Bacteria test method, primer set, reagent set, and bacteria / fungus test method

A primer set and reagent set for PCR amplification of bacterial 23S rRNA with fluorescent probes address the challenges of comprehensive bacterial and fungal detection in rapid microbiological testing, enhancing sensitivity and coverage for pharmaceuticals with short shelf lives.

WO2026071123A1PCT designated stage Publication Date: 2026-04-02FUJIFILM WAKO PURE CHEMICAL CORP
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/034264
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-30
Filing Date
2025-09-26
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing nucleic acid amplification tests (NATs) targeting bacterial rRNA face challenges in comprehensiveness and detection sensitivity, particularly for rapid microbiological testing of pharmaceuticals with short shelf lives, as they need to detect various bacteria types and low bacterial counts within a short timeframe.

Method used

A method using a primer set and reagent set for PCR amplification of conserved sequences in bacterial 23S rRNA, combined with fluorescent dye-labeled probes, to enhance detection sensitivity and coverage, allowing simultaneous testing for bacteria and fungi.

Benefits of technology

The method provides excellent bacterial coverage and detection sensitivity, suitable for rapid microbiological testing of pharmaceuticals with short shelf lives, ensuring accurate and comprehensive bacterial and fungal detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

A bacteria test method according to the invention tests for the presence or absence of bacteria in a sample, and includes amplifying a conserved sequence in bacterial 23S rRNA by PCR using a primer set consisting of a primer (1) and a primer (2). Primer (1): A primer having a sequence of SEQ ID NO: 2, and / or a primer having a sequence in which one to three bases have been modified in the sequence of SEQ ID NO: 2. Primer (2): At least one selected from the group consisting of primers having a sequence of SEQ ID NO: 3, primers having the sequence of SEQ ID NO: 3 in which one to three bases have been modified, primers having a sequence of SEQ ID NO: 36, primers having the sequence of SEQ ID NO: 36 in which one to three bases have been modified, primers having a sequence of SEQ ID NO: 39, primers having the sequence of SEQ ID NO: 39 in which one to three bases have been modified, primers having a sequence of SEQ ID NO: 41, and primers having the sequence of SEQ ID NO: 41 in which one to three bases have been modified.
Need to check novelty before this filing date? Find Prior Art

Description

Bacteriological testing methods, primer sets, reagent sets, and bacterial / fungal testing methods

[0001] This disclosure relates to bacterial testing methods, primer sets, reagent sets, and bacterial / fungal testing methods.

[0002] Cell and gene therapies generally need to be administered to patients within 48 to 96 hours of manufacture. This means that cell and gene therapies have a shelf life of only 48 to 96 hours after manufacture. Microbiological testing by culture (for example, a 14-day culture test to determine the presence of bacteria and fungi) is not applicable to pharmaceuticals with such short shelf lives. There is a need for rapid microbiological testing that is applicable to pharmaceuticals with short shelf lives.

[0003] Nucleic acid amplification tests (NATs) are rapid tests that can detect nucleic acids quickly and are promising as rapid microbiological tests. Ribosomal RNA (rRNA) is a promising target for NAT microbiological testing. Because rRNA is the RNA (ribonucleic acid) that makes up ribosomes and exists in multiple copies within cells, it can be a highly sensitive target for NATs. In addition, rRNA sequences have been analyzed in a wide variety of organisms, and a comprehensive sequence database has been established. Therefore, rRNA sequences that are specific to microorganisms and common among microorganisms are promising targets for NAT microbiological testing.

[0004] For example, Patent Documents 1 to 3 disclose a method for microbial testing that includes a step of amplifying a target region selected from 5S rRNA, 16S rRNA, or 23S rRNA of a microorganism.

[0005] International Publication No. 2011 / 010740, International Publication No. 2007 / 094077, U.S. Patent Application Publication No. 2022 / 0298573, Specification

[0006] Applying NAT, which targets bacterial rRNA, to a test to determine the presence or absence of bacteria in a sample presents challenges in terms of comprehensiveness and detection sensitivity. Specifically, it is necessary to be able to comprehensively detect rRNA from bacteria present in the sample, regardless of the type of bacteria, and to be able to detect bacteria even when the number of bacteria in the sample is small.

[0007] This disclosure is made under the circumstances described above. The objective of this disclosure is to provide a bacterial testing method, a primer set, a reagent set, and a bacterial / fungal testing method that are excellent in comprehensive bacterial coverage and detection sensitivity.

[0008] The following embodiments are included as specific means for solving the aforementioned problems: <1> A method for testing for the presence or absence of bacteria in a sample, comprising amplifying a conserved sequence in bacterial 23S rRNA by PCR using a primer set consisting of the following primers (1) and (2); Primer (1): A primer having the sequence of Sequence ID No. 2, and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 2; Primer (2): At least one selected from the group consisting of a primer having the sequence of Sequence ID No. 3, a primer having the sequence of Sequence ID No. 3, a primer having the sequence of Sequence ID No. 36, a primer having the sequence of Sequence ID No. 36, a primer having the sequence of Sequence ID No. 39, a primer having the sequence of Sequence ID No. 39, a primer having the sequence of Sequence ID No. 41, and a primer having the sequence of Sequence ID No. 41. <2> The bacterial testing method according to <1>, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (3) below; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47, and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 47. <3> The bacterial testing method according to <1> or <2>, wherein the consensus sequence of the conserved sequence in the bacterial 23S rRNA is SEQ ID NO: 1 or has 90% or more sequence identity with SEQ ID NO: 1.<4> A primer set comprising the following primers (1) and primer (2) for amplifying a conserved sequence in bacterial 23S rRNA: Primer (1): A primer having the sequence of Sequence ID No. 2, and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 2; Primer (2): At least one selected from the group consisting of a primer having the sequence of Sequence ID No. 3, a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 3, a primer having the sequence of Sequence ID No. 36, a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 36, a primer having the sequence of Sequence ID No. 39, a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 39, a primer having the sequence of Sequence ID No. 41, and a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 41. <5> The primer set according to <4>, wherein primer (1) comprises two or three types of primers with different base sequences, and primer (2) comprises at least one type of primer. <6> The primer set according to <4>, wherein the primer (1) comprises two or three primers with different base sequences, and the primer (2) comprises two primers with different base sequences. <7> A reagent set comprising the primer set according to any one of <4> to <6>, and a fluorescent dye-labeled probe having a fluorescent dye bound to the following probe (3) for detecting a conserved sequence in bacterial 23S rRNA; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45, a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47, and a probe having a sequence in which one base is modified in the sequence of SEQ ID NO: 47.<8> The reagent set according to <7>, wherein the primer (1) comprises at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 2, a primer having the sequence of SEQ ID NO: 5, a primer having the sequence of SEQ ID NO: 6, a primer having the sequence of SEQ ID NO: 7, and a primer having the sequence of SEQ ID NO: 8; the primer (2) comprises at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 9, a primer having the sequence of SEQ ID NO: 10, a primer having the sequence of SEQ ID NO: 34, a primer having the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37, a primer having the sequence of SEQ ID NO: 38, a primer having the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 40, a primer having the sequence of SEQ ID NO: 41, and a primer having the sequence of SEQ ID NO: 42; and the probe (3) comprises at least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 11, a probe having the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 44, a probe having the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 46, and a probe having the sequence of SEQ ID NO: 47. <9> The reagent set according to <8>, wherein the primer (1) comprises two or three types of primers with different base sequences, and the primer (2) comprises at least one type of primer. <10> The reagent set according to <8>, wherein the primer (1) comprises two or three types of primers with different base sequences, and the primer (2) comprises two types of primers with different base sequences. <11> The reagent set according to any one of <7> to <10>, further comprising a primer set for amplifying a conserved sequence in fungal 25S / 28S rRNA, and a fluorescent dye-labeled probe for detecting a conserved sequence in fungal 25S / 28S rRNA.<12> A method for simultaneously testing for the presence or absence of bacteria and fungi in a sample, comprising amplifying the conserved sequence in bacterial 23S rRNA and the conserved sequence in fungal 25S / 28S rRNA by PCR using a primer set described in any one of <4> to <6> and a primer set for amplifying the conserved sequence in fungal 25S / 28S rRNA. <13> The bacterial and fungal testing method according to <12>, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound, and a fluorescent dye-labeled probe for detecting a conserved sequence in fungal 25S / 28S rRNA; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45, a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47, and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 47.

[0009] This disclosure provides a bacterial testing method, a primer set, a reagent set, and a bacterial / fungal testing method that offer excellent bacterial coverage and detection sensitivity.

[0010] Experiment 2: Correlation between template copy number and Ct value. Experiment 3: Amplification curve of RT-qPCR. This is a graph of the Ct value shown in Table 9. This is a graph of the Ct value shown in Table 11. Example 1: Amplification curve of RT-qPCR: B. subtilis, C. sporogenes, P. aeruginosa Example 1: Amplification curve of RT-qPCR: S. aureus, C. acnes, E. coli Example 1: Amplification curve of RT-qPCR: M. luteus, K. rhizophila, S. epidermidis Example 1: Amplification curve of RT-qPCR: S. pneumoniae, S. pyogenes, A. baumannii Example 1: Amplification curve of RT-qPCR: A. calcoaceticus, B. diminuta, M. extorquens Example 1: Amplification curve of RT-qPCR: P. protegens, A. hydrophila, L. pneumophila Example 1: Amplification curve of RT-qPCR: L. monocytogenes, S. enterica_Abony, S. enterica_Typhimurium Example 1: Amplification curve of RT-qPCR: A. brasiliensis, C. albicans, P. citrinum

[0011] The embodiments of this disclosure are described below. These descriptions and embodiments are illustrative and do not limit the scope of the embodiments.

[0012] In this disclosure, numerical ranges indicated using "~" represent a range that includes the numbers before and after "~" as the minimum and maximum values, respectively. In numerical ranges described in stages within this disclosure, the upper or lower limit of one numerical range may be replaced with the upper or lower limit of another numerical range described in stages. Furthermore, in numerical ranges described within this disclosure, the upper or lower limit of that numerical range may be replaced with the values ​​shown in the examples.

[0013] In this disclosure, "A and / or B" is synonymous with "at least one of A and B." In other words, "A and / or B" may be A alone, B alone, or a combination of A and B.

[0014] In this disclosure, the term "process" includes not only independent processes but also processes that cannot be clearly distinguished from other processes, provided that their objectives are achieved.

[0015] When referring to the amount of each component in a composition in this disclosure, if there are multiple types of substances corresponding to each component in the composition, unless otherwise specified, it refers to the total amount of those multiple types of substances present in the composition.

[0016] Regarding substance concentration, "M" represents molar concentration, where 1M = 1 mol / L. Unless otherwise specified, "%" in relation to substance concentration refers to a mass basis.

[0017] The full spelling of abbreviations used in this disclosure is as follows: PCR: Polymerase Chain Reaction qPCR: Quantitative Polymerase Chain Reaction RT-PCR: Reverse Transcription-Polymerase Chain Reaction RT-qPCR: Reverse Transcription-Quantitative Polymerase Chain Reaction

[0018] qPCR is also called rtPCR (real-time Polymerase Chain Reaction). To avoid confusion between rt (real-time) and RT (Reverse Transcription), this disclosure will refer to it as qPCR, not rtPCR.

[0019] The degree of sequence identity (%) is calculated using the CLUSTAL W Multiple Sequence Alignment Program (ClustalW2.1).

[0020] <Experiment> The bacterial testing method described herein was created based on the results of experiments conducted by the inventors. The inventors' base sequence analysis of bacterial 23S rRNA, PCR experiments, and their results are described below.

[0021] [Sequencing Analysis of Bacterial 23S rRNA] Bacterial ribosomes contain 23S rRNA (23S ribosomal RNA) in their large subunits. The gene encoding 23S rRNA on the bacterial genomic DNA is called 23S rDNA (23S ribosomal DNA).

[0022] Twenty-two types of bacteria (shown in Table 1) were selected for analysis of their 23S rDNA base sequences. These 22 types of bacteria consist of the 21 types listed in ISO 24190:2023 "Biotechnology - Analytical methods - Risk-based approach for method selection and validation for rapid microbial detection in bioprocesses," plus Bacteroides fragilis, for a total of 22 types.

[0023]

[0024] The nucleotide sequences of 23S rDNA from 22 bacterial species were obtained from the National Center for Biotechnology Information (NCBI) database. The accession numbers of the 23S rDNA for each bacterium are shown in Table 2.

[0025]

[0026] Sequence analysis revealed two highly conserved regions in 22 bacterial species. These regions are referred to as the P1 region and the P2 region.

[0027] In the consensus sequence (total base count 3305 bp) obtained by aligning the 23S rDNA of 22 bacterial species, the P1 region is the region from 2284 bp to 2343 bp, and the P2 region is the region from 2800 bp to 2999 bp.

[0028] As a result of sequence analysis, the nucleotide sequence of the P1 region has a sequence identity of 92% to 100% in the comparison of two types within 22 types of bacteria shown in Table 1.

[0029] As a result of sequence analysis, the nucleotide sequence of the P2 region has a sequence identity of 87% to 100% in the comparison of two types within 22 types of bacteria shown in Table 1.

[0030] [Experiment 1: Screening of primer-probe sets with high detection sensitivity] Primer-probe set No. 1 for amplifying and detecting the P1 region and primer-probe sets No. 2 to 4 for amplifying and detecting the P2 region were prepared. The reverse primer also serves as a reverse transcription primer. The probe is a fluorescent dye-labeled probe with a fluorescent dye FAM bound to the 5'-end and a quencher BHQ1 bound to the 3'-end. The nucleotide sequences of the primers and the probe are shown in Table 3.

[0031] In primer-probe set No. 2, the forward primer consists of 4 types of degenerate primers, the reverse primer consists of 3 types of degenerate primers, and the probe consists of 2 types of degenerate probes. In primer-probe set No. 3, the forward primer consists of 4 types of degenerate primers, and the probe consists of 2 types of degenerate probes. In primer-probe set No. 4, the forward primer consists of 3 types of degenerate primers, and the reverse primer consists of 2 types of degenerate primers. In the second to fourth forward primers, reverse primers, and probes, the bases different from the first forward primer, reverse primer, and probe are underlined.

[0032]

[0033] The RT-qPCR reaction solution shown in Table 4 was prepared. "Hot Start TTx DNA Polymerase" (Toyobo Co., Ltd.) is a DNA polymerase derived from Thermus thermophilus HB8 strain and is a DNA polymerase having reverse transcription activity. Hot Start TTx DNA Polymerase is a DNA polymerase used for so-called "hot start PCR" that is inactivated by a neutralizing antibody. The template is the total RNA of B. subtilis.

[0034]

[0035] The final concentrations of the primers and probe in the RT-qPCR reaction solution are 0.25 μM for the forward primer, 0.25 μM for the reverse primer, and 0.05 μM for the probe.

[0036] RT-qPCR was performed using the RT-qPCR reaction solution shown in Table 4 in the following cycle. Among the following cycles, <1> is a heat treatment to inactivate the neutralizing antibody and restore the activity of Hot Start TTx DNA Polymerase, <2> is an incubation for reverse transcription, <3> is a heat treatment to denature cDNA into single strands, and <4> - <5> are two-step PCR (denaturation / annealing and extension).

[0037] <1> 90°C / 30 seconds <2> 60°C / 5 minutes <3> 95°C / 1 minute <4> 95°C / 10 seconds <5> 60°C / 25 seconds... fluorescence detection <4> - <5> are repeated 45 times

[0038] The Ct value (Threshold Cycle) of RT-qPCR is shown in Table 5. RT-qPCR was performed by diluting the template concentration in six steps. NTC (No Template Control) is a negative control without a template.

[0039]

[0040] From the results shown in Table 5, it was determined that Primer / Probe Set No. 4 has the highest detection sensitivity.

[0041] [Experiment 2: Comparison of detection sensitivity for P1 and P2 regions] Using primer-probe set No. 1, which targets the P1 region, and primer-probe set No. 4, which targets the P2 region, the detection sensitivity for the P1 and P2 regions was compared.

[0042] Using total RNA or genomic DNA of B. subtilis as a template, RT-qPCR or qPCR was performed in the following cycle.

[0043] - RNA template - <1> 90°C / 30 seconds <2> 60°C / 5 minutes <3> 95°C / 1 minute <4> 95°C / 10 seconds <5> 60°C / 25 seconds...fluorescence detection Repeat <4>-<5> 45 times

[0044] -The template is DNA- <3> 95°C / 2 min <4> 95°C / 10 sec <5> 60°C / 25 sec...Fluorescence detection Repeat <4>-<5> 45 times

[0045] Figure 1 shows the correlation between template copy number and Ct value. As is clear from the upper graph in Figure 1, when the template was DNA, there was no difference between the Ct values ​​of the P1 region and the P2 region, and the P1 and P2 regions had equivalent detection sensitivity. On the other hand, as is clear from the lower graph in Figure 1, when the template was RNA, the Ct value of the P2 region was lower than that of the P1 region, and the P2 region had higher detection sensitivity than the P1 region. This difference in detection sensitivity could not be predicted from the base sequence. It was inferred that this difference in detection sensitivity was due to the secondary structure of rRNA. That is, rRNA forms a secondary structure by intramolecular hydrogen bonds between bases, and it was inferred that the P2 region is a region located in a place where reverse transcription proceeds relatively easily (for example, outside the secondary structure).

[0046] The results of Experiment 2 showed that the P2 region is more suitable than the P1 region for detecting the presence or absence of bacteria in a sample by RT-qPCR targeting conserved sequences within bacterial 23S rRNA.

[0047] [Experiment 3: Confirmation of the detection power of primer-probe set No. 4] Primer-probe set No. 4 consists of three types of degenerate forward primers and two types of degenerate reverse primers. The degeneracy was reversed, and the detection power of a primer set with one type of forward primer and one type of reverse primer was confirmed.

[0048] The RT-qPCR reaction solutions shown in Table 4 were prepared. Using the total RNA of B. subtilis as a template, RT-qPCR was performed with a template copy number of 10,000 copies using the same cycle as in Experiment 1. The amplification curve of the RT-qPCR is shown in Figure 2.

[0049] All six combinations of forward and reverse primers were confirmed to have the ability to detect the target region.

[0050] [Experiment 4: Examination of the acceptable range of sequence identity for primer-probe set No. 4] The forward primer, reverse primer, or probe of primer-probe set No. 4 were subjected to 1 to 3 base substitutions, and their functionality was checked. The base sequences of each primer-probe set are shown in Table 6. The substituted bases are underlined.

[0051]

[0052] The RT-qPCR reaction solutions shown in Table 4 were prepared. Using the total RNA of B. subtilis as a template, RT-qPCR was performed with a template copy number of 10,000 copies using the same cycle as in Experiment 1. The Ct values ​​of the RT-qPCR are shown in Table 7.

[0053]

[0054] The results shown in Table 7 indicate that the primer-probe sets shown in Table 6 are nearly equivalent to each other.

[0055] [Experiment 5: Examination of the acceptable range of reverse primers] New primer-probe sets, such as Primer-Probe Set No. 5, were created by changing the reverse primer of Primer-Probe Set No. 4, and their functionality was checked. The base sequences of each primer-probe set are shown in Table 8. All of these primer-probe sets are for amplifying and detecting the P2 region or a part of the P2 region. The reverse primer also serves as the reverse transcription primer.

[0056]

[0057] In Table 8, the underlined bases represent bases that have been modified from the reverse primers Rv1, Rv3, Rv4, or Rv5.

[0058] The RT-qPCR reaction solutions shown in Table 4 were prepared. Synthetic RNA consisting of the nucleotide sequence of Sequence ID No. 1 was used as a template, with a template copy number of 1 × 10⁻¹⁶. 7 , 1 x 10 6 , 1 x 10 5 , 1 x 10 4 , 1 x 10 3 or 1 x 10 2 Then, RT-qPCR was performed using the same cycle as in Experiment 1. The Ct values ​​from RT-qPCR are shown in Table 9 and Figure 3.

[0059]

[0060] The results shown in Table 9 demonstrate that the primer-probe sets shown in Table 8 have the ability to detect the target region, and that these primer-probe sets are nearly equivalent to each other.

[0061] [Experiment 6: Examination of the acceptable range of sequence identity for primer-probe set No. 5] New primer-probe sets, such as Primer-Probe Set No. 5-Probe3, were created by changing the probes in Primer-Probe Set No. 5, and their functionality was confirmed. The base sequences of each primer-probe set are shown in Table 10. All of these primer-probe sets are for amplifying and detecting the P2 region. The reverse primer also serves as the reverse transcription primer.

[0062]

[0063] In Table 10, the underlined bases mean the bases changed from Probe 3 or Probe 4.

[0064] An RT-qPCR reaction solution shown in Table 4 was prepared. Using synthetic RNA consisting of the nucleotide sequence of SEQ ID NO: 1 as a template, with the template copy number of 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 or 1×10 2 , RT-qPCR was performed with the same cycles as in Experiment 1. The Ct values of RT-qPCR are shown in Table 11 and FIG. 4.

[0065]

[0066] From the results shown in Table 11, it was shown that the primer-probe sets shown in Table 10 have the detection ability for the target region, and these primer-probe sets are substantially equivalent to each other.

[0067] Based on the above experimental results, the present disclosure provides a new bacterial detection method. The bacterial detection method, primer set, probe and reagent set of the present disclosure will be described below.

[0068] <Bacterial Detection Method> The bacterial detection method of the present disclosure is a method for detecting the presence or absence of bacteria in a sample by PCR targeting a conserved sequence in bacterial 23S rRNA.

[0069] The bacterial detection method of the present disclosure includes both a form in which reverse transcription of nucleic acid is performed prior to PCR and a form in which reverse transcription of nucleic acid is not performed. In the former form, the reverse transcription product of 23S rRNA and 23S rDNA can be amplified by PCR. In the latter form, 23S rDNA can be amplified by PCR.

[0070] The bacterial detection method of the present disclosure includes PCR using a primer set consisting of the following primer (1) and primer (2).

[0071] Primer (1): A primer having the sequence of Sequence ID No. 2 (CATCGCTCAACGGGATAAAAAG), and / or a primer having a sequence in which 1 to 3 bases have been modified in the sequence of Sequence ID No. 2.

[0072] Primer (2): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3 (ATAGGGACCGAACTGTTCTCAC), a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 36 (GGACCGAACTGTTCTCACGAACGTCT), a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 39 (GATAGGGGACCGAACTGTTCTCACGAACG), a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 41 (ACGTTCCTGAACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified in the sequence of SEQ ID NO: 41.

[0073] The primer set consisting of primer (1) and primer (2) is a primer set that amplifies the P2 region as described above. The consensus sequences obtained by aligning the nucleotide sequences of the P2 regions of 22 bacterial species shown in Table 1 are shown below.

[0074] Sequence number 1: CATCGCTCAAACGGATAAAAGGTACNCCCGGGGATAACAGGCTGATCTCGCCCAAGAGTTCATATCGACGGCGGGGTTTGGCACCTCGATGTCGGCTC ATCGCATCCTGGGGCTGAAGTNGGTCCCAAGGGTTNGGCTGTTCGCCNATTAAAGCGGTACGCGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCCTAT

[0075] Sequence ID 1 corresponds to the region from 2800 bp to 2999 bp in the consensus sequence (total base count 3305 bp) obtained by aligning the 23S rDNA of 22 bacterial species. The underlined parts in Sequence ID 1 correspond to the sequence of Sequence ID 2, Sequence ID 4, and the complementary sequence of Sequence ID 3, respectively.

[0076] The consensus sequence may not be identical to Sequence ID No. 1, depending on the alignment algorithm, the database from which the bacterial 23S rDNA base sequences are obtained, and the number of bacterial species from which base sequences are obtained. Preferably, the consensus sequence has 90% or more sequence identity with Sequence ID No. 1, and more preferably, 95% or more sequence identity with Sequence ID No. 1.

[0077] The P2 region is a highly conserved sequence in bacteria. Furthermore, the P2 region is presumed to be located in a region of the rRNA secondary structure where reverse transcription proceeds relatively easily (for example, outside the secondary structure). Additionally, SEQ ID NO: 2 and SEQ ID NO: 3 are the nucleotide sequences of primer Fw1 and primer Rv1, which constitute the aforementioned primer-probe set No. 4, and primer-probe set No. 4 has been confirmed to have high detection sensitivity for bacterial 23S rRNA. Furthermore, detection power has also been confirmed for primer-probe set No. 5 and others (sets listed in Tables 8 and 10), which were constructed based on primer-probe set No. 4. Therefore, PCR using a primer set consisting of primer (1) and primer (2) can comprehensively and sensitively determine the presence or absence of bacteria. Accordingly, the bacterial testing method disclosed herein is excellent in both comprehensive bacterial coverage and detection sensitivity.

[0078] The bacterial testing method of this disclosure quantifies PCR amplification products, for example, by electrophoresis or fluorescence measurement. Preferably, the bacterial testing method of this disclosure includes real-time quantification of PCR amplification products by a fluorescence monitoring method. The fluorescence monitoring method may be either an intercalator method using a double-stranded DNA-binding fluorescent dye or a probe method using a fluorescent dye-labeled probe.

[0079] From the viewpoint of superior comprehensive bacterial coverage and detection sensitivity, the bacterial testing method of this disclosure is preferably quantified using a fluorescent dye-labeled probe to which a fluorescent dye is bound, and more preferably performed in real time by a probe method using the fluorescent dye-labeled probe.

[0080] Probe (3): At least one selected from the group consisting of a probe having the sequence of Sequence ID No. 4 (TTTGGCACCTCGATTCGGC), a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 4, a probe having the sequence of Sequence ID No. 43 (TTTGGCACCTCGATTCGGCTC), a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 43, a probe having the sequence of Sequence ID No. 45 (TGGCACCTCGATTCGGG), a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 45, a probe having the sequence of Sequence ID No. 47 (CACCTCGATTCGGC), and a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 47.

[0081] Sequence IDs 4, 43, 45, and 47 are located within Sequence ID 1. In other words, probe (3) is a probe that binds to the amplification product of a primer set consisting of primer (1) and primer (2). Sequence ID 4 is the base sequence of the probe that constitutes primer-probe set No. 4, and primer-probe set No. 4 has been confirmed to have high sensitivity for detecting bacterial 23S rRNA. Therefore, the bacterial testing method of this disclosure is superior in bacterial coverage and detection sensitivity by using a fluorescent dye-labeled probe, to which a fluorescent dye is bound to probe (3), for real-time quantification.

[0082] An example of an embodiment of the bacterial testing method of this disclosure is realized by performing the following steps (1) and (2).

[0083] Step (1): Preparation of qPCR reaction solution or RT-qPCR reaction solution. Step (2): PCR and real-time quantification, or reverse transcription, PCR and real-time quantification.

[0084] The bacterial testing method described herein includes both a form in which nucleic acid reverse transcription is performed prior to PCR and a form in which nucleic acid reverse transcription is not performed. In the former form, it is preferable to prepare a qPCR reaction solution and perform PCR and real-time quantification. In the latter form, it is preferable to prepare an RT-qPCR reaction solution and perform reverse transcription, PCR and real-time quantification.

[0085] Reverse transcription and PCR are achieved by temperature cycling that activates the enzyme. Reverse transcription of nucleic acids is achieved by maintaining the RT-qPCR reaction mixture at a temperature at which the reverse transcriptase functions for a certain period of time. PCR may be a three-step PCR (denaturation / annealing / extension) or a two-step PCR (denaturation / annealing and extension). The appropriate step is performed depending on the enzyme contained in the reaction mixture.

[0086] Real-time quantification is preferably performed using a fluorescence monitoring method. PCR is repeated while monitoring the fluorescence intensity. When the fluorescence intensity reaches the threshold, it is determined to be positive (i.e., bacteria are present in the sample). When the fluorescence intensity does not reach the threshold, it is determined to be negative (i.e., no bacteria are present in the sample). The PCR threshold and the number of cycles are predetermined by preliminary experiments.

[0087] The qPCR reaction solution contains all the components necessary for the qPCR reaction. The RT-qPCR reaction solution contains all the components necessary for the RT-qPCR reaction. These components include nucleic acid samples prepared from the sample, primer sets, double-stranded DNA-binding fluorescent dyes or fluorescent dye-labeled probes, enzymes, and dNTPs.

[0088] [Samples and Nucleic Acid Samples] Samples are derived from the subject of bacterial testing. Examples of such subjects include pharmaceuticals, quasi-drugs, cosmetics, active pharmaceutical ingredients, reagents, food, food ingredients, health foods, supplements, animal feed, drinking water, tap water, medical gases, medical components, medical devices, sanitary materials, biological samples, blood, and cultured cells. Examples of pharmaceuticals include small molecule drugs, medium molecule drugs (e.g., peptide drugs, nucleic acid drugs), biopharmaceuticals (e.g., antibody drugs), cell preparations, and gene preparations.

[0089] A typical example of a sample is a pharmaceutical product. The bacterial testing method of this disclosure is suitable for the purpose of bacterial testing of pharmaceutical products with a short shelf life after manufacture (e.g., cell preparations, gene preparations).

[0090] The method for preparing nucleic acid samples from a sample is not limited, and any known nucleic acid extraction and purification methods are applicable. If the sample is a liquid or suspension, a portion of the liquid or suspension is taken and nucleic acid is extracted. If the sample is a powder, for example, the powder is dissolved or suspended in sterile water and nucleic acid is extracted. If the sample is a solid, for example, the solid surface is washed with sterile water and nucleic acid is extracted from this washing solution. If the sample is a gas, for example, the gas is passed through a sterile filter, the filter is washed with sterile water, and nucleic acid is extracted from this washing solution.

[0091] When preparing nucleic acid samples from a sample, hydrolysis of the DNA contained in the nucleic acid sample may or may not be performed. DNA hydrolysis can be achieved by adding deoxyribonuclease (DNase) to the nucleic acid sample and incubating it.

[0092] When DNA in a nucleic acid sample is hydrolyzed, the 23S rDNA on the genomic DNA is not amplified by PCR. In this case, reverse transcription of the nucleic acid is necessary prior to PCR. In this configuration, the amplified product, which is reverse transcribed from 23S rRNA, is quantified in real time.

[0093] If the DNA in the nucleic acid sample is not hydrolyzed, reverse transcription of the nucleic acid may or may not be performed prior to PCR. In the former case, the amplification products of 23S rRNA and 23S rDNA are quantified in real time. In the latter case, the amplification product of 23S rDNA is quantified in real time.

[0094] When preparing nucleic acid samples from a sample, the sample may be treated with a cell-impermeable or cytodegradable nucleic acid crosslinking agent prior to lysis. Cell-impermeable nucleic acid crosslinking agents irreversibly crosslink nucleic acids (e.g., double-stranded DNA, double-stranded RNA, single-stranded DNAs, single-stranded RNAs) of dead bacteria (i.e., cells with damaged cell membranes). Cytodegradable nucleic acid crosslinking agents are indegradable by dead bacteria and therefore irreversibly crosslink nucleic acids (e.g., double-stranded DNA, double-stranded RNA, single-stranded DNAs, single-stranded RNAs) of dead bacteria. Both types of nucleic acid crosslinking agents inhibit the amplification of nucleic acids from dead bacteria. Therefore, treating the sample with a cell-impermeable or cytodegradable nucleic acid crosslinking agent before lysis can suppress false positives due to nucleic acids from dead bacteria in the bacterial testing method of this disclosure. Examples of cell-impermeable or cell-degradable nucleic acid crosslinking agents include ethidium monoazide, propidium monoazide, and nucleic acid modification compounds disclosed in International Publication No. 2022 / 051405.

[0095] [Primer Set] A primer set consists of primer (1) and primer (2). Primer (1) acts as the forward primer, and primer (2) acts as the reverse primer. Primer (2) also serves as the reverse transfer primer.

[0096] Primer (1) is a primer having the sequence of Sequence ID No. 2, and / or a primer having a sequence in which 1 to 3 bases are modified in the sequence of Sequence ID No. 2.

[0097] Primer (2) is at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3, a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 36, a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 39, a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 41, and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 41.

[0098] From the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, one of the following groups (a), (b), (c), or (d) may be selected and used as the primer (2). • Group (a): A primer having the sequence of SEQ ID NO: 3, and / or a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 3. • Group (b): A primer having the sequence of SEQ ID NO: 36, and / or a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36. • Group (c): A primer having the sequence of SEQ ID NO: 39, and / or a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 39. • Group (d): A primer having the sequence of SEQ ID NO: 41, and / or a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 41.

[0099] Modifications to the bases in the sequences of SEQ ID NO: 2, 3, 36, 39, and 41 mean at least one selected from the group consisting of base substitutions, deletions, additions, and insertions. A single base modification is a base substitution, deletion, addition, or insertion. A two- or three-base modification is any combination of base substitutions, deletions, additions, and insertions totaling two or three bases. Examples of two- or three-base modifications include two- or three-base substitutions; one-base deletion and one-base addition; and three-base insertions.

[0100] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 2 is preferably 18 to 23 bases, more preferably 19 to 22 bases, and even more preferably 20 to 21 bases.

[0101] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 3 is preferably 18 to 24 bases, more preferably 19 to 23 bases, and even more preferably 20 to 23 bases.

[0102] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 36 is preferably 20 to 30 bases, more preferably 21 to 29 bases, and even more preferably 22 to 27 bases.

[0103] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 39 is preferably 20 to 30 bases, more preferably 22 to 28 bases, and even more preferably 23 to 26 bases.

[0104] A primer having a sequence in which one to three bases have been modified in the sequence of Sequence ID No. 41 is preferably 18 to 23 bases, more preferably 19 to 23 bases, and even more preferably 20 to 22 bases.

[0105] Primer (1) may be of the same type, or two or more types with different base sequences may be used in combination. Primer (2) may be of the same type, or two or more types with different base sequences may be used in combination.

[0106] In this disclosure, a mixture of primers with similar but not identical base sequences is referred to as "degenerate primers." The use of degenerate primers is preferable from the viewpoint of comprehensive bacterial coverage.

[0107] When primer (1) is a degenerate primer, from the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, primer (1) is preferably a mixture of two to four types of primers, and more preferably a mixture of two or three types of primers. When primer (2) is a degenerate primer, from the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, primer (2) is preferably a mixture of two or three types of primers, and more preferably a mixture of two types of primers.

[0108] Primer (1) and / or primer (2) may have modifying groups introduced to adjust the strength of hydrogen bonds between complementary strands for the purpose of controlling the Tm value (the temperature at which 50% of the double-stranded DNA dissociates into single-stranded DNA). Examples of modifying groups introduced to primers to control the Tm value include the introduction of an amino group at the 2 position of adenine and the introduction of a methyl group at the 5 position of cytosine. In this disclosure, the introduction of modifying groups to primers to control the Tm value is not included in base substitution and base modification.

[0109] [Double-stranded DNA-binding fluorescent dye or fluorescent dye-labeled probe] Real-time quantification of PCR amplification products is preferably performed by a fluorescence monitoring method. The fluorescence monitoring method may be an intercalator method using a double-stranded DNA-binding fluorescent dye, or a probe method using a fluorescent dye-labeled probe.

[0110] An example of a double-stranded DNA-binding fluorescent dye is SYBR Green.

[0111] Examples of fluorescent dye-labeled probes include hydrolysis probes that emit fluorescence when hydrolyzed by a DNA extension reaction initiated by a primer; probes that emit fluorescence when their hairpin structure opens upon binding to a complementary strand; and probe sets in which two probes emit fluorescence when they bind to a complementary strand. These fluorescent dye-labeled probes are sequence-specific probes and are designed based on the base sequence of the nucleic acid to be quantified.

[0112] As a fluorescent dye-labeled probe, a fluorescent dye-labeled probe in which a fluorescent dye is bound to the probe (3) is preferred from the viewpoint of excellent comprehensive bacterial coverage and detection sensitivity.

[0113] The probe (3) is at least one selected from the group consisting of a probe having the sequence of sequence number 4, a probe having a sequence in which one base is modified from the sequence of sequence number 4, a probe having the sequence of sequence number 43, a probe having a sequence in which one base is modified from the sequence of sequence number 43, a probe having the sequence of sequence number 45, a probe having a sequence in which one base is modified from the sequence of sequence number 45, a probe having the sequence of sequence number 47, and a probe having a sequence in which one base is modified from the sequence of sequence number 47.

[0114] From the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, probe (3) may be selected from one of the following groups: (e), (f), (g), or (h). • Group (e): A probe having the sequence of Sequence ID No. 4, and / or a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 4. • Group (f): A probe having the sequence of Sequence ID No. 43, and / or a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 43. • Group (g): A probe having the sequence of Sequence ID No. 45, and / or a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 45. • Group (h): A probe having the sequence of Sequence ID No. 47, and / or a probe having a sequence in which one base is modified in the sequence of Sequence ID No. 47.

[0115] Modification of bases in the sequence of Sequence ID No. 4, Sequence ID No. 43, Sequence ID No. 45, and Sequence ID No. 47 means at least one selected from the group consisting of base substitution, deletion, addition, and insertion. A sequence in which one base has been modified in the sequence of Sequence ID No. 4, Sequence ID No. 43, Sequence ID No. 45, or Sequence ID No. 47 is a sequence in which one base has been substituted, deleted, added, or inserted.

[0116] The probe (3) may be of the same type, or two or more probes with different base sequences may be used in combination.

[0117] In this disclosure, a mixture of probes with similar but not identical base sequences is referred to as a "degenerate probe." The use of a degenerate probe is preferable from the viewpoint of comprehensive bacterial coverage. When probe (3) is a degenerate probe, from the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, probe (3) is preferably a mixture of two to four types of probes, more preferably a mixture of two or three types of probes, and even more preferably a mixture of two types of probes.

[0118] The probe (3) may have a modifying group introduced to adjust the strength of the hydrogen bond between complementary chains for the purpose of controlling the Tm value. Examples of introducing a modifying group to the probe to control the Tm value include introducing an amino group to the 2-position of adenine and introducing a methyl group to the 5-position of cytosine. In this disclosure, the introduction of a modifying group to the probe to control the Tm value is not included in base substitution and base modification.

[0119] The following are examples of preferred combinations of primer (1), primer (2), and probe (3) used in the bacterial testing method of this disclosure.

[0120] Primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 2, a primer having the sequence of SEQ ID NO: 5 (CGTCGCCTCAACGGGATAAAAAG), a primer having the sequence of SEQ ID NO: 6 (CGTCACTCAACGGGATAAAAAG), a primer having the sequence of SEQ ID NO: 7 (CATGGCTCAACGGGATAAAAAG), and a primer having the sequence of SEQ ID NO: 8 (GTTCGCCTCAACGGGATAAAAAG). Primer (2) includes a primer having the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 9 (ATAGAGACCGAACTGTTCTCAC), a primer having the sequence of SEQ ID NO: 10 (TATGGGACCGAACTGTTCTCAC), a primer having the sequence of SEQ ID NO: 34 (ATAGGGACCGAACTGTTCTCACGA), a primer having the sequence of SEQ ID NO: 35 (ATAGGGACCAAACTGTTCTCACGA), a primer having the sequence of SEQ ID NO: 36, and SEQ ID NO: 37 (AGG It includes at least one selected from the group consisting of a primer having the sequence GACCGAACTGTCTCAACGAACGTCT, a primer having the sequence SEQ ID NO: 38 (CCGAACTGTCTCAACGAACGTCT), a primer having the sequence SEQ ID NO: 39, a primer having the sequence SEQ ID NO: 40 (GATAGGGAACCGAACTGTTCTCCACG), a primer having the sequence SEQ ID NO: 41, and a primer having the sequence SEQ ID NO: 42 (ACGTTCTAAAAACCCAGCTCGCGT), A form in which the probe (3) includes at least one selected from the group consisting of a probe having the sequence of sequence number 4, a probe having the sequence of sequence number 11 (TTTGGGACCTCGATGTCGGC), a probe having the sequence of sequence number 43, a probe having the sequence of sequence number 44 (GTTTGGGCACCTCGATGTCGGCTC), a probe having the sequence of sequence number 45, a probe having the sequence of sequence number 46 (TGGCACCTCGATGTCGGC), and a probe having the sequence of sequence number 47.

[0121] From the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, the above configuration is preferable in which primer (1) includes two or three types of primers with different base sequences, primer (2) includes at least one type of primer, and probe (3) includes one type of probe or two types of probes with different base sequences. From the above viewpoint, a more preferable configuration is in which primer (1) includes two or three types of primers with different base sequences, primer (2) includes two types of primers with different base sequences, and probe (3) includes one type of probe or two types of probes with different base sequences.

[0122] [Enzymes] The qPCR reaction solution contains DNA polymerase. The RT-qPCR reaction solution contains reverse transcriptase and DNA polymerase. Reverse transcriptase and DNA polymerase may be separate enzymes, or an enzyme may possess both reverse transcriptase activity and DNA polymerase activity in a single enzyme. Examples of the latter include the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus, and DNA polymerases modified from said DNA polymerase.

[0123] One example of an enzyme embodiment is a hot-start PCR enzyme that has been inactivated by a neutralizing antibody.

[0124] [dNTPs] dNTPs (deoxynucleoside triphosphates) are a mixture of dATP (deoxyadenosine triphosphate), dCTP (deoxycytidine triphosphate), dGTP (deoxyguanosine triphosphate), and dTTP (deoxythymidine triphosphate). Generally, dNTPs are an equimolar mixture of dATP, dCTP, dGTP, and dTTP.

[0125] The concentrations of nucleic acid sample, primer set, double-stranded DNA-binding fluorescent dye, fluorescently labeled probe, enzyme, and dNTPs contained in the qPCR reaction solution or RT-qPCR reaction solution may be the same as those of a typical qPCR reaction solution or RT-qPCR reaction solution.

[0126] [Other components] The solvent and dispersion medium for the qPCR reaction solution and RT-qPCR reaction solution are water. The qPCR reaction solution and RT-qPCR reaction solution contain stabilizers for each component, divalent cations (e.g., Mg 2+ Mn 2+ ), may contain pH adjusters, pH buffers, etc. The pH of the qPCR reaction solution and the RT-qPCR reaction solution is preferably in the range of 8.0 to 8.2.

[0127] The type of pH buffer contained in the qPCR reaction solution and the RT-qPCR reaction solution is not limited. Examples of pH buffers include Good's buffers. Preferred Good's buffers have an optimal pH range in the alkaline range, and examples include Tricinene, Bicinene, TAPS, TAPSO, EPPS, HEPPSO, and POPSO. pH adjustment is preferably performed with sodium hydroxide or potassium hydroxide.

[0128] This disclosure further provides a reagent set suitable for bacterial testing ("bacterial testing reagent set") and a reagent set suitable for bacterial and fungal testing ("bacterial and fungal testing reagent set"). The bacterial testing reagent set, the bacterial and fungal testing method, and the bacterial and fungal testing reagent set will be described in order below.

[0129] <Bacterial Testing Reagent Set> The bacterial testing reagent set of this disclosure is a reagent set for preparing a qPCR reaction solution or an RT-qPCR reaction solution to be used in the bacterial testing method of this disclosure.

[0130] The bacterial testing reagent set described herein includes at least a primer set and a fluorescently labeled probe. The primer set and the fluorescently labeled probe are housed in separate containers. A set of reagents housed in these separate containers constitutes a reagent set.

[0131] [Primer Set] The form of the primer set is as described above in the description of the bacterial testing method of this disclosure, and the preferred form is also as described above.

[0132] The primers (1) and (2) that make up the primer set may be housed in separate containers, or they may be housed together in a single container. The primers may be housed in a container in a form dissolved or dispersed in a buffer solution, for example.

[0133] [Fluorescent dye-labeled probe] The form of the fluorescent dye-labeled probe is as described above in the description of the bacterial testing method of this disclosure, and the preferred form is also as described above.

[0134] Fluorescent dye-labeled probes are, for example, contained in light-shielding containers in a form dissolved or dispersed in a buffer solution.

[0135] [Other Reagents] The bacterial testing reagent set of this disclosure may further include enzymes. The enzymes are housed in a separate container from the primer set and the fluorescent dye-labeled probes.

[0136] The form of the enzyme is as previously described in the description of the bacterial testing method of this disclosure, and the preferred form is also as previously described. The enzyme is contained in a container, for example, dissolved or dispersed in 50% (v / v) glycerol / buffer solution.

[0137] The bacterial testing reagent set disclosed herein may include all the reagents necessary for bacterial testing. The bacterial testing reagent set disclosed herein may also include the instruments used for bacterial testing.

[0138] The bacterial testing reagent set of this disclosure is preferably distributed in a form that preserves the functionality of the primer and fluorescent dye-labeled probe, for example, in a light-shielded form.

[0139] <Bacterial and Fungal Testing Method> The bacterial and fungal testing method disclosed herein is a method for simultaneously testing for the presence or absence of bacteria and fungi in a sample by multiplex PCR targeting conserved sequences in bacterial 23S rRNA and conserved sequences in fungal 25S / 28S rRNA.

[0140] Fungal ribosomes contain either 25S rRNA (25S ribosomal RNA) or 28S rRNA (28S ribosomal RNA) in their large subunits. The gene encoding 25S / 28S rRNA on the fungal genomic DNA is called 25S / 28S rDNA (25S / 28S ribosomal DNA).

[0141] The conserved sequences within the fungal 25S / 28S rRNA may be known conserved sequences or newly discovered conserved sequences. For example, the base sequences of 25S / 28S rDNA from multiple types of fungi can be obtained from existing databases, sequence analysis can be performed, and newly discovered conserved sequences can be found. Examples of fungi to be analyzed include Aspergillus brasiliensis, Candida albicans, and Penicillium citrinum, which are listed in ISO 24190:2023 "Biotechnology — Analytical methods — Risk-based approaches for the selection and validation of methods for rapid microbial detection in bioprocesses".

[0142] The bacterial and fungal testing methods described herein include both forms in which nucleic acid reverse transcription is performed prior to PCR, and forms in which nucleic acid reverse transcription is not performed. In the former form, the rRNA reverse transcript and rDNA can be amplified by PCR. In the latter form, rDNA can be amplified by PCR.

[0143] The bacterial and fungal testing method described herein includes PCR using the first and second primer sets described below. This PCR is a so-called multiplex PCR because it uses multiple types of primer sets together.

[0144] First primer set: A primer set consisting of primer (1) and primer (2) for amplifying a conserved sequence in bacterial 23S rRNA. The morphologies of primer (1) and primer (2) are as described above in the description of the bacterial testing method of this disclosure, and the preferred morphologies are also as described above.

[0145] Second primer set: A primer set consisting of forward and reverse primers for amplifying conserved sequences in fungal 25S / 28S rRNA.

[0146] The bacterial and fungal testing method disclosed herein quantifies PCR amplification products, for example, by electrophoresis or fluorescence measurement. Preferably, the bacterial and fungal testing method disclosed herein includes real-time quantification of PCR amplification products by a fluorescence monitoring method. The fluorescence monitoring method may be either an intercalator method using a double-stranded DNA-binding fluorescent dye or a probe method using a fluorescent dye-labeled probe.

[0147] From the viewpoint of superior comprehensiveness and detection sensitivity of bacteria and fungi, the bacterial and fungal testing method disclosed herein preferably performs real-time quantification using a probe method with the first and second probes described below.

[0148] First probe: A fluorescently labeled probe, in which a fluorescent dye is conjugated to probe (3), for detecting conserved sequences within bacterial 23S rRNA. The morphology of probe (3) and the fluorescently labeled probe are as previously described in the description of the bacterial testing method of this disclosure, and the preferred morphology is also as previously described.

[0149] Second probe: A fluorescently labeled probe for detecting conserved sequences within fungal 25S / 28S rRNA. The second probe is a sequence-specific probe that binds to the amplified DNA of the second primer set.

[0150] The second primer set and second probe may be commercially available products, or they may be newly designed and manufactured primer sets and probes.

[0151] Preferably, the fluorescent dyes of the first probe and the second probe have the same principle of controlling fluorescence emission. The fluorescent dyes of the first probe and the second probe may be the same or different. If the fluorescent dyes of the first probe and the second probe are different, bacteria and fungi can be detected separately.

[0152] An example of an embodiment of the bacterial and fungal testing method of this disclosure is realized by performing the following steps (11) and (12).

[0153] Step (11): Preparation of qPCR reaction solution or RT-qPCR reaction solution. Step (12): PCR and real-time quantification, or reverse transcription, PCR and real-time quantification.

[0154] The bacterial and fungal testing methods disclosed herein include both forms in which nucleic acid reverse transcription is performed prior to PCR, and forms in which nucleic acid reverse transcription is not performed. In the former form, a qPCR reaction solution is prepared, and PCR and real-time quantification are performed. In the latter form, an RT-qPCR reaction solution is prepared, and reverse transcription, PCR, and real-time quantification are performed.

[0155] The forms of processes (11) and (12) are the same as those of processes (1) and (2) described above.

[0156] The qPCR reaction solution contains all the components necessary for the qPCR reaction. The RT-qPCR reaction solution contains all the components necessary for the RT-qPCR reaction. These components include a nucleic acid sample prepared from the sample, a primer set (first primer set and second primer set), a double-stranded DNA-binding fluorescent dye or a fluorescent dye-labeled probe (first probe and second probe), an enzyme, and dNTPs. The form of each of the above components is as described above in the description of the bacterial testing method of this disclosure, and the preferred form is also as described above.

[0157] <Reagent Set for Bacterial and Fungal Testing> The reagent set for bacterial and fungal testing disclosed herein is a reagent set for preparing a qPCR reaction solution or an RT-qPCR reaction solution to be used in the bacterial and fungal testing method disclosed herein. The reagent set for bacterial and fungal testing disclosed herein is a reagent set for simultaneously testing for the presence or absence of bacteria and fungi in a sample.

[0158] The bacterial and fungal test reagent set disclosed herein comprises at least a first primer set, a first fluorescent dye-labeled probe, a second primer set, and a second fluorescent dye-labeled probe. The above four components are housed in separate containers. A set of reagents housed in each of these containers constitutes a reagent set.

[0159] The bacterial and fungal test reagent set disclosed herein may further contain enzymes. The enzymes are housed in a separate container from the four reagents described above.

[0160] The bacterial and fungal testing reagent set disclosed herein may include all the reagents necessary for bacterial and fungal testing. The bacterial and fungal testing reagent set disclosed herein may also include the instruments used for bacterial and fungal testing.

[0161] The forms of each of the reagents described above are as previously stated in the description of the bacterial testing reagent set of this disclosure, and the preferred forms are also as previously stated.

[0162] The following are examples of preferred combinations of primer (1), primer (2), and probe (3) that constitute the bacterial testing reagent set, bacterial and fungal testing reagent set, and bacterial and fungal testing method of this disclosure.

[0163] A configuration in which primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 2, a primer having the sequence of SEQ ID NO: 5, a primer having the sequence of SEQ ID NO: 6, a primer having the sequence of SEQ ID NO: 7, and a primer having the sequence of SEQ ID NO: 8; primer (2) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 9, a primer having the sequence of SEQ ID NO: 10, a primer having the sequence of SEQ ID NO: 34, a primer having the sequence of SEQ ID NO: 35, a primer having the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 37, a primer having the sequence of SEQ ID NO: 38, a primer having the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 40, a primer having the sequence of SEQ ID NO: 41, and a primer having the sequence of SEQ ID NO: 42; and probe (3) includes at least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 11, a probe having the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 44, a probe having the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 46, and a probe having the sequence of SEQ ID NO: 47.

[0164] From the viewpoint of balancing comprehensive bacterial coverage and detection sensitivity, the above configuration is preferable in which primer (1) includes two or three types of primers with different base sequences, primer (2) includes at least one type of primer, and probe (3) includes one type of probe or two types of probes with different base sequences. From the above viewpoint, a more preferable configuration is in which primer (1) includes two or three types of primers with different base sequences, primer (2) includes two types of primers with different base sequences, and probe (3) includes one type of probe or two types of probes with different base sequences.

[0165] The bacterial testing methods and bacterial / fungal testing methods of this disclosure will be explained below with reference to examples. The materials, amounts used, concentrations, processing procedures, etc., shown in the following examples can be modified as appropriate, as long as they do not deviate from the spirit of this disclosure. Therefore, the scope of the bacterial testing methods and bacterial / fungal testing methods of this disclosure should not be interpreted restrictively by the specific examples shown below.

[0166] <Example 1> Twenty-one types of bacteria and three types of fungi shown in Table 12 were cultured. These bacteria and fungi are listed in ISO 24190:2023 "Biotechnology — Analytical methods — Risk-based approaches for the selection and validation of methods for rapid microbial detection in bioprocesses".

[0167]

[0168] The culture medium of each bacterium was ultracentrifuged to concentrate the bacteria. The bacteria were suspended in a buffer solution, and cell wall-degrading enzymes and proteolytic enzymes were added. Next, nucleic acid extraction was performed using the Boom method, during which DNA was hydrolyzed with DNase I. The extracted RNA was washed and concentrated to obtain RNA samples.

[0169] The RT-qPCR reaction solutions shown in Table 13 were prepared. The bacterial primer-probe set is Primer-Probe Set No. 4, as described in Tables 3 and 6. The fungal primer-probe set is for amplifying and detecting conserved sequences within fungal 25S / 28S rRNA. The base sequences of the primers and probes are shown in Table 14. The reverse primer also serves as the reverse transcription primer. The probe is a fluorescently labeled probe with the fluorescent dye Cy5 bound to its 5' end and the quencher BHQ3 bound to its 3' end. The templates were RNA samples extracted from 21 types of bacteria and 3 types of fungi.

[0170]

[0171]

[0172] The following is an example of a consensus sequence of a conserved sequence within fungal 25S / 28S rRNA.

[0173] SEQ ID NO: 48: GGAAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGA AGTTTCCCTCAGGATAGCAGTAACGCGAANTCAGTTTTATGAGGTAAAGCGAATGATT AGAGGCCTTGGGGTTGAAACAAACCTTTAACCTATTCTCAAACTTTAAAATATGTAAGAAG

[0174] Sequence ID 48 corresponds to the region from 849 bp to 1072 bp in the consensus sequence (total base count 2986 bp) obtained by aligning the 25S / 28S rDNA of three fungal species shown in Table 12. The underlined portions of Sequence ID 48 are, in order, the sequence of Sequence ID 31, the sequence of Sequence ID 33, and the complementary sequence of Sequence ID 32.

[0175] The consensus sequences for the 25S / 28S rDNA of three fungal species may differ from Sequence ID No. 48 depending on the alignment algorithm, the database used to obtain the base sequences of the fungal 25S / 28S rDNA, and the number of fungal species whose base sequences are obtained. Examples of consensus sequences for the 25S / 28S rDNA of three fungal species include those with more than 90% sequence identity with Sequence ID No. 48, or those with more than 95% sequence identity with Sequence ID No. 48.

[0176] RT-qPCR was performed using the RT-qPCR reaction mixture shown in Table 13, following the cycle below: <1> 90°C / 30 sec <2> 60°C / 5 sec <3> 95°C / 1 sec <4> 95°C / 10 sec <5> 60°C / 25 sec...fluorescence detection Repeat <4>-<5> 45 times

[0177] The mold density can be set to 7 levels (5.0 x 10 6 Copy, 5.0 x 10 5 Copy, 5.0 x 10 4 Copy, 5.0 x 10 3 Copy, 5.0 x 10 2 Copy, 5.0 x 10 1 Copy, 5.0 x 10 0 The samples were diluted (to 50 copies) and RT-qPCR was performed. The amplification curves of the RT-qPCR for each bacterium are shown in Figures 5 to 12. As is clear from Figures 5 to 12, the bacterial primer-probe set and the fungal primer-probe set had detection power for 50 copies each of 21 bacterial species and 3 fungal species.

[0178] <Example 2: Bacterial testing (or bacterial / fungal testing) of cell preparations> [Preparation of nucleic acid samples] Cell preparations are autologous cell preparations for cancer treatment, manufactured, for example, by introducing specific genes into T cells collected from the blood of cancer patients.

[0179] A portion of the cell preparation is collected, and the cells are separated by centrifugation, or by filter filtration that allows bacteria and fungi to pass through. After separating the cells, ultracentrifugation may be performed to concentrate the bacteria and fungi. The recovered bacteria and fungi are suspended in a buffer solution to obtain a suspension.

[0180] A cell-impermeable or cytodegradable DNA crosslinking agent is added to the suspension to irreversibly crosslink the genomic DNA of the dead bacteria. The suspension is washed with buffer and resuspended in buffer.

[0181] Cell wall-degrading enzymes are added to the suspension to degrade the cell walls of bacteria and fungi. Next, proteolytic enzymes are added to the suspension to degrade the proteins contained in the suspension. Then, nucleic acid extraction is performed using the Boom method. DNA may be hydrolyzed with DNase I during this process. The extracted nucleic acids are washed and concentrated to obtain a nucleic acid sample.

[0182] [RT-qPCR (or Multiplex RT-qPCR)] A nucleic acid sample is mixed with a bacteria-specific primer set (i.e., a primer set consisting of primer (1) and primer (2)), a bacteria-specific fluorescent dye-labeled probe (i.e., a fluorescent dye-labeled probe to which a fluorescent dye is bound), dNTPs, reverse transcriptase, and DNA polymerase to prepare an RT-qPCR reaction mixture. This RT-qPCR reaction mixture is then used to perform RT-qPCR.

[0183] Multiplex RT-qPCR may also be performed by adding a fungus-specific primer set and a fungus-specific fluorescent dye-labeled probe for amplifying and detecting conserved sequences in fungal 25S / 28S rRNA to the above RT-qPCR reaction mixture. The fluorescent dyes of the bacterial-specific probe and the fungus-specific probe may be the same or different. If the fluorescent dyes of the bacterial-specific probe and the fungus-specific probe are different, bacteria and fungi can be detected separately.

[0184] Real-time quantification is performed using a fluorescence monitoring method. PCR is repeated a predetermined number of times while monitoring the fluorescence intensity. When the fluorescence intensity reaches the threshold, it is determined to be positive (i.e., the cell preparation is contaminated with bacteria and / or fungi). When the fluorescence intensity does not reach the threshold, it is determined to be negative (i.e., the cell preparation is not contaminated with bacteria and / or fungi). The PCR threshold and the number of cycles are predetermined by preliminary experiments.

[0185] By automating the preparation of nucleic acid samples and RT-qPCR (or multiplex RT-qPCR), it is possible to perform bacterial testing (or bacterial / fungal testing) of cell preparations in a sterile room without human intervention.

[0186] All documents, patent applications, and technical standards described herein are incorporated by reference to the same extent as if each individual document, patent application, and technical standard were specifically and individually noted to be incorporated by reference.

[0187] The disclosure of Japanese application number 2024-171185, filed on 30 September 2024, is incorporated herein by reference in its entirety.

Claims

1. A method for testing for the presence or absence of bacteria in a sample, comprising amplifying a conserved sequence in bacterial 23S rRNA by PCR using a primer set consisting of the following primers (1) and (2); Primer (1): A primer having the sequence of Sequence ID No. 2 (CATCGCTCAACGGGATAAAAAG), and / or a primer having a sequence in which 1 to 3 bases have been modified in the sequence of Sequence ID No.

2. Primer (2): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3 (ATAGGGACCGAACTGTTCTCAC), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 36 (GGACCGAACTGTTCTCACGAACGTCT), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 39 (GATAGGGGACCGAACTGTTCTCACGAACG), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 41 (ACGTTCTGAGACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO:

41.

2. The bacterial testing method according to claim 1, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound to the probe (3) described below; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4 (TTTGGCACACCTCGATGTCGGC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43 (TTTGGCACACCTCGATGTCGGCTC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45 (TGGCACACCTCGATGTCGGG), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47 (CACCTCGATGTCGGC), and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO:

47.

3. The bacterial testing method according to claim 1 or claim 2, wherein the consensus sequence of the conserved sequence in the bacterial 23S rRNA is Sequence ID No. 1 or has 90% or more sequence identity with Sequence ID No.

1.

4. A primer set consisting of the following primers (1) and (2) for amplifying conserved sequences in bacterial 23S rRNA; Primer (1): A primer having the sequence of Sequence ID No. 2 (CATCGCTCAACGGATAAAG), and / or a primer having a sequence in which 1 to 3 bases have been modified from the sequence of Sequence ID No.

2. Primer (2): At least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 3 (ATAGGGACCGAACTGTTCTCAC), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 3, a primer having the sequence of SEQ ID NO: 36 (GGACCGAACTGTTCTCACGAACGTCT), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 36, a primer having the sequence of SEQ ID NO: 39 (GATAGGGGACCGAACTGTTCTCACGAACG), a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO: 39, a primer having the sequence of SEQ ID NO: 41 (ACGTTCTGAGACCCAGCTCGCGT), and a primer having a sequence in which 1 to 3 bases are modified from the sequence of SEQ ID NO:

41.

5. The primer set according to claim 4, wherein the primer (1) comprises two or three primers with different base sequences, and the primer (2) comprises at least one primer.

6. The primer set according to claim 4, wherein the primer (1) comprises two or three primers with different base sequences, and the primer (2) comprises two primers with different base sequences.

7. A reagent set comprising a primer set according to any one of claims 4 to 6, and a fluorescent dye-labeled probe having a fluorescent dye bound to the following probe (3) for detecting a conserved sequence in bacterial 23S rRNA; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4 (TTTGGCACACCTCGATGTCGGC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43 (TTTGGCACACCTCGATGTCGGCTC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45 (TGGCACACCTCGATGTCGGG), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47 (CACCTCCGATGTCGGC), and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO:

47.

8. The primer (1) includes at least one selected from the group consisting of a primer having the sequence of SEQ ID NO: 2 (CATCGCTCAACGGGATAAAAAG), a primer having the sequence of SEQ ID NO: 5 (CGTCCGCTCAACGGGATAAAAAG), a primer having the sequence of SEQ ID NO: 6 (CGTCACTCAACGGGATAAAAAG), a primer having the sequence of SEQ ID NO: 7 (CATGGCTCAACGGGATAAAAAG), and a primer having the sequence of SEQ ID NO: 8 (GTTCCGCTCAACGGGATAAAAAG). The primer (2) is a primer having the sequence of SEQ ID NO: 3 (ATAGGGACCGAACTGTCTTCAC), a primer having the sequence of SEQ ID NO: 9 (ATAGAGACCGAACTGTCTTCAC), a primer having the sequence of SEQ ID NO: 10 (TATGGGACCGAACTGTCTTCAC), a primer having the sequence of SEQ ID NO: 34 (ATAGGGACCGAACTGTCTTCACGA), a primer having the sequence of SEQ ID NO: 35 (ATAGGGACCAAACTGTGTTCACGA), a primer having the sequence of SEQ ID NO: 36 (GGACCGAACTGTTCTCACGAACGTTTCT), and SEQ ID NO: 37 (AGG It includes at least one selected from the group consisting of a primer having the sequence GACCGAACTGTCTCAACGAACGTCT, a primer having the sequence SEQ ID NO: 38 (CCGAACTGTCTCAACGAACGTCT), a primer having the sequence SEQ ID NO: 39 (GATAGGGAACCGAACTGTCTCAACGACG), a primer having the sequence SEQ ID NO: 40 (GATAGGGAACCGAACTGTCTCACG), a primer having the sequence SEQ ID NO: 41 (ACGTTCCTGAACCCAGCTCGCGT), and a primer having the sequence SEQ ID NO: 42 (ACGTTCTAAAAACCCAGCTCGCGT),The reagent set according to claim 7, wherein the probe (3) includes at least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4 (TTTGGCACCTCGATGTCGGC), a probe having the sequence of SEQ ID NO: 11 (TTTGGGGCACCTCGATGTCGGC), a probe having the sequence of SEQ ID NO: 43 (TTTGGCACCTCGATGTCGGCTC), a probe having the sequence of SEQ ID NO: 44 (GTTTGGGCACCTCGATGTCGGCTC), a probe having the sequence of SEQ ID NO: 45 (TGGCACCTCGATGTCGGG), a probe having the sequence of SEQ ID NO: 46 (TGGCACCTCGATGTCGGC), and a probe having the sequence of SEQ ID NO: 47 (CACCTCGATGTCGGC).

9. The reagent set according to claim 8, wherein the primer (1) comprises two or three types of primers with different base sequences, and the primer (2) comprises at least one type of primer.

10. The reagent set according to claim 8, wherein the primer (1) comprises two or three types of primers with different base sequences, and the primer (2) comprises two types of primers with different base sequences.

11. The reagent set according to claim 7, further comprising: a primer set for amplifying conserved sequences in fungal 25S / 28S rRNA; and a fluorescent dye-labeled probe for detecting conserved sequences in fungal 25S / 28S rRNA.

12. A method for simultaneously testing for the presence or absence of bacteria and fungi in a sample, comprising amplifying a conserved sequence in bacterial 23S rRNA and a conserved sequence in fungal 25S / 28S rRNA by PCR using a primer set described in any one of claims 4 to 6 and a primer set for amplifying a conserved sequence in fungal 25S / 28S rRNA.

13. The bacterial and fungal testing method according to claim 12, further comprising quantifying the amplification product of the PCR using a fluorescent dye-labeled probe to which a fluorescent dye is bound, and a fluorescent dye-labeled probe for detecting a conserved sequence in fungal 25S / 28S rRNA; Probe (3): At least one selected from the group consisting of a probe having the sequence of SEQ ID NO: 4 (TTTGGCACACCTCGATTCGGC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 4, a probe having the sequence of SEQ ID NO: 43 (TTTGGCACACCTCGATTCGGCTC), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 43, a probe having the sequence of SEQ ID NO: 45 (TGGCACACCTCGATTCGGG), a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 45, a probe having the sequence of SEQ ID NO: 47 (CACCTCGATTCGGC), and a probe having a sequence in which one nucleotide is modified in the sequence of SEQ ID NO: 47.

Citation Information

Patent Citations

  • Primer and probe for detecting mycobacterium avium and method of detecting mycobacterium avium using the same

    JP2019068812A

  • Determination of an infection profile in an individual and uses thereof

    US20220298573A1

  • Method for detection of microorganism and kit for detection of microorganism

    WO2007094077A1

  • Method and kit for detecting microorganisms

    WO2011010740A1