Pre-eclampsia biomarker and use thereof
By using the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494 as biomarkers for preeclampsia, combined with specific primers and RT-qPCR technology, the accuracy and feasibility issues of early diagnosis of preeclampsia were resolved, and a non-invasive and low-cost diagnostic approach was achieved.
Patent Information
- Application Number
- PCT/CN2025/136712
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-24
- Filing Date
- 2025-11-21
- Publication Date
- 2026-04-02
AI Technical Summary
Current technologies lack safe and effective methods for early diagnosis of preeclampsia, and the predictive efficacy of existing biomarkers needs further validation. The experimental techniques are too demanding and difficult to apply on a large scale.
Using the fusion genes PSPC1-MRPS31P2 and LINC00630-AL035494 as biomarkers for preeclampsia, and combining specific primers with RT-qPCR or digital PCR technology, a non-invasive diagnostic protocol applicable to peripheral blood and placental tissue of pregnant women was developed.
It enables early prediction and accurate diagnosis of preeclampsia, reduces experimental costs and technical barriers, and is suitable for large-scale clinical application.
Smart Images

Figure CN2025136712_02042026_PF_FP_ABST
Abstract
Description
A preeclampsia biomarker and application thereof TECHNICAL FIELD
[0001] The present application belongs to the field of biomedical technology, and particularly relates to a preeclampsia biomarker and application thereof. BACKGROUND
[0002] Preeclampsia (PE) is a serious pregnancy complication associated with hypertension, and the main symptoms are high blood pressure, proteinuria, edema, liver or kidney function damage, etc. in pregnant women after 20 weeks of gestation, and the symptoms become more serious as the gestation progresses. Statistics show that about 2-8% of pregnant women will suffer from preeclampsia every year, which is one of the main causes of maternal and fetal deaths. Preeclampsia has a complex pathogenesis, and is a comprehensive disease with multiple factors, multiple mechanisms and multiple pathways. In clinical practice, taking low-dose aspirin or oral calcium supplementation can improve the condition to a certain extent, but there is still a lack of safe and effective treatment methods, and termination of pregnancy is the only effective means at present. At the same time, the current diagnosis of preeclampsia mainly depends on clinical symptoms such as blood pressure, proteinuria, central nervous system symptoms, liver and kidney function blood biochemical indicators of pregnant women, and there is a lack of specific and sensitive early diagnosis technology. Therefore, improving the ability to diagnose preeclampsia in the early stage and timely clinical intervention and treatment are of great significance to prevent and reduce the risk of preeclampsia and death. However, since the pathogenesis of preeclampsia has not been fully understood, accurate and effective prediction and diagnosis methods have not yet been established.
[0003] A large number of studies have confirmed that angiogenic factors (such as soluble fms-like tyrosine kinase-1 (sFlt-1), placental growth factor (PlGF), soluble endoglin (sEng)) can play a certain predictive role in preeclampsia in the second trimester of pregnancy. The negative predictive value of sFlt-1 / PlGF ratio ≤38 is 99.3%, and the positive predictive value of ratio >38 is 36.7%. However, the predictive efficiency of such indicators still needs to be further verified through prospective, large sample size, multi-center clinical studies, and the risk factors of pregnant women are still important clinical indicators for screening high-risk groups in early pregnancy. In recent work, the plasma cell-free RNA (cfRNA) transcriptome and DNA (cfDNA) methylation patterns of pregnant women with pre-eclampsia symptoms and normal pregnant women were compared, and the sensitivity of diagnosing preeclampsia reached about 70%, but the experimental technical threshold was high, and large-scale verification was lacking.
[0004] Placenta formation and abnormal development is one of the key pathological mechanisms of preeclampsia. Studies have shown that the placenta is very similar to tumors in some ways, such as high cell proliferation and division ability, invasion, high expression of angiogenic factors (such as vascular endothelial growth factor (VEGF)), etc. Therefore, there may be some biological phenomena commonly seen in tumors in the placenta, such as fusion genes. Fusion genes are a new gene formed by the fusion of all or part of the sequences of two or more genes, which belong to a kind of variation, and have been confirmed to be closely related to the pathogenesis of some diseases. At present, the research on fusion genes is mainly concentrated in the field of tumors, and some fusion genes have been developed as biomarkers for tumor diagnosis and therapeutic targets. SUMMARY
[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a preeclampsia biomarker, which can be used as a biomarker for non-invasive prenatal diagnosis of preeclampsia, has the advantages of high accuracy, low technical threshold and low cost, and is suitable for large-scale promotion and use.
[0006] The present application also proposes a nucleic acid molecule.
[0007] The present application also proposes a kit.
[0008] The present application also proposes the application of the above-mentioned preeclampsia biomarker.
[0009] According to a first aspect of the present application, a preeclampsia biomarker is proposed, which comprises at least one of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494.
[0010] In some embodiments of the present application, the nucleotide sequence of the fusion gene PSPC1-MRPS31P2 near the fusion site is shown in SEQ ID NO. 1.
[0011] In some embodiments of the present application, the nucleotide sequence of the fusion gene LINC00630-AL035494 near the fusion site is shown in SEQ ID NO. 2.
[0012] In some embodiments of the present application, the sequence information of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 is as follows:
[0013] According to a second aspect of the present application, a nucleic acid molecule comprising specific primers for detecting the biomarker of preeclampsia according to the first aspect of the present application is provided.
[0014] In some embodiments of the present application, the nucleic acid molecule comprises specific primers for detecting the fusion gene PSPC1-MRPS31P2.
[0015] In some preferred embodiments of the present application, the specific primers for detecting the fusion gene PSPC1-MRPS31P2 comprise: a primer pair as set forth in SEQ ID NO. 3 and SEQ ID NO. 4; or a primer pair as set forth in SEQ ID NO. 5 and SEQ ID NO. 6.
[0016] In some embodiments of the present application, the nucleic acid molecule comprises specific primers for detecting the fusion gene LINC00630-AL035494.
[0017] In some preferred embodiments of the present application, the specific primers for detecting the fusion gene LINC00630-AL035494 comprise: a primer pair as set forth in SEQ ID NO. 7 and SEQ ID NO. 8; or a primer pair as set forth in SEQ ID NO. 9 and SEQ ID NO. 10.
[0018] In some embodiments of the present application, the nucleic acid molecule is suitable for detection by RT-qPCR or digital PCR.
[0019] According to a third aspect of the present application, a kit comprising the nucleic acid molecule according to the second aspect of the present application is provided.
[0020] In some embodiments of the present application, the kit further comprises a nucleic acid extraction reagent, a primer set for a reference gene, and a PCR reaction reagent.
[0021] In some preferred embodiments of the present application, the PCR reaction reagent comprises a DNA polymerase, dNTPs, and a fluorescent dye.
[0022] In some embodiments of the present application, the kit is suitable for use with sample types including blood samples and placental tissue samples.
[0023] In some preferred embodiments of the present application, the blood sample comprises a serum sample and / or a plasma sample.
[0024] According to a fourth aspect of the present application, the use of the biomarker of preeclampsia according to the first aspect of the present application in (1) to (3) is provided:
[0025] (1) preparing a product for detecting preeclampsia;
[0026] (2) preparing a product for evaluating preeclampsia prognosis analysis;
[0027] (3) screening a drug for treating and / or preventing preeclampsia.
[0028] The present application has at least the following beneficial effects:
[0029] The preeclampsia biomarker provided by the present application can provide a non-invasive diagnosis scheme for prenatal preeclampsia in clinic. The preeclampsia specific highly expressed fusion genes (PSPC1-MRPS31P2 and LINC00630-AL035494) in the peripheral blood of pregnant women are detected by real-time quantitative PCR, so as to realize early prediction of preeclampsia, disease diagnosis and monitoring of the state of patients during the disease. The marker can be combined with the existing clinical diagnosis scheme to improve the accuracy of preeclampsia diagnosis. The kit provided by the present application can be used for early diagnosis of diseases, and the reagent cost and experimental operation difficulty are low, which is suitable for large-scale clinical promotion. BRIEF DESCRIPTION OF DRAWINGS
[0030] The present application will be further described below in combination with the drawings and examples, in which:
[0031] FIG. 1A is a detection result graph of the expression level of the fusion gene PSPC1-MRPS31P2 in the clinical placenta sample in Example 1 of the present application; FIG. 1B is a detection result graph of the expression level of the fusion gene LINC00630-AL035494 in the clinical placenta sample in Example 1 of the present application; wherein, “Control” is a healthy person sample, “PE” is a preeclampsia patient sample, “***” represents p value less than 0.001, and “*” represents p value less than 0.05;
[0032] FIG. 2A is a detection result graph of the expression level of the fusion gene PSPC1-MRPS31P2 in the clinical plasma sample in Example 2 of the present application; FIG. 2B is a detection result graph of the expression level of the fusion gene LINC00630-AL035494 in the clinical plasma sample in Example 3 of the present application; wherein, “Control” is a healthy person sample, “PE” is a preeclampsia patient sample, “**” represents p value less than 0.01, and “*” represents p value less than 0.05;
[0033] FIG. 3 is a ROC analysis curve graph of the combined expression level of the fusion gene PSPC1-MRPS31P2 in the clinical plasma sample in Example 2 and the fusion gene LINC00630-AL035494 in the clinical plasma sample in Example 3 of the present application;
[0034] Figure 4 is a flowchart of the verification test of embodiments 2-4 of the present application. DETAILED DESCRIPTION
[0035] The concept and technical effects of the present application will be described in detail below in combination with embodiments, so as to fully understand the purposes, features and effects of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0036] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values of the range, as well as every numerical value between the minimum and maximum values. Further, when the range refers to integers, every integer value between the minimum and maximum values of the range is included. In addition, when multiple ranges are provided to describe the same feature or characteristic, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein are to be understood as including any and all sub-ranges subsumed therein.
[0037] The reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field, unless otherwise specified.
[0038] Example 1: Screening of biomarkers associated with preeclampsia
[0039] This example is based on 10 placental samples of patients with preeclampsia (all of which are of the Late-Onset Preeclampsia (LOP) type, which is the main subtype of preeclampsia, accounting for more than 80%) and 9 placental samples of healthy pregnant women similar in age and gestational age to the above-mentioned patients. The whole transcriptome sequencing technology (RNA sequencing, RNA-seq) was used to draw the transcriptome map of these placental samples, and then the STAR-Fusion software was used to identify a plurality of fusion genes, including the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494. Further, specific qPCR primers were designed for the above-mentioned target fusion genes, and the expression levels of the target fusion genes in the above-mentioned 19 placental samples were precisely quantitatively analyzed using specific primers. The specific test steps are as follows:
[0040] 1) Sample collection:
[0041] After the pregnant woman gave birth, fresh placental chorionic membrane tissue on the fetal side was collected into a 2 mL cryopreservation tube and immediately placed in a -80 °C refrigerator for long-term storage until use. Before use, about 100 mg of tissue was taken by liquid nitrogen grinding without thawing the placental tissue for subsequent RNA extraction, reverse transcription, and other experiments.
[0042] 2) Specific primer design:
[0043] According to the sequence of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 near the fusion position, the corresponding specific primers were designed.
[0044] The sequence of the fusion gene PSPC1-MRPS31P2 near the fusion site is as follows: 5'-TGAGGCAAGATCTAATGAGGCGTCAAGAAGAACTCAGACGCTTGGAAGAACTCAGAAACCAAGAGTTGCAAAAACGGAAGCAAATACAACTAAGACATGAAGAGGAGCATCGGCGGCGTGAGGAAGAAATGATCCGACACAGAGAACAGGAGGAACTGAGGCGACAGCAAGAGGGCTTTAAGCCAAACTACATGGAAAATGGTGATAAAAGAAAATGTGGCTGAAGTTACCCGAAGTTCAGCTTGCAGTGTAATTCAGAAGAGTTAAGACCAGAAGTACTGGAATCATACTTCCTTTCAGAATTGAGTCCCTAAGTCCTGAGTTGGTGGCAGCTGCATCTGCTGTGGCAGATTCTCTCCCTTTTGACAAGCAAATAACCAAGTCAGAGCTGTTGAGGCAGCTCCAGCAGCATGAGGAAGAGTCAAGGGCACAGAGAGATGCAGAGAGAACTAAAATTAGTTTCAGTAACGTAATATCAGATATGAATGTTGCCAGATCTGCTACAGCTAGAGTTTGTTCAAGACCAGAGCATCAGATTCAGTTTGACAAGGGCTATGACAATTATCCTGGCCAGGAGAAGACTGCTGATCTTACAAAAAG-3'(SEQ ID NO. 1);
[0045] The sequence of the fusion gene LINC00630-AL035494 near the fusion site is as follows: 5'-CTTGAACATCGAGATGAAAATATACTGTCTACGTTGTTCAACACAATAGCTAATGGCAACTGTGGCAGTTGAACACCCGAAACGTGATGAATGTGACTGAGGAACTGAACTTTTAGTTTCATTGTGACATGATGAATGAATTTATTGAGCCCCAGGAAGAAGGAAAATTAAAGAAGAGCAAAGAATAATAGCTGGACAGAAGATGGGGGTCATTGAACCTATATCCTAGTTGCCAGACCAGTAAACTGACCATGGGACCTGGGGGAGGCAGCAGATGACCGAAAACCTGGAGTGATGTGGCTGAATACCGCATGATCTGAAGACTGCACTGGTGGCTGCGATTGATATTGGAAAAGCAGTTTCCCATTGAGTCTCAAATGAAGAGAGTGCAGATGAAGAGGAGAAGACTCTGTATTGAACCAAGGTGCTCTACACAGTAGCCCCTACTAAGCTCCCAGCAGATGCCAGCATCAGTCATCCATCTCTTCATGTGGATGTCTG-3'(SEQ ID NO. 2);
[0046] The principles of primer design mainly include: the length of the primer is 17-25 bp; the percentage of GC content of each primer is between 40% and 60%; the annealing temperature of the primer approaches 60°C, and the difference between the annealing temperatures of the upstream and downstream primers is within 5°C; and the internal or between-primer complementary of 3 or more than 3 bases is avoided. Two pairs of available primers are designed, and the specific sequences are as follows:
[0047] PSPC1-MRPS31P2-upstream primer 1: 5'-CAGAATTGAGTCCCTAAGTCCTGA-3'(SEQ ID NO. 3);
[0048] PSPC1-MRPS31P2-downstream primer 1: 5'-CTGCCTCAACAGCTCTGACT-3'(SEQ ID NO. 4);
[0049] PSPC1-MRPS31P2-upstream primer 2: 5'-TCAGAATTGAGTCCCTAAGTCCTG-3'(SEQ ID NO. 5);
[0050] PSPC1-MRPS31P2-Upper primer 1: 5'-TGCCTCAACAGCTCTGACTT-3' (SEQ ID NO. 5);
[0051] LINC00630-AL035494-Upper primer 1: 5'-AGCAGATGACCGAAAACCTG-3' (SEQ ID NO. 7);
[0052] LINC00630-AL035494-Upper primer 2: 5'-GCAGATGACCGAAAACCTGG-3' (SEQ ID NO. 9);
[0053] LINC00630-AL035494-Upper primer 2: 5'-GCAGATGACCGAAAACCTGG-3' (SEQ ID NO. 9);
[0054] LINC00630-AL035494-Upper primer 2: 5'-GCAGATGACCGAAAACCTGG-3' (SEQ ID NO. 9);
[0055] This example uses PSPC1-MRPS31P2-Upper primer 1, PSPC1-MRPS31P2- Lower primer 1, LINC00630-AL035494-Upper primer 1 and LINC00630-AL035494- Lower primer 1 for testing.
[0056] 3) Extraction of placental tissue RNA and quantitative detection of target genes:
[0057] RNA was extracted from the placental samples obtained in step 1) using TRIzol Reagent (Invitrogen, #15596018) reagent and Direct-zol RNA Miniprep Kits (Zymo, #R2052), and reverse transcription was performed using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vayzme, #R333-01) kit. The cDNA obtained by reverse transcription was diluted 2-fold and used for subsequent quantitative detection;
[0058] The expression levels of fusion gene PSPC1-MRPS31P2 and LINC00630-AL035494 in placental tissue samples were quantitatively detected by qPCR using Taq Pro Universal SYBR qPCR Master Mix (Vayzme, #Q712-02) kit with diluted cDNA as template, and the results are shown in FIG. 1A and FIG. 1B.
[0059] As can be seen from FIG. 1A and FIG. 1B, compared with the control group, the expression levels of PSPC1-MRPS31P2 and LINC00630-AL035494 in the placental samples of preeclampsia were significantly up-regulated.
[0060] The sequence information of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 is shown in Table 1.
[0061] Table 1 Sequence information of fusion gene PSPC1-MRPS31P2 and LINC00630-AL035494
[0062] Example 2 Application of fusion gene PSPC1-MRPS31P2 as a biomarker in the preparation of a product for detecting preeclampsia
[0063] This example provides specific detection primers for fusion gene PSPC1-MRPS31P2, and 22 peripheral blood samples from pregnant women are used, of which 12 are from LOP type preeclampsia patients, and 10 are healthy controls similar in age and gestational age to the above-mentioned patients. The blood sample collection time is between 30-34 weeks of gestation, and the feasibility of fusion gene PSPC1-MRPS31P2 as a biomarker for preeclampsia is verified, and the specific verification process is as follows:
[0064] 1) Sample collection:
[0065] Peripheral blood (6 mL) was collected from the vein using a blood collection tube containing an anticoagulant (ethylenediaminetetraacetic acid (EDTA)), and centrifuged at low temperature (4°C) and medium speed (1600 rpm) for 15 min using a centrifuge. Then the upper liquid was aspirated and transferred to a new centrifuge tube, and then centrifuged at low temperature (4°C) and high speed (16000 rpm) for 15 min using a centrifuge, and then the upper liquid (i.e. plasma) was aspirated and transferred to a new centrifuge tube or cryogenic tube. The plasma can be used immediately for subsequent experiments, or can be stored in an ultra-low temperature (-80°C) refrigerator until use.
[0066] 2) Specific primer design:
[0067] This example uses the PSPC1-MRPS31P2-upstream primer 1 and the PSPC1-MRPS31P2-downstream primer 1 provided in Example 1 to test.
[0068] 3) Extraction of plasma cfRNA and quantitative detection of target genes:
[0069] The cfRNA was extracted from the plasma sample obtained in step 1) using the Quick-cfDNA / cfRNA Serum & Plasma Kit (Zymo, #R1072) extraction kit, and specific reverse transcription and cDNA amplification of the cfRNA were performed using the Single Cell Sequence Specific Amplification Kit (Vayzme, #P621-01) kit. The amplified cDNA was diluted 25-fold and used for subsequent quantitative detection.
[0070] The diluted cDNA was used as a template, and the Taq Pro Universal SYBR qPCR Master Mix (Vayzme, #Q712-02) kit was used to quantitatively detect the expression level of the fusion gene PSPC1-MRPS31P2 in the plasma sample by qPCR. The results are shown in Figure 2A. Further, ROC curve analysis was performed based on the qPCR quantitative data, and the results are shown in Figure 3.
[0071] As shown in Figure 2A, compared with the control group, the expression level of the fusion gene PSPC1-MRPS31P2 in the plasma cfRNA of the disease group (PE group) was significantly up-regulated, and the difference was statistically significant.
[0072] As shown in Figure 3, the AUC is 0.79, indicating that the fusion gene PSPC1-MRPS31P2 can effectively distinguish preeclampsia patients and can be used as a specific biomarker for plasma diagnosis of preeclampsia.
[0073] Example 3 Application of fusion gene LINC00630-AL035494 as a biomarker in the preparation of a product for detecting preeclampsia
[0074] This example provides specific detection primers for the fusion gene LINC00630-AL035494, and uses 22 peripheral blood samples from pregnant women (the same as in Example 2) to verify the feasibility of the fusion gene LINC00630-AL035494 as a biomarker for preeclampsia. The specific verification process is as follows:
[0075] 1) Sample collection: see step 1) of Example 2.
[0076] 2) Specific primer design:
[0077] This example uses the LINC00630-AL035494-upstream primer 1 and LINC00630-AL035494-downstream primer 1 provided in Example 1 for testing.
[0078] 3) Extraction of cfRNA and quantitative detection of target genes:
[0079] The specific steps are described in step 3) of Example 2, and the results are shown in Figure 2B. Further ROC curve analysis was performed based on the qPCR quantitative data, and the results are shown in Figure 3.
[0080] As shown in Figure 2B, compared with the control group, the expression level of fusion gene LINC00630-AL035494 in the plasma cfRNA of the disease group (PE group) was significantly up-regulated, and the difference was statistically significant.
[0081] As shown in Figure 3, the AUC is 0.82, indicating that the fusion gene LINC00630-AL035494 can effectively distinguish preeclampsia patients and can be used as a specific biomarker for plasma diagnosis of preeclampsia.
[0082] Example 4 Application of combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 as biomarkers in the preparation of products for detecting preeclampsia
[0083] In this example, the combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 is used as a biomarker for preeclampsia, and the feasibility of using the combination of fusion gene PSPC1-MRPS31P2 and fusion gene LINC00630-AL035494 as a biomarker for preeclampsia is verified using clinical plasma samples. The specific test verification process is described in Example 2 and Example 3, and the results are shown in Figures 2A, 2B, and 3. In this example, the expression levels of the two fusion genes are detected separately, and the maximum value of each fusion gene in the control group is used as the cutoff value, i.e. there is no false positive, and the specificity is 100%. If the expression level of any one of the two fusion genes in the preeclampsia sample is higher than the cutoff value, it is determined to be positive, and the detection sensitivity reaches 75% (i.e. 9 positive samples of preeclampsia are detected), indicating that the combination analysis of the two fusion genes can effectively identify preeclampsia patients, and can be used as a specific biomarker combination for plasma diagnosis of preeclampsia.
[0084] The test flowchart for verifying Examples 2-4 of the present application is shown in Figure 4.
[0085] It should be noted that in addition to the RT-qPCR used in the embodiments of the present application, other quantitative methods can also be used for the biomarkers provided by the present application, including high-throughput sequencing technology (such as RNA-seq), digital PCR (digital PCR, dPCR) and the like.
[0086] The embodiments of the present application are described in detail above in combination with the drawings, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.
Claims
1. A biomarker of pre-eclampsia, characterized in that, The preeclampsia biomarker comprises at least one of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494.
2. The preeclampsia biomarker of claim 1, wherein, The sequence information of the fusion gene PSPC1-MRPS31P2 and the fusion gene LINC00630-AL035494 is as follows:
3. A nucleic acid molecule, characterized in that, The nucleic acid molecule comprises specific primers for detecting the preeclampsia biomarker as described in claim 1 or 2.
4. The nucleic acid molecule of claim 3, wherein, The nucleic acid molecule comprises specific primers for detecting the fusion gene PSPC1-MRPS31P2; Preferably, the specific primers for detecting the fusion gene PSPC1-MRPS31P2 comprise: a primer pair as shown in SEQ ID NO. 3 and SEQ ID NO. 4; or, a primer pair as shown in SEQ ID NO. 5 and SEQ ID NO.
6.
5. The nucleic acid molecule of claim 3, wherein, The nucleic acid molecule comprises specific primers for detecting the fusion gene LINC00630-AL035494; Preferably, the specific primers for detecting the fusion gene LINC00630-AL035494 comprise: a primer pair as shown in SEQ ID NO. 7 and SEQ ID NO. 8; or, a primer pair as shown in SEQ ID NO. 9 and SEQ ID NO.
10.
6. A kit characterized in that, The kit comprises the nucleic acid molecule as described in any one of claims 3-5.
7. The kit of claim 6, wherein The kit further comprises a nucleic acid extraction reagent, a primer set for a reference gene, and a PCR reaction reagent.
8. The kit of claim 7, wherein The PCR reaction reagent comprises a DNA polymerase, dNTPs, and a fluorescent dye.
9. The kit of claim 6, wherein The kit is applicable to sample types including blood samples and placental tissue samples; Preferably, the blood sample comprises a serum sample and / or a plasma sample.
10. Use of the preeclampsia biomarker as described in claim 1 or 2 in (1)-(3): (1) preparing a product for detecting preeclampsia; (2) preparing a product for evaluating a preeclampsia prognosis analysis; (3) screening a drug for treating and / or preventing preeclampsia.