HAO1 gene-targeting composition and use thereof
Gene editing using a combination of CRISPR/Cas system-targeted HAO1 gene has solved the problem of long-term inhibition of HAO1 expression, achieving a reduction in glyoxylate production and oxalate accumulation, and alleviating kidney damage in patients with type 1 primary hyperoxaluria.
Patent Information
- Application Number
- PCT/CN2025/126075
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-30
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Current technologies have not yet provided an effective long-term treatment to inhibit HAO1 expression, which leads to excessive glyoxylate production in patients with type 1 primary hyperoxaluria, resulting in oxalate accumulation and kidney damage.
A composition targeting the HAO1 gene using the CRISPR/Cas system, comprising a nuclease and guide RNA, reduces the production of HAO1 protein and inhibits the formation of glyoxylate through gene editing.
It effectively reduces urinary oxalate excretion, lowers urinary oxalate levels, alleviates kidney damage, and delays or prevents the progression of end-stage renal disease.
Smart Images

Figure PCTCN2025126075-FTAPPB-I100001 
Figure PCTCN2025126075-FTAPPB-I100002 
Figure PCTCN2025126075-FTAPPB-I100003
Abstract
Description
Compositions targeting hao1 gene and uses thereof Cross-reference to Related Applications This application claims the benefit of and priority to patent application CN2024113867988, filed September 30, 2024, entitled “Compositions targeting hao1 gene and uses thereof,” the entire contents of which, including any sequence listing and drawings, are incorporated herein by reference in their entirety. Regarding Electronic Sequence Listing In accordance with WIPO Standard ST.26, the symbol “t” is used to represent both T in DNA and U in RNA (the definition of the symbol “t” is “thymine in DNA / uracil in RNA (t / u)”). Thus, in a sequence listing prepared according to ST.26, in any instance where the sequence is RNA, every occurrence of T in the sequence should be considered as U. BACKGROUND Primary hyperoxaluria type 1 (PH1) is a genetic disorder characterized primarily by the accumulation of oxalate. In PH1 cases, mutations are typically found in the enzyme alanine:glyoxylate aminotransferase (AGT or AGT1) encoded by the AGXT gene. Normally, AGT converts glyoxylate to glycine in the liver peroxisome. However, the mutant AGT in patients with PH1 is unable to break down glyoxylate, leading to elevated levels of glyoxylate and its metabolite, oxalate. Humans cannot oxidize oxalate, so high levels of oxalate in PH1 patients lead to hyperoxaluria, an abnormally high level of oxalate in the urine. In primary hyperoxaluria type 1 (PH1), excess oxalate also binds to calcium, forming calcium oxalate in the kidneys and other organs, and deposition of calcium oxalate can cause either widespread deposition of calcium oxalate (nephrocalcinosis) or formation of kidney stones and bladder stones (urolithiasis) and lead to kidney damage. Common kidney complications in PH1 include blood in the urine (hematuria), urinary tract infections, kidney damage, and end-stage renal disease (ESRD). Over time, the kidneys of patients with PH1 can begin to fail, and the level of oxalate in the blood can rise. Deposition of oxalate in tissues throughout the body, such as systemic oxalosis, can occur due to high blood oxalate levels and can cause complications in the bones, skin, and eyes. Hydroxyacid oxidase 1 (HAOl) converts glycolate to glyoxylate. Inhibition of HAOl in individuals with PHI would block the formation of glyoxylate, and excess glycolate would be excreted through urine. The idea of treating PHI by inhibiting HAOl is further supported by data indicating that human subjects with an abnormal splicing variant of HAOl have asymptomatic glycolic aciduria, with increased urinary glycolate excretion without concomitant overt renal pathology (see Frishberg Y et al., J Med Genet 51(8):526-9 (2014)). Thus, PHI can be treated by inhibiting the expression of HAOl to block glyoxylate production and thus the production of its metabolic product, oxalate. While results on short-term inhibition of HAOl expression show encouraging preliminary data (see Liebow et al., J Am Soc Nephrol. 2017 Feb;28(2):494-503), there is still a need for a therapeutic modality that can inhibit HAOl expression long-term. As used herein, the term "treatment" refers to any administration or application of a therapeutic agent to a subject for a disease or condition, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing recurrence of one or more symptoms of the disease. For example, treatment of PHI can include alleviating symptoms of PHI. As used herein, the term "therapeutically relevant oxalate reduction" or "oxalate levels within the therapeutic range" means a reduction in urinary oxalate excretion greater than 30% compared to baseline (see, Leumann and Hoppe (1999) Nephrol Dial Transplant 14:2556-2558, at 2557, 2nd column), to achieve oxalate levels within the therapeutic range means reducing urinary oxalate from baseline by greater than 30%. For example, "normal oxalate levels" or "normal oxalate range" can refer to between about 80 and about 122 pg oxalate / mg of creatine (see, Li et al. (2016) Biochim Biophys Acta 1862(2):233-239). In some embodiments, the therapeutically relevant oxalate reduction is to a level less than or within 200%, 150%, 125%, 120%, 115%, 110%, 105%, or 100% of the normal level. SUMMARY In view of the above background, the present disclosure provides compositions and methods for targeting the HAOl gene using the CRISPR / Cas system to reduce HAOl protein production and reduce glyoxylate production in subjects with PHI. In some aspects, the disclosure provides a nuclease comprising an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO. 1. In some aspects, the disclosure provides a composition targeting a HAO1 gene for gene editing, the composition comprising: (i) a nuclease of the disclosure or a first nucleic acid encoding the nuclease; (ii) a guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence specific to a target sequence within a HAO1 gene. In some aspects, the disclosure provides a polynucleotide encoding a nuclease and / or a guide RNA of the disclosure. In some aspects, the disclosure provides a vector comprising a polynucleotide of the disclosure. In some embodiments, the vector of the disclosure encodes a guide RNA as disclosed herein. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector, or a recombinant lentivirus vector. In some aspects, the disclosure provides a ribonucleoprotein (RNP) comprising a nuclease and a guide RNA of the disclosure. In some aspects, the disclosure provides a lipid nanoparticle (LNP) comprising a composition of the disclosure. In some aspects, the disclosure provides a kit comprising a composition of the disclosure, a polynucleotide of the disclosure, a vector of the disclosure, a ribonucleoprotein (RNP) of the disclosure, or a lipid nanoparticle (LNP) of the disclosure. In some aspects, the disclosure provides a cell comprising a composition of the disclosure, a nucleic acid of the disclosure, or a vector of the disclosure. In some aspects, the disclosure provides a guide RNA comprising (i) a spacer sequence specific to a target sequence in a HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located 5' of the target sequence comprising a motif of 5'-TTN-3'; and (ii) a direct repeat sequence. In some embodiments, the target sequence is selected from any one of SEQ ID NOs. 6-17. In some embodiments, the spacer sequence is selected from any one of SEQ ID NOs. 31-42. In some embodiments, the guide RNA sequence is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the sequence of any one of SEQ ID NOs. 18-29, 43-54. In some aspects, the disclosure provides a pharmaceutical composition comprising a composition of the disclosure, a vector of the disclosure, a ribonucleoprotein (RNP) of the disclosure, a lipid nanoparticle (LNP) of the disclosure, or a cell described by the disclosure; and a pharmaceutically acceptable excipient. In some aspects, the disclosure provides a formulation containing a composition as described by the disclosure, a polynucleotide of the disclosure, a vector of the disclosure, a ribonucleoprotein (RNP) of the disclosure, a lipid nanoparticle (LNP) of the disclosure, a pharmaceutical composition of the disclosure, or a cell described by the disclosure, and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the formulation is a liquid formulation. In some embodiments, the formulation is in the form of an injection. In some aspects, the disclosure provides a method for editing a HAO1 gene in a cell, the method comprising contacting a host cell with a composition of the disclosure, a polynucleotide of the disclosure, a vector of the disclosure, or a ribonucleoprotein (RNP) of the disclosure to genetically edit a HAO1 gene in the host cell. In some aspects, the disclosure provides a method for treating hyperoxaluria in a subject, the method comprising administering to a subject in need thereof a composition of the disclosure, a polynucleotide of the disclosure, a vector of the disclosure, a ribonucleoprotein (RNP) of the disclosure, a lipid nanoparticle (LNP) of the disclosure, a pharmaceutical composition of the disclosure, or a cell of the disclosure for editing a HAO1 gene. BRIEF DESCRIPTION OF DRAWINGS An understanding of certain features and advantages of the present disclosure will be obtained by reference to the following detailed description and drawings, which sets forth illustrative embodiments in which the principles of the present disclosure can be utilized, and in which: FIG. 1 depicts cleavage activity of different CasY7 variants and guide RNAs targeting the HAO1 gene. FIG. 2 depicts cleavage activity of HAO1-crRNA-1-12 mediating variant C30725 targeting the HAO1 gene, respectively. FIG. 3 depicts a map of PHK09T plasmid. DETAILED DESCRIPTION The techniques and procedures described or referenced herein include techniques and procedures that are generally well understood and / or routinely practiced by those skilled in the art, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003). Technical terms Unless otherwise indicated, each of the following terms has the meaning associated with it as this section pertains. The indefinite articles "a" and "an" mean at least one, and are used interchangeably with the phrases "at least one" and "one or more." For example, "a member" means at least one member, or one or more members. The conjunctions "or" and "and / or" can be used interchangeably, as nonexclusive alternatives. Also, the use of the term "including" as well as other forms such as "include," "includes," and "included" is not limiting. The terms "comprising," "having," "including," and "containing" and any form of these terms are open-ended and do not exclude additional, unrecited elements, or method steps. Any implementation discussed in this specification contemplates carrying out the method or making the composition in addition to those other than the specific embodiments discussed. The term "consisting essentially of as used herein in reference to a given embodiment means those elements required by the given embodiment. This term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic of the embodiments of the disclosure. The term "about" means within an acceptable range determined by one of skill in the art for a particular value, some of which will vary as a function of the manner in which the value is measured or determined, i.e., as limited by the measurement system. If a particular value is specified in the application and claims, unless otherwise indicated, the term "about" is intended to mean within an acceptable range of the specified value. The term“subject” refers to a human, a mouse, or a non-human primate. A human subject can be of any age (e.g., infant, child, adolescent, or adult), and can have a disease, and can in fact have a genetic alteration. The terms“treat,”“treating,” and“treatment” mean to treat a subject (e.g., a human subject) for a disease, including one or more of: inhibiting the disease, i.e., arresting or preventing its development or progression; relieving the disease, i.e., causing regression of the disease state; relieving one or more symptoms of the disease; and curing the disease. The terms“prevent,”“preventing,” and“prevention” mean to prevent a disease in a subject, including: (a) avoiding or precluding the disease; (b) affecting the predisposition toward the disease; or (c) preventing or delaying the onset of at least one symptom of the disease. As used herein, the term“complex” refers to a population of two or more molecules. In some embodiments, a complex comprises a polypeptide and a nucleic acid molecule that interact with each other (e.g., bind, contact, adhere). As used herein, the term“complex” can refer to a population of a guide RNA and a polypeptide (e.g., CasY7 / variant thereof). As used herein, the term“complex” can refer to a population of a guide RNA, a polypeptide, and a target sequence. As used herein, the term“complex” can refer to a complex of a guide RNA targeting HAO1 and CasY7. As used herein, the terms“protospacer adjacent motif” and“PAM” are used interchangeably to refer to a DNA sequence adjacent to a target sequence (e.g., a HAO1 target sequence) to which a complex of a guide RNA (e.g., a guide RNA targeting a HAO1 gene) and CasY7 / variant thereof binds. In the case of a double-stranded target, the guide RNA binds to the first strand of the target (e.g., the target strand or spacer-complementary strand), and the PAM sequence as described herein is present in the second complementary strand (e.g., the non-target strand or non-spacer-complementary strand). As used herein, the term“adjacent” includes instances in which the guide RNA of the complex comprising the guide RNA and CasY7 / variant thereof specifically binds to, interacts with, or associates with the target sequence immediately adjacent to the PAM. In such instances, there are no nucleotides between the target sequence and the PAM. The term“adjacent” also includes instances in which there are a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides between the target sequence to which the guide RNA binds and the PAM. In some embodiments, the PAM sequence as described herein is present in the non-target strand (e.g., the non-spacer-complementary strand). As used herein, the term "guide RNA" refers to any RNA molecule that facilitates targeting of a nuclease polypeptide described herein (e.g., CasY7 or a variant thereof) to a target sequence (e.g., a sequence of the HAOl gene). A guide RNA can be designed to comprise a molecule that includes a sequence that is complementary to a particular nucleic acid sequence (e.g., a HAOl nucleic acid sequence). A guide RNA can comprise a sequence that targets DNA (i.e., a spacer sequence) and a direct repeat (DR) sequence. The term "crRNA" is also used herein to refer to a guide RNA, and "spacer sequence" and "spacer sequence" are used interchangeably herein. In some embodiments, the spacer sequence is complementary to the target sequence. As used herein, the term "complementary" refers to the ability of a nucleobase of a first nucleic acid molecule (e.g., a guide RNA) to base pair with a nucleobase of a second nucleic acid molecule (e.g., a target sequence). Two complementary nucleic acid molecules are capable of non-covalently binding under appropriate conditions of temperature and ionic strength of the solution. In some embodiments, a first nucleic acid molecule (e.g., a spacer sequence of a guide RNA) comprises 100% complementarity to a second nucleic acid (e.g., a target sequence). In some embodiments, a first nucleic acid molecule (e.g., a spacer sequence of a guide RNA) is complementary to a second nucleic acid molecule (e.g., a target sequence) if the first nucleic acid molecule comprises at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the second nucleic acid. As used herein, the term "substantially complementary" refers to a polynucleotide (e.g., a spacer sequence of a guide RNA) that has a certain level of complementarity to a target sequence. In some embodiments, the level of complementarity is such that the polynucleotide can hybridize to the target sequence with sufficient affinity to allow a nuclease polypeptide (e.g., CasY7 / variant thereof) complexed with the polynucleotide to act on (e.g., cleave) the target sequence. In some embodiments, a spacer sequence that is substantially complementary to a target sequence has less than 100% complementarity to the target sequence. In some embodiments, a spacer sequence that is substantially complementary to a target sequence has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the target sequence. In some embodiments, a guide RNA having a spacer sequence that is substantially complementary to a target sequence has 100% complementarity to the target sequence. As used herein, the terms "target" and "target sequence" refer to a nucleic acid sequence to which a guide RNA specifically binds. In some embodiments, the DNA targeting sequence (e.g., spacer) of a guide RNA binds to a target sequence. In the case of a double-stranded target, the guide RNA binds to the first strand of the target (i.e., the target strand or spacer-complementary strand), and a PAM sequence as described herein is present in the second complementary strand (i.e., the non-target strand or non-spacer-complementary strand). The term "kit" refers to any collection of two or more components that together constitute a functional unit useful for a particular purpose. By way of illustration (but not limitation), a kit according to the present disclosure can include a guide RNA complexed with or capable of complexing with an RNA-guided nuclease, and accompanied (e.g., suspended in, or suspendable in) a pharmaceutically acceptable carrier. In certain embodiments, a kit can include a boost element. The kit can be used to introduce the complex into, for example, a cell or a subject, for the purpose of causing a desired genomic alteration in such cell or subject. The components of the kit can be packaged together, or the components can be packaged separately. A kit according to the present disclosure also optionally includes a description of use (DFU) that describes, for example, use of the kit according to the methods of the present disclosure. The DFU can be packaged physically with the kit, or the DFU can be made available to a user of the kit, for example, electronically. The terms "polynucleotide," "nucleotide sequence," "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," and "oligonucleotide" refer to a series of nucleotide bases (also referred to as "nucleotides") in DNA and RNA, and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, etc. can be chimeric mixtures or derivatives or modified forms, single- or double-stranded. They can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences typically carry genetic information, including but not limited to information for cell organelles to make proteins and enzymes. The terms include both double- and single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and both sense and antisense polynucleotides. The terms also include nucleic acids containing modified bases. The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors," or simply, "expression vectors." In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, a "plasmid" and "vector" refer to the same type of genetic element; however, the present description is intended to include such The term "operably linked" means that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a target cell when the vector is introduced into the target cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). The regulatory sequences include those that direct constitutive expression of a nucleotide sequence in a variety of types of host cells, as well as those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Additionally, the DNA-targeting endonuclease can be delivered by way of a vector that includes a regulatory sequence that directs the synthesis of the DNA-targeting endonuclease at particular intervals of time or over a particular period of time. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression of the desired gene product, and the like. As used herein, the term "HA01" refers to "glycolate oxidase 1", which is also known as "hydroxy acid oxidase" HAO1 is a peroxisomal protein that is primarily expressed in the liver and pancreas, and its activity comprises oxidation of glycolate and 2-hydroxy fatty acids. "Primary hyperoxaluria type 1 (PH1)" is an autosomal recessive disorder due to mutations in the AGXT gene that encodes the liver peroxisomal alanine-glyoxylate aminotransferase (AGT) enzyme. AGT metabolizes glyoxylate to glycine. Lack of AGT activity, or its mis-targeting to mitochondria, allows oxidation of glyoxylate to oxalate, which can only be excreted in the urine. High oxalate levels lead to calcium oxalate stone formation and renal parenchymal damage, resulting in progressive deterioration of kidney function and, ultimately, end-stage renal disease. The term "treatment" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease, or disorder. For example, the terms "treating" and "treatment" refer to the administration of an effective amount of a composition (e.g., an effective amount of a composition comprising a population of hematopoietic progenitor cells) to a subject to reduce or improve (e.g., beneficial or desired clinical outcome) at least one symptom of the disease. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. In some embodiments, treatment can refer to an extension of life compared to the expected life span in the absence of treatment. Thus, one of skill in the art will appreciate that treatment can improve the disease state, but not necessarily cure the disease. In some embodiments, treatment can include prevention. In alternative embodiments, treatment does not include prevention. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The terms "pharmaceutically acceptable," "physiologically tolerable," and grammatical variations thereof, as used herein, are interchangeable with respect to composition, carrier, diluent and reagent, and are used interchangeably with the term "physiologically tolerable" and refer to a material that does not produce an untoward, undesirable, or inappropriate in vivo response associated with its administration or use, such as nausea, dizziness, gastric upset, etc. A pharmaceutically acceptable carrier does not deliriously elicit an immune response to an agent with which it is combined unless so desired. The preparation / formulation of a pharmaceutical composition that includes the active ingredient dissolved or dispersed in a suitable carrier so as to allow the mixture to be injected can be well known in the art, and need not be limited according to formulation. Generally, such compositions can be prepared as injectable, liquid solutions or suspensions, however, solid forms suitable for solution or suspension in liquid prior to use can also be prepared. The preparation can also be emulsified or provided in liposome form. The active ingredient can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient in amounts suitable for use in the therapeutic methods described herein. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can include minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and the like, which do not deliriously affect the efficacy of the active ingredient. The therapeutic compositions of the present disclosure can include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2- ethylamino ethanol, histidine, procaine and the like. Physiologically tolerable carriers are well known in the art. An exemplary liquid carrier is a sterile aqueous solution that contains no substances other than the active ingredient and water, or a sterile aqueous solution containing a buffer, such as sodium phosphate at physiological pH, physiological saline or both, such as phosphate-buffered saline. Still further, the aqueous carrier can contain more than one buffer, as well as salts (such as sodium and potassium chlorides), dextrose, polyethylene glycol and other solutes. The liquid composition can also contain a liquid phase other than water, and can include a suspension of the active ingredient in a liquid. Exemplary such additional liquid phases are glycerol, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active agent used in the methods described herein (which will be effective in the treatment of a particular disorder or condition) will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. As used herein in reference to a disease, disorder, or symptom thereof, "prevention" or "preventing" means reducing the likelihood that an individual will develop a disease or disorder (e.g., PHI). For example, an individual having one or more risk factors for a disease or disorder does not develop the condition; or develops such a disease or disorder at a later time or with less severity, relative to a population having the same risk factors and not receiving a treatment described herein, when the likelihood of developing the disease or disorder is reduced. A failure to develop symptoms of a disease, or a reduction in the development of symptoms (e.g., a reduction of at least 10% in a clinically accepted score for the disease or disorder) or delay (e.g., by days, weeks, months, or years) is considered effective prevention. I. Compositions The present disclosure provides compositions targeting the HAO1 gene that can be used to edit the HAO1 gene target, illustratively, the compositions can disrupt the HAO1 gene. In some embodiments, the composition targeting the HAO1 gene for use in gene editing of the HAO1 gene, the composition comprises: (i) a nuclease of the present disclosure or a first nucleic acid encoding a nuclease of the present disclosure; (ii) a guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence specific for a target sequence within the HAO1 gene. In some embodiments, the guide RNA is comprised of a direct repeat (DR) sequence and a spacer sequence. In some embodiments, the guide RNA binds to the nuclease to form a CRISPR-Cas complex that targets the HAO1 gene target sequence. In some embodiments, the spacer sequence is specific for a HAO1 target sequence, wherein the HAO1 target sequence is adjacent to a protospacer adjacent motif (PAM), in some embodiments, the PAM sequence is 5'-TTN-3' as described herein. In the case of a dsDNA gene target, the guide RNA binds to the first strand (non-PAM strand) of the gene target, and the PAM sequence as described herein is present in the second complementary strand (i.e., PAM strand). In some embodiments, the disclosure provides a complex comprising a guide RNA and a nuclease. In some embodiments, the RNA guide and the nuclease bind to each other in a molar ratio of about 1 : 1. In some embodiments, the complex comprising the guide RNA and the nuclease binds to a complementary region of a target sequence within the HAOl gene. In some embodiments, the complex comprising the guide RNA targeting HAOl and the nuclease binds to a complementary region of a target sequence within the HAOl gene in a molar ratio of about 1 : 1. In some embodiments, the complex of the guide RNA and the nuclease has enzymatic activity, such as nuclease activity, to cleave the HAOl target sequence and / or the complementary sequence. In some embodiments, the guide RNA, the nuclease, and the complementary region of the HAOl target sequence, whether alone or together, are not naturally occurring. In some embodiments, the guide RNA in the complex comprises a direct repeat (DR) sequence and / or a spacer sequence described herein. In some embodiments, the sequence of the guide RNA has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to the sequence of any one of SEQ ID NOs. 18-29, 43-54. In some embodiments, the guide RNA has any one of SEQ ID NOs. 18-29, 43-54. In some embodiments, the compositions provided by the present disclosure include a nuclease polypeptide as described herein and / or a nucleic acid (e.g., RNA) encoding a nuclease as described herein. In some embodiments, the compositions provided by the present disclosure include a nuclease polypeptide as described herein and / or a first nucleic acid (e.g., RNA) encoding a nuclease as described herein and a guide RNA or a second nucleic acid encoding the guide RNA. In some embodiments, the nuclease polypeptide or the first nucleic acid encoding the nuclease is included within the same composition as the guide RNA or the second nucleic acid encoding the guide RNA. In some embodiments, the nuclease or the RNA encoding the nuclease polypeptide is included within a separate composition as the guide RNA or the second nucleic acid encoding the guide RNA. In some embodiments, the guide RNA includes a direct repeat (DR) sequence and / or a spacer sequence as described herein. In some embodiments, the DR sequence of the guide RNA has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to the sequence of any one of SEQ ID NOs. 3-4. In some embodiments, the spacer sequence of the guide RNA has the sequence of any one of SEQ ID NOs. 31-42. 1. CasY7 polypeptide / variant The compositions of the present disclosure include CasY7 or variants thereof as described in PCT / CN2024 / 092707, the relevant disclosures of which are incorporated by reference for the subject matter and purposes cited herein. The nucleotide sequence of the CasY7 polypeptide parent is set forth in SEQ ID NO. 1, and the encoding nucleotide is set forth in SEQ ID NO. 2. In some embodiments, the nuclease of the present disclosure has an amino acid sequence that includes at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO. 1. In some embodiments, the nuclease of the present disclosure comprises an amino acid sequence that differs from the amino acid sequence of SEQ ID NO. 1 by no more than 70 amino acid residues, e.g., differs by 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 amino acid residues. In some embodiments, the nuclease of the present disclosure comprises one or more mutations at positions 175, 176, 282, 283, 285, 416, 417, 418, 419, 420, 788, and 829 of SEQ ID NO. 1. In some cases, the nuclease comprised by the compositions of the present disclosure comprises amino acid mutations at multiple positions. In some embodiments, the nuclease comprised by the compositions of the present disclosure comprises one or more mutations relative to the amino acid sequence set forth in SEQ ID NO. 1 that are amino acid substitutions, which optionally comprise the following mutation patterns: (i) Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; or (ii) E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420. In some embodiments, the nuclease of the present disclosure comprises one or more mutations relative to the amino acid sequence set forth in SEQ ID NO. 1 that are amino acid substitutions, which optionally comprise the following mutation patterns: (a) Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; (b) A175 + E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; (c) E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420 + E788; or (d) E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420 + E829. In some embodiments, the nuclease of the present disclosure comprises one or more mutations relative to the amino acid sequence set forth in SEQ ID NO. 1 that are amino acid substitutions, optionally comprising the following mutation patterns: (e) Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A; (f) A175R + E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A; (g) E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A + E788R; or (h) E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A + E829R. The amino acid mutations of the nucleases described herein relative to the amino acid sequence set forth in SEQ ID NO. 1 can be one or more amino acid changes, but in some cases, the changes to the nucleases of the present disclosure can also be substantial, for example, as part of an amino-terminal extension and / or carboxy-terminal extension of the nucleases described as fusion proteins: In some embodiments, the nucleases can contain additional proteins or peptides, for example, one or more proteins or polypeptides. In some cases, the additional proteins or polypeptides can be selected from the group consisting of a nuclear localization signal (NLS), a nuclear export signal (NES), a reporter protein (e.g., a fluorescent protein), a Cas protein targeting moiety, a DNA binding domain (e.g., Lex A DBD, Gal4 DBD, Sp1 DBD), an epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, etc.), a transcriptional activation domain (e.g., VP64, VPR, p65, Rta), a transcriptional repression domain (e.g., KRAB domain, SID domain, NuE domain, NcoR domain, or SID4X domain), a nuclease, a deaminase (e.g., an adenosine deaminase or a cytidine deaminase), a methylase (e.g., a DNA methylase DNMT), a demethylase, a transcriptional release factor, an HDAC, a lytic activity polypeptide, a ligase, an integrase, a transposase, a recombinase, a polymerase, an exonuclease (e.g., T5E), and a base excision repair inhibitor (e.g., a uracil-DNA glycosylase inhibitor (UGI)). In some cases, the additional protein or polypeptide can be selected from a protein or peptide having a methylase activity, a demethylase activity, an acetyltransferase activity, a deacetylase activity, a kinase activity, a phosphatase activity, a ubiquitin ligase activity, a deubiquitinating activity, an adenylation activity, a deadenylation activity, a SUMOylation activity, a desumoylation activity, a ribosylation activity, a deribosylation activity, a myristoylation activity, a demyristoylation activity, a glycosylation activity (e.g., from an O-GlcNAc transferase), and a deglycosylation activity. In some embodiments, the functional domain is selected from an adenosine deaminase catalytic domain or a cytidine deaminase catalytic domain. In some embodiments, the adenosine deaminase catalytic domain or cytidine deaminase catalytic domain comprises one or more of ADAR1, ADAR2, APOBEC, AID, or TAD. In some embodiments, the additional protein or peptide can comprise an epitope peptide for labeling, such as a His tag, Myc, and FLAG. In some embodiments, the nuclease described in the present disclosure can be fused to a detectable moiety, such as a fluorescent protein (e.g., green fluorescent protein (GFP) or yellow fluorescent protein (YFP)). In some embodiments, the nuclease of the present disclosure comprises at least 1 nuclear localization signal (NLS) and / or nuclear export signal (NES), e.g., comprises 2, 3, 4, 5, or more NLS, and / or comprises at least 1 nuclear export signal (NES) (e.g., 2, 3, 4, 5, or more. In some embodiments, the nuclease of the present disclosure comprises 2-4 nuclear localization signals (NLS). In some embodiments, the nuclease of the present disclosure comprises at least 1 (e.g., 2, 3, 4, 5, or more) NLS and at least 1 (e.g., 2, 3, 4, 5, or more) NES. In some embodiments, the nuclease of the present disclosure is substantially inactive, e.g., the nuclease comprises amino acid mutations selected from the group consisting of: D592A, D643A, E820A, and / or D992A, relative to the amino acid sequence set forth in SEQ ID NO. 1. The nuclease of the present disclosure (e.g., CasY7 or a variant thereof) is smaller relative to other nucleases, the CasY7 parent polypeptide and variants thereof are only 1022 amino acids, whereas spCas9 is 1368 amino acids and LbCpf1 is 1246 amino acids, which makes the CasY7 of the present disclosure and variants thereof advantageous for delivery, and having low off-target, high specificity properties. 2. Guide RNA In some embodiments, the compositions described herein include a guide RNA targeting the HAOl gene. The guide RNA can direct a CasY7 polypeptide or variant thereof included in the compositions as described herein to a HAOl gene target sequence. Two or more guide RNAs can direct two or more separate CasY7 and / or variants thereof to 2 or more (e.g., 3, 4, 5, 6, 7, 8, 9, or more) HAOl gene target sequences. In some embodiments, the compositions of the present disclosure include a guide RNA targeting a HAOl gene regulatory sequence (e.g., an enhancer sequence). In some embodiments, the compositions of the present disclosure include 1 guide RNA targeting the HAOl gene, in some cases, the compositions of the present disclosure include 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) guide RNAs. In some embodiments, the guide RNA included in the compositions herein comprises: (1) a spacer sequence capable of hybridizing to a target sequence of a HAOl gene, thereby directing the complex to the target DNA of the HAOl gene, and (2) a direct repeat (DR) sequence capable of forming a complex with a nuclease of the present disclosure or a variant thereof. In some embodiments, the guide RNA of the present disclosure comprises (i) a spacer sequence specific to a target sequence in a HAOl gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located 5' of the target sequence comprising the motif 5'-TTN-3'; and (ii) a direct repeat (DR) sequence capable of forming a complex with a nuclease of the present disclosure or a variant thereof. In some embodiments, the guide RNA does not comprise a tracrRNA. In some embodiments, the direct repeat (DR) sequence is 5' of the spacer sequence, which is capable of forming a complex with a Cas protein of the present disclosure or a variant polypeptide thereof, or a fusion protein of the present disclosure. In some embodiments, the guide RNA comprises, or consists essentially of, or consists of a direct repeat sequence (DR) and a spacer sequence. In some embodiments, the guide RNA is a single molecule nucleic acid, the direct repeat (DR) sequence is linked to the spacer sequence. In some embodiments, the guide RNA comprises multiple tandemly arranged spacer sequences, optionally separated by nucleotide sequences, e.g., direct repeat (DR) sequences as defined herein. The positions of the different spacer sequences are tandem without affecting activity. In some embodiments, the guide RNA comprises multiple (e.g., 2 or more) identical direct repeat (DR) sequences. In some embodiments, the guide RNA comprises multiple (e.g., 2 or more) different direct repeat (DR) sequences. In some embodiments, the guide RNA comprises spacer sequences and direct repeat sequences that are directly connected to each other. In some embodiments, the guide RNA comprises spacer sequences and direct repeat sequences that are connected to each other by a linker (e.g., an RNA linker comprising multiple nucleotides). (i) direct repeat (DR) sequence In some embodiments, the guide RNA described herein comprises a direct repeat (DR) sequence. In some embodiments, the direct repeat (DR) sequence of the guide RNA has a sequence consisting of multiple nucleotides, in some cases, the guide RNA described herein comprises a direct repeat (DR) sequence consisting of 15-90 (e.g., 16-80, 17-75, 18-70, 19-65, 20-60, 23-55, 25-50, 23, or 27) nucleotides. In some embodiments, the direct repeat (DR) sequence can comprise the nucleotide sequence set forth in any one of SEQ ID NO. 3 or 4, or a nucleotide sequence having at least about 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the nucleotide sequence set forth in any one of SEQ ID NO. 3 or 4. In some embodiments, the DR is a “functional variant” (e.g., a “functionally truncated version,” a “functionally extended version,” or a “functionally replaced version”) of the nucleotide sequence set forth in SEQ ID NO. 3 or 4, but still has the function of a DR, still retains at least a portion (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or higher) of the function of the reference DR (parental DR). In some embodiments, the DR sequence comprises a stem-loop structure near the 3' end (immediately adjacent to the spacer sequence). A "stem-loop structure" refers to a nucleic acid having a secondary structure, including a region of nucleotides known or predicted to form a double-stranded (stem) portion, connected at one end by a substantially single-stranded nucleotide connection (loop). The term "hairpin" structure is also used herein to refer to a stem-loop structure. These structures are well known in the art, and the terms are used according to their meanings generally known in the art. The stem-loop structure does not require exact base pairing. Thus, the stem can comprise one or more base mismatches. Alternatively, the base pairing can be exact, i.e., does not include any mismatches. In one embodiment, the guide RNA of the present disclosure comprises a direct repeat (DR) sequence comprising a stem-loop structure near the 3' end of the DR. In some embodiments, the stem comprised in the DR consists of 5 pairs of complementary bases that hybridize to each other, and the loop is 6, 7, 8, or 9 nucleotides in length. In some embodiments, the loop is 7 nucleotides in length. In some embodiments, the stem can comprise at least 2, at least 3, at least 4, or at least 5 base pairs. In some embodiments, the DR comprises two stretches of complementary nucleotides of about 5 nucleotides in length separated by about 7 nucleotides. In some embodiments, the stem-loop structure comprises a first stem nucleotide strand of 5 nucleotides in length; a second stem nucleotide strand of 5 nucleotides in length, wherein the first and second stem nucleotide strands can hybridize to each other; and a loop nucleotide strand arranged between the first and second stem nucleotide strands, wherein the loop nucleotide strand comprises 6, 7, or 8 nucleotides. As used herein, two or more guide RNAs having substantially identical or no substantial difference in secondary structure means that the stems and / or loops comprised in the crRNAs differ in length by no more than 1, 2, or 3 nucleotides; differ in nucleotide type (A, U, G, or C) by no more than 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides when the nucleotide sequences of the guide RNAs are compared by sequence alignment. In some embodiments, two or more guide RNAs having substantially identical or no substantial difference in secondary structure means that the stems comprised in the crRNAs differ by at most one pair of complementary bases, and / or the loops differ by at most one nucleotide in length, and / or comprise stems of identical length but with mismatched bases. In some embodiments, the stem loop structure comprises 5'-X1X2X3X4X5NNNNNNNX6X7X8X9X10-3'; X1, X2, X3, X4, X5, X6, X7, X8, X9, X10 are any base comprising A, T, C, or G, N is any base comprising A, T, C, or G; wherein X1, X2, X3, X4, X5and X6, X7, X8, X9, X10can hybridize to each other to form a stem and such that NNNNNNN forms a loop; more preferably wherein the DR sequence comprises a stem loop structure of any one of the following proximal to the 3' end of the DR sequence: 5'-CCGTCNNNNNNNGACGG-3'; wherein, wherein N is any base comprising A, T, C, or G. In some embodiments, the DR sequence that can direct any nuclease or variant polypeptide of the disclosure to a target site comprises one or more nucleotide changes selected from nucleotide additions, insertions, deletions, and substitutions that do not result in a substantial difference in secondary structure compared to the DR sequence set forth in SEQ ID NO. 3 or 4, or a functionally truncated version thereof. In some embodiments, the direct repeat (DR) sequence herein has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to the sequence set forth in SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence described herein has at least 95% identity (e.g., at least 95%, 96%, 97%, 98%, or 99% identity) to a portion of the sequence set forth in SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence described herein has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to the reverse complement of SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence described herein has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a portion of the reverse complement of SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence herein is set forth in SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence herein is the reverse complement of that set forth in SEQ ID NO. 3 or 4. (ii) spacer sequence In some embodiments, the guide RNA of the present disclosure comprises a spacer sequence. In some embodiments, the spacer sequence is at least about 15 nucleotides in length, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 50 nucleotides (e.g., any of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides). In certain embodiments, the spacer sequence is from about 16 to about 27 nucleotides, e.g., from about 17 to about 24 nucleotides, from about 18 to about 24 nucleotides, or from about 18 to about 22 nucleotides. In some embodiments, the spacer sequence of the guide RNA is complementary to a non-PAM strand sequence. In some embodiments, the spacer sequence is designed to be complementary to a particular DNA strand, e.g., a DNA strand of a genomic locus. In some embodiments, the spacer sequence is at least about 70% complementary (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) to a target sequence of the HAO1 gene. In certain embodiments, the spacer sequence is at least about 15 (e.g., at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more) nucleotides of match between the spacer sequence and a target sequence of a nucleic acid of interest (e.g., DNA). For the spacer sequence, full complementarity is not required, as long as there is sufficient complementarity for the guide RNA to function (i.e., to guide the nuclease to the target site). In some embodiments, the efficiency of nuclease-mediated cleavage can be tuned by introducing one or more mismatches between the spacer sequence and the target sequence (e.g., 1 or 2 mismatches between the spacer sequence and the target sequence, including the position of the mismatch along the spacer / target sequence). The effect of the mismatch (e.g., doublet mismatch) on the cleavage efficiency is greater when the mismatch is located more centrally in the spacer sequence (i.e., not at the 3' or 5' end of the spacer sequence). Thus, by selecting the position of the mismatch along the spacer sequence, the efficiency of the nuclease cleavage targeted to the target sequence of the HAO1 gene can be tuned. For example, if it is desired that the cleavage rate of the target sequence is less than 100% (e.g., in a population of cells), 1 or 2 mismatches between the spacer sequence and the target sequence can be introduced in the spacer sequence. In some embodiments, the spacer sequence of the guide RNA of the present disclosure comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences set forth in SEQ ID NOs. 31-42. In some embodiments, the spacer sequence comprises any one of the nucleotide sequences set forth in SEQ ID NOs. 31-42. (iii) Modifications to guide RNAs In some embodiments, the guide RNAs herein comprise one or more nucleotide modifications. Exemplary modifications can include any modification to the sugar, nucleobase, internucleoside linkage (e.g., to the linking phosphate / to the phosphodiester bond / to the phosphodiester backbone), and any combination thereof. In some embodiments, the RNA guides can comprise any available modification to the sugar, nucleobase, or internucleoside linkage (e.g., to the linking phosphate, to the phosphodiester bond, to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase can be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halo group (e.g., chloro or fluoro). In certain embodiments, the modification (e.g., one or more modifications) is present in each of the sugar and internucleoside linkage. The modification can be a modification of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof. In some embodiments, the modifications to the guide RNAs can comprise chemical modifications or cell-induced modifications. For example, Lewis and Pan describe some non-limiting examples of RNA modifications within cells in “RNA modifications and structures cooperate to RNA guide-protein interactions,” Nat Reviews Mol Cell Biol, 2017, 18:202-210. Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) can be present at different positions in the sequence. One of ordinary skill in the art will appreciate that nucleotide analogs or other modifications can be located at any position in the sequence such that the function of the sequence is not substantially reduced. The sequence can comprise from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any intermediate percentage (e.g., 1-100%). In some embodiments, the functional nucleotide analog comprises at least one chemical modification to the nucleobase, sugar group, and / or phosphate group. Thus, a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to the nucleobase, sugar group, and / or nucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group, or nucleoside linkage of a nucleic acid molecule are provided herein. In some embodiments, functional nucleotide analogs comprise non-standard nucleobases. In some embodiments, standard nucleobases (e.g., adenine, guanine, uracil, thymine, and cytosine) in a nucleotide can be modified or replaced to provide one or more functional analogs of that nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications including, but not limited to, alkyl, aryl, halogen, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused or open rings, oxidations, and / or reductions. In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), 4-thio-uracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho5U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo uracil), 3-methyluracil (m3U), 5-methoxyuracil (mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyluracil (mcm5U), 5-methoxycarbonylmethyl-2-thiouracil (mcm5s2U), 5-aminomethyl-2-thiouracil (nm5s2U), 5-methylaminomethyl-2-uracil (mnm5U), 5-methylaminomethyl-2-thiouracil (mnm5s2U), 5-methylaminomethyl-2-selenouracil (mnm5se2U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyluracil (cmnm5U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm5s2U), 5-propynyluracil, 1-propynyl-pseudouracil, 5-taurinomethyluracil (τm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thiouracil (τm5s2U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m5U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (Et1ψ), 5-methyl-2-thio-uracil (m5s2U), 1-methyl-4-thio-guanylate (m1s4ψ), 4-thio-1-methyl-guanylate, 3-methyl-guanylate (m3ψ), 2-thio-1-methyl-guanylate, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio- dihydrouridine, 2-methoxy-uracil, 2-methoxy-4-thiouracil, 4-methoxy-uridine, 4- methoxy-2-thiouridine, N1-methyl-uridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)uridine (acp3y), 5-(isopentenylaminomethyl)uracil (m5U), 5-(isopentenyl)aminomethyl)-2-thiouracil (m5s2U), 5,2'-O-dimethyluridine (m5Um), 2-thio-2'-O-methyluridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm5Um), 5- carbamoylmethyl-2'-O-methyluridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O- methyluridine (cmnm5Um), 3,2'-O-dimethyluridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Umm), 1-thio-uracil, deoxythymidine, 5-(2- carbomethoxyethenyl)-uracil, 5-(carbamoyloxymethyl)-uracil, 5-carbamoylmethyl-2- thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil, and 5-3-(1-E-propenylamino)uracil. In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include 5-azacytosine, 6-azacytosine, pseudisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudisocytidine, pyrrolocytosine, pyrrolo pseudisocytosine nucleoside, 2-thiocytosine nucleoside (s2C), 2-thio-5-methylcytosine nucleoside, 4-thio-pseudisocytosine nucleoside, 4-thio-1-methyl-pseudisocytosine nucleoside, 4-sulfanyl-1-methyl-1-deaza-pseudisocytidine, 1-methyl-1-deaza-pseudisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methylcytosine, 4-methoxy-pseudisocytosine nucleoside, 4-methoxy-1-methyl-pseudisocytosine nucleoside, lysidine (k2C), 5,2'-0-dimethylcytosine nucleoside (m5Cm), N4-acetyl-2'-0-methylcytidine (ac4Cm), N4,2'-0-dimethylcytidine (m4Cm), 5-formyl-2'-0-methylcytidine (f5Cm), N4,N4,2'-0-trimethylcytidine (m42Cm), 1-thiocytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine. In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a substitution for adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidopurine, 7-deazapurine, 7-deaza-8-azapurine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenine (mlA), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-isopentenyladenine (i6A), 2-methylthio-N6-isopentenyladenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (i06A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2i06A), N6-glycinamidoformyl-adenine (g6A), N6-threoninamidoformyl-adenine (t6A), N6-methyl-N6-threoninamidoformyl-adenine (m6t6A), 2-methylthio-N6-threoninamidoformyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxy-n-pentylaminoformyl-adenine (hn6A), 2-methylthio-N6-hydroxy-n-pentylaminoformyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyladenine, 2-methylthioadenine, 2-methoxyadenine, N6,2'-O-dimethyladenosine (m6Am), N6,N6,2'-O-trimethyladenosine (m62Am), 1,2'-O-dimethyladenosine (mlAm), 2-amino-N6-methylpurine, l-thioadenine, 8-azidopurine, N6-(19-amino-pentaoxadodecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine. In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanines include inosine (I), 1-methyl inosine (ml), inosine (imG), methyl inosine (mimG), 4-demethyl inosine (imG-14), isodeoxytyrosine (imG2), wybutosine (yW), peroxytyrosine (o2yW), hydroxytyrosine (OHyW), undermodified hydroxytyrosine (OHyW*), 7-deazaguanine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueosine, 7-cyano-7-deazaguanine (preQO), 7-aminomethyl-7-deazaguanine (preQl), geobiosine (G+), 7-deaza-8-azaguanine, 6-thioguanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-azaguanine, 7-methyl-guanine (m7G), 6-thio-7-methylguanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methylguanine (mlG), N2-methylguanine (m2G), N2,N2-dimethylguanine (m22G), N2,7-dimethylguanine (m2,7G), N2,N2,7-dimethylguanine (m2,2,7G), 8-oxoguanine, 7-methyl-8-oxoguanine, 1-methyl-6-thioguanine, N2-methyl-6-thioguanine, N2,N2-dimethyl-6-thioguanine, N2-methyl-2'-0-methyl-guanine (m2Gm), N2,N2-dimethyl-2'-0-methylguanosine (m22Gm), 1-methyl-2'-0-methylguanosine (mlGm), N2,7-dimethyl-2'-0-methylguanosine (m2,7Gm), 2'-0-methyl inosine (Im), 1,2'-0-dimethyl inosine (mIm), 1-thioguanine, and O-6-methylguanine. In some embodiments, the non-standard nucleobases of the functional nucleotide analogs can independently be purine, pyrimidine, purine or pyrimidine analogs. For example, in some embodiments, the non-canonical nucleobases can be modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobases can also include, for example, naturally occurring and synthetic derivatives of bases, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazauridine, 7-deazauridine, 3-deazauridine, pyrazolo[3,4-d]pyrimidine, imidazo[l,5-a]l,3,5 triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine, or 1,3,5 triazine. In some embodiments, the functional nucleotide analogs comprise non-standard sugar groups. In various embodiments, the non-standard sugar groups can be 5-carbon or 6-carbon sugars (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) having one or more substituents which can be halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido groups, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, and the like. Generally, RNA molecules comprise a ribose sugar group, which is a five-membered ring with an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or an alkylene group, such as methylene or ethylene); addition of a double bond (e.g., replacing ribose with a cyclopentenyl or cyclohexenyl group); annulation of the ring of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); expansion of the ring of ribose (e.g., forming a 6- or 7-membered ring with additional carbon or heteroatoms, such as a deoxyhexitol, arabitol, mannitol, cyclohexyl, cyclohexenyl, and morpholino (also with phosphoramidate backbones)); polycyclic forms (e.g., tricyclic and “unlocked” forms, such as glycol nucleic acids (GNA) (e.g., R-GNA or S-GNA, in which ribose is replaced with glycol units attached to phosphodiester bonds), threose nucleic acids (TNA, in which ribose is replaced with a-L-threofuranosyl-(3’→2’)), and peptide nucleic acids (PNA, in which 2-amino-ethyl-glycine linkages replace ribose and the phosphodiester backbone). In some embodiments, the sugar group comprises one or more carbons having the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, nucleic acid molecules can include nucleotides containing, for example, arabinose or L-ribose as the sugar. In some embodiments, the nucleic acid molecule includes at least one nucleoside in which the sugar is L-ribose, 2’-O-methyl ribose, 2’-fluoro ribose, arabinose, a hexitol, LNA, or PNA. In some embodiments, the payload nucleic acid molecules of the present disclosure can comprise one or more modified nucleoside linkages (e.g., phosphate backbones). The phosphate groups of the backbone can be altered by substituting one or more of the oxygen atoms with different substituents. In some embodiments, functional nucleotide analogs can include another nucleoside linkage in place of the unaltered phosphate moiety. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenoates, phosphoroborates, phosphoroboranoates, phosphonooxidic hydrogens, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Both non-linking oxygens of phosphorodithioates are replaced with sulfur. Altered phosphate linkages can also be linked by replacing oxygen with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylenephosphonates). Alternative nucleosides and nucleotides include boranophosphate (BH3), thio, methyl, ethyl and / or methoxy in place of one or more non-bridging oxygens. As non-limiting examples, two non-bridging oxygens at the same position (e.g., alpha, beta or gamma position) can be replaced with thio and methoxy. The stability of RNA and DNA is enhanced (e.g., against exonucleases and endonucleases) by the substitution of one or more oxygen atoms at the position of the phosphate moiety (e.g., alpha-thio-phosphate). Thio-phosphate DNA and RNA have enhanced nuclease resistance and thus have longer half-lives in cellular environments. Other nucleoside linkages for use in accordance with the present disclosure include nucleoside linkages that do not include a phosphorus atom. When the compositions disclosed herein include a nucleic acid (e.g., an mRNA molecule) encoding a nuclease disclosed herein, the nucleic acid molecule can contain any of the modifications disclosed herein, if applicable. (iv) Exemplary guide RNAs In some embodiments, the target sequence of the guide RNA of the present disclosure is selected from any one of SEQ ID NO. 6-17. In some embodiments, the spacer sequence of the guide RNA of the present disclosure is selected from any one of SEQ ID NO. 31-42. In some embodiments, the guide RNAs in the compositions of the present disclosure are as shown in SEQ ID NO. 18-29 (first group), SEQ ID NO. 43-54 (second group), with the following chemical modifications as shown in the table below. II. Preparation and expression of compositions targeting HAO1 1. Preparation of CasY7 polypeptides and variants thereof In some embodiments, the nuclease of the present disclosure can be prepared in a variety of ways. In some embodiments, the nuclease of the present disclosure is expressed by a host cell, isolated, and purified by constructing an expression vector capable of expressing the nuclease of the present disclosure. In some embodiments, it is obtained by in vitro coupled transcription-translation system. In some embodiments, the host cell used for expressing the nuclease of the present disclosure can be selected from any cell that can be used for nuclease expression, illustratively, the host cell can be selected from E. coli, yeast (budding yeast, Saccharomyces cerevisiae and Schizosaccharomyces, S. pombe), nematode (Caenorhabditis elegans), Xenopus oocyte, and animal cells (e.g., CHO cells, COS cells, and HEK293 cells). The method for in vivo expression of the nuclease or variant thereof of the present disclosure in a host cell, comprising providing a polynucleotide encoding the nuclease or variant thereof to the host cell, expressing the nuclease polypeptide or variant thereof in the host cell, and then obtaining the nuclease polypeptide or variant thereof from the host cell. The method for transferring the above-mentioned expression vector into a host cell (i.e., transformation method) is not particularly limited, and known methods such as electroporation, calcium phosphate method, liposome method, and DEAE dextran method can be used. In some embodiments, after the host is transformed with the expression vector, the host cell is cultured, incubated, or propagated to produce the nuclease. In some embodiments, after the nuclease is expressed, the host cell is collected, and the nuclease polypeptide is purified, illustratively, the nuclease can be purified from the culture and the like according to conventional methods (e.g., filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.). Various methods can be used to determine the production level of the nuclease in the host cell, illustratively, methods using polyclonal or monoclonal antibodies specific to the nuclease polypeptide of the present disclosure and variants thereof or a marker tag as described elsewhere herein can be employed, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (MA), fluorescence immunoassay (FIA), and fluorescence-activated cell sorting (FACS) can be employed. These and other assays are well known in the art (see, e.g., Maddox et al., J. Exp. Med. 158:1211
[1983] ). 2. Preparation of guide RNA Various methods can be employed to prepare the guide RNA. In some embodiments, the guide RNA can be synthesized using chemical synthesis, enzymatic synthesis, or a combination thereof, for example, standard phosphoramidite-based solid-phase synthesis methods can be employed, or the guide RNA can be synthesized in vitro by operably linking the DNA encoding the guide RNA to a promoter control sequence recognized by a bacteriophage RNA polymerase. Examples of suitable bacteriophage promoter sequences include T7, T3, SP6 promoter sequences, or variants thereof. In some embodiments, the guide RNA is expressed from DNA encoding it, e.g., a DNA vector comprising a sequence encoding the guide RNA. The guide RNA can be encoded separately or with the nuclease. Such DNA sequences can be introduced into an expression system (e.g., a cell) together or separately. For example, a DNA sequence encoding a nuclease and a DNA sequence encoding a guide RNA can be introduced into a cell, each DNA sequence can be part of separate molecules (e.g., one vector containing the nuclease-encoding sequence and a second vector containing the guide RNA-encoding sequence), or both can be part of the same molecule (e.g., one vector containing the coding (and regulatory) sequences for both the nuclease and the guide RNA). The RNA can be transcribed from a synthetic DNA molecule (e.g., a gene fragment). The guide RNA molecule can be transcribed in vitro. In some embodiments, the guide RNA is synthesized using one or more modified nucleotides, e.g., as described above. In some embodiments, the guide RNA is prepared by expressing the RNA guide sequence in a cell transfected with a plasmid comprising a sequence encoding the guide RNA. In some embodiments, the plasmid encodes multiple different guide RNAs. In some embodiments, multiple different plasmids each encoding a different guide RNA are transfected into the cell. In some embodiments, the guide RNA is expressed from a recombinant vector (e.g., a plasmid) that encodes the guide RNA and also encodes the nuclease. In some embodiments, the guide RNA is expressed from a recombinant vector (e.g., a plasmid) that expresses the guide RNA but does not express the nuclease. In some embodiments, the guide RNA can be provided by a vendor. 3. Preparation of a ribonucleic acid complex (RNP) Provided herein is a ribonucleic acid complex (RNP) comprising a nuclease of the disclosure and a guide RNA of the disclosure. In some embodiments, the guide RNA targeting the HAOl gene is complexed with the nuclease to form a ribonucleoprotein (RNP). In some embodiments, the guide RNA and the nuclease complex to form the RNP at a temperature (e.g., at 20-50 °C, specifically, at about 20 °C, 25 °C, 30 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C, 50 °C). In some embodiments, the guide RNA does not dissociate from the nuclease at 37 °C for an incubation period (e.g., at least about 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, or more). In some embodiments, the guide RNA and nuclease are complexed in a complexation buffer. In some embodiments, the complexation buffer has a pH value in a range. In some embodiments, the pH value is in a range of about 7.3 to 8.6 (e.g., about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6). In some embodiments, the nuclease can be overexpressed in a host cell and complexed with the guide RNA prior to purification as described herein. In some embodiments, the mRNA or DNA encoding the nuclease is introduced into the cell such that the nuclease is expressed in the cell. In some embodiments, the guide RNA is also introduced into the cell, either simultaneously, separately, or sequentially, from a single mRNA or DNA construct, such that an RNP complex is formed in the cell. III. Methods of targeting HAO1 gene The present disclosure also provides methods of targeting a target sequence of the HAO1 gene for editing. In some embodiments, the methods comprise introducing into a cell a guide RNA and a nuclease targeting the HAO1 gene, e.g., an RNP formed by a guide RNA and a nuclease targeting the HAO1 gene can be introduced into a cell; or a nucleic acid vector expressing a guide RNA and a nuclease targeting the HAO1 gene is introduced into a cell; or a nuclease mRNA, a guide RNA is introduced into a cell, optionally, a template DNA is also introduced. In some embodiments, by delivering the compositions described herein to a cell / tissue / human, the HAO1 gene in the cell / tissue / human is disrupted. 1. Design of target sequence In some embodiments, the guide RNA disclosed herein is designed to be complementary to a target sequence adjacent to a PAM of a CasY7 polypeptide or a variant thereof. In some embodiments, the target sequence is within a regulatory sequence of the HAO1 gene, and the guide RNA can bind to the target sequence through base pairing. In some embodiments, the cell comprises one or more (e.g., 1, 2, 3, 4, 5, 6, or more) copies of the target sequence. In some embodiments, the HAO1 gene targeted by the guide RNA of the present disclosure is located in a mammalian cell. In some embodiments, the HAO1 gene is located in a primate cell, preferably, a human cell. In some embodiments, the target sequence of the HAO1 gene is present in the nucleus of the cell. In some embodiments, the target sequence is endogenous to the cell. In some embodiments, the target sequence is located in genomic DNA. In some embodiments, the target sequence is located in chromosomal DNA. In some embodiments, the target sequence is located in a regulatory region of the HAO1 gene, such as a promoter, an enhancer, a 5' or 3' untranslated region, etc. In some embodiments, the target sequence is adjacent to a 5'-TTN-3' PAM sequence, where N is any nucleotide. The 5'-TTN-3' sequence can be immediately adjacent to the target sequence, or within a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides of the target sequence. In some embodiments, the target sequence is a ssDNA (single-stranded DNA). In some embodiments, the target sequence is a dsDNA (double-stranded DNA). In some embodiments, the target sequence comprises both single-stranded and / or double-stranded regions. In some embodiments, the guide RNA is designed to bind to a first strand (non-PAM strand) of a double-stranded target nucleic acid, and the 5'-TTN-3' PAM sequence is present in the second complementary strand (PAM strand). In some embodiments, the guide RNA binds to a target sequence on the non-PAM strand that is complementary to a target sequence on the PAM strand adjacent to a 5'-TTN-3' sequence. In some embodiments, the target sequence of the HAO1 gene is as set forth in SEQ ID NO. 6-17. 2. Gene editing The present disclosure also provides methods of modifying a target sequence of a HAO1 gene. In some embodiments, the method comprises introducing a guide RNA targeting HAO1 and a nuclease into a cell. In some embodiments, the target sequence of the HAO1 gene is as set forth in SEQ ID NO. 6-17 or the reverse complement thereof. In some embodiments, the nuclease has nuclease activity. In some embodiments, CasY7 or a variant thereof induces one or more DNA double-strand breaks in the cell. In some embodiments, CasY7 or a variant thereof induces one or more DNA single-strand breaks in the cell. In some embodiments, CasY7 or a variant thereof induces one or more DNA nicks in the cell. In some embodiments, the DNA breaks and / or nicks result in formation of one or more indels (e.g., one or more deletions). In some embodiments, the guide RNA disclosed herein forms a complex with CasY7 or a variant thereof and directs it to a target sequence adjacent to a 5'-TTN-3' sequence. In some embodiments, the complex induces a deletion (e.g., a nucleotide deletion or a DNA deletion) adjacent to a 5'-TTN-3' sequence. In some embodiments, the complex induces a deletion adjacent to a PAM sequence of 5'-TTA-3', 5'-TTT-3', 5'-TTG-3', or 5'-TTC-3'. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a 5'-TTN-3' sequence. In some embodiments, the deletion results in altered expression of the HAO1 gene. In some embodiments, the deletion results in altered function of the HAO1 gene. In some embodiments, the deletion reduces or inactivates the function of the HAO1 gene. In some embodiments, the deletion is a frameshift deletion or a non-frameshift deletion. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of a 5'-TTN-3' sequence. In some embodiments, the methods described herein are used to engineer a cell comprising a deletion in the HAO1 gene as described herein. The compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein can be used in the treatment of treatment of Type 1 hyperoxaluria (PH1). Any suitable delivery or administration method known in the art can be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein. Such methods can involve contacting a target sequence with a composition, vector, nucleic acid, or guide RNA disclosed herein. Such methods can involve methods of editing a HAO1 sequence as disclosed herein. In some embodiments, cells engineered using the guide RNAs of the disclosure are used for ex vivo gene therapy. In some embodiments, the compositions, vectors, nucleic acids, guide RNAs, and cells of the disclosure are used to treat hyperoxaluria. In some embodiments, the compositions, vectors, nucleic acids, guide RNAs, and cells of the disclosure are used to treat Type 1 hyperoxaluria. In some embodiments, wherein one or more guide RNAs target an exonic region of the HAO1 gene, the one or more guide RNAs are used to treat Type 1 hyperoxaluria (PH1). 3. Delivery The compositions of the disclosure can be formulated. In some aspects, the disclosure provides a polynucleotide encoding a nuclease of the disclosure (e.g., CasY7 and variants thereof). In yet another aspect, the present disclosure provides a delivery composition comprising (1) a nuclease of the present disclosure, a polynucleotide of the present disclosure, or a composition of the present disclosure; and (2) a delivery vehicle. In yet another aspect, the present disclosure also provides a vector comprising a polynucleotide of the present disclosure. In some embodiments, the vector encodes a guide nucleic acid as defined in the present disclosure. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector (vector genome), or a recombinant lentivirus vector. In yet another aspect, the present disclosure provides a recombinant AAV (rAAV) viral particle comprising a rAAV vector genome of the present disclosure. A brief introduction to AAV for delivery can be found at “Adeno-Associated Virus (AAV) Guide” (addgene.org / guides / aav / ). In some embodiments, a delivery vehicle, such as a liposome, is included in the compositions of the present disclosure and delivered to a cell (e.g., prokaryotic, eukaryotic, plant, mammalian, etc.) by known methods. These methods include, but are not limited to, transfection (e.g., lipid-mediated cationic polymers, calcium phosphate, dendrimers); electroporation or other membrane-disrupting methods (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)), microinjection, microparticle bombardment (“gene gun”), direct sonication, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, exosomes, lipid nanoparticle (LNP)-mediated transfer, and any combination thereof. In some embodiments, the nuclease and the guide RNA of the compositions of the present disclosure are delivered together, exemplarily, packaged together in a single AAV particle. In another example, the nuclease component and the guide RNA component are delivered together via LNP. In some embodiments, the nuclease component and the guide RNA component are delivered separately, exemplarily, packaged into separate AAV particles. In some cases, the nuclease component and the guide RNA are delivered differently, e.g., the nuclease component is delivered via an AAV particle while the guide RNA is delivered via LNP. In some embodiments, the disclosure provides a LNP comprising an mRNA encoding a nuclease (e.g., CasY7 or a variant thereof), a guide RNA, or an mRNA encoding both a nuclease and a guide RNA. In some embodiments, the transcriptional template for the mRNA encoding a CasY7 polypeptide is set forth in SEQ ID NO: 5. In some embodiments, the transcriptional template for the mRNA encoding a CasY7 polypeptide is adapted to yield the mRNA transcriptional template for each variant by modifying the pattern of mutations (relative to the CasY7 variant) as appropriate. Correspondingly, in some embodiments, the present application further provides cells produced by such methods, as well as organisms (e.g., animals, plants, or fungi) comprising such cells or produced from such cells. 4. Genetically modified cells The compositions or complexes of the disclosure can be delivered to a variety of cells. In some embodiments, the cell is an isolated cell. In some embodiments, the cell is in cell culture or in a co-culture of two or more cell types. In some embodiments, the cell is ex vivo. In some embodiments, the cell is derived from a living organism and maintained in cell culture. In some embodiments, the cell is a unicellular organism. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell. In some embodiments, the cell is an archaeal cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is selected from an animal cell, a vertebrate cell, a mammalian cell, a non-human mammalian cell, a non-human primate cell, a rodent (e.g., a mouse or rat) cell, a human cell, a plant cell, or a yeast cell) or a prokaryotic cell (e.g., a bacterial cell). In some embodiments, the cell is a plant cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is an animal cell. In some embodiments, the cell is an invertebrate animal cell. In some embodiments, the cell is a vertebrate animal cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a rodent cell. In some embodiments, the cell is synthetically made, sometimes referred to as an artificial cell. In some embodiments, the plant cell is derived from a monocotyledonous plant, e.g., rice, maize, wheat, barley, oat, sorghum, millet, grasses, Poaceae, Zizania, Avena, Coix, Hordeum, Oryza, Panicum (e.g., millet (Panicum miliaceum)), Secale, Setaria (e.g., proso millet (Setaria italica)), Sorghum, Triticum, Zea, Cymbopogon, Saccharum (e.g., sugarcane (Saccharum officinarum)), Phyllostachys, Dendrocalamus, Bambusa, Yushania. In some embodiments, the cell is derived from an animal, e.g., a pig, an ox, a sheep, a goat, a mouse, a rat, a llama, a monkey, a rabbit, a chicken, a duck, a goose, a fish (e.g., a zebrafish). In some embodiments, the cell is derived from a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, 293T, MF7, K562, HeLa, CHO. In some embodiments, the cell is an immortal or immortalized cell. In some embodiments, the cell is a primary cell. In some embodiments, the population of modified cells are animal cells; for example, derived from a rodent, rat, mouse, rabbit, dog cell, or non-human primate cell; for example, a cynomolgus monkey cell. In some embodiments, the cells are human cells. In some embodiments, the cells are liver cells. Any genetically modified cell produced using the compositions disclosed herein can also be within the scope of the present disclosure, which can include a disrupted HAO1 gene. The compositions, vectors, nucleic acids, guide RNAs, and cells of the present disclosure can be used in therapy. The compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein can be used in a method of treating a disease or condition in a subject. Any suitable delivery or administration method known in the art can be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein. Such methods can involve contacting a target sequence with a composition, vector, nucleic acid, or guide RNA of the present disclosure. Such methods can involve a method of editing a HAO1 gene target sequence as disclosed herein. In some embodiments, cells engineered using the guide RNAs disclosed herein are used for ex vivo gene therapy. IV. Therapeutic Applications Any composition of the present disclosure or modified cell produced using a composition of the present disclosure can be used to treat a disease associated with the HAO1 gene. In some embodiments, the disease associated with the HAO1 gene is primary hyperoxaluria, illustratively, including hyperoxaluria type 1. Any suitable delivery or administration method known in the art can be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells of the present disclosure. Such methods can involve contacting a target sequence with a composition, vector, nucleic acid, or guide RNA of the present disclosure. Such methods can involve a method of editing a HAO1 gene target sequence as disclosed herein. In some embodiments, cells engineered using the compositions disclosed herein can be used for ex vivo gene therapy. The compositions of the present disclosure or modified cells produced using a composition as disclosed can be used to treat a disease associated with the HAO1 gene, for example, primary hyperoxaluria (PH). In some embodiments, the primary hyperoxaluria (PH) includes PH1, PH2, or PH3. In some embodiments, the target disease for which the compositions of the present disclosure are directed is PH1. In some embodiments, the present disclosure provides methods for treating a HAOl gene-associated disease (e.g., PH, specifically, e.g., PH1), the methods comprising administering to a subject (e.g., a human patient) in need of treatment any of the compositions disclosed herein. The compositions of the present disclosure are delivered to the particular tissue or cell in need. In some embodiments, the compositions of the present disclosure include one or more LNPs encompassing one or more of the nuclease and / or guide RNA components of the present disclosure, one or more vectors (e.g., viral vectors) encoding one or more components of the compositions of the present disclosure, or a combination thereof. In some embodiments, the compositions of the present disclosure can be formulated to form a pharmaceutical composition, which can further include one or more pharmaceutically acceptable carriers. Active agents (e.g., the compositions of the present disclosure or components thereof or modified cells) in combination with sterile water or sterile isotonic saline. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oil or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations can further include one or more additional ingredients, including, but not limited to, suspending, stabilizing, or dispersing agents. Pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension or solution. This suspension or solution can be formulated according to known techniques and can include additional ingredients such as those described herein, in addition to the cells, such as dispersing agents, wetting agents, or suspending agents. Such sterile injectable formulations can be prepared using non-toxic parenterally acceptable diluents or solvents such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or diglycerides. Other parenterally administrable formulations include those that can include the cells in packaged form, in liposome formulations, or as components of biodegradable polymer systems. Some compositions for sustained release or implantation can include pharmaceutically acceptable polymers or hydrophobic materials such as emulsions, ion exchange resins, sparingly soluble polymers, or sparingly soluble salts. In some embodiments, the modified cells produced using any of the compositions of the present disclosure can be administered to a subject in need of treatment (e.g., a human patient). The modified cells can include substitutions, insertions, and / or deletions in the HAOl gene. In some embodiments, the modified cells can comprise a cell line modified by a nuclease (such as CasY7 or a variant thereof), a reverse transcriptase, and an editing template RNA (e.g., a guide RNA and an RT donor RNA). In some cases, the modified cells can be a heterogeneous population of cells comprising different types of gene edits. Alternatively, the modified cells can comprise a substantially homogenous population of cells (e.g., at least 80% of the cells in the entire population) comprising one particular gene edit in the HAOl gene. In some examples, the cells can be suspended in a suitable culture medium. In some embodiments, the pharmaceutical compositions of the present disclosure can be prepared, packaged, or sold in a formulation suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intralesional, buccal, ocular, intraocular, intravenous, intraorgan, or another route of administration. The pharmaceutical compositions of the present disclosure can be prepared, packaged, or sold in unit dosages or as a plurality of unit dosages in a multiple dose form. As used herein, a “unit dosage” is a discrete amount of the pharmaceutical composition (e.g., a gene editing system or components thereof) that is to be administered to a subject or a convenient fraction of such a dose, e.g., half or a third of such a dose. In some embodiments, the pharmaceutical compositions comprising a gene editing system or components thereof as described herein can be administered to a subject in need thereof, e.g., a subject having a liver disease associated with the HAOl gene. In some cases, the gene editing system or components thereof can be delivered to a particular cell or tissue (e.g., to a liver cell), where the gene editing system can act to genetically modify the HAOl gene in such a cell. In some embodiments, the present disclosure provides a method of treating or preventing a disease or condition in a subject, the method comprising administering a composition or pharmaceutical composition described herein. In some embodiments, the disease or condition is PH1. In some embodiments, the composition or pharmaceutical composition described herein is administered in a unit dose, e.g., a single administration, as described above. In some embodiments, the unit dose achieves durable treatment and / or prevention. In some embodiments, the method achieves durable treatment and / or prevention. Durable treatment and / or prevention as used herein encompasses treatment and / or prevention for a period of at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more. In some embodiments, a single dose of the composition or pharmaceutical composition described herein is sufficient to treat and / or prevent any of the indications described herein for the life of the subject. It will be understood by those skilled in the art that the actual dose can vary greatly depending on a variety of factors, such as carrier selection, target cell, organism, tissue, general condition of the subject to be treated, degree of transformation / modification sought, route of administration, mode of administration, type of transformation / modification sought, etc. In some embodiments, the composition or pharmaceutical composition comprising the same of the present disclosure is administered intravenously to a subject. In some embodiments, the composition or pharmaceutical composition is administered into the liver circulation of a subject. In some embodiments, a single administration of the composition provided herein is sufficient to knock down expression of a mutant protein. In some cases, multiple administrations of the composition or pharmaceutical composition of the present disclosure can result in a more optimal therapeutic effect. In some embodiments, the treatment slows or stops progression of PH1 disease. In some embodiments, the treatment slows or stops progression of end-stage renal disease (ESRD). In some embodiments, the treatment slows or stops the need for a kidney and / or liver transplant. In some embodiments, the treatment results in an improvement, stabilization, or slowing of changes in PH1 symptoms. V. Detection methods The present disclosure also provides a method of detecting a target DNA, the method comprising contacting the target DNA with a system of the present disclosure, wherein the target DNA is modified by the complex, and wherein the modification detects the target DNA. In some embodiments, the modification generates a detectable signal, e.g., a fluorescent signal. VI. Kits and uses thereof The present disclosure also provides kits, e.g., kits that can be used, e.g., to practice the methods described herein for genetically modifying a HAOl gene. In some embodiments, a kit of the present disclosure comprises a guide RNA and a nuclease (CasY7 or a variant thereof). In some embodiments, a kit of the present disclosure comprises a guide RNA, a template DNA, and a nuclease (CasY7 or a variant thereof). In some embodiments, a kit comprises a polynucleotide encoding a nuclease of the present disclosure (CasY7 or a variant thereof), and optionally the polynucleotide is included within, e.g., any of the vectors described herein. In some embodiments, a kit of the present disclosure comprises a polynucleotide encoding a guide RNA disclosed herein. In some embodiments, the nuclease (or polynucleotide encoding CasY7 or a variant thereof) and the guide RNA (e.g., as a ribonucleoprotein) can be packaged within the same container (e.g., vial) within the kit, or can be packaged in separate containers (e.g., vials), the contents of which can be mixed prior to use. In some embodiments, a kit of the present disclosure can additionally comprise instructions for use of the optional buffers, guide RNA, template DNA, and / or nuclease. In some embodiments, a kit includes one or more buffers that can be used to solubilize any of the one or more components contained therein, and / or to provide suitable reaction conditions for one or more of the components. Illustratively, the buffers can include one or more of the following: PBS, HEPES, Tris, MOPS, Na2CO3, NaHCO3, NaB, or combinations thereof. In some embodiments, the reaction conditions include an appropriate pH, such as an alkaline pH. In some embodiments, the pH is between 7-10. In some embodiments, any one or more of the kit components can be stored in a suitable container or at a suitable temperature, e.g., 4°C. All references and publications cited herein are hereby incorporated by reference. Examples The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the present disclosure; it being understood by way of illustrative example that other procedures, methods or techniques known to those skilled in the art could alternatively be utilized. Example 1 Construction of variants of CasY7 To identify more nucleases, the applicant annotated and obtained CasY7 protein (amino acid sequence as shown in SEQ ID NO. 1, nucleotide coding sequence as shown in SEQ ID NO. 2), DR sequence (SEQ ID NO. 3) and PAM preference (5'-TTN-3'), optimized DR-1 (SEQ ID NO. 4) and the like (PCT / CN2024 / 092707, the contents of which are hereby incorporated by reference in their entirety) using bioinformatics approach. After protein function prediction, it was considered that the 282-920th engineered mutation of the CasY7 polypeptide amino acid sequence might affect its cleavage activity. Therefore, the CasY7 expression plasmid was used as a template, and the predicted mutation sites were used as the center to design PCR primers, and the nucleotide sequences after introducing mutations on the PCR primers were used to perform engineered mutations. The CasY7 and each variant are shown in Table 1 as follows: Table 1 CasY7 mutation method (relative to CasY7) Example 2 CasY7 and its variants target HAO1 target in HepG2 cells 1. The mRNA transcription template of CasY7 and its variants (wherein the sequence of CasY7-WT mRNA transcription template is shown in SEQ ID NO. 5, and the sequence of each variant mRNA transcription template is adaptively changed according to the mutation) was synthesized by Nanjing Kingsray. T7 High Yield RNA Synthesis Kit (NEB, E2040S) kit was used for in vitro transcription reaction to obtain the mRNA of each nuclease. 2. According to the PAM (5'-TTN-3') of CasY7 and its variants, the spacer sequence was designed at the downstream 20 bp target sequence consistent with the PAM sequence, and the crRNA sequence was designed using the optimized DR sequence (DR-1, SEQ ID NO. 4): HAO1-crRNA-4 was synthesized by Nanjing Kingsray, and was delivered to HepG2 cells using LNP, as follows: A four-component LNP lipid delivery system (purchased from Ivetop (Shanghai) Pharmaceutical Technology Co., Ltd.) was used. Specifically, Yoltech Lipid1 (compound 10), DSPC, cholesterol, and PEG-DMG were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5. CasY7 and its variant mRNA were dissolved separately with hHAO-crRNA targeting the hHAO1 gene (mass ratio 1:1) in 100 mM enzyme-free citrate buffer at pH 4 (RNA concentration 0.2 mg / mL). The ethanol solution of the lipid carrier and the buffer of mRNA were mixed at a 1:3 (volume / volume) ratio (total lipid to mRNA mass ratio 40:1) and flowed through a microfluidic nanomedicine manufacturing system (NanoAssemblr Ignite, Canada) at a flow rate of 12 ml / min to obtain nucleic acid lipid nanoparticles. The obtained nucleic acid lipid nanoparticles were immediately diluted 40-fold in 1×DPBS buffer. HepG2 cells (purchased from ATCC) were seeded in DMEM medium (Gibco, 11965092) supplemented with 10% FBS (v / v) containing 1% Penicillin Streptomycin (v / v) (Gibco, 15140122) and cultured in a 37°C cell culture incubator containing 5% CO2. Cells for transfection were seeded in 96-well cell culture plates the day before transfection and observed the following day. LNP transfection was performed when the cell density reached approximately 80%. LNP@mRNA (transfection dose of 40 ng / well) was added to HepG2 cells. Cells were collected 48 hours after transfection, and genomic DNA was extracted from the collected cells (TIANGEN, DP304-03). Cleavage activity was assessed, amplified by PCR, and sequenced by Beijing Qingke Biotechnology Co., Ltd. The synthetic method of Yoltech Lipid1 (compound 10, PCT / CN2024 / 104304, the entire contents of which are incorporated herein by reference) is as follows: 5-[(2-Butyl-1-oxylidene octyl)oxy]valerate-7-butyl-21-(10-butyl-3,9-dioxylidene-2,8-dioxahexadecane-1-yl)-19-[3-(diethylamino)propyl]-8-oxylidene-19-aza-9-oxadodecane-22-yl ester Step 1: Synthesis of Compounds 1-2 In a 500 mL round bottom flask, cyclohexyl acetate (25.00 g, 249.70 mmol, 1.0 eq), distilled water (20 mL), ethanol (200 mL), sodium hydroxide (10.99 g, 274.67 mmol, 1.1 eq) were added. After 3 hours of reaction at 70 °C, the solvent was removed by concentration under reduced pressure, 200 mL of acetone was added slowly to the flask, tetrabutylammonium iodide (4.61 g, 12.48 mmol, 0.05 eq), benzyl bromide (51.25 g, 299.64 mmol, 1.2 eq) was added, followed by overnight reaction at 70 °C. The reaction was quenched by adding 500 mL of water, extracted twice with 500 mL of ethyl acetate each, the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and column chromatography gave benzyl 5-hydroxypentanoate (37.00 g, yield 71.2%). Step 2: Synthesis of compound 1-4 In a 500 mL round bottom flask, benzyl 5-hydroxypentanoate (37.00 g, 177.67 mmol, 1.0 eq), 2-butyloctanoic acid (35.59 g, 177.67 mmol, 1.0 eq), 250 mL of dichloromethane and 4-dimethylaminopyridine (21.70 g, 177.67 mmol, 1.0 eq) were added, and finally 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (51.09 g, 266.50 mmol, 1.5 eq) was added. The reaction was carried out at room temperature for 4 hours, diluted with 500 mL of water, extracted twice with 500 mL of dichloromethane each, the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and column chromatography gave 2-butyloctanoic acid-5-(benzyloxy)-5- oxopentyl ester (64.00 g, yield 92.2%). Step 3: Synthesis of compound 1-5 In a 250 mL round bottom flask, 2-butyloctanoic acid-5-(benzyloxy)-5-oxopentyl ester (64.00 g, 163.87 mmol, 1.0 eq), methanol (75 mL), tetrahydrofuran (75 mL) were added, and finally Pd / C (3.49 g, 32.78 mmol, 0.2 eq, 10% purity) was added. The reaction was carried out at room temperature for 16 hours under an atmosphere of hydrogen gas, filtered and concentrated to give 5-[(2-butyloxy-1-oxo octyl)oxy] pentanoic acid (45.00 g, yield 91.4%). Step 4: Synthesis of compound 1-7 To a round bottom flask containing 100 mL of dichloromethane was added 5-[(2- butyl-l-oxoacetyl)oxy]pentanoic acid (10.00 g, 33.29 mmol, 1.0 eq), 2-hydroxymethylpropane- 1,3-diol (3.53 g, 33.29 mmol, 1.0 eq), 4-dimethylaminopyridine (0.81 g, 6.66 mmol, 0.2 eq), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (9.57 g, 49.94 mmol, 1.5 eq), and N,N-diisopropylethylamine (8.60 g, 66.58 mmol, 2.0 eq) at room temperature and stirred for 4 hours. The reaction was quenched by adding 200 mL of water and extracted twice with 200 mL of dichloromethane each time. The organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. Purification by column chromatography yielded 2-butylacetic acid-18-butyl-8- (hydroxymethyl)-5, 11, 17-trioxo-6, 10, 16-trioxa-24-azatetracosan-1-yl ester (7.80 g, 69.9% yield). Step 5: Synthesis of compound 1-8 To a round bottom flask containing 30 mL of dichloromethane was added compound 2-butylacetic acid-18-butyl-8-(hydroxymethyl)-5, 11, 17-trioxo-6, 10, 16-trioxa-24- azatetracosan-1-yl ester (3.90 g, 5.81 mmol, 1.0 eq), triethylamine (1.76 g, 17.43 mmol, 3.0 eq), and methanesulfonic anhydride (2.02 g, 11.62 mmol, 2.0 eq) at room temperature and slowly added at 0 °C. The reaction was slowly allowed to warm to room temperature and stirred for 4 hours. The reaction was quenched by adding 30 mL of water and extracted twice with 50 mL of dichloromethane each time. The organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. Purification by column chromatography yielded methane sulfonic acid-12-butyl-2-(10-butyl-3, 9-dioxo-2, 8-dioxadecan-1-yl)-5, 11-dioxo-4, 10-dioxaoctadecan-1-yl ester (3.85 g, 88.4% yield). Step 6: Synthesis of compound 1-10 Compound 1-8 (600.0 mg, 0.80 mmol, 1.0 eq), 3-amino-1-propanol (300.0 mg, 3.99 mmol, 5.0 eq), potassium carbonate (280.0 mg, 2.00 mmol, 2.5 eq), potassium iodide (130.0 mg, 0.80 mmol, 1.0 eq) were added into 10 mL of acetonitrile, protected by nitrogen, heated to 90 degrees Celsius, and reacted for 16 hours at room temperature. The reaction solution was concentrated, diluted with water, extracted with ethyl acetate three times, the organic phase was combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain compound 5-[(2-butyl-1-oxoacetyl)oxy]pentanoic acid-12-butyl-2-{[(3- hydroxypropyl)amino]methyl}-5,11-dioxo-4,10-dioxadodecan-1-yl ester (210.0 mg, 36.11%). MS: m / z [M+H] = 728.6. + = 728.6. Step 7: Synthesis of compound 10 Compound 2-butyl octanoic acid-8-(10-butyl-3,9-dioxo-2,8-dioxahexadecan-1-yl)-14- ethyl-5-oxo-10,14-diaz-6-oxahexadecan-1-yl ester (500.0 mg, 0.64 mmol, 1.0 eq), 2-butyl octanoic acid-9-bromononyl ester (390.0 mg, 0.96 mmol, 1.5 eq), potassium carbonate (270.0 mg, 1.92 mmol, 3.0 eq), potassium iodide (110.0 mg, 0.64 mmol, 1.0 eq) were added into 20 mL of acetonitrile, protected by nitrogen, heated to 90 degrees Celsius, and reacted overnight. The reaction solution was concentrated, diluted with water, extracted with dichloromethane three times, the organic phase was combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 5-[(2-butyl-1-oxoacetyl)oxy]pentanoic acid-7-butyl-21-(10-butyl-3,9-dioxo-2,8-dioxahexadecan-1-yl)-19-[3-(diethylamino)propyl]-8-oxo-19-aza-9-oxadocosan-22-yl ester (132.8 mg, yield 18.8%). MS: m / z [M+H] = 1107.9. + = 728.6. 1 H NMR (300 MHz, CDCl3) δ 4.15-4.01 (m, 10H), 3.44-3.20 (m, 4H), 2.71-2.50 (m, 6H), 2.39-2.23 (m, 12H), 2.02-1.40 (m, 28H), 1.38-1.22 (m, 48H), 0.92-0.75 (m, 18H). As can be seen from the analysis, each variant of CasY7 and the guide RNA (HA01-crRNA-4) mediates significant targeted cleavage activity (Figure 1). 3. To study the mediation effect of HAO1-crRNA-1, HAO1-crRNA-2, HAO1-crRNA-3, HAO1-crRNA-5, HAO1-crRNA-6, HAO1-crRNA-7, HAO1-crRNA-8, HAO1-crRNA-9, HAO1-crRNA-10, HAO1-crRNA-11, and HAO1-crRNA-12, the variant C30725 was selected as the research object, and HAO1-crRNA-4 was used as the control for the experiment: (1) The coding nucleotide sequence of C30725 was constructed into the ABE8e plasmid (Addgene, Plasmid #138489) at positions 466-5160 to construct a C30725 expression plasmid. The HAO1-crRNA expression plasmid was constructed, a CACC sequence was added to the 5' end of the upstream sequence of HAO1-crRNA, an AAAA sequence was added to the 5' end of the downstream sequence, and oligos were synthesized, as follows: (2) After the upstream and downstream sequences of the aforementioned HAO1-crRNA were synthesized, annealing was performed by a preset program (95°C, 5 min; from 95°C to 85°C at -2°C / s; from 85°C to 25°C at -0.1°C / s), and then the annealing product was ligated to the PHK09T vector (the sequence of the PHK09T vector is shown in SEQ ID NO. 30, and the plasmid map is shown in Figure 3) linearized by BsmBI (NEB, #R0580L). The linearization of the PHK09T vector and the ligation of the HAO1-crRNA annealing product to the linearized vector were as follows: The PHK09T vector was first linearized, and the linearization system was as follows: 3 μg of the PHK09T vector; 6 μL of buffer (NEB, #R0539L); 2 μL of BsmBI; ddH2O was added to 60 μL, and enzyme digestion was performed at 50°C overnight. The ligation system of the HAO1-crRNA annealing product to the linearized vector was as follows: 1 μL of T4 ligase buffer (NEB, #M0202L), 20 ng of linearized vector, 5 μL of annealed oligo fragment, 0.5 μL of T4 ligase (NEB, #M0202L), and ddH2O was added to 10 μL, and ligation was performed at 16°C overnight. (3) The HAO1-crRNA expression plasmid obtained in step (2) was transformed into E. coli DH5a competent cells (Unique Biotech, DL1001) for amplification, and the plasmid was extracted (using an endotoxin-free plasmid maxi extraction kit, TIANGEN: DP120-01). After determining the plasmid concentration, the plasmid was stored for later use, and the HAO1-crRNA expression plasmid was obtained. (4) HEK293T cells (purchased from ATCC) were inoculated in DMEM medium (Gibco, 11965092) containing 10% FBS (v / v) and 1% Penicillin Streptomycin (v / v) (Gibco, 15140122) and cultured in a 37°C cell incubator containing 5% CO2. For transfection, cells were inoculated in a 24-well cell culture plate the day before and observed the next day. When the cell density reached about 80%, the cells were transfected. C30725 expression plasmid and HAO1-crRNA expression plasmid were transfected into HEK293T cells, and the amount of plasmid transfected into each cell in a 24-well plate was C30725 expression plasmid 0.3 μg, HAO1-crRNA expression plasmid 0.3 μg, and EGFP-C1 plasmid 0.3 μg (control plasmid). The specific transfection operation is as follows: C30725 expression plasmid, HAO1-crRNA expression plasmid, and EGFP-C1 plasmid were mixed with 25 μl of The serum-reduced medium (Source Bioscience, L530KJ) was diluted and 2 μl of Lipofectamine 3000 (Invitrogen, L3000015) reagent was added and mixed to serve as reagent A, and was allowed to stand for 5 minutes. At the same time, 2 μl of Lipofectamine 3000 transfection reagent (Invitrogen, L3000015) was mixed with 25 μl of The serum-reduced medium (Source Bioscience, L530KJ) was diluted and mixed to serve as reagent B, and was allowed to stand for 5 minutes. The above reagent A and reagent B were mixed and uniformly blown, and allowed to stand for 20 minutes. After standing, the mixed reagent was added dropwise to the 24-well plate cells to be transfected, and was placed back in a 37°C, 5% CO2 incubator for culture. After 6 hours of transfection, the culture medium was replaced with DMEM medium containing 10% FBS. (5) After 48 hours of transfection, EGFP fluorescence protein expression indicates that cell transfection is successful, and cells expressing EGFP are sorted for editing efficiency detection. The cells are subjected to genome extraction (using a genomic DNA extraction kit, TIANGEN, DP304-03). The sequences near the target sites are subjected to PCR amplification using the PCR primers in the following table as a template: The PCR amplification system is as follows: 2x Taq Master Mix (Vazyme, P112-03) 25 μL; Primer-F (HAO1-F) (10 pmol / μL) 1 μL; Primer-R (HAO1-R) (10 pmol / μL) 1 μL; template 1 μL; ddH2O is added to 50 μL. The primers are designed, and after PCR amplification, the obtained PCR products are used for high-throughput deep sequencing (Kecheng Biotechnology Co., Ltd.) or Sanger sequencing (Platinum Biotechnology (Shanghai) Co., Ltd.) for editing efficiency identification. Analysis shows that each crRNA mediates significant cleavage activity (Figure 2). Example 3 Off-target identification of CasY7 variants and guide RNAs To evaluate the application of CasY7 variants in human cells, 133 gene sites and off-target protospacer sequences (DNA sequences) that may occur off-target cleavage were predicted according to the HAO1-crRNA-4 target sequence (SEQ ID NO. 8) and its PAM (5'-TTA-3') sequence (see Table 2). C30725 variant and HAO1-crRNA-4 were used as research objects, and HepG2 cell transfection was performed in the same dose and the same way as in steps 1-2 of Example 2. Deep sequencing was used to detect target activity and off-target activity. Analysis shows that compared with the control group (only C30725 variant mRNA is encapsulated in LNP), the C30725 variant does not show off-target cleavage activity at the predicted sites (Table 2). This shows that targeted editing mediated by C30725 variant and HAO1-crRNA-4 does not occur obvious off-target, and has high fidelity. Table 2 Prediction of possible off-target sites, corresponding spacer sequences and editing efficiency Example 4 HAO1 gene editing in animals in vivo To study the in vivo editing effect of the composition targeting HAO1 gene, 6-7 week old C57BL / 6 female mice (purchased from Jiangsu Jizu Pharmaceutical Company) were selected as the research object. In the same way as steps 1-2 of example 2, lipid nanoparticles (LNP) encapsulating variant C30725 mRNA and HAO1-crRNA-4 were prepared, and were administered systemically by tail vein injection at a dose of 0.2 mg / kg. PBS buffer was injected into the tail vein of mice of the same age and gender group as a negative control. The editing efficiency was detected one week after administration of the mice, and the liver tissue was taken after the mice were sacrificed, and the genome was extracted after lysis. The efficiency was analyzed by deep sequencing, and the deep sequencing results were analyzed by crispresso software to analyze the specific site, and the editing efficiency was analyzed. The in vivo editing efficiency of the composition targeting HAO1 gene was 50%, which indicated that the nuclease of the present disclosure exhibited significant genome editing efficiency in mammalian cells, indicating its excellent potential in therapeutic genome editing applications. In summary, the composition of the present disclosure has robust editing activity and high specificity for therapeutic applications. Various modifications and variations to the described products, methods, and uses of the present disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the present disclosure. Although the present disclosure has been described in connection with specific embodiments thereof, it will be understood that further modifications will be apparent to those skilled in the art and that this is intended to be encompassed by the following claims. Indeed, various modifications of the described modes of carrying out the present disclosure which are obvious to those skilled in the art are intended to be within the scope of the present disclosure. It is intended to cover in those claims any and all equivalents. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
Claims
A nuclease comprising an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO.
1. The nuclease of claim 1, comprising substitution at one or more of the following positions: 175, 176, 282, 283, 285, 416, 417, 418, 419, 420, 788, and 829 of SEQ ID NO.
1. Preferably, the following mutation pattern is included in the amino acid sequence set forth in SEQ ID NO. 1: (i) Y282+D283+A285+G416+I417+E418+F419+D420; or (ii) E176+Y282+D283+A285+G416+I417+E418+F419+D420; Preferably, the following mutation pattern is included in the amino acid sequence set forth in SEQ ID NO. 1: Y282+D283+A285+G416+I417+E418+F419+D420; A175+E176+Y282+D283+A285+G416+I417+E418+F419+D420; E176+Y282+D283+A285+G416+I417+E418+F419+D420+E788; or E176+Y282+D283+A285+G416+I417+E418+F419+D420+E829; More preferably, the substitution of the nuclease compared to the amino acid sequence set forth in SEQ ID NO. 1 is selected from the following mutation pattern: Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A; A175R+E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A; E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A+E788R; or E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A+E829R. A composition targeting HAO1 gene for gene editing of HAO1 gene, the composition comprising: (i) a nuclease or a first nucleic acid encoding the nuclease of claim 1 or 2; (ii) a guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence specific to a target sequence within the HAO1 gene. The composition of claim 3, comprising the first nucleic acid encoding the nuclease, the first nucleic acid being codon-optimized for expression in a eukaryotic cell. The composition of claim 3 or 4, wherein the target sequence is within a promoter or an exon of the HAO1 gene; Optionally, the target sequence is located in the promoter, first exon, second exon, or fourth exon sequence of the HAO1 gene. The composition of claim 5, wherein the spacer sequence is 15-100 nucleotides in length, preferably 16 to 50 nucleotides, more preferably 17 to 30 nucleotides, more preferably 18 to 22 nucleotides, more preferably 20 nucleotides. The composition of any one of claims 3-6, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) comprising the sequence 5'-TTN-3'. The composition of any one of claims 3-7, wherein the target sequence is selected from: (i) GCCAAAGTTCAGATTTAGTTCTC (SEQ ID NO. 6); (ii) CCCCAGACCTGTAATAGTCATAT (SEQ ID NO. 7); (iii) ATTCTAGATGGAAGCTGTATCCA (SEQ ID NO. 8); (iv) GGACAGAGGGTCAGCATGCCAAT (SEQ ID NO. 9); (v) GAGACGACAGTGGACTTGCTGCA (SEQ ID NO. 10); (vi) GCCACATATGCAGCAAGTCCACT (SEQ ID NO. 11); (vii) AAACCAGTACTTTATCATTTT (SEQ ID NO. 12); (viii) ATCCTAAAATAAGAAATGCAT (SEQ ID NO. 13); (ix) GCAAAAGTCTATTAATAATT (SEQ ID NO. 14); (x) TACATCCTCACTGTTCTGTT (SEQ ID NO. 15); (a) TCAATTATTAATAGACTTTT (SEQ ID NO. 16); or (b) TTTGTCAATTATTAATAGAC (SEQ ID NO. 17). The composition of any one of claims 3-8, wherein the spacer sequence is optionally selected from: (i) GCCAAAGUUCAGAUUUAGUUCUC (SEQ ID NO. 31); (ii) CCCCAGACCUGUAAUAGUCAUAU (SEQ ID NO. 32); (iii) AUUCUAGAUGGAAGCUGUAUCCA (SEQ ID NO. 33); (iv) GGACAGAGGGUCAGCAUGCCAAU (SEQ ID NO. 34); (v) GAGACGACAGTGGACTTGCTGCA (SEQ ID NO. 10); (vi) GCCACATATGCAGCAAGTCCACT (SEQ ID NO. 11); (vii) AAACCAGTACTTTATCATTTT (SEQ ID NO. 12); (viii) ATCCTAAAATAAGAAATGCAT (SEQ ID NO. 13); (ix) GCAAAAGTCTATTAATAATT (SEQ ID NO. 14); (x) TACATCCTCACTGTTCTGTT (SEQ ID NO. 15); (a) TCAATTATTAATAGACTTTT (SEQ ID NO. 16); or (b) TTTGTCAATTATTAATAGAC (SEQ ID NO. 17). (v) GAGACGACAGUGGACUUGCUGCA (SEQ ID NO. 35); (vi) GCCACAUAUGCAGCAAGUCCACU (SEQ ID NO. 36); (vii) AAACCAGUACUUUAUCAUUUU (SEQ ID NO. 37); (viii) AUCCUAAAAUAAGAAAUGCAU (SEQ ID NO. 38); (ix) GCAAAAGUCUAUUAAUAAUU (SEQ ID NO. 39); (x) UACAUCCUCACUGUUCUGUU (SEQ ID NO. 40); (a) UCAAUUAUUAAUAGACUUUU (SEQ ID NO. 41); or (b) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42). The composition of any one of claims 3-9, wherein the guide RNA comprises the spacer sequence and a direct repeat (DR) sequence. The composition of claim 10, wherein the direct repeat sequence has a nucleotide sequence that is at least about 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence set forth in SEQ ID NO. 3 or 4. The composition of any one of claims 3-11, wherein the guide RNA is selected from any one of SEQ ID NOs. 18-29, 43-54. The composition of any one of claims 3-12, wherein the second nucleic acid encoding the guide RNA has been codon-optimized for expression in a eukaryotic cell. A polynucleotide encoding the nuclease and / or guide RNA described in any one of claims 3-13. A vector comprising the polynucleotide of claim 14; Optionally, wherein the vector encodes a guide RNA as described in any one of claims 3-13; Optionally, wherein the vector is a plasmid vector, a recombinant AAV (rAAV) vector, or a recombinant lentivirus vector. A ribonucleoprotein (RNP) comprising the nuclease of claim 1 or 2 and optionally a guide RNA as defined in any one of claims 3-13. A lipid nanoparticle (LNP) comprising the nuclease of claim 1 or 2 or the composition of any one of claims 3-13. A kit comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, the ribonucleoprotein (RNP) of claim 16, or the lipid nanoparticle (LNP) of claim 17. A cell comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, or the vector of claim 15, and obtained after gene editing of the cell by the composition, nucleic acid, or vector. The cell of claim 19, wherein the cell is a eukaryotic cell. Optionally, the cell is a rodent cell (e.g., a mouse cell, a rat cell), a non-human primate cell, or a human cell. Optionally, the cell comprises a liver cell. A pharmaceutical composition comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, or the cell of any one of claims 19-20; and a pharmaceutically acceptable carrier or excipient. A formulation comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, the pharmaceutical composition of claim 18, or the cell of claim 19 or 20, and a pharmaceutically acceptable carrier, diluent, or excipient. A guide RNA comprising: (i) a spacer sequence specific for a target sequence in a HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located 5' of the target sequence comprising the motif 5'-TTN-3'; and (ii) a direct repeat sequence; Optionally, the target sequence is selected from any one of SEQ ID NOs. 6-17; Optionally, the spacer sequence is selected from any one of SEQ ID NOs. 31-42; Optionally, the guide RNA sequence is selected from any one of SEQ ID NOs. 18-29, any one of SEQ ID NOs. 43-54. A method for editing a HAO1 gene in a cell, the method comprising contacting a host cell with the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, or the ribonucleoprotein (RNP) of claim 16, to genetically edit a HAO1 gene in the host cell. The method of claim 24, wherein the contacting occurs ex vivo, in vivo, or in vitro. A method for treating hyperoxaluria in a subject, the method comprising administering to a subject in need thereof a composition for editing a HAO1 gene of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, or the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, the cell of any one of claims 19-20, the pharmaceutical composition of claim 21, or the formulation of claim 22. The method of claim 26, wherein the subject is a human patient having hyperoxaluria. Optionally, the hyperoxaluria is primary hyperoxaluria type 1 (PH1).