is a term that includes the N-terminal and C-terminal amino acids of a peptide chain, unless otherwise specified. Also, in amino acid sequences described in this specification, the left side is always the N-terminus and the right side is always the C-terminus.
[0020] In this specification, when a numerical range is described as "A to B (where A and B are arbitrary numbers)," it means "A or greater and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and less than or equal to B," and "A or greater and less than B."
[0021] <RSV> In this specification, "RSV" is also referred to as respiratory syncytial virus. However, it is meant to encompass all synonyms, including naturally occurring RSV and its variants, unless otherwise specified.
[0022] RSV is a human-infecting virus belonging to the Pneumovirus genus of the Paramyxoviridae family. Therefore, RSV is an enveloped RNA virus that replicates in the cytoplasm and matures by budding on the plasma membrane of the host cell. The RSV genome is an unsegmented, negative-sense single-stranded RNA. The RSV genome is approximately 15 kbp and encodes 11 proteins, including 9 structural proteins and 2 non-structural proteins. RSV possesses three surface proteins: the F protein (fusion protein), the G protein (adhesion glycoprotein), and the SH protein (low molecular weight hydrophobic protein). Of these, the G protein and F protein are known to induce neutralizing antibodies. Furthermore, the G protein and F protein are major transmembrane surface glycoproteins that control the initial stages of infection into host cells. RSV adheres to host cells via the G protein and enters the cell by fusing with the host cell membrane via the F protein.
[0023] After RSV enters a host cell, RNA replication occurs via N protein (nucleoprotein), L protein (large protein), and P protein (phosphorylated protein). L protein has an RNA-dependent RNA polymerase domain. Furthermore, according to Gilman et al. "Structure of the Respiratory Syncytial Virus Polymerase Complex" Cell 179, 2019, 193-204, P protein plays a role in regulating RNA replication and transcription through interaction with L protein and others. In other words, RNA replication in RSV can be inhibited by suppressing the expression of the gene encoding P protein (hereinafter simply referred to as the "P gene"). The inventors of this invention investigated double-stranded RNA that targets the P gene. As a result, they found a double-stranded RNA that can suppress the proliferation of RSV.
[0024] Typically, RSV is divided into two subgroups (RSV-A and RSV-B) based on differences in its reaction with monoclonal antibodies to G proteins. Furthermore, these subgroups can be further classified into several genotypes, for example, based on the gene sequence of the C-terminal or second hypervariable region of the G protein. Known genotypes of type A RSV (i.e., RSV-A) include GA1, GA2, GA3, GA4, GA5, GA6, GA7, SAA1, NA1, NA2, and ON1. Furthermore, known genotypes of type B RSV (i.e., RSV-B) include GB1, GB2, GB3, GB4, BA1, BA2, BA3, BA4, BA5, BA6, BA7, BA8, BA9, BA10, SAB1, SAB2, SAB3, SAB4, and URU1-2.
[0025] As mentioned above, RSV is classified into several genotypes based on the gene sequence of the C-terminal side or the second hypervariable region of the G protein. However, unlike the G protein gene sequence, the P gene tends to be conserved. Therefore, double-stranded RNA targeting the P gene can be used to inhibit the growth of all genotypes or strains of RSV.
[0026] RSV is a single-stranded negative-sense virus. The nucleotide sequence of RSV can be obtained from international databases. For example, international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniProt, and Ensemble. Specifically, the nucleotide sequence of the P gene is provided in NC_001803.1, etc. In some databases, the RSV genome sequence is represented by thymine (T) instead of uracil (U), but in this case, considering that RSV is a single-stranded negative-sense virus, T can be read as U.
[0027] The amino acid sequence shown in Sequence ID No. 9 consists of 241 amino acid residues and is the amino acid sequence of the RSV P protein. The nucleotide sequence shown in Sequence ID No. 10 consists of 726 nucleotides and is the nucleotide sequence of the RSV P protein.
[0028] <Double-stranded RNA> The double-stranded RNA disclosed herein is a double-stranded RNA having a first strand and a second strand. The first strand has a main sequence consisting of 19 to 23 bases, the 5' end of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence. The main sequence also includes a portion of the base sequence that encodes the RSV P protein. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, and will be described in detail below.
[0029] The double-stranded RNA disclosed herein can function at least as small interfering RNA (siRNA). That is, such double-stranded RNA is expected to induce RNA interference (RNAi). RNAi is a gene silencing process that uses short double-stranded RNA such as siRNA to suppress gene expression in a sequence-specific manner. When siRNA is introduced into a cell, it forms a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to a homologous sequence of mRNA transcribed from the target gene (in this case, the P gene of RSV) and specifically cleaves the mRNA. This inhibits the translation of the target protein.
[0030] The main sequence of the sense strand is typically composed of polynucleotides, which are polymers of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or by the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).
[0031] The main sequence of the sense strand may contain a nucleotide sequence that includes a portion of the nucleotide sequence encoding the RSV P protein. This allows the double-stranded RNA to function as an siRNA targeting the aforementioned P protein.
[0032] The main sequence of the sense strand is preferably selected to include the nucleotide sequence encoding the RSV P protein, but to the extent that the effects of this technology are achieved, one or more nucleotides (e.g., two nucleotides) may be substituted for, deleted from, and / or added (inserted) to other nucleotides.
[0033] The proportion of the main sequence of the sense strand that is encoded by the RSV P protein is not particularly limited. When the entire main sequence is considered as 100%, it is preferably 5% or more, but may also be 10% or more, 15% or more, 90% or more, or even 100% or more.
[0034] The 5' end of the main sequence of the sense strand is preferably guanine or cytosine. Because guanine and cytosine have a higher binding affinity to the complementary strand than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively lower. Although the details of the mechanism are not clear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand whose 5' end is more energetically unstable than the sense strand or antisense strand. Therefore, having guanine or cytosine at the 5' end of the main sequence makes it easier for the antisense strand to be incorporated into RISC, allowing for more favorable induction of RNAi. This allows the double-stranded RNA to function favorably as siRNA.
[0035] Preferably, the five bases at the 3' end of the main sequence of the sense strand contain 60% or more (i.e., 3 or more) adenine and / or uracil, may contain 80% or more (i.e., 4 or more) or even 100% (i.e., 5 bases). This makes the stability of the 5' end of the antisense strand relatively lower than that of the 3' end. As a result, the antisense strand is more easily incorporated into RISC, and RNAi can be more favorably induced.
[0036] The total GC content of the sense strand's main sequence (the total percentage of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but is often between 10% and 70%, preferably between 20% and 60%, and may be between 30% and 55%. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and the RNA having the main sequence, as well as the ease of RNA cleavage. With the above GC content, the effects of RNAi can be efficiently exerted.
[0037] The main sequence can be selected from 19 to 23 bases from the G or C region of the gene encoding the RSV P protein. For example, the main sequence may be any of the following base sequences: GAAUGCUUCACACAUUAGU (Sequence ID 3); GCUUCACACAUUAGUAGUA (Sequence ID 4); GAGUGCAGGAACCCUACAUCU (Sequence ID 6). The base sequences shown in Sequence ID 3, Sequence ID 4, and Sequence ID 6 are all composed of RNA.
[0038] When double-stranded RNA is introduced into cells, nonspecific inhibition of expression or cell proliferation due to interferon response, etc., is generally possible. For example, when double-stranded RNA is used clinically, depending on the base sequence of the introduced double-stranded RNA, it may bind to various RNA receptors in cells and promote the innate immune response. However, as shown in the examples described below, double-stranded RNA with the base sequences shown in SEQ ID NOs: 3, 4, and 6 as the main sequence has excellent infection suppression activity against RSV and has very few side effects (e.g., innate immune reactions) when introduced into cells. Therefore, clinical application is highly promising.
[0039] GUGAAAAAUCUAGGAAUUGCU (Sequence ID 1) is the sequence of bases 428 to 446 of the RSV P protein encoding sequence (i.e., the sequence from the start codon to the stop codon). CUAGGAAUGCUUCACACAU (Sequence ID 2) is the sequence of bases 436 to 454 of the RSV P protein encoding sequence. GAAUGCUUCACACAUUAGU (Sequence ID 3) is the sequence of bases 440 to 458 of the RSV P protein encoding sequence. GCUUCACACAUUAGUAGUA (Sequence ID 4) is the sequence of bases 444 to 462 of the RSV P protein encoding sequence. GCGAGUGCCAGGACCUACAU (Sequence ID 5) is the nucleotide sequence from position 463 to 481 of the nucleotide sequence that codes for the RSV P protein. GAGUGCCAGGACCUACAUCU (Sequence ID 6) is the nucleotide sequence from position 465 to 483 of the nucleotide sequence that codes for the RSV P protein. CAUCUGCUCGGGGAAUGGUAU (Sequence ID 7) is the nucleotide sequence from position 479 to 497 of the nucleotide sequence that codes for the RSV P protein. CUCGGGGAAUGGUAUAAGAGA (Sequence ID 8) is the nucleotide sequence from position 485 to 503 of the nucleotide sequence that codes for the RSV P protein.
[0040] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may comprise an additional sequence consisting of 2 to 4 bases that is added to the 5' or 3' end of the main sequence. Preferably, the additional sequence is added to the 3' end of the main sequence. The addition of the additional sequence can more effectively induce RNAi.
[0041] The additional sequence is composed of polynucleotides (dimers, trimers, or tetramers). The polynucleotides constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. Further, the additional sequence may include modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.
[0042] The nucleotide sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base or more of adenine, uracil, or thymine. Further, from the viewpoint of improving the stability of double-stranded RNA, the nucleotide sequence constituting the additional sequence is more preferably TT (thymine-thymine).
[0043] <Sense strand and antisense strand> The sense strand is composed of, for example, a nucleotide sequence of 21 bases or more and 27 bases or less, and may be composed of 21 bases or more and 25 bases or less, or 21 bases or more and 23 bases or less. In a preferred example, it is composed of 21 bases to 23 bases consisting of 19 bases to 21 bases of the main sequence and 2 bases of the additional sequence. In such an example, RNAi can be effectively induced.
[0044] The antisense strand may have a nucleotide sequence complementary to the main sequence of the sense strand. Thereby, the antisense strand hybridizes with the sense strand to form a double-stranded structure. Further, the nucleotide sequence of the antisense strand may be partially complementary to the main sequence of the sense strand. That is, one or more bases (for example, 2 bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize under at least physiological conditions, they can function as siRNA. The complementary nucleotide sequence portion is typically composed of a polymer of ribonucleotides (RNA).
[0045] In the double-stranded RNA disclosed herein, the sense strand or the antisense strand is typically composed of unmodified ribonucleotides (RNA). However, to the extent that it does not significantly impair the technology of the present disclosure, the double-stranded RNA of the present disclosure may contain DNA, as well as chemically modified DNA or RNA, and other known nucleotide analogs. That is, one or more bases (e.g., 2 or more bases to 5 bases) of the sense strand or the antisense strand may be replaced with chemically modified RNA (or DNA) such as methylation or pseudouridylation. Examples of such chemically modified RNA or DNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, inosine, and acyclic artificial nucleic acids. For example, any one or more (e.g., 2 bases) of uridine in the double-stranded RNA of the present disclosure can be replaced with pseudouridine. Further, the sense strand or the antisense strand may have a ligand that binds to a receptor specifically expressed in the cell to be introduced. The ligand can be added, for example, to the 5'-end side and / or the 3'-end side of the sense strand or the antisense strand. The ligand can be, for example, N-acetylgalactosamine (GalNAc) or a derivative thereof. By having GalNAc as a ligand, the delivery property to hepatocytes can be improved.
[0046] In the double-stranded RNA disclosed herein, the antisense strand may have a main sequence complementary to the main sequence of the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end side or the 3'-end side of the complementary main sequence. From the viewpoint of improving the function as siRNA, this additional sequence may be added to the 3'-end side of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end side of the main sequence, the additional sequence of the antisense strand is added to the 3'-end side of the complementary base sequence. Note that the configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence of the sense strand described above. Typically, the base sequence of the additional sequence of the antisense strand is the same as the additional sequence of the sense strand to which it hybridizes, but it may also be a different base sequence.
[0047] The antisense strand may consist of, for example, a base sequence of 21 to 27 bases, or it may consist of 21 to 25 bases, or 21 to 23 bases. The antisense strand may consist of a base sequence of the same length as the sense strand. Furthermore, the antisense strand may consist of a base sequence in which all or part of the base sequence, excluding the added sequence, is complementary to the main sequence of the sense strand. In a preferred example, the antisense strand consists of a base sequence of the same length as the sense strand, and all of the base sequences, excluding the added sequence, are complementary to the main sequence of the sense strand.
[0048] <Method for Producing Double-Stranded RNA> The first and second strands constituting the double-stranded RNA disclosed herein can be produced according to general chemical synthesis methods. For example, they can be synthesized using a commercially available automated DNA / RNA synthesizer. Alternatively, the first and second strands may be synthesized in vitro or in vivo based on genetic engineering techniques. It is preferable that the synthesized first and second strands be purified, which can be done, for example, by HPLC.
[0049] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) the first and second strands. The annealing method can be any conventionally known method. For example, the first and second strands can be mixed in equal amounts in a solvent, heated at 90°C for 1 to 5 minutes, and then cooled to 4°C to room temperature to perform annealing. Suitable solvents include, for example, distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer with pH 7.4, PBS, etc.). To prevent contamination of the solvent with active RNase (RNA-degrading enzyme), it is preferable to use a solvent that has been treated, for example, by DEPC treatment or autoclaving.
[0050] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein also includes a form in which the first strand and the second strand are locally double-stranded via a loop structure. That is, the double-stranded RNA of this disclosure can also be used as shRNA (short hairpin RNA) in another embodiment. shRNA is an RNA in which a main sequence and its complementary sequence exist on a single strand, and a loop sequence exists to form a loop structure between them. By having a loop structure, the main sequence and its complementary sequence hybridize, forming a local double-stranded structure. As a result, the shRNA can be processed by the intracellular enzyme Dicer, and the siRNA of this embodiment can be formed.
[0051] The structure of the shRNA may be the same as that of conventionally known shRNAs. The length of the shRNA may be, for example, 50 to 70 bases. The length of the loop sequence may be, for example, 19 to 29 loops. The shRNA can be incorporated into a vector (e.g., a lentiviral expression vector). By using shRNA, RNAi can be stably induced in cells, and viral replication can be stably suppressed.
[0052] <Composition> The composition disclosed herein contains the double-stranded RNA described above. The composition disclosed herein may contain one type of double-stranded RNA or two or more types of double-stranded RNA. In addition to the double-stranded RNA described above, it may also contain various pharmaceutically acceptable carriers depending on the form of use. Preferred carriers are those commonly used in pharmaceuticals as diluents, excipients, etc. Such carriers vary appropriately depending on the use and form of the composition. Typical examples include water, physiological buffers, and various organic solvents. Such carriers may also be aqueous solutions of alcohol (ethanol, etc.) of appropriate concentration, glycerol, non-drying oils such as olive oil, or liposomes. Secondary components that may be included in the pharmaceutical composition include various fillers, bulking agents, binders, humectants, surfactants, dyes, fragrances, etc. It may also contain carriers used in conventionally known drug delivery systems (DDS).
[0053] The form of the composition disclosed herein is not particularly limited. For example, typical forms of the composition include liquids, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. It can also be prepared as a lyophilized product or granules for use by injection, etc., by dissolving it in physiological saline or a suitable buffer (e.g., PBS) immediately before use to prepare a drug solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (sub-components) as materials can be based on conventionally known methods, and such formulation methods themselves do not characterize this disclosure, so a detailed explanation is omitted. For detailed information on formulations, see, for example, Comprehensive Medicinal Chemistry, edited by Corwin Hansch, published by Pergamon Press (1990).
[0054] The compositions disclosed herein inhibit at least RSV infection. Thus, a method for treating RSV infection is provided. The treatment method includes administering the compositions to humans and / or non-human animals. RSV is a virus that can infect not only humans but also non-human animals. Examples of such animals include mammals such as monkeys, cattle, sheep, and goats.
[0055] One aspect of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a cell membrane-permeable peptide fragment (cell-penetrating peptide, CPP) capable of introducing foreign substances from outside the cell through the cell membrane into the cytoplasm. This peptide fragment can be directly or indirectly bound (linked) to the double-stranded RNA disclosed herein to construct a construct of the peptide fragment and the double-stranded RNA. Generally, double-stranded RNA has a negative charge and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly binding (linking) the double-stranded RNA disclosed herein to the N-terminal and / or C-terminal side of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues of the peptide fragment is not limited as long as its cell membrane permeability is not impaired.
[0056] When the peptide fragment and the double-stranded RNA are indirectly bound, a linker may be placed between the peptide fragment and the double-stranded RNA, for example. The type of linker is not particularly limited. Typically, it may be a peptidolytic linker, a non-peptidolytic linker, etc. Furthermore, the method of binding the peptide fragment and the double-stranded RNA is not particularly limited and can be carried out according to various conventionally known scientific methods.
[0057] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of this disclosure. However, the double-stranded RNA does not have to be bound to the N-terminal or C-terminal side of the peptide fragment. In this embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, by electrical or molecular interactions. Since such a complex is more readily introduced into eukaryotic cells, the double-stranded RNA can be efficiently introduced. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used is preferably positively charged with a high proportion of basic amino acids. In this case, the proportion of the peptide fragment may be 5 to 100 times that of the double-stranded RNA in molar terms, and preferably 40 to 60 times.
[0058] <Method for producing the composition and its use> This disclosure may provide a method for suppressing RSV infection using the composition disclosed herein. The method disclosed herein includes a preparation step of preparing the composition disclosed herein and a step of supplying the composition to target cells.
[0059] In the preparation step, for example, the composition disclosed herein can be prepared by conventionally known methods as described above.
[0060] In the supply process, the composition disclosed herein is supplied to cells infected with at least RSV in vivo or in vitro. The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. While cells other than RSV-infected cells may be present at the supply site of the composition, the composition may be supplied only to the target cells (i.e., RSV-infected cells).
[0061] The method of administering the composition may be in accordance with methods conventionally used in the treatment of animals, and is not particularly limited. The composition may be used in vivo in a manner and in a dosage appropriate to its form and purpose. For example, as a liquid, it can be administered in any desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflamed tissue, etc.) of a patient or animal (i.e., a living organism) by injection intravenously, lymphatically, intramuscularly, subcutaneously, intradermally, or intraperitoneally. Alternatively, it can be administered directly to tissue (e.g., the affected area, such as tissue or organ containing tumor cells, virus-infected cells, etc.) in solid form such as tablets, or in gel or aqueous jelly form such as ointment. Alternatively, solid forms such as tablets can be administered orally. In the case of oral administration, encapsulation or application of a protective (coating) material is preferable to suppress digestive enzyme degradation in the gastrointestinal tract.
[0062] In vivo, the amount of the composition supplied is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be, for example, 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less.
[0063] Furthermore, the amount of the composition supplied in vitro is not particularly limited. The lower limit of the double-stranded RNA concentration in the culture medium of the supplied material, such as cells, may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.
[0064] The compositions disclosed herein can be supplied into the target cell by known transfection methods. These may include, for example, chemical gene transfer methods using cationic molecules (such as commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, they may be supplied into the cell using cell membrane-permeable peptide fragments.
[0065] The following describes some test examples relating to the technology disclosed herein, but the technology of this disclosure is not intended to be limited to those shown in such test examples.
[0066] <Preparation of siRNA> Polynucleotides with the base sequences shown in SEQ ID NOs: 11-26 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the other sequence (main sequence) is composed of RNA. The obtained polynucleotides were used to prepare siRNAs for samples 1-8 shown in Table 1 by annealing the sense strand and antisense strand, which have complementary sequences. The siRNAs shown in samples 1-8 were dissolved in PBS to a concentration of 50 μM to prepare each RNA solution.
[0067]
[0068] As shown in Table 1, the sense strand of the siRNA of Sample 1 consists of a main sequence consisting of SEQ ID NO: 1 (part of the nucleotide sequence encoding the RSV P protein) and an additional sequence consisting of TT attached to the 3' end of the main sequence. In Sample 1, the main sequence is composed of RNA, and the additional sequence is composed of DNA; in other words, it is a chimera. Similarly, the sense strands of the siRNAs of Samples 2-8 shown in Table 1 consist of a main sequence consisting of SEQ ID NOs: 2-8 and an additional sequence consisting of TT attached to the 3' end of the main sequence. Furthermore, the antisense strands of the siRNAs of Samples 1-8 consist of a nucleotide sequence complementary to SEQ ID NOs: 1-8 (the main sequence of the antisense strand) and an additional sequence consisting of TT attached to the 3' end of the complementary nucleotide sequence. In Controls 1 and 2, described later, AccuTarget Negative Control siRNA (SN-1012, BIONEER) was used as the siRNA.
[0069] <Introduction of siRNA into cells> Human RSV, RSV / Sendai / 28-30 (subgroup A), was used as the virus. HEp-2 cells were used to infect the cells with the virus. Eagle's minimum essential medium (EMEM) containing 2% fetal bovine serum (FBS) was used as the culture medium. First, HEp-2 cells were introduced in 5 × 10⁶ cells. 4 Seeds were seeded into 96-well cell culture plates to achieve a cells / well ratio, and cultured at 37°C in 5% CO2. 2 The siRNAs were cultured for 24 hours under environmental conditions. Next, using the transfection reagent Lipofectamine® RNAiMAX (manufactured by Thermo Fisher Scientific), the prepared siRNAs were added to the wells to achieve a siRNA concentration of 50 nM in the well medium. Subsequently, the culture was performed at 37°C and 5% CO2. 2 The cells were incubated in the environment for 5 hours.
[0070] <Viral Infection of Cells> After adding siRNA and culturing for 5 hours, 0.1 MOI of RSV was used to infect HEp-2 cells cultured in the wells. One day after infection, the wells were washed with PBS, the culture medium was added to the wells, and the cells were cultured for a further 2 days. The cells in the wells were then collected. RNA was isolated and recovered from the collected cells using ISOGEN (manufactured by Nippon Gene Co., Ltd.). The amount of recovered RNA was measured based on the absorbance at 260 nm. 500 ng of RNA was used to prepare cDNA (hereinafter also referred to as "cell extract sample") using the Superscript VILO cDNA Synthesis Kit (manufactured by Thermo Fisher Scientific).
[0071] (Samples 2-8) Samples 2-8 were conducted in the same manner as Sample 1, except that the siRNA in Sample 1 was changed to the one shown in Table 1 for Samples 2-8.
[0072] (Control 1) In Control 1, a control siRNA that does not target a specific gene was introduced. Otherwise, it was the same as Sample 1. In other words, Control 1 represents an example of a study in which a siRNA targeting a specific gene was not introduced.
[0073] (Control 2) In Control 2, neither the virus nor virus-targeting siRNA was introduced. Furthermore, the cultured HEp-2 cells were not infected with RSV. Otherwise, the procedure was the same as in Sample 1. In other words, Control 2 represents a test example without RSV infection.
[0074] <Human IFNA1 RNA Amount> The amount of human IFNA1 RNA in cell extracts was quantified by qRT-PCR. IFNA1 refers to interferon-α, a type of type I interferon. IFNA1 is a type of cytokine induced by viral infections, etc. IFNA1 expression is involved in the innate immune response. Therefore, a low amount of IFNA1 RNA indicates that the cell's innate immune response is suppressed.
[0075] For the measurements, SYBR Green Real-Time PCR Master Mix (Thermo Fisher Scientific) was used as the reagent for qRT-PCR. The PCR machine used was the StepOnePlus® Real-Time PCR System (Thermo Fisher Scientific). Primers (SEQ ID NO: 27 and SEQ ID NO: 28) targeted the internal region of human IFNA1 (see Table 2). In addition, qRT-PCR targeting human GAPDH was performed to standardize the qRT-PCR (primers SEQ ID NO: 29 and SEQ ID NO: 30).
[0076]
[0077] As shown in Figure 1, samples 1-4, 6, and 7 were shown to reduce the innate immune response to the virus. Note that Figure 1 shows relative values with control 2 set to 1. In Figure 1, a smaller value on the vertical axis indicates lower expression levels of the target gene. As shown in Figure 1, in control 1, the amount of IFNA1 RNA was significantly increased compared to control 2, which was not infected with the virus. This is thought to be because IFNA1 was induced by the viral infection.
[0078] Based on the above test results, the siRNAs from samples 1-4, 6, and 7 reduced the innate immune response (IFNA1) when introduced into cells. Therefore, clinical application is expected.
[0079] <Measurement of RNA Amount of N Gene> The amount of RNA of the gene encoding the RSV N protein (hereinafter simply referred to as the "N gene") in cell extract samples was quantified by qRT-PCR. The N protein forms a complex with the RSV genome (Bakker et al. "The respiratory syncytial virus nucleoprotein-RNA complex forms a left-handed helical nucleocapsid" Journal of General Virusology 94, 2013, 1734-1738). If the amount of RNA of the N gene is low, RSV infection (increase in genomic RNA) may be suppressed. In this quantitative analysis, the RNA amount was measured in the same manner as for IFNA1 described above, except that the primers used were changed to SEQ ID NO: 31 and SEQ ID NO: 32 (which target the internal region of the N gene).
[0080] As shown in Figure 2, the amount of RNA in the N gene was significantly reduced in samples 1-6 compared to control 1. Furthermore, the amount of RNA in the N gene in sample 7 was almost unchanged compared to control 1. In sample 8, the amount of RNA in the N gene was increased compared to control 1. Note that Figure 2 shows relative values with control 1 set to 1. A smaller value on the vertical axis indicates lower expression levels of the target gene.
[0081] <Measurement of Virus Copy Number> Next, the virus copy number was measured. After introducing siRNA into cells and culturing for 5 hours, HEp-2 cells cultured in wells were infected with 0.1 MOI of RSV. One day after infection, the wells were washed with PBS, the culture medium was added to the wells, and the cells were cultured for a further 2 days. After that, the culture medium (supernatant) in the wells was collected. The collected supernatant was mixed with an equal volume of 2× RNA lysis buffer (0.4 μL SUPERaseI® RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM TCl-HCl (pH 7.4), 40%, glycerol) and allowed to stand at room temperature for 10 minutes. After that, it was diluted 10-fold with distilled water to prepare the supernatant sample for qRT-PCR.
[0082] The amount of RNA from the RSV N gene in the supernatant sample prepared above was quantified by qRT-PCR. One Step TB green PrimeScript (registered trademark) PLUS RT-PCR kit (Perfect Real Time) (manufactured by Takara Bio Inc.) was used as the qRT-PCR reagent. The same PCR machine as above was used. The primers used were those shown in SEQ ID NO: 33 and SEQ ID NO: 34. In addition, the nucleotide sequence shown in SEQ ID NO: 35 was used as the probe for this measurement. The probe was modified with FAM (5-Carboxyfluorescein) at the 5' end and TAMRA (5-Carboxytetramethylrhodamine) at the 3' end. Furthermore, a calibration curve was created using an RSV RNA fragment synthesized by in vitro transcription as a template. The number of viral copies in each sample was calculated by referring to the created calibration curve. Figure 3 is a graph showing the number of viral copies three days after transfection of RSV-infected cells with the above siRNA. In Figure 3, a smaller value on the vertical axis indicates a smaller amount of virus (RSV) in the supernatant sample.
[0083] The results of measuring the RNA amount of the N gene of RSV (see Figure 2) and the results of measuring the viral copy number (see Figure 3) were compared. In Figure 2, a decrease in the RNA amount of the N gene was confirmed by introducing the siRNA of samples 1 to 6 into cells. Of these, samples 3, 4, and 6 showed a significant decrease in the RNA amount of the N gene, as well as a significant decrease in the viral copy number. In other words, it was shown that RSV infection was suitably suppressed in samples 3, 4, and 6.
[0084] The specific examples of the technologies disclosed herein have been described in detail above, but these are merely illustrative and do not limit the scope of the claims. The technologies described in the claims include various modifications and changes to the specific examples described above.
[0085] The technologies disclosed herein may be omitted or combined as appropriate, unless no particular problems arise. Furthermore, this specification includes the disclosures described in the following sections.
[0086] Item 1: A double-stranded RNA having a first strand and a second strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5' end of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence, wherein the main sequence is determined from the base sequence encoding the P protein of respiratory syncytial virus and consists of one of the following base sequences: GAAUGCUUCACACAUAGU (Sequence ID 3); GCUUCACACAUAGUAGU (Sequence ID 4); GAGUGCAGGACCCUACAUCU (Sequence ID 6);
[0087] Item 2: The double-stranded RNA according to Item 1, wherein the second strand comprises a main sequence complementary to the main sequence of the first strand, and an additional sequence consisting of 2 to 4 bases attached to the 3' end of the complementary main sequence.
[0088] Item 3: A double-stranded RNA having a first strand and a second strand, wherein the first strand includes a main sequence containing a portion of the nucleotide sequence encoding the P protein of RSL, and the second strand includes a complementary main sequence that binds to the main sequence, where the main sequence is a nucleotide sequence of 19 to 23 nucleotides, and includes any of the following nucleotide sequences: GAAUGCUUCACACAUAGU (SEQ ID NO: 3); GCUUCACACAUAGUAGUA (SEQ ID NO: 4); and GAGUGCAGGACCUCAUCU (SEQ ID NO: 6).
[0089] Item 4: The first strand described above includes an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence, as described in Item 3, for the double-stranded RNA described in Item 3.
[0090] Item 5: The double-stranded RNA according to item 3 or 4, wherein the second strand comprises an additional sequence consisting of 2 to 4 bases attached to the 3' end of the complementary main sequence.
[0091] Item 6: A double-stranded RNA according to any one of items 1 to 5, wherein at least three of the five bases at the 3' end of the main sequence are adenine (A) and / or uracil (U).
[0092] Item 7: A double-stranded RNA according to any one of items 1 to 6, wherein the base sequence constituting the above-mentioned additional sequence is thymine-thymine (TT).
[0093] Item 8: A composition that inhibits RSV infection, comprising the double-stranded RNA described in any one of items 1 to 7.
[0094] Item 9: A method for treating RSV infection, comprising administering the composition described in Item 8 to an animal other than a human.
Claims
1. A double-stranded RNA having a first strand and a second strand, wherein the first strand includes a main sequence containing a portion of the base sequence encoding the P protein of RSL, and the second strand includes a complementary main sequence that binds to the main sequence, where the main sequence is a base sequence of 19 to 23 bases, and consists of any of the following: GAAUGCUUCACACAUUAGU (SEQ ID NO: 3); GCUUCACACAUUAGUAGU (SEQ ID NO: 4); and GAGUGCCAGGACCUACAUCU (SEQ ID NO: 6).
2. The double-stranded RNA according to claim 1, wherein the first strand includes an additional sequence consisting of 2 to 4 bases attached to the 3' end of the main sequence.
3. The double-stranded RNA according to claim 2, wherein the second strand includes an additional sequence consisting of 2 to 4 bases attached to the 3' end of the complementary main sequence.
4. The double-stranded RNA according to claim 3, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
5. A composition that inhibits the proliferation of RSV, comprising the double-stranded RNA described in any one of claims 1 to 4.
6. A method for treating RSV infection, comprising administering the composition described in claim 5 to an animal other than a human.
Citation Information
Patent Citations
rnai regulation of rsv, piv and other respiratory viruses and their use
JP2008517940A
Methods and compositions for the prevention or treatment of RSV infection
JP2011506484A
NOVEL siRNA BASED ON SARS-CoV-2 RNA SEQUENCE, AND USE OF THE SAME
JP2023013932A