Medicament for treating disease related to motor neuron injury
By using circular RNA with circBank ID hsa_circPTPRN2_018 to bind to an adeno-associated virus vector and intrathecally injecting overexpressing circPTPRN2, the problem of poor ALS treatment efficacy was solved, motor neuron function was significantly improved, and the survival time of mice was prolonged.
Patent Information
- Application Number
- PCT/CN2025/092999
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-26
- Filing Date
- 2025-05-07
- Publication Date
- 2026-04-02
AI Technical Summary
Existing medications for treating amyotrophic lateral sclerosis (ALS) are not very effective, there is a lack of effective treatment strategies, and the pathogenesis of ALS is unclear. Existing drugs such as edaravone and riluzole have limited efficacy.
By using circular RNA with circBank ID hsa_circPTPRN2_018 and binding it to an adeno-associated virus vector, intrathecal injection of overexpressed circPTPRN2 improved mitochondrial dysfunction in motor neurons, increased ATP production, reduced ROS levels, and alleviated axonal swelling and degeneration.
It slows down the progression of ALS, improves motor function, prolongs the survival of mice, significantly increases ATP production and improves mitochondrial membrane potential, and reduces axonal swelling.
Smart Images

Figure CN2025092999_02042026_PF_FP_ABST
Abstract
Description
Medicament for treating diseases related to motor neuron injury TECHNICAL FIELD
[0001] The present application relates to the field of gene therapy, in particular to a medicament for treating diseases related to motor neuron injury, the medicament comprising: circBank ID hsa_circPTPRN2_018 of circular RNA and applicable pharmaceutical carriers; the present application also relates to the use of circular RNA in the preparation of a medicament for treating diseases related to motor neuron injury. BACKGROUND
[0002] Amyotrophic lateral sclerosis (ALS) is a motor neuron disease of unknown etiology, which can simultaneously involve upper and lower motor neurons. Patients show progressive muscle atrophy, weakness, paralysis, and eventually die of respiratory failure. ALS has the characteristics of fast progression and high mortality. The disease is highly heterogeneous, and the pathogenesis is not clear. There is a lack of effective treatment drugs. Currently, the drugs approved by FDA and widely used in clinical practice are edaravone, riluzole and AMX0035 (sodium phenylbutyrate and taurine glycol complex preparation), but the efficacy is not ideal. Therefore, it is of great scientific value and social significance to explore the pathological mechanism of ALS disease, develop new treatment strategies, and solve the unmet clinical needs. The following references are of reference value: 1) Errichelli L, Dini Modigliani S, Laneve P, et al. FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons. Nat Commun. 2017;8:14741. Published 2017 Mar 30. doi:10.1038 / ncomms14741; This literature describes that the depletion and mutation of FUS are key factors affecting the biogenesis of circRNA, and the mutation of FUS gene can cause ALS, thus providing a theoretical basis for the possible regulation of circRNA in the pathological process of ALS. 2) Colantoni A, Capauto D, Alfano V, et al. FUS Alters circRNA Metabolism in Human Motor Neurons Carrying the ALS-Linked P525L Mutation. Int J Mol Sci. 2023;24(4):3181. Published 2023 Feb 6. doi:10.3390 / ijms 24043181; This literature shows that the dysregulation of circRNA expression in MN carrying P525L FUS mutation and links the dysregulation to the pathogenesis of ALS. The above two literatures show that circRNA dysregulation is involved in the regulation of the pathological process of ALS, but they have not confirmed which circRNA is related to which specific pathological process, which is their deficiency.See also document 3) D'Ambra E, Santini T, Vitiello E, et al. Circ-Hdgfrp3 shuttles along neurites and is trapped in aggregates formed by ALS-associated mutant FUS. iScience. 2021;24(12):103504. Published 2021 Nov 25. doi:10.1016 / j.isci.2021.103504. This document found that circ-Hdgfrp3 binds to mutant FUS-positive aggregates in MNs under stress conditions, and the localization of circ-Hdgfrp3 changed after stress removal. This finding raises the hypothesis that long-term co-localization of circ-Hdgfrp3 with FUS inclusions under ALS-associated conditions can interfere with its transport and can interfere with its functional activity; the disadvantage of this document is that it does not confirm the biological function of circ-Hdgfrp3 and whether it regulates the ALS pathological process. SUMMARY
[0003] The purpose of the present application is to select a new circular RNA as an early diagnostic indicator and therapeutic target for ALS. circPTPRN2 is down-regulated in ALS SOD1D90A mutant motor neurons, and can be used as an early diagnostic marker for this mutant gene ALS. Overexpression of circPTPRN2 alleviates mitochondrial dysfunction in ALS motor neurons, providing a new treatment for ALS.
[0004] 1. A medicament for treating diseases, damages, degeneration associated with motor neuron damage in a patient, the medicament comprising: a circular RNA with circBank ID hsa_circPTPRN2_018 and a suitable pharmaceutical carrier.
[0005] 2. The medicament of item 1, wherein the pharmaceutical carrier is selected from a viral vector, a virus-like particle, a nanoparticle, an extracellular vesicle; preferably an adeno-associated virus.
[0006] 3. The medicament of item 1 or 2, wherein the patient is a vertebrate and / or invertebrate; preferably a mammal.
[0007] 4. The medicament of item 1 or 2, wherein the disease, impairment, degeneration associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, Kennedy disease, Parkinson's disease.
[0008] 5. Use of the circular RNA with circBank ID hsa_circPTPRN2_018 for the manufacture of a medicament for treating a subject with a disease, impairment, degeneration associated with motor neuron injury.
[0009] 6. The use of item 5, wherein the disease, impairment, degeneration associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, Kennedy disease, Parkinson's disease.
[0010] 7. The use of item 5 or 6, wherein in the manufacture of a medicament for treating a disease, impairment, degeneration associated with motor neuron injury, a suitable pharmaceutical carrier is used in addition to the circular RNA with circBank ID hsa_circPTPRN2_018.
[0011] 8. The use of item 7, wherein the pharmaceutical carrier is selected from the group consisting of a viral vector, a virus-like particle, a nanoparticle, an extracellular vesicle; preferably an adeno-associated virus.
[0012] 9. The use of item 7, wherein the subject is a vertebrate and / or invertebrate; preferably a mammal.
[0013] 10. A method of administering the medicament of any one of items 1-4, wherein the medicament of any one of items 1-4 is injected into the spinal canal of the subject, i.e. intrathecally.
[0014] 11. The medicament of item 4 and / or the use of any one of items 6-9, wherein the disease, impairment, degeneration associated with motor neuron injury comprises at least one of the group consisting of axonal swelling degeneration, mitochondrial dysfunction, and abnormal energy metabolism.
[0015] Optionally, wherein the mitochondrial function comprises at least one of the group consisting of mitochondrial membrane potential, ROS level, ATP production.
[0016] Optionally, the circular RNA is overexpressed in the subject.
[0017] Optionally, the circular RNA is capable of improving the decline of the mitochondrial membrane potential, increasing the level of ATP generation, and reducing the level of ROS.
[0018] Optionally, the circular RNA is capable of improving the axonal swelling degeneration of the patient.
[0019] 12. A method of treating a disease, impairment, degeneration associated with motor neuron injury in a patient, the method comprising: administering to the patient a circular RNA with circBank ID hsa_circPTPRN2_018.
[0020] 13. A marker for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, the marker comprising: a circular RNA with circBank ID hsa_circPTPRN2_018.
[0021] 14. A kit for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, the kit comprising: reagents for detecting the expression level of a circular RNA with circBank ID hsa_circPTPRN2_018.
[0022] 15. The kit of item 14, wherein the reagents for detecting the expression level of a circular RNA with circBank ID hsa_circPTPRN2_018 comprise: a primer set for amplifying the circular RNA.
[0023] Preferably, the primer set for amplifying the circular RNA comprises: primers with sequences as set forth in SEQ ID NO. 2 to SEQ ID NO. 5.
[0024] Optionally, the reagents for detecting the expression level of a circular RNA with circBank ID hsa_circPTPRN2_018 further comprise: RNA extraction reagents, reverse transcription reagents, and cDNA synthesis reagents.
[0025] 16. The kit of item 14, wherein the reagents for detecting the expression level of a circular RNA with circBank ID hsa_circPTPRN2_018 comprise: an antibody specifically binding to a circular RNA with circBank ID hsa_circPTPRN2_018 or an expression product thereof.
[0026] 17. A chip for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, the chip comprising: a probe or antibody for detecting the content of circRNA with circBank ID hsa_circPTPRN2_018.
[0027] 18. The chip of item 17, further comprising: a primer set for amplifying the circRNA.
[0028] Preferably, the primer set for amplifying the circRNA comprises primers with sequences as set forth in SEQ ID NO. 2 to SEQ ID NO. 5.
[0029] 19. A method for detecting a disease, impairment, degeneration associated with motor neuron injury, comprising the steps of:
[0030] contacting a sample to be detected with a primer set or primer probe composition that specifically binds to circRNA with circBank ID hsa_circPTPRN2_018;
[0031] or, contacting a sample to be detected with an antibody that specifically binds to circRNA with circBank ID hsa_circPTPRN2_018;
[0032] Preferably, the primer in the primer set or primer probe composition comprises primers with sequences as set forth in SEQ ID NO. 2 to SEQ ID NO. 5.
[0033] 20. The marker of item 13, and / or the kit of any one of items 14-16, and / or the chip of item 17 or 18, and / or the method for detecting of item 19, wherein the disease associated with motor neuron injury is selected from any one of the following group: amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA).
[0034] The beneficial technical effects achieved by the technical solutions of the present application
[0035] The patients suffering from ALS or SMA can be treated by the technical solutions of the present application, and the motor function of the patients can be improved by intrathecal delivery of adeno-associated virus overexpressing circPTPRN2, and the disease course can be delayed. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 is the iPSC adhesion situation of each group after drug screening. The adhesion of iPSCs of Circ group transfected with overexpression lentivirus, NC group transfected with control lentivirus and D90A group without virus transfected are shown after adding puromycin for 72 hours. It can be seen that cells of Circ group and NC group are survived, while no cell of D90A group is survived, which indicates that drug screening is successful.
[0037] Figure 2 is the verification of motor neuron transfection efficiency. Figure 2A is the GFP expression of D90D MN, D90A MN, OE-NC MN and OE-Circ MN groups. It can be seen that GFP is expressed in motor neurons of NC-OE and Circ-OE groups, indicating that lentivirus is successfully transfected into motor neurons. Figure 2B is the mRNA expression level of circPTPRN2 in each group detected by RT-qPCR, in which the overexpression efficiency of Circ-OE MN group is significantly higher than that of other groups.
[0038] Figure 3 is the mitochondrial membrane potential of each group of motor neurons. The left graph is TMRM staining mitochondria in living cells of D90D MN, D90A MN, NC-OE MN and Circ-OE MN. The fluorescence intensity of mitochondria in MN axons is evaluated by microscope photography to reflect the level of mitochondrial membrane potential. The right graph is a statistical analysis graph. It can be seen from the graph that the mitochondrial membrane potential of Circ-OE MN is significantly higher than that of D90A MN and NC-OE MN, indicating that CircRNA PTPRN2 can improve the decrease of mitochondrial membrane potential of D90A MN.
[0039] Figure 4 is the ATP generation of each group of motor neurons. It can be seen from the detection and statistics of ATP level of each group of motor neurons that the ATP level of Circ-OE group is significantly higher than that of other groups, indicating that overexpression of circRNA PTPRN2 can improve the ATP generation of D90A MN.
[0040] Figure 5 shows the survival of each group of mice. It is concluded that the median survival of mice injected with overexpression circ PTPRN2 adeno-associated virus is 21 days and 19 days longer than that of mice injected with PBS and control adeno-associated virus. G93A ALS SOD
[0041] Figure 6 shows that overexpression of CircPTPRN2 improves D90A MN axon degeneration. Figure 6A is a schematic diagram of axon swelling of four groups of MNs. Figure 6B is a statistical analysis graph of axon swelling results of four groups of MNs. The white arrow indicates the site of axon swelling. The result value is Mean±SEM, and *** represents P<0.001. Scale bar = 50 μm.
[0042] Figure 7 is the RT-qPCR detection of CircPTPRN2 expression levels in scAAV9-NC / CircPTPRN2 group mice.
[0043] Figure 8 is that overexpression of CircPTPRN2 improves motor function in SOD1G93A mice. Behavioral assessments of WT, SOD1G93A, scAAV9-NC and scAAV9-CircPTPRN2 group mice at different time points include: Figure 8A: results of the rotarod fatigue test in a line graph; Figure 8B: results of forelimb grip strength in a line graph; Figure 8C: results of hindlimb grip strength in a line graph; Figure 8D: results of the hanging grid test in a line graph; and Figure 8E: average stride length in gait analysis in a line graph; n = 6-14 mice per group. The result value is Mean ± SEM, * indicates statistical analysis P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0044] Figure 9 is that overexpression of CircPTPRN2 protects the neuromuscular junction in SOD1G93A mice. Figure 9A: results of EMG waveform in each group of mice at 14-20 weeks in a histogram; Figure 9B: results of CMAP amplitude peak in each group of mice in a histogram; Figure 9C: results of CMAP latency in each group of mice in a histogram; n = 6-13 mice per group, the result value is Mean ± SEM, * indicates statistical analysis P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0045] Figure 10 is that overexpression of CircPTPRN2 improves histopathology in SOD1G93A mice at the end stage of the disease. Figure 10A: gross observation of bilateral hindlimb gastrocnemius and tibialis anterior muscle in each group of mice at the end stage of the disease, TA: tibialis anterior muscle, GA: gastrocnemius; Figure 10B: statistical histogram of the mass ratio of gastrocnemius in each group of mice at the end stage of the disease; Figure 10C: representative graph and results of statistical analysis of gastrocnemius muscle fiber cross-sectional area in each group of mice; n = 3 mice per group, the result value is Mean ± SEM, * indicates statistical analysis P < 0.05, and *** indicates P < 0.001; scale bar = 50 μm.
[0046] Figure 11 is no obvious toxic effect of intrathecal injection of overexpression or negative control self-complementary adeno-associated virus on other organs of SOD1G93A mice. Figure 11A: Representative images of the structure of each organ tissue of the four groups of mice, the arrows respectively indicate the fibers and myocardial cells of the myocardium of the heart, the hepatic lobules and central veins of the liver, the red pulp and splenic corpuscles of the spleen, the alveoli and alveolar cavities of the lung, and the glomeruli and renal tubules of the kidney; Figure 11B: The weights of the heart, liver, spleen, lung and kidney of each organ of the four groups of mice at the end of the disease at 21 weeks, n = 3; Figure 11C: The weights of the heart, liver, spleen, lung and kidney of each organ of the four groups of mice after death, n = 3; the result value is Mean ± SEM, ns indicates no statistical significance; scale bar = 100 pm.
[0047] Figure 12 is the identification and expression verification of CircPTPRN2 ring structure. Figure 12A: Schematic diagram of CircPTPRN2 ring; Figure 12B: Sanger sequencing result of CircPTPRN2; the arrow indicates the reverse splicing site; Figure 12C: Agarose gel electrophoresis band diagram of CircPTPRN2; Figure 12D: RT-qPCR verification of CircPTPRN2 expression level in D90A MNs and D90D MNs; the result value is Mean ± SEM, ns indicates no statistical significance, and ** indicates P < 0.01.
[0048] Figure 13 is the expression level of CircPTPRN2 in the blood of ALS group patients and non-ALS group patients detected by RT-qPCR.
[0049] Figure 14 is a schematic diagram of the process of in vivo and in vitro experiments carried out by the present application to verify the function of circPTPRN2. DETAILED DESCRIPTION
[0050] The specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although specific embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present application can be more thoroughly understood and the scope of the present application can be accurately conveyed to those skilled in the art.
[0051] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It is further understood that unless specifically defined in this specification, the terms "including", "including but not limited to", and "comprising" are not intended as limiting and are used interchangeably. It is further to be understood that the description of a certain feature does not indicate that all and only those features are present by implication, other features can or can not be present. It is further to be understood that the description of any feature as an "aspect" does not indicate that all and only those features are present by implication, other features can or can not be present. It is intended that the specification set forth the breadth of the application and any claims eventually drafted will be construed in accordance with the full breadth and scope of the claims, without undue restriction. The specification and drawings are accordingly to be regarded in an illustrative rather than a restrictive sense.
[0052] As used herein, "substantially free of," with respect to a particular component, is used to denote that the particular component has not been deliberately formulated into the composition and / or is present only as a contaminant or in trace amounts. Thus, the total amount of a particular component resulting from any inadvertent contamination of the composition is less than 0.05%, preferably less than 0.01%. Most preferably, compositions are contemplated wherein the amount of a particular component is not detectable by standard analytical methods.
[0053] As used in this specification, "a" or "an" can mean one or more. As used in the claims, the word "a" or "an" when used in conjunction with the word "comprising" can mean one or more than one.
[0054] The term "or" is used in the claims as a total or as an alternative to the limitation that it follows, unless explicitly indicated to the contrary. As used herein, "another" can mean at least a second or more.
[0055] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects over time.
[0056] The methods for obtaining the various biological materials described in the examples are provided only to achieve the specific purposes disclosed and should not be construed as limiting the source of the biological materials used in the present application. In fact, the source of the biological materials used is broad and any biological material that can be obtained without violating the law and the ethical principles of morality can be used as a replacement according to the indications in the examples.
[0057] The present application provides, in a first aspect, a medicament for treating a disease associated with motor neuron injury.
[0058] In one embodiment, a medicament for treating a disease associated with motor neuron injury is provided, the medicament comprising: a circRNA of circBank ID hsa_circPTPRN2_018 and a suitable pharmaceutical carrier. Herein, the sequence of the circRNA of circBank ID hsa_circPTPRN2_018 is shown in SEQ ID NO. 1:
[0059] In the context of the present specification, circBank (http: / / www.circbank.cn / index.html) is a database that can obtain human circRNA sequences. circBank is a comprehensive human circRNA database, which includes more than 140000 human annotated circRNAs from different sources. In addition to the basic information of circRNA, it also includes information such as miRNA binding predicted by two methods, circRNA protein coding potential, circRNA conservation, circRNA modification such as mutation and methylation, etc.
[0060] The reason for the applicant to choose the circRNA of hsa_circPTPRN2_018 is: first, through literature review, it is found that circRNA is specifically expressed in neural tissue and can play an important regulatory function in neurodegenerative diseases; second, the applicant found and verified the down-regulation of circRNA expression of hsa_circPTPRN2_018 in motor neurons carrying ALS mutant gene SOD1 through sequencing and qPCR, so we choose to overexpress the circRNA to observe whether it can alleviate the disease phenotype of ALS motor neurons.
[0061] In one embodiment, a medicament is provided, wherein the pharmaceutical carrier is an adeno-associated virus.
[0062] In the context of the present specification, "adeno-associated virus" as "pharmaceutical carrier" has various methods of use, and the measures taken by the applicant in animal experiments are: injecting adeno-associated virus overexpressing circRNA into the spinal canal of mice. The way to introduce circRNA into the body of patients in clinical trials is limited, and the commonly used method is to inject adeno-associated virus overexpressing circRNA into the spinal canal of patients. Herein, any technical means that can introduce circRNA into the body of patients and have a therapeutic effect are suitable.
[0063] In still another specific embodiment, a medicament is provided, wherein the disease associated with motor neuron impairment is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA).
[0064] In the context of the present specification, amyotrophic lateral sclerosis (ALS), also known as ALS, is a chronic and progressive neurological disease that mainly damages upper and lower motor neurons and the muscles of the trunk, limbs and head and face. The cause of this disease is not clear, which may be related to genetic factors, lifestyle, exposure to toxic substances, excessive physical labor, low body mass index, head trauma history, metabolic diseases, abnormal autoimmune function and other factors; the peak incidence usually occurs at the age of 45 or above, and the incidence in men is higher than that in women. The main clinical manifestations of amyotrophic lateral sclerosis are progressive skeletal muscle weakness, muscle atrophy, muscle bundle tremor and bulbar palsy, which will gradually worsen with the development of the disease, and even affect the respiratory muscles, leading to dyspnea. Patients may also experience symptoms such as numbness, limb paralysis, weight loss, arrhythmia, and may also face emotional problems such as depression and anxiety. Parkinson's disease, also known as "paralysis agitans", is a neurodegenerative disease. The main cause of this disease is the degeneration and death of dopaminergic neurons in the substantia nigra, which may be related to genetics, environmental factors and aging of the nervous system; it is recognized that aging is the most important factor in the occurrence of Parkinson's disease, and the disease has a significant old age high incidence characteristic, and the incidence in men is slightly higher than that in women; the symptoms of Parkinson's disease are different, mainly including motor and non-motor symptoms; motor symptoms include static tremor, muscle rigidity, motor retardation and posture balance disorder; non-motor symptoms mainly include constipation, olfactory dysfunction, sleep disorders, autonomic nervous dysfunction, and mental and cognitive disorders. Spinal muscular atrophy (SMA), also known as progressive spinal muscular atrophy and spinal muscular atrophy, is a disease caused by degeneration of motor neurons in the anterior horn of the spinal cord and brainstem motor nuclei, leading to muscle weakness and muscle atrophy. It is an autosomal recessive genetic disease and is not uncommon in clinical practice. According to the age of onset and the severity of muscle weakness, it is clinically divided into three types: SMA-I, SMA-II and SMA-III, i.e. infantile type, intermediate type and juvenile type. The common feature is the degeneration of the anterior horn cells of the spinal cord, and the clinical manifestations are progressive, symmetrical, extensive flaccid paralysis and muscle atrophy mainly in the proximal limbs. Intelligence development and sensation are normal. The difference between each type is determined according to the age of onset, the speed of disease progression, the degree of muscle weakness and the length of survival. There is no specific and effective treatment for this disease, and the main treatment measures are to prevent or treat complications such as pneumonia, malnutrition, skeletal deformity, movement disorders and mental and social problems caused by severe muscle weakness.
[0065] In yet another specific embodiment, a medicament is provided, wherein the patient is a mammal. Specifically, the mammal includes, but is not limited to, tiger, wolf, mouse, rat, mink, monkey, zebra, fox, bear, elephant, leopard, musk ox, lion, small panda, warthog, antelope, reindeer, koala, rhinoceros, lynx, giraffe, panda, anteater, orangutan, manatee, otter, civet, dolphin, walrus, hedgehog, polar bear, kangaroo, armadillo, hippopotamus, seal, whale, weasel, and common domestic animals and pets; specifically, the domestic animals include, but are not limited to, horse, cow, sheep, pig, chicken; specifically, the pets include, but are not limited to, cat, dog, hamster, rabbit.
[0066] The present application provides, in a second aspect, a pharmaceutical use of a specific circular RNA.
[0067] In one specific embodiment, a use of a circular RNA with circBank ID of hsa_circPTPRN2_018 in the preparation of a medicament for treating a disease related to motor neuron injury is provided.
[0068] In yet another specific embodiment, the above use is provided, wherein the disease related to motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA).
[0069] In yet another specific embodiment, the above use is provided, wherein, in the preparation of a medicament for treating a disease related to motor neuron injury, a suitable pharmaceutical carrier is used in addition to the circular RNA with circBank ID of hsa_circPTPRN2_018.
[0070] In one specific embodiment, the above use is provided, wherein the pharmaceutical carrier is an adeno-associated virus.
[0071] In yet another specific embodiment, the above use is provided, wherein the patient is a mammal.
[0072] The present application provides, in a third aspect, a method of administering a medicament.
[0073] In yet another specific embodiment, the above method of administering a medicament is provided, wherein the medicament as described above is injected into the spinal canal of the patient; here, the "patient" can be an animal or a human, which should be understood in a broad sense.
[0074] Example section
[0075] The reagents involved in the present application are as follows:
[0076] DMH1 (Tocris, UK), is the abbreviation of Dorsomorphin Homolog 1, is a BMP signaling pathway inhibitor;
[0077] SB431542 (Tocris, UK), is a TGF-β receptor inhibitor;
[0078] CHIR99021 (Tocris, UK), is a GSK-3β inhibitor;
[0079] RA (Tocris, UK), namely Retinoic Acid, also known as retinoic acid;
[0080] SAG (Selleck, USA), is Smoothened Agonist, namely smooth agonist;
[0081] DMEM / F12 (purchased from Gibco, USA);
[0082] Neurobasal (purchased from Gibco, USA);
[0083] N2 (purchased from Gibco, USA), namely N2 Supplement, namely N2 cell culture additive;
[0084] B27 (purchased from Gibco, USA), namely B-27 Supplement, namely B-27 cell culture additive;
[0085] AA (purchased from Sigma, USA), namely Arachidonic Acid, namely ascorbic acid;
[0086] Glutamax (purchased from Gibco, USA), is a cell culture additive;
[0087] P / S, namely penicillin-streptomycin mixed solution.
[0088] ALS SOD1 mutant-derived D90A MNs exhibit ALS-related pathological phenotypes, and many studies have reported that many ALS patients carrying SOD1 D90A mutations clinically often show first lower extremity paralysis, then slowly progress to upper extremities, and finally involve medullary muscles, etc. In this application, the iPSCs are provided by Professor Zhang Sunchun's team of Waisman Center, University of Wisconsin, USA. D90A iPSCs line and normal control ALS SOD1 D90D iPSCs line (referred to as D90D iPSCs and D90A iPSCs, the number of passages is not more than 50 times).
[0089] In the present application, the function of circPTPRN2 is verified by in vivo and in vitro experiments. The process of in vivo and in vitro experiments is shown in Figure 14, and is described in the following examples.
[0090] Example 1 Effect of circPTPRN2 on mitochondrial function (in vitro cell experiment):
[0091] ① Experimental supplies:
[0092] 1) Experimental materials: 35mm confocal dish, sterile gun head, sterile centrifuge tube, sterile pipette.
[0093] 2) Cell culture reagents: DMEM / F-12 medium, Neurobasal medium, DMEM / F12, GlutaMax, AA, B27, N2, RA, SAG, BDNF, GDNF, IGF, Compound E.
[0094] 3) Mitochondrial dye: TMRM.
[0095] 4) Induction and drug screening reagents: doxy (doxycycline hydrochloride), puromycin, Bicyclomycin S0027 enhanced ATP detection kit.
[0096] 5) Instruments: CO2 cell incubator, biological safety cabinet, electric pipette and Olympus confocal microscope, microplate reader.
[0097] ② Experimental method: The overexpression lentivirus vector construction and packaging were completed by Jikai Company, and the process included: A) Preparation of overexpression lentivirus clone. Linearized vector was obtained by restriction enzyme digestion, and PTPRN2 gene fragment (SEQ ID NO. 1) was prepared by PCR amplification. The reaction system was prepared with linearized vector and target gene amplification product, and the recombination reaction was carried out to realize the in vitro circularization of linearized vector and target gene fragment. The recombination product was directly transformed, and the single colony on the plate was identified by PCR. The positive clone was sequenced and the results were analyzed. The correct clone broth was cultured and extracted to obtain high-purity plasmid. B) Packaging lentivirus. Jikai used a tool vector plasmid and two virus packaging auxiliary plasmids to co-transfect 293T cells. Virus collection supernatant of un-purified cells was carried out at 48-72h after transfection, and high-titer overexpression CircPTPRN2 lentivirus stock solution was obtained by centrifugal shrinkage concentration purification. After obtaining, it was placed in a-80 degree refrigerator and could be stored for one year.
[0098] 1) iPSCs overexpressing circPTPRN2 are obtained: The appropriate amount of lentivirus overexpressing circPTPRN2 and control lentivirus are prepared in advance, and divided into control lentivirus transfection group (NC-OE) and overexpression lentivirus transfection group (Circ-OE). After the ALS mutant iPSC cells are digested with dispase, they are washed twice with DF-12, then the medium is added, the target clone is gently blown off with a 200ul gun head, the clone is blown off with a 1ml gun head, and the gun head is first wetted with DF-12 to avoid the clone sticking to the gun head wall, and then 10ul of trypan blue is mixed for counting. According to the instructions, the amount of cells infected in a 6-well plate is 200,000, so the cells are divided into corresponding amounts, NC-OE at least two holes, Circ-OE at least two holes.
[0099] Then the cell suspension is transferred to a clean EP tube, 250ul / tube. Add the corresponding virus amount 6.67ul, this time the NC multiplicity of infection (MOI) is 5, the circ multiplicity of infection (MOI) is 5, after adding the virus, add 750ul of medium and mix gently, then cover the lid and put it in the incubator for half an hour. After half an hour, take out the EP tube and add the cells to each well of the 6-well plate, and add Rho 1ul per well.
[0100] After transfection for 72h, add puromycin 1.5ug / ml for drug screening, continue to screen for three days, then expand the remaining iPSC clones, add doxy for induction for one day, then observe the expression of GFP under a microscope to determine whether the transfection is successful. The iPSC stable transfection strain stably overexpressing CircPTPRN2.
[0101] 2) Differentiate iPSC overexpressing CircPTPRN2 into mature motor neurons. Human iPSCs are directionally differentiated into neuroepithelial cells (NEP) in vitro, the small molecules in NEP medium are DMH1 (2 mM) + SB431542 (2 mM) + CHIR99021 (3 mM); NEP is directionally differentiated into spinal MNP in vitro, the small molecules in MNP medium are DMH1 (2 mM) + SB431542 (2 mM) + CHIR99021 (1 mM) + RA (0.1 mM) + SAG (0.5 mM); spinal motor neuron progenitor cells are directionally differentiated into post-mitotic spinal motor neurons in vitro, the motor neuron progenitor cells are resuspended after digestion for suspension culture, the small molecules in MN medium are RA (0.5 mM) + SAG (0.1 mM), and MNP is directionally differentiated into post-mitotic motor neurons after 7 days, which specifically express Hb9 and Tuj1 after adhesion; matrigel-coated 24-well plates are operated on ice and overnight; MN maturation medium is prepared in the dark, and the medium is the same as the MN medium (4.7 mL DMEM / F12 + 4.8 mL Neurobasal + 0.05 mL N2 + 0.1 mL B27 + 0.1 mL AA + 0.1 mL Glutamax + 0.1 mL P / S + 5 uL RA (0.5 mM) + 1 uL SAG (0.1 mM), but Compound E (0.5 mM) needs to be added for the first 3 days, the MN balls on the 19th day of differentiation are digested into single or several cells with Accutase, and are seeded in matrigel-coated 24-well plates, which are cultured at 37°C, 5% CO2, and the compound E is removed after 3 days of adhesion, and the culture is continued for 7 days (equivalent to a total of 10 days); post-mitotic neurons are not mature, and post-mitotic motor neurons continue to be cultured for 10 days under the action of notch signal inhibitor Compound E, and specifically express Chat and Map2. MN is induced to express CircPTPRN2 by adding doxy (1 mg / ml) on the third day after adhesion. Mature motor neurons overexpressing CircPTPRN2 can be obtained on the 10th day after adhesion. The overexpression efficiency of CircPTPRN2 is verified by RT-qPCR. Total RNA is extracted by RNA extraction kit RC112 (purchased from Norgen), cDNA is synthesized by reverse transcription kit FSQ-101 (purchased from toyobo, DNase I is purchased from Norgen), and RT-qPCR is performed on the obtained cDNA; the kit for RT-qPCR is RR420A purchased from Takara, and the method for using the kit is referred to for this part of the experiment. The primers involved in this part of the experiment are as follows:
[0102] CircPTPRN2 gene F: CTCATCCCAGTTCAGCGACG (SEQ ID NO. 2), CircPTPRN2 gene R: GAACTTGGTGGAGTCTTCTTGCT (SEQ ID NO. 3);
[0103] GAPDH gene F: CATGAGAAGTATGACAACAGCCT (SEQ ID NO. 4), GAPDH gene R: AGTCCTTCCACGATACCAAAGT (SEQ ID NO. 5).
[0104] wherein the GAPDH gene is a reference gene.
[0105] 3) Motor neuron live cell mitochondrial membrane potential staining. Four groups of motor neurons were obtained according to the above differentiation steps, which were ALS SOD1 mutant D90A group (referred to as D90A MN) and mutant gene correction D90D group (referred to as D90D MN), transfection control lentivirus group (referred to as NC-OE MN), and overexpression CircPTPRN2 group (referred to as Circ-OE MN).
[0106] TMRM dye was used to label mitochondrial membrane potential, and an appropriate amount of DMSO was mixed with TMRM stock solution to prepare 200 nM TMRM dye reagent. 1 μl of TMRM was taken and added to a 1 ml confocal dish containing motor neurons, and then incubated in a 37 degree incubator for half an hour. Subsequently, the culture medium was aspirated and washed with DF-12, fresh culture medium and a small amount of TMRM dye were added to a final concentration of 25 nM, and then placed back in the incubator for 10 minutes. The dyed confocal dish was placed under a confocal microscope for observation and photography, the laser excitation wavelength was set to 594, and the layer with the strongest fluorescence intensity was selected for photography. ImageJ was used to count the fluorescence intensity of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN groups.
[0107] 4) Evaluation of ATP production in motor neurons. After 13 days of plating D90D MN, D90A MN, OE-NC MN, OE-Circ MN into 24-well plate, the level of ATP production was detected. The reagents for detection were prepared in advance on ice, including ATP detection working solution, ATP standard solution with multiple concentration gradients, i.e. standard. After the formal detection started, the motor neuron medium was first aspirated, and 80 microliters of lysis solution was added to lyse the cells in each well. To lyse the cells sufficiently, a pipette was used to repeatedly blow or shake the culture plate to make the lysis solution fully contact and lyse the cells. After lysis, centrifugation was performed at 12000g at 4°C for 5 minutes, and the supernatant was taken as the sample of each group. 100 microliters of ATP detection working solution was added to the detection well or detection tube. It was placed at room temperature for 3-5 minutes to make all the background ATP consumed, thereby reducing the background. 20 microliters of sample or standard was added to the detection well or detection tube, and quickly mixed with a gun (micropipette). At least 2 seconds later, the RLUs or CPMs were determined by a chemiluminescence instrument (luminometer) or liquid scintillation instrument. At the same time, the protein concentration of each group was detected by a protein concentration kit.
[0108] According to the standard curve and the protein concentration of each group, the normalized ATP concentration in the D90D MN, D90A MN, OE-NC MN, and OE-Circ MN groups was calculated.
[0109] ③ Experimental results:
[0110] Figure 1 shows the iPSC adhesion of each group after drug screening.
[0111] The adhesion of iPSC after adding puromycin for 72 hours in the Circ group transfected with overexpression lentivirus, the NC group transfected with control lentivirus, and the D90A group transfected with virus is shown in the figure. It can be seen that cells remain in the Circ group and the NC group, while no cells remain in the blank D90A group, indicating that the drug screening is successful.
[0112] Figure 2 shows the transfection efficiency verification of motor neurons.
[0113] Figure A shows the GFP expression of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN. It can be seen that the motor neurons of the NC-OE and Circ-OE groups have GFP expression, indicating that the lentivirus has successfully transfected into the motor neurons. Figure B shows the mRNA expression level of circPTPRN2 in each group detected by RT-qPCR, and the overexpression efficiency of the Circ-OE MN group is significantly higher than that of other groups.
[0114] Figure 3 shows the mitochondrial membrane potential of motor neurons in each group.
[0115] The left graph shows that TMRM stains mitochondria in D90D MN, D90A MN, NC-OE MN, and Circ-OE MN live cells. The fluorescence intensity of mitochondria in MN axons is evaluated by microscopy to reflect the level of mitochondrial membrane potential. The right graph is a statistical analysis. The mitochondrial membrane potential of Circ-OE MN is significantly higher than that of D90A MN and NC-OE MN, indicating that CircRNA PTPRN2 can improve the decrease of mitochondrial membrane potential in D90A MN.
[0116] Figure 4 shows the ATP generation of motor neurons in each group.
[0117] The ATP levels of the Circ-OE group were significantly higher than those of the other groups, indicating that overexpression of circRNA PTPRN2 can improve the ATP generation of D90A MN.
[0118] The above results are summarized: mitochondria are the energy center of cells, responsible for producing most of the energy molecules required by cells, adenosine triphosphate (ATP). Mitochondrial dysfunction can lead to decreased energy production, increased oxidative stress, mitochondrial DNA damage, and other phenotypes, impairing the function of cells and tissues. Mitochondrial dysfunction has been reported in several articles on neurodegenerative diseases, including ALS. Mitochondrial dysfunction can be defined as a decrease in mitochondrial respiratory capacity, a decrease in mitochondrial membrane potential, an increase in oxygen radical production, and abnormalities in mitochondrial mass and oxidative phosphorylation. In this patent, overexpression of circPTPRN2 can alleviate some mitochondrial dysfunction, including increasing the mitochondrial membrane potential and ATP production of ALS MN, thus becoming a possible treatment strategy for ALS.
[0119] Alternative solutions:
[0120] In the above step 2), the matrigel-coated glass slides used to culture motor neurons can be replaced with plo and laminin-coated, and the specific experimental protocol is as follows:
[0121] After placing sterile glass slides in a 24-well plate, add 80ul plo (0.1mg / ml), and place in a 37℃, 5% CO2 incubator for overnight coating. On the second day, remove the plate and discard the plo, wash with sterile BI water for 2-3 times, then add 50ul laminin per well, and place in a 37℃, 5% CO2 incubator for 2 hours of coating. Then add the motor neuron pellet suspension to the glass slides, and place in a 37℃, 5% CO2 incubator for adhesion. After 1 hour, remove the cell plate and add fresh MN culture medium 500ul / well, then change the medium every other day. After 10 days, mature motor neurons are obtained.
[0122] Other steps are the same as above.
[0123] Figure 6 shows that overexpression of CircPTPRN2 improves D90A MNs axonal degeneration, specifically four groups of MNs axonal swelling schematic diagram and result statistical analysis diagram, white arrow indicates the axonal swelling site. The result value is Mean ± SEM, *** represents P < 0.001. Scale bar = 50 μm. In order to explore whether overexpression of CircPTPRN2 can improve the axonal degeneration of D90A MNs, the present application refers to the above method to obtain mature D90D MNs, D90A MNs, NC-OE MNs, Circ-OE MNs in vitro using chemical small molecules to induce iPSCs differentiation, and then observe the axonal morphology of the four groups of MNs on the 20th day under a microscope. The results are shown in Figure 6: overexpression of CircPTPRN2 can significantly reduce the number of axonal swelling of D90A MNs on the 20th day, and improve the axonal degeneration (Figures 6A, 6B).
[0124] Example 2 Intrathecal injection of adeno-associated virus overexpressing CircPTPRN2 prolongs the survival of ALS mice (in vivo experiment using mice)
[0125] Previous studies have reported that the mitochondria of ALS patients and ALS SOD1 G93A The activity of oxidative phosphorylation (OXPHOS) complex in the mitochondria of mouse models is significantly impaired. Mitochondrial dysfunction leads to axonal degeneration, which is a prominent early event before the loss of MNs. The following experiments were performed on ALS SOD1 G93A mice.
[0126] The experimental animals were genetically engineered C57 mice with genotype SOD1 G93A , 6-8 weeks old, purchased from Hubei Youdu Co., Ltd. The experimental mice were raised in the Experimental Animal Center of Tongji Hospital, and the room temperature was maintained at 25±2℃, with 12 / 12h light-dark alternation, free access to food and water. All animal experimental procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals. The experimental protocol was reviewed and approved by the Experimental Animal Welfare and Ethics Committee of Tongji Hospital, Huazhong University of Science and Technology.
[0127] ① Experimental supplies:
[0128] 1) Experimental materials: 25ul microsyringe
[0129] 2) Experimental reagents: 3% sodium pentobarbital, PBS, overexpression of circPTPRN2 adeno-associated virus (purchased from Jikai), control adeno-associated virus (purchased from Jikai).
[0130] ② Experimental method:
[0131] 1) Obtaining adeno-associated virus overexpressing circPTPRN2.
[0132] A) First, prepare an adeno-associated virus clone overexpressing circPTPRN2. The steps are the same as in "Lentinvirus Preparation". Specifically, obtain a linearized vector using restriction endonuclease digestion, and prepare the PTPRN2 gene fragment using PCR amplification. Prepare a reaction system using the linearized vector and the target gene amplification product, and perform a recombination reaction to achieve in vitro circularization of the linearized vector and the target gene fragment. Transform the recombinant product directly, select single clones from the plate for PCR identification, and sequence and analyze the results of positive clones. Expand and extract the correct clone culture to obtain a high-purity plasmid.
[0133] B) Adeno-associated virus (AAV) packaging. Jikai Biotechnology used a three-plasmid system—GV series AAV9 vector, pHelper vector, and pAAV-RC vector—to co-transfect HEK 293T cells. Virus harvest (i.e., unpurified cell supernatant and cell pellet) was performed 72 hours after transfection. High-purity AAV9 virus overexpressing CircPTPRN2 was obtained by gradient density centrifugation and stored in a preservation solution. The resulting solution can be stored at -80°C for one year.
[0134] 2) Intrathecal injection: Mice were fasted for 24 hours prior to intrathecal injection, but water was allowed. The mice were weighed using an electronic weigher and the weight was recorded. Anesthesia was administered via intraperitoneal injection of 3% sodium pentobarbital (0.5 ml / 100 g). Successful anesthesia was indicated by no response to tail or paw pinching and the disappearance of corneal reflex. Specific groupings were as follows: wild-type mice and SOD1... G93A Mice were randomly divided into 4 groups: 1. Wild-type mice injected with PBS (wild-type, n=10); 2. SOD1 G93A Mice injected with PBS (SOD1) G93A (n=10); 3.SOD1 G93A Mice were injected with the negative control group of complementary adeno-associated virus (scAAV9-NC, n=10); 4. SOD1 G93AMice were injected with CircPTPRN2-expressing self-complementary adeno-associated virus groups (scAAV9-CircPTPRN2, n=9). Sterile operation was performed during the operation process, and the environmental temperature was controlled at about 28°C. The successfully anesthetized mouse was fixed on the operation table in a prone position, and the limbs were fixed with tape; the hair at the lumbar vertebrae site was removed with an electric shaver, and the pink skin was exposed; the right hand held forceps dipped in alcohol cotton ball gently wiped the skin at the lumbar vertebrae; the blade was slowly drawn along the lumbar vertebrae for 1.5-2.0 cm, and the skin was slowly probed until the lumbar spine process was fully exposed; the experimenter's non-dominant hand fixed the mouse's head and upper body, and the iliac crest hip was firmly fixed with the thumb and index finger, so as to accurately position later. The spinous process of L6 was used as the positioning mark (the most prominent spinous process of the mouse), and a micropipette (25 μl) was used to puncture at the center point between L5 and L6 segments. After piercing the skin, the experimenter could feel the micropipette "sliding into" between the vertebrae, at which time the needle insertion speed should be slowed down as much as possible. After continuing to enter a few millimeters, the mouse's tail would appear to pop or appear "S" shape swing, which was considered as a sign of successful puncture. Then a total volume of 10 μl of adeno-associated virus was injected into the subarachnoid space at a constant rate of 10 μl / min (no more than 10 μl for a single injection), and then the micropipette was rotated out to complete the intrathecal injection of the mouse.
[0135] 3) Observe the state of the mouse, change the cage, change the bedding and change the water every week, and record the survival time of the mouse.
[0136] 4) The end of the experiment: when the motor function of the ALS mouse degenerates seriously, the mouse cannot stand up within 30 seconds of lateral recumbency, and is sacrificed.
[0137] ③ Experimental results:
[0138] Figure 5 shows the survival time of mice in each group.
[0139] By comparing and analyzing, it is concluded that the median survival time of mice injected with circPTPRN2-expressing adeno-associated virus groups is prolonged by 21 days and 19 days (SOD G93A SOD G93A -PBS vs SOD G93A -circPTPRN2 P<0.01; SOD G93A -NC vs SOD G93A -circPTPRN2 P<0.05). It is suggested that the injection of circPTPRN2-expressing adeno-associated virus into ALS SOD G93A Intrathecal delivery of circPTPRN2-expressing adeno-associated virus can significantly prolong the survival time of mice.
[0140] Example 3 RT-qPCR detection of CircPTPRN2 expression level in scAAV9-NC / CircPTPRN2 group mice (in vivo experiment using mice)
[0141] The kit for RT-qPCR was purchased from Takara Company, and the experimental part was performed according to the use method of the kit. The primers involved in this part of the experiment are as follows, and other related primers are shown in Example 1:
[0142] Mouse CircPTPRN2 gene F: CCACATGATCCTGAAGGGAAAGC (SEQ ID NO. 6), Mouse CircPTPRN2 gene R: GCAATGGAGAGGAAGGTGAGC (SEQ ID NO. 7).
[0143] Mouse Actin gene F: GTGACGTTGACATCCGTAAAGA (SEQ ID NO. 8), Mouse Actin gene R: GCCGGACTCATCGTACTCC (SEQ ID NO. 9).
[0144] The specific results are shown in Figure 7. The RT-qPCR results show that the expression level of CircPTPRN2 in the scAAV9-CircPTPRN2 group mice is about 2.7 times that of the scAAV9-NC group, indicating that the self-complementary adeno-associated virus is successfully transfected into the mouse spinal cord and overexpresses CircPTPRN2.
[0145] Example 4 Behavioral assessment (in vivo experiment using mice)
[0146] All mice need to be adapted before all behavioral tests.
[0147] 1) Grip strength test
[0148] The grip strength of the mice was evaluated once a week using a grip strength meter at the 8th week (the day of injection) and 4 weeks after injection. The grip strength meter with a grid was used to obtain the grip strength of each mouse. The mouse was lifted by holding the skin at the back of the neck, and then the tail of the mouse was gently pulled. The forelimbs or hindlimbs of the mouse were placed on the grid of the grip strength meter. When the mouse voluntarily grabbed the grid, the tail of the mouse was gently pulled horizontally backward until the mouse released the grid. At this time, the peak grip strength was automatically recorded by the grip strength meter. After the measurement was completed, the grip strength data was collected. Each mouse was tested 5-6 times, and the average grip strength of the mice in each group was compared after removing the maximum and minimum values.
[0149] 2) Rotarod test
[0150] The mice were placed in their respective compartments on the rotarod and the acceleration of the horizontal rod was set to 4 rpm / s. After the device was started, the rotating rod gradually accelerated from an initial speed of 5 rpm / s to a final speed of 40 rpm / s over a period of 5 min. The mice maintained their balance by running on the rod or by holding onto the rod. When the mice fell, the instrument automatically recorded the latency to fall. Each mouse was tested three times with at least a 5 min interval between each test. The average latency to fall for each mouse was recorded and analyzed for differences between groups.
[0151] 3) Grid suspension test
[0152] The mice were placed in their respective compartments on the rotarod and the acceleration of the horizontal rod was set to 4 rpm / s. After the device was started, the rotating rod gradually accelerated from an initial speed of 5 rpm / s to a final speed of 40 rpm / s over a period of 5 min. The mice maintained their balance by running on the rod or by holding onto the rod. When the mice fell, the instrument automatically recorded the latency to fall. Each mouse was tested three times with at least a 5 min interval between each test. The average latency to fall for each mouse was recorded and analyzed for differences between groups.
[0153] (1) A small cardboard box with dimensions of approximately 25 cm in length, width, and height was assembled without a lid. A wire mesh plate (10 mm x 10 mm) was used as the lid, and a foam pad was placed underneath to prevent injury to the mice when they fell and to ensure a high enough height to prevent the mice from voluntarily jumping off.
[0154] (2) The test mouse was placed on the grid, and then the grid was immediately inverted so that the mouse was hanging on the grid. At the same time, a timer was started. The test ended when the mouse fell or had been hanging on the grid for 3 min, and the mouse’s persistence time was recorded. Each mouse was tested a maximum of two times, with at least a 2 min rest between tests. The second test was only performed if the mouse did not reach 3 min in the first test. After each test, the mouse was returned to its cage.
[0155] 4) Gait test
[0156] The mice were placed on the transparent runway for gait recording, and a camera was used to capture the footprint video underneath the runway. The speed of the conveyor belt was set to 8 cm / s. The captured video was analyzed objectively by the system to quantify gait parameters, including foot contact time, swing time, footprint area, inter-step interval, and foot area. The collected data were compared and analyzed.
[0157] Specific results are shown in FIG. 8. As shown in FIG. 8A, the rotarod test results showed that the duration of the mice in the scAAV9-CircPTPRN2 group on the rotarod was longer than that of the mice in the scAAV9-NC group at week 13 (P = 0.044), and the time was longer than that of the SOD1G93A Group vs scAAV9-NC Group mice (17w: vs SOD1 G93A P=0.04, vs scAAV9-NC P<0.001; 19w: vs SOD1 G93A P=0.001, vs scAAV9-NC P=0.006;). As shown in FIG. 8B, forelimb grip strength test results showed that the grip strength of scAAV9-CircPTPRN2 Group mice was greater than SOD1 G93A Group mice (P=0.012), as shown in FIG. 8C, hindlimb grip strength results showed that the grip strength of scAAV9-CircPTPRN2 Group mice was greater than SOD1 G93A Group (14w: P=0.006, 17w: P=0.036, 19w: P=0.003), and was greater than the grip strength of scAAV9-NC Group mice at 15 weeks (P=0.04). As shown in FIG. 8D, the results of the hanging grid test showed that the duration of scAAV9-CircPTPRN2 Group mice was longer than that of scAAV9-NC Group mice at 17 weeks (P<0.001). As shown in FIG. 8E, gait analysis results showed that the average stride length of scAAV9-CircPTPRN2 Group mice was significantly longer than that of SOD1 G93A Group vs scAAV9-NC Group mice (vs SOD1 G93A P=0.004, vs scAAV9-NC P=0.037), and was significantly longer than SOD1 G93A Group (P=0.005). The above results suggest that overexpression of CircPTPRN2 can improve the motor function of SOD1 G93A mice at different stages of the disease, including grip strength, endurance, coordination and balance, and average stride length in gait.
[0158] Example 5 Electromyography test (EMG) and compound muscle action potential (CMAP)
[0159] The steps of electromyography (EMG) detection are as follows:
[0160] Electromyography (EMG) evaluation was performed at 14 weeks of age, 17 weeks of age, and 20 weeks of age, respectively.
[0161] 1) The mouse was anesthetized with isoflurane (1%-1.5%) by mask inhalation, and the right lateral gastrocnemius muscle of the mouse was depilated with depilatory cream, and the corresponding skin was exposed.
[0162] 2) The ring-shaped recording electrodes representing the anode and cathode were inserted into the distal gastrocnemius muscle belly, and the two recording electrodes should be kept no more than 5 mm apart. A ground electrode was inserted into the tail to minimize artifacts.
[0163] 3) The EMG signals were amplified by Z2J-AMP-NCC08 amplifiers and digitized by a data acquisition system. The signal sampling rate was set to 1000 Hz, and the sampling time was 2 min. The data were stored in a computer for subsequent analysis. 5-6 potential values were recorded for each mouse, and the electromyogram waveform of each group was exported. Finally, statistical analysis was performed on all collected potentials.
[0164] The method of evaluating Compound Muscle Action Potential (CMAP) is as follows:
[0165] CMAP evaluation was performed at the 8th week of age (the day of injection), 14th week of age, 15th week of age, 17th week of age, and 20th week of age, respectively.
[0166] 1) The mice were anesthetized with isoflurane (2%-3%) according to the method described above, and the anesthesia was maintained using a mask to maintain a constant flow of 1%-1.5% isoflurane. The CMAP induced by gastrocnemius muscle was measured.
[0167] 2) First, use hair removal cream to completely remove the hair on the right hind limb and lower back of the mouse. Place the reference recording electrode on the ankle of the right hind limb, and place the active recording electrode on the muscle belly of the right gastrocnemius muscle.
[0168] 3) To stimulate the sciatic nerve, a pair of anode and cathode needles were inserted into the ipsilateral paraspinal and proximal hind limb regions near the sciatic nerve for stimulation. A ground electrode was placed on the tail to minimize artifacts.
[0169] 4) To obtain the CMAP response of each group of mice, the stimulation intensity was gradually increased from 0 mA, and the supramaximal stimulation was determined as 120% of the stimulation intensity, and the response amplitude was no longer increased. The baseline peak value induced by supramaximal stimulation (about 3 mA) and the peak CMAP amplitude were added, and the latency of the waveform appearance was recorded. 3-5 maximum CMAP responses were recorded for each mouse.
[0170] 5) The average value of the successful and maximum CMAP responses obtained for each mouse was calculated and used for intergroup comparison.
[0171] Specific results are shown in FIG. 9. EMG and CMAP are objective detection means for evaluating neuromuscular junction lesions. The bundle tremor potential appearing in the EMG detection signal reflects abnormal discharge of MNs, and the fibrillation potential and positive sharp wave reflect the degree of muscle denervation. The latency and amplitude of CMAP reflect demyelination and axon damage, respectively. Referring to FIG. 9A, the frequencies and amplitudes of the fibrillation potential and positive sharp wave measured in the scAAV9-CircPTPRN2 group of mice were significantly lower than those in the SOD1 G93A group and the scAAV9-NC group of mice (P<0.05) at weeks 14, 17 and 20. As shown in FIG. 9B, the peak value of the CMAP amplitude was significantly higher than that in the scAAV9-NC group (P=0.006) at week 17. In addition, the CMAP latency of the scAAV9-CircPTPRN2 group of mice was significantly lower than that of the SOD1 G93A group of mice (P=0.031) at week 17 (FIG. 9C). The above results suggest that overexpression of CircPTPRN2 can protect the neuromuscular junction of the gastrocnemius muscle of SOD1 G93A mice in the middle and late stages of disease, and delay muscle denervation.
[0172] Example 6 Muscle weighing and testing
[0173] The mice were injected intraperitoneally with 2% sodium pentobarbital, and after the mice were anesthetized, they were quickly executed by cervical dislocation. The left and right anterior tibialis and gastrocnemius muscles were stripped out, washed clean of blood, and photographed, weighed, and standardized by body weight, and the muscle / body weight mass ratio of each group of mice was compared.
[0174] The obtained muscle tissue was dehydrated, transparentized, embedded, and deparaffinized, and then subjected to Masson staining, which included the following steps: after deparaffinization, the section was stained with hematoxylin dye to stain the nucleus, washed with water, soaked in 1% hydrochloric acid alcohol, washed with water, and then soaked in ponceau dye. After completion, it was washed with water; then it was placed in a 1% phosphomolybdate solution for 5 min, spun dry, and then dyed with aniline blue dye. Then it was washed with 1% glacial acetic acid and water. It was dehydrated with 95% alcohol and anhydrous ethanol, transparentized, air-dried, and then mounted on a microscope for observation and photography of the section tissue. The cross-sectional area of the gastrocnemius muscle fiber was measured using Image-pro Plus.
[0175] FIG. 10A shows the general appearance of the bilateral gastrocnemius and anterior tibialis muscles of WT group, SOD1 G93A group, scAAV9-NC group and scAAV9-CircPTPRN2 group of mice. Referring to FIG. 10B, by comparing the muscle mass ratio, the results show that the gastrocnemius muscle mass ratio of the scAAV9-CircPTPRN2 group of mice was significantly higher than that of the SOD1 G93AThe scAAV9-CircPTPRN2 group mice. Referring to FIG. 10C, the cross-sectional area of muscle fibers was evaluated by Masson staining of gastrocnemius muscle sections of mice in each group, and the results showed that the cross-sectional area of muscle fibers of the gastrocnemius muscle of the scAAV9-CircPTPRN2 group mice was significantly larger than that of the SOD1 G93A The scAAV9-CircPTPRN2 group mice. The above results suggest that overexpression of CircPTPRN2 can significantly improve SOD1 G93A Muscle atrophy of the gastrocnemius muscle of the mice at the end stage of the disease.
[0176] Example 7 Effects of self-complementary adeno-associated virus scAAV9-NC and scAAV9-CircPTPRN2 on SOD1 G93A Toxic effects on mice
[0177] The mice were anesthetized by intraperitoneal injection of 2% sodium pentobarbital. At the junction of the arterial and venous apex of the mouse heart, a perfusion needle was inserted into the aorta to perfuse 0.9% NaCl into the right auricle until the outflow was colorless and transparent; then 4% paraformaldehyde was continuously perfused until the mouse was stiff all over, i.e., the end of perfusion. Then the spinal cord, gastrocnemius muscle, tibialis anterior muscle, heart, liver, spleen, lung, and kidney of the mouse were carefully stripped and soaked in a centrifuge tube containing pre-cooled 4% paraformaldehyde solution, and stored in a 4°C refrigerator overnight. After overnight, the muscle tissue and heart, liver, spleen, lung, and kidney were used for subsequent paraffin embedding and staining.
[0178] The steps of HE staining were as follows: after dewaxing, the sections were soaked in hematoxylin for 5 min, then water-washed, soaked in 1% hydrochloric acid aqueous solution, water-washed, and finally soaked in eosin staining solution for 2 min, and then placed in water for standing; dehydrated with anhydrous ethanol, transparented with xylene, and mounted; observed and photographed the section tissue under a microscope, and compared the differences in the structure of each organ.
[0179] Referring to FIG. 11, the results showed that the myocardial fiber arrangement of the heart of the four groups of mice was regular, and the myocardial cell morphology was complete; the liver lobule structure of the liver was clear, and the central vein structure was normal; the red pulp and white pulp of the spleen had clear boundaries, and the splenic corpuscle structure was clear; the alveolar structure of the lung was complete, and the alveolar cavity was clear; the glomerular structure of the kidney was normal, and the renal tubular epithelial cell morphology was complete, and no obvious inflammatory reaction or abnormality was observed in the organ tissues of the mice in each group (FIG. 11A, B). In addition, we collected the heart, liver, spleen, lung, and kidney organs of the mice at the end stage of the disease and after death, and the results showed that there was no significant difference in the organ weight between each group (FIG. 11B, C). The above evidence suggests that no obvious toxic effects of self-complementary adeno-associated virus scAAV9-NC and scAAV9-CircPTPRN2 on SOD1 G93A The mice had obvious toxic effects.
[0180] Example 8 Verification of the circular structure of CircPTPRN2
[0181] Total RNA was extracted from cells overexpressing CircPTPRN2 obtained using the method in Example 1 using an RNA extraction kit RC112 (purchased from Novizan Biotech). cDNA was synthesized using a reverse transcription kit FSQ-101 (purchased from Toyobo Biotech, DNase I purchased from Novizan Biotech). The obtained cDNA was then subjected to PCR using a PCR amplification kit P213 purchased from Novizan Biotech.
[0182] Genomic gDNA extraction: MNs were extracted at a ratio of 5 × 10⁻⁶. 5 The cells were seeded at a density of / wells into 6-well cell culture plates. gDNA was extracted on day 13 after MNs adhered to the plates. Lysis buffer (Lysis Bufer) was prepared: 0.5 mL 1M Tris-HCl (pH 8.0) + 2 mL 0.5M EDTA + 58.5 g NaCl + 1 mL 10% SDS + distilled water to 10 mL. Before use, 10 mg / mL Proteinase K was added at a 1:100 ratio and mixed thoroughly. Cells were lysed with this Lysis Bufer and incubated at 56°C for 30 min. After centrifugation, the supernatant was collected, and an equal volume of isopropanol was added and mixed thoroughly. The mixture was allowed to stand and then centrifuged again. The supernatant was discarded, and the cells were dried. gDNA can be dissolved in sterile water and stored at -20°C or used directly in subsequent experiments.
[0183] Agarose gel electrophoresis: Samples were prepared using conventional methods.
[0184] CircPTPRN2 is located in the interval of chr7: 157539056-15858782 of human chromosome 7, and is formed by circularization of the 12th and 13th exons of the host gene PTPRN2 precursor mRNA, with a full length of 408 nt. The circularization schematic diagram of CircPTPRN2 is shown in FIG. 12A. The first sequencing result shows the reverse splicing site of CircPTPRN2 (FIG. 12B), verifying that CircPTPRN2 is formed by reverse circularization of the 12th and 13th exons. In order to further verify that CircPTPRN2 is formed by head-to-tail connection of exons, after extracting the cDNA and gDNA of D90D MNs, we designed reverse Divergent primers (i.e. CircPTPRN2 primers) and opposite Convergent primers (i.e. PTPTN2 primers) to amplify CircPTPRN2, PTPTN2 and positive control GAPDH. Agarose gel electrophoresis analysis of the amplification products showed that the band of CircPTPRN2 only appeared in the cDNA lane but not in the gDNA lane, indicating that CircPTPRN2 can only be amplified from cDNA by reverse primers; in contrast, the bands of PTPTN2 and GAPDH appeared in both cDNA and gDNA lanes, indicating that both can be amplified by the corresponding opposite primers (FIG. 12C). This result shows that CircPTPRN2 is a circular RNA formed by reverse splicing mechanism.
[0185] Example 9 RT-qPCR detection of CircPTPRN2 expression level in blood of non-ALS and ALS patients
[0186] The kit RR420A for RT-qPCR was purchased from Takara Company, and the experimental part was performed according to the use method of the kit. The primers involved in this part of the experiment are as follows, and other related primers are shown in Example 1:
[0187] CircPTPRN2 gene F: CTCATCCCAGTTCAGCGACG (SEQ ID NO. 2), CircPTPRN2 gene R: GAACTTGGTGGAGTCTTCTTGCT (SEQ ID NO. 3);
[0188] GAPDH gene F: CATGAGAAGTATGACAACAGCCT (SEQ ID NO. 4), GAPDH gene R: AGTCCTTCCACGATACCAAAGT (SEQ ID NO. 5).
[0189] Among them, the GAPDH gene is an internal reference gene.
[0190] The specific results are shown in Figure 13. RT-qPCR results showed that the expression level of CircPTPRN2 in the blood of ALS patients was significantly higher than that in the control group, indicating that CircPTPRN2 can serve as a biomarker for disease detection. It can be used to prepare products with detection functions, such as kits and chips.
[0191] Although the embodiments of this application have been described above in conjunction with the accompanying drawings, this application is not limited to the specific embodiments and application fields described above. The specific embodiments described above are merely illustrative and instructive, not restrictive. Those skilled in the art can make many other forms based on the guidance of this specification and without departing from the scope of protection of the claims of this application, and these are all within the scope of protection of this application.
Claims
1. A medicament for treating a disease, impairment, deterioration associated with motor neuron injury in a subject, the medicament comprising: a circRNA with circBank ID hsa_circPTPRN2_018 and a suitable pharmaceutical carrier.
2. The medicament of claim 1, wherein, The pharmaceutical carrier is selected from the group consisting of a viral vector, a virus-like particle, a nanoparticle, an extracellular vesicle; preferably is an adeno-associated virus.
3. The medicament according to claim 1 or 2, wherein The subject is a vertebrate and / or an invertebrate; preferably is a mammal.
4. The medicament according to claim 1 or 2, wherein The disease, impairment, degeneration associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, Kennedy disease, Parkinson's disease.
5. Use of a circRNA with circBank ID hsa_circPTPRN2_018 in the manufacture of a medicament for treating a subject with a disease, impairment, degeneration associated with motor neuron injury.
6. The use of claim 5, wherein, The disease, impairment, degeneration associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, Kennedy disease, Parkinson's disease.
7. The use according to claim 5 or 6, wherein, In the manufacture of a medicament for treating a disease, impairment, degeneration associated with motor neuron injury, a circRNA with circBank ID hsa_circPTPRN2_018 is used in combination with a suitable pharmaceutical carrier.
8. The use of claim 7, wherein, The pharmaceutical carrier is selected from the group consisting of a viral vector, a virus-like particle, a nanoparticle, an extracellular vesicle; preferably is an adeno-associated virus.
9. The use of claim 7, wherein, The subject is a vertebrate and / or an invertebrate; preferably is a mammal.
10. A method of administering a medicament as claimed in any one of claims 1 to 4 wherein, The medicament as claimed in any one of claims 1-4 is injected into the spinal canal of the subject, i.e. intrathecally.
11. The medicament of claim 4 and / or the use of any one of claims 6-9, wherein the disease condition of amyotrophic lateral sclerosis comprises at least one of the group consisting of axonal swelling degeneration, mitochondrial dysfunction, and abnormal energy metabolism; Optionally, wherein the mitochondrial function comprises at least one of the group consisting of mitochondrial membrane potential, ROS level, ATP production; Optionally, the circRNA is overexpressed in the subject; Optionally, the circRNA is capable of improving the decrease of the mitochondrial membrane potential, increasing the level of the ATP production, and decreasing the ROS level; Optionally, the circRNA is capable of improving the axonal swelling degeneration of the subject.
12. A method of treating a disease, impairment, degeneration associated with motor neuron injury in a subject, the method comprising: A circRNA with circBank ID hsa_circPTPRN2_018 is administered to a subject.
13. A marker for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, said marker comprising: A circRNA with circBank ID hsa_circPTPRN2_018.
14. A kit for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, the kit comprising: A reagent for detecting the expression level of a circRNA with circBank ID hsa_circPTPRN2_018.
15. The kit of claim 14, the reagent for detecting the expression level of the circular RNA with circBank ID of hsa_circPTPRN2_018 comprises: A primer set for amplifying the circRNA; A primer set for amplifying the circRNA; Preferably, the primer set for amplifying the circular RNA comprises primers with sequences as shown in SEQ ID NO. 2 to SEQ ID NO.
5.
16. The kit of claim 14, the reagent for detecting the expression level of the circular RNA with circBank ID of hsa_circPTPRN2_018 comprises: An antibody specifically binding to the circular RNA with circBank ID hsa_circPTPRN2_018 or an expression product thereof.
17. A chip for detecting a disease, impairment, degeneration associated with motor neuron injury in a subject, the chip comprising: A probe or antibody for detecting the content of the circular RNA with circBank ID hsa_circPTPRN2_018.
18. The chip of claim 17, further comprising: A primer set for amplifying the circular RNA; Preferably, the primer set for amplifying the circular RNA comprises primers with sequences as shown in SEQ ID NO. 2 to SEQ ID NO.
5.
19. A method for detecting a disease, lesion, degeneration associated with motor neuron injury, comprising the following steps: contacting a sample to be detected with a primer set or primer probe composition specifically binding to the circular RNA with circBank ID hsa_circPTPRN2_018; or contacting a sample to be detected with an antibody specifically binding to the circular RNA with circBank ID hsa_circPTPRN2_018; Preferably, the primer in the primer set or primer probe composition comprises primers with sequences as shown in SEQ ID NO. 2 to SEQ ID NO.
5.
20. The marker of claim 13, and / or the kit of any one of claims 14-16, and / or the chip of claim 17 or 18, and / or the detection method of claim 19, wherein, The disease associated with motor neuron injury is selected from any one of the following group: amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, Kennedy disease, Parkinson's disease.
Citation Information
Patent Citations
Parkinson's disease biomarker and application thereof
CN111187827A
Medicament for treating diseases related to motor neuron injury
CN119139498A
ALS biomarker and ALS diagnosis method
WO2020013233A1
Herpesvirus-induced gene or protein expression and methods for treating neurological disorders
WO2024086692A2