Composition for promoting differentiation of muscle stem cells into myotubes, comprising ethanolamine and method for differentiating muscle stem cells using same

Ethanolamine alone in muscle stem cell culture media improves differentiation efficiency into myotubes, addressing the challenge of high-quality cultured meat production by increasing gene expression and differentiation rates.

WO2026071587A1PCT designated stage Publication Date: 2026-04-02HANWHA SOLUTIONS CORP
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/014268
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-30
Filing Date
2025-09-12
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing methods struggle to achieve high differentiation efficiency of muscle stem cells into myotubes, necessitating precise control of the cellular environment and specific factors, and ethanolamine's role as a lipid source complicates fat formation during differentiation.

Method used

Ethanolamine is used alone as a differentiation promoter in muscle stem cell culture media, excluding insulin and transferrin, to enhance the expression of MyoD, MyoG, and MyHC genes and Desmin protein, improving differentiation efficiency into myotubes.

Benefits of technology

Ethanolamine treatment increases the differentiation rate of muscle stem cells into myotubes by 3 to 25%, enhancing gene expression and promoting the formation of high-quality cultured meat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025014268_02042026_PF_FP_ABST
    Figure KR2025014268_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for promoting differentiation of muscle stem cells into myotubes, comprising a compound that promotes lipid metabolism or cell differentiation, for example, ethanolamine or a functional equivalent thereof, and to a method for differentiating muscle stem cells using same. More specifically, the present invention provides a composition for promoting differentiation of muscle stem cells into myotubes, comprising only ethanolamine, a composition for a muscle stem cell culture medium comprising same, a method for differentiating muscle stem cells into myotubes, using the composition for promoting differentiation or the composition for a culture medium, a myotube culture obtained by the differentiation method, and a cultured meat and food composition comprising same.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for promoting differentiation of muscle stem cells into myotubes containing ethanolamine and method for differentiating muscle stem cells using the same

[0001] This application claims priority based on Korean Patent Application No. 10-2024-0132589 filed on September 30, 2024, and all contents disclosed in the specification and drawings of said application are incorporated into this application.

[0002] The present invention relates to a composition for promoting differentiation of muscle stem cells into myotubes, comprising a compound that promotes lipid metabolism or cell differentiation, such as ethanolamine or a functional equivalent thereof, and a method for differentiating muscle stem cells using the same. More specifically, the invention provides a composition for promoting differentiation from muscle stem cells into myotube cells, comprising only ethanolamine; a composition for a muscle stem cell culture medium containing the same; a method for differentiating muscle stem cells into myotube cells using the differentiation-promoting composition or the culture medium composition; a myotube cell culture obtained by the differentiation method; cultured meat containing the same; and a food composition.

[0003] One of the most critical steps in cultured meat production is the efficient differentiation of muscle stem cells into muscle fiber cells, which directly affects the texture, taste, and nutritional profile of the final product.

[0004] Muscle stem cells possess the inherent ability to differentiate into mature muscle fiber cells, but achieving high differentiation efficiency in vitro is difficult and requires precise control of the cellular environment and specific factors that promote maturation into muscle cells.

[0005] Although various growth factors, cytokines, and extracellular matrix components have been studied to improve the differentiation efficiency into myofibrillar cells, the development of more effective differentiation promoters is still required.

[0006] Meanwhile, ethanolamine is primarily used as a supplementary component in culture media for muscle stem cell differentiation, along with insulin-transferrin-selenium (ITS), and insulin-transferrin-selenium-ethanolamine is also referred to as 'ITS-X'. According to Patent Document 1, ethanolamine is known as a lipid source or a lipid agent that contributes to lipid formation, so it is expected that using only ethanolamine alone, excluding ITS, will contribute to fat formation during the differentiation of muscle stem cells.

[0007] Against this background, the inventors completed the present invention by confirming that using ethanolamine alone without ITS promotes the efficiency of differentiation from muscle stem cells into muscle cells.

[0008] [Prior Art Literature]

[0009] [Patent Literature]

[0010] (Patent Document 1) International Patent Publication No. WO 2018 / 128779

[0011] Accordingly, the object of the present invention is to provide a novel use of ethanolamine as a muscle stem cell differentiation promoter and a method for differentiating muscle stem cells into myotubes using the same.

[0012] Another objective of the present invention is to provide a use for ethanolamine for the differentiation of muscle stem cells into myotube cells.

[0013] Another objective of the present invention is to provide a use of ethanolamine for the preparation of a culture medium for promoting differentiation from muscle stem cells into myotube cells.

[0014] Another objective of the present invention is to provide a myotube cell culture obtained by a method of differentiating muscle stem cells using ethanolamine.

[0015] Another objective of the present invention is to provide cultured meat obtained by culturing the aforementioned myotube cell culture and a food composition comprising the same.

[0016] Another objective of the present invention is to provide a method for producing cultured meat or food using the aforementioned myotube cell culture.

[0017] Another objective of the present invention is to provide a use for the aforementioned myotube cell culture for use in the production of cultured meat or food.

[0018] To solve the above-mentioned problem, the present invention provides a composition for promoting differentiation from muscle stem cells into myotube cells, comprising ethanolamine.

[0019] In the present invention, the ethanolamine may be one or more selected from the group consisting of monoethanolamine (MEA), diethanolamine (DEA), and triethanolamine (TE).

[0020] In the present invention, the composition may not include one or more selected from the group consisting of insulin, transferrin, and selenium.

[0021] In the present invention, the composition can increase the expression of one or more genes selected from the group consisting of MyoD, MyoG, and MyHC genes and the Desmin protein of muscle stem cells.

[0022] In addition, the present invention provides a culture medium composition for muscle stem cells comprising the aforementioned composition for promoting differentiation.

[0023] In the present invention, the culture medium composition may further include serum or serum replacements.

[0024] In the present invention, the serum may be one or more selected from the group consisting of fetal bovine serum (FBS), human platelet lysate (hPL), human serum (HS), platelet-rich plasma (PRP), platelet poor plasma (PPP), calf serum, horse serum, porcine serum, and sheep serum.

[0025] In the present invention, the culture medium composition may further include one or more selected from the group consisting of chicken embryo extract, albumin, growth factors, hormones, amino acids, and vitamins.

[0026] Additionally, the present invention provides a method for differentiating muscle stem cells into myotube cells, comprising treating muscle stem cells with the aforementioned differentiation-promoting composition or culturing muscle stem cells in the aforementioned muscle stem cell culture medium composition, and a myotube cell culture obtained thereby.

[0027] Furthermore, the present invention provides cultured meat obtained by culturing the aforementioned myotube cell culture and a food composition comprising the same.

[0028] The composition for promoting differentiation from muscle stem cells into myotubes according to the present invention comprises ethanolamine (MEA and / or DEA) as a differentiation promoter as a single active ingredient and can increase the enhancement of muscle-generating gene expression in muscle stem cells. Accordingly, by treating existing media for inducing differentiation into myotubes with ethanolamine (MEA and / or DEA) as a differentiation promoter alone or in combination with other selective agents, the differentiation efficiency into myotubes can be improved, making it possible to produce high-quality cultured meat at a high yield using this.

[0029] Figure 1 shows the differentiation-promoting effect of muscle stem cells according to treatment with ethanolamine at different concentrations (0.5, 1, 2, and 5 μg / ml) through Desmin staining.

[0030] Figure 2 shows the percentage (%) of Desmin-stained nuclei in the total nucleic acid of the image in Figure 1.

[0031] Figure 3 shows the changes in the expression levels of MyoD and MyoG, which are markers for maintaining muscle stem cell differentiation ability, and the myosin heavy chain (MyHC), a muscle differentiation marker, following ethanolamine treatment.

[0032] Figure 4 shows the relative expression levels of each gene (MyoD, MyoG, and MyHC) in the undifferentiated group, differentiated group, and ethanolamine-treated group of Figure 3, converted into percentages (%).

[0033] The present invention will be described in more detail below.

[0034] All technical terms used in this invention, unless otherwise defined, are used in the sense generally understood by those skilled in the art in the relevant field of this invention. Additionally, while preferred methods or samples are described herein, similar or equivalents are also included within the scope of this invention.

[0035] All numerical values ​​expressing the size, quantity, and physical properties of the feature parts used in this specification and claims should be understood as being modified by the term "approximately." Therefore, unless otherwise stated, numerical parameters disclosed in this specification and claims should be understood as approximations that may vary depending on the desired properties to be obtained by a person skilled in the art using the contents disclosed in this specification.

[0036] As described above, various growth factors, cytokines, and extracellular matrix components have been studied to improve the differentiation efficiency into myofibroblasts; however, the development of more effective differentiation promoters is still required. Accordingly, while searching for novel differentiation promoters capable of efficiently differentiating muscle stem cells into myotubes, the inventors sought a solution to the aforementioned problem by confirming that adding ethanolamine, known as a lipid source or lipid agent that contributes to lipid formation, to the culture medium improves the differentiation efficiency from muscle stem cells into myotubes.

[0037] Accordingly, the first aspect of the present invention relates to a composition for promoting differentiation from muscle stem cells into myotube cells, comprising ethanolamine.

[0038] In relation to the first aspect above, the present invention also provides a use of ethanolamine for use in the differentiation of muscle stem cells into myotube cells.

[0039] In addition, the present invention provides a use of ethanolamine for use in the preparation of a culture medium for promoting differentiation from muscle stem cells into myotube cells.

[0040] In the present invention, the ethanolamine may be one or more selected from the group consisting of monoethanolamine (MEA), diethanolamine (DEA), and triethanolamine (TE).

[0041] The above monoethanolamine is an organic compound (CAS No: 141-43-5) having the structure of Chemical Formula 1 below, and can be used for the purpose of promoting differentiation from muscle stem cells into myotube cells.

[0042] [Chemical Formula 1]

[0043]

[0044] In the present invention, the diethanolamine is an organic compound (CAS No: 111-42-2) having the structure of Chemical Formula 2 below, and can be used for the purpose of promoting differentiation from muscle stem cells into myotube cells.

[0045] [Chemical Formula 2]

[0046]

[0047] In the present invention, the triethanolamine is an organic compound having the structure of Chemical Formula 3 below (CAS No: 102-71-6) and can be used for the purpose of promoting differentiation from muscle stem cells into myotube cells.

[0048] [Chemical Formula 3]

[0049]

[0050] In the present invention, the monoethanolamine, diethanolamine, and triethanolamine may each be used alone or in combination.

[0051] In the present invention, the ethanolamine may also be used in the form of a salt. For example, monoethanolamine, diethanolamine, and triethanolamine may each be used in the form of a salt such as acetate, formate, chloride, phosphate, sulfate, oxalate, thiosulfate, or thiocyanate, but are not limited thereto.

[0052] In this specification, the term "muscle stem cell" refers to a cell having the characteristics of a muscle stem cell, including proliferation without transformation, indeterminate proliferation, self-renewal ability, and the ability to differentiate into muscle. Any cell exhibiting self-renewal ability, indeterminate proliferation ability, or muscle differentiation ability may be included without limitation. The self-renewal ability and muscle differentiation ability can be verified using markers. Furthermore, the muscle stem cell line may be a cell exhibiting expression of MyoD, MyHC, and Desmin along with self-renewal ability, for example. The type and origin of the muscle stem cell line are not limited as long as it possesses differentiation ability and self-renewal ability. The muscle stem cells may be derived from, for example, mammals, humans, monkeys, pigs, horses, cattle, chickens, ducks, sheep, dogs, cats, mice, or rabbits.

[0053] In the present invention, the muscle stem cells may include progenitor cells such as quiescent satellite cells in a growth arrest state and activated satellite cells called myoblasts.

[0054] In this specification, the term "differentiation" refers to the phenomenon in which the structure or function of cells becomes specialized during the growth of cell division and proliferation, that is, the change in form or function of biological cells, tissues, etc., to perform the tasks assigned to each. The degree of differentiation into a specific cell type may be measured or determined by methods well known in the art. Furthermore, said differentiation may be confirmed by examining cell morphology using an optical microscope or a confocal microscope while measuring cell surface markers (e.g., staining cells with tissue-specific or cell-marker-specific antibodies) and changes in cell morphology (e.g., nuclear-to-cytoplasmic ratio) using techniques such as flow cytometry or immunocytochemistry, or by measuring changes in gene expression using techniques well known in the art such as polymerase chain reaction (PCR) and gene-expression profiling.

[0055] In this specification, the term "myotube" refers to a contractile fibrous cell that serves as a unit constituting muscle, also known as a "myofiber." These myotubes form bundles to ultimately form muscle.

[0056] In the present invention, the differentiation-promoting composition may not include one or more selected from the group consisting of insulin, transferrin, and selenium.

[0057] The differentiation-promoting composition according to the present invention contains only ethanolamine as an active ingredient without insulin, transferrin, and selenium, and can promote differentiation from muscle stem cells into myotube cells when treated in a differentiation-inducing medium.

[0058] Genes associated with the differentiation of myoblasts into muscle fibers include, for example, MyoD, Myosin heavy chain (MyHC), and Myogenin (MyoG) genes. "MyoD" is a myogenic transcription factor whose expression increases during the early stages of differentiation. MyHC refers to a protein gene required for differentiation into muscle fibers. "Myogenin" is one of the major genes involved in myogenesis. The expression levels of the aforementioned genes increase along with the differentiation of myoblasts into muscle fibers.

[0059] Furthermore, "Desmin" is one of the earliest protein markers representing muscle tissue during embryonic development; it exists at low levels during the early stages of muscle cell development but increases as it approaches final differentiation. Therefore, the differentiation rate of muscle stem cells can be evaluated by confirming Desmin expression.

[0060] In a specific embodiment of the present invention, the differentiation pattern of muscle stem cells following ethanolamine treatment was evaluated. Referring to the results in Figure 1, in the undifferentiated control group, muscle stem cells maintained an undifferentiated state, but when a differentiation-inducing medium composition was added, it was confirmed that the differentiation efficiency into myotube cells increased as the concentration of ethanolamine increased.

[0061] In another specific embodiment of the present invention, to evaluate the effect of ethanolamine on the differentiation of muscle stem cells into myotubes, changes in the expression of Desmin protein according to treatment with ethanolamine at different concentrations were examined. Referring to the results in Figure 1, it was observed that the expression of Desmin, a muscle differentiation marker, increased as the concentration of ethanolamine in the differentiation induction medium increased. Furthermore, referring to the results in Table 1 of Figure 2, which quantifies the Desmin expression levels, the Desmin expression of muscle stem cells cultured in a differentiation induction medium containing ethanolamine increased by approximately 3 to 22% compared to the Desmin expression of muscle stem cells cultured in a differentiation induction medium not containing ethanolamine. This can be interpreted as an increase in the differentiation rate into myotubes by approximately 3 to 22% due to ethanolamine treatment.

[0062] The composition for promoting differentiation from muscle stem cells into myotube cells according to the present invention may contain ethanolamine in a concentration range of 0.5 to 10 μg / ml, preferably 1 to 8 μg / ml, more preferably 2 to 8 μg / ml.

[0063] When ethanolamine within the above concentration range is treated to muscle stem cells, the differentiation rate of the muscle stem cells can be improved by 3 to 25%, preferably 10 to 22%, compared to muscle stem cells whose differentiation was induced without ethanolamine treatment.

[0064] In another specific embodiment of the present invention, the expression levels of muscle differentiation-related genes in muscle stem cells were evaluated following ethanolamine treatment. Referring to the results in Figure 3, the expression levels of MyoD, MyoG, and MyHC genes in muscle stem cells of the differentiation induction experimental group containing ethanolamine were improved compared to muscle stem cells of the differentiation induction group not containing ethanolamine, and in particular, the expression levels of MyoD and MyHC genes were significantly improved. In addition, referring to the results in Figure 4 and Table 3, which show the relative expression levels of the three genes converted into percentages (%), the expression of MyoD, MyoG, and MyHC genes in muscle stem cells cultured in a differentiation induction medium containing ethanolamine increased by 24%, 2%, and 22%, respectively, compared to the gene expression of muscle stem cells cultured in a differentiation induction medium not containing ethanolamine.

[0065] Accordingly, the composition according to the present invention can increase the expression of one or more genes selected from the group consisting of MyoD, MyoG, and MyHC genes of muscle stem cells and the expression of Desmin protein.

[0066] A second aspect of the present invention relates to a culture medium composition for muscle stem cells comprising the aforementioned composition for promoting differentiation.

[0067] The above composition may be included and used in "medium," "culture medium," "medium for culture," "medium composition," "composition for culture," and "medium composition for culture."

[0068] In this specification, the terms “medium,” “culture medium,” “medium for culture,” “medium composition,” “composition for culture,” and “medium composition for culture” refer to a culture solution containing nutrients that enable the growth and survival of stem cells under in vitro culture conditions, and are not distinguished in this specification and may be used interchangeably. The basic medium that can be used in the present invention may be selected from DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F-12, α-MEM (α-modified Minimum Essential Media), GMEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), etc., but is not limited thereto.

[0069] Any medium used in the industry other than the above medium is sufficient, and the medium may additionally contain serum or a serum substitute.

[0070] In the present invention, the serum may be derived from animals, preferably from mammals such as pigs, horses, cattle, goats, sheep, and dogs. For example, the serum may be one or more selected from the group consisting of fetal bovine serum (FBS), human platelet lysate (hPL), human serum (HS), platelet-rich plasma (PRP), platelet poor plasma (PPP), calf serum, hourse serum, porcine serum, and sheep serum, but is not limited thereto.

[0071] In the present invention, the serum substitute may include heat-treated bovine serum albumin, bovine transferrin, bovine insulin, etc., which are manufactured to replace animal serum. Additionally, commercially available serum substitutes may be used. Examples of commercially available serum substitutes include Omni Serum (Advanced Biotechnologies Inc., Columbia, Md.) or Knockout TM There is Serum Replacement (Invitrogen).

[0072] In a specific embodiment of the present invention, horse serum was used as the serum.

[0073] In the present invention, the composition for the culture medium may further include one or more selected from the group consisting of chicken embryo extract, albumin, growth factors, hormones, amino acids, and vitamins.

[0074] In the present invention, the chicken embryo extract may be added for the purpose of maintaining the proliferative capacity of muscle stem cells, the albumin may be added for the purpose of supplying protein nutrients to the composition for the culture medium, the growth factor and hormone may be added for the purpose of promoting the growth and differentiation of muscle stem cells, the amino acid may be added for the purpose of promoting muscle protein synthesis and supporting cell growth and differentiation, and the vitamin may be added for the purpose of promoting cell growth and differentiation and reducing oxidative stress of cells.

[0075] In addition, the culture medium composition of the present invention may further include inorganic salts and other components. The inorganic salts include trace components (CuSO₄). 4· 5H2O, Fe(NO3) 3·9H2O, ZnSO4), phosphoenol pyruvate, sodium selenite, and sodium bicarbonate, and other components may include, but are not limited to, D-glucose, linoleic acid, lipoic acid, sodium pyruvate, hypoxanthine sodium, putrescine hydrochloride, and polyamine solution.

[0076] In addition to the above composition, it is desirable to use antibiotics, antifungal agents, and / or substances commonly used in the industry to prevent the growth of Mycoplasma to prevent infection by bacteria, fungi, etc. As antibiotics, any antibiotics commonly used in cell culture, such as penicillin-streptomycin, may be used; as antifungal agents, commonly used substances such as alporelysin B, and as Mycoplasma inhibitors, commonly used substances such as gentamicin, ciprofloxacin, and azithromycin may be used, but are not limited thereto. Additionally, commercially available antibiotic-antimycotic (AA) (Gibco) may be used.

[0077] A third aspect of the present invention relates to a method for differentiating muscle stem cells into myotubes, comprising treating muscle stem cells with the aforementioned differentiation-promoting composition or culturing muscle stem cells in the aforementioned muscle stem cell culture medium composition.

[0078] Specifically, the differentiation method described above can be performed by culturing muscle stem cells in a medium for inducing muscle fiber differentiation supplemented with ethanolamine.

[0079] The above-mentioned medium for inducing muscle fiber differentiation may not contain any differentiation promoters other than ethanolamine, or may contain other differentiation promoters. For example, the above-mentioned medium for inducing muscle fiber differentiation may be in the form of a basic medium or a basic medium to which additional differentiation promoters are added, such as wnt3a, wnt4, or wnt5 proteins, which are agonists involved in the wnt signaling pathway, substances known to activate the wnt signaling pathway, beef extract, catechin, etc. Since the type of basic medium is the same as previously described, its description is omitted.

[0080] A fourth aspect of the present invention relates to a myotube cell culture obtained by the differentiation method described above, cultured meat obtained by culturing the myotube cell culture, and a food composition comprising the cultured meat.

[0081] In relation to the fourth aspect above, the present invention provides a method for producing cultured meat, comprising the step of producing cultured meat by culturing the myotube cell culture.

[0082] In addition, the present invention provides a method for manufacturing food comprising the steps of: culturing the myotube cell culture to produce cultured meat; and processing the produced cultured meat to produce food.

[0083] In addition, the present invention provides a use of the myotube cell culture for use in the manufacture of cultured meat or food.

[0084] In the present invention, "myotube culture" refers to a cell aggregate containing a large number of myotubes formed through the differentiation of muscle stem cells.

[0085] In the present invention, the method for preparing the myotube cell culture is the same as the method for differentiating muscle stem cells into myotube cells described above, so the description thereof is omitted.

[0086] In the method for manufacturing cultured meat or food according to the present invention, a step of differentiation from muscle stem cells into myotube cells may be performed prior to the step of manufacturing cultured meat by culturing the myotube cell culture.

[0087] The method for producing cultured meat according to the present invention can be carried out under known conditions used for myotube cell culture when producing cultured meat. For example, cultured meat can be produced by culturing the myotube cell culture in three dimensions or by maturing it under appropriate support / culture conditions to develop it into myofibers.

[0088] According to a specific embodiment of the present invention, the method for producing cultured meat may include the following steps:

[0089] (a) Cell proliferation stage: By culturing muscle stem cells under appropriate culture conditions, a sufficient number of cells can be obtained.

[0090] (b) Differentiation induction step: After reaching a sufficient cell density, myotube formation of muscle stem cells can be induced by replacing the medium with a differentiation induction medium. At this time, the medium used may be the type of medium described in the second aspect of the present invention.

[0091] (c) Organization or structuring step: The formed myotube cell culture can be manufactured in a form similar to the texture of real meat by culturing it on a scaffold (e.g., collagen, gelatin, plant-derived hydrogel, etc.) or by structuring it using 3D bioprinting technology. If necessary, biophysical stimuli such as electrical stimulation or mechanical tension can be applied to improve the arrangement and maturity of muscle fibers. This organization or structuring step is performed optionally as needed and may also be omitted.

[0092] (d) Harvesting and processing step: After harvesting the formed cultured meat tissue, it can be manufactured into a final food or food material through processing steps such as molding, cooking, drying, freezing, and mixing.

[0093] Cultured meat produced according to the manufacturing method of the present invention can be provided in a state with improved freshness preservation and distribution stability by undergoing a packaging or storage step using methods such as refrigeration, freezing, or vacuum packaging.

[0094] The food manufacturing method of the present invention may include a process of processing the obtained cultured meat into various forms of food after performing steps (a) to (d), for example, steps such as molding, seasoning, heating, sterilization, drying, or freeze-drying of the cultured meat, as well as mixing or adding with other food ingredients.

[0095] The final food product may be a single cultured meat item or a complex food containing cultured meat, and it may be manufactured in the form of ready-to-eat meals, Home Meal Replacements (HMR), snacks, health functional foods, etc. For example, cultured meat may be consumed on its own or provided as a complex meal replacement combined with sauces, vegetables, grains, etc.

[0096] In the present invention, the food composition may be prepared as snacks, dumplings, fried foods, stir-fried foods, sauces, seasonings, powder mixes, breads, beverages, processed canned foods, or processed noodles, but is not limited thereto. The form in which cultured meat is added to the food may be ground into various particle sizes depending on the purpose of use in the food.

[0097] In the present invention, the cultured meat included in the food composition may be further treated with a coloring agent. Colorants refer to compounds that impart color to food; to reproduce the red meat color of beef or pork, artificial colorants, natural colorants, natural extracts [e.g., beet root extract, pomegranate fruit extract, cherry extract, carrot extract, red cabbage extract, red seaweed extract], modified natural extracts, natural juices (e.g., beet root juice, pomegranate juice, cherry juice, carrot juice, red cabbage juice, red seaweed juice), modified natural juices, FD&C (Food Drug Cosmetics) Red 3 (erythrosin), FD&C Green 3 (fast green FCF), FD&C Red 40 (allura red AC), FD&C Yellow 5 (tartazine), FD&C Yellow 6 (sunset yellow FCF), FD&C Blue 1 (brilliant blue FCF), FD&C Blue 2 (indigotine), titanium oxide, annatto, Anthocyanins, betanin, beta-APE 8 carotenal, beta-carotene, black currant, burnt sugar, canthaxanthin, caramel, carmine / carminic acid, cochineal extract, curcumin, lutein, carotenoids, monascin, paprika, riboflavin, saffron, turmeric, and combinations thereof may be used, but are not specifically limited thereto. Additionally, colorants such as nitrites and ascorbic acid, erythorbic acid, or salts thereof that promote the color development of said nitrites may be further added as color-developing aids.

[0098] In the present invention, the cultured meat included in the food composition may additionally be provided with antioxidants, emulsifiers, salts, etc., to stabilize proteins and prevent fat rancidity, color change, or fat separation. The antioxidants, emulsifiers, salts, etc., may be used without limitation as long as they are widely used in the industry.

[0099] The food composition comprising the cultured meat of the present invention may also be manufactured as a synthetic food product. In addition to the cultured meat, the synthetic food may further include minerals, vitamins, supplementary vitamins, essential fatty acids, essential amino acids, enzymes, antioxidants, or a combination of two or more of these.

[0100] In addition, synthetic foods containing cultured meat may further include flavoring agents, flavor enhancers, sweeteners, coloring agents, color-developing agents, bleaching agents, preservatives, disinfectants, antioxidants, leavening agents, coagulants, or thickeners.

[0101] The above synthetic food may be in the form of paste, puree, soup, pie, powder, granule, chip, tablet, capsule, or spread.

[0102] Cultured meat produced by the manufacturing method of the present invention can be used as a substitute for conventional animal meat. Specifically, it can be processed or manufactured in the form of a processed meat product. The processed meat product may include, for example, sterilized meat products, ham products, pressed ham, mixed pressed ham, sausage, mixed sausage, dried sausage (dried mixed sausage), semi-dried sausage (semi-dried mixed sausage), heated frozen sausage, bacon products, dried preserved meat, seasoned meat, ground processed meat products, packaged meat, and other processed meat products, but is not limited thereto.

[0103] The present invention will be described in more detail below through examples. These examples are solely for the purpose of illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as limited by these examples.

[0104] [Example 1]

[0105] Confirmation of the differentiation effect of muscle stem cells following ethanolamine treatment

[0106] 1-1. Isolation of muscle stem cells

[0107] After disinfecting the beef round tissue with 70% ethanol, any tissue suspected of external contamination was removed inside a sterile workbench. The tissue was transferred to a culture dish free of internal contamination, washed three times with PBS, and then unnecessary non-muscle tissues such as membranes and lipids were removed as much as possible using sterile scissors and forceps. After transferring the tissue to a culture dish free of internal contamination and washing it three times with PBS, unnecessary non-muscle tissues such as membranes and lipids were removed as much as possible using sterile scissors and forceps. Then, 2g of the tissue was placed in 10ml of enzyme (0.25% trypsin) solution, cut into small pieces within the enzyme solution, and the solution containing the cut pieces was uniformly ground using a grinder. 10ml of the enzyme combination solution was added to the ground tissue, and the mixture was homogenized by shaking incubation at 180rpm at 37.5℃ for 60 minutes. After treatment with 0.1% DNase I for 1 minute, the cells were filtered through 100 µm and 70 µm strainers to destroy any remaining red blood cells. The cells were washed with medium supplemented with 10% FBS, diluted with culture medium, plated, and then cultured.

[0108] 1-2. Differentiation Effects of Treatment with Ethanolamine at Different Concentrations on Muscle Stem Cells

[0109] Muscle stem cells isolated in Example 1-1 were cultured in cell culture flasks containing an undifferentiated control group (DMEM / F12 containing 10% FBS and 10 ng / ml FGF2) and cultured until confluency reached 80%. After removing all the culture supernatant, differentiation induction media containing horse serum (DMEM / F12 containing 2% horse serum) and differentiation induction media containing horse serum and ethanolamine (DMEM / F12 containing 2% horse serum and 0.5, 1, 2, or 5 μg / ml ethanolamine) were applied, respectively, and the muscle differentiation pattern was observed for 5 to 7 days. Monoethanolamine was used as the type of ethanolamine.

[0110] As shown in Figure 1, muscle stem cells remained in an undifferentiated state in the undifferentiated control group (DMEM / F12 containing 10% FBS and 10 ng / ml FGF2), but when the differentiation-inducing medium composition was added, it was observed that the differentiation efficiency into myotube cells increased as the concentration of ethanolamine increased.

[0111] 1-3. Confirmation of Muscle Stem Cell Marker Expression Following Ethanolamine Addition

[0112] Cells were fixed in 4% paraformaldehyde (PFA) at room temperature for 10 to 20 minutes, after which the residual fixative was removed. After completely removing residues by washing twice with PBS, non-specific binding sites were blocked by incubating in a blocking solution (e.g., 3% bovine serum albumin aqueous solution or 10% general goat serum solution) at room temperature for 40 to 60 minutes or by incubating overnight at 4°C. According to the manufacturer's instructions, the primary antibody, Desmin antibody, was diluted in the blocking solution. The diluted primary antibody was placed in cell culture plates from which the blocking solution had been removed, and the cells were incubated overnight at 4°C under light blockage. Unbound primary antibody was removed by washing the cells three times for 5 minutes each with a wash buffer (e.g., PBS). According to the manufacturer's instructions, the fluorescence-conjugated secondary antibody was diluted in the solution, and the cells were incubated with the diluted secondary antibody at room temperature for 1 hour under light blockage. Cells were washed three times for 5 minutes each with wash buffer (e.g., PBS) to remove unbound secondary antibodies. Nuclear staining was performed using a mounting solution containing DAPI, and the coverslip was fixed to a cell culture flask. After completely drying the mounting solution attached to the coverslip, the immunofluorescence-stained cells were visualized using a fluorescence microscope or confocal microscope equipped with the appropriate filter set used.

[0113] As shown in Figure 1, when comparing muscle stem cells cultured in a control medium (DMEM / F12 containing 10% FBS and 10 ng / ml FGF2) with muscle stem cells cultured in a differentiation induction medium containing horse serum (DMEM / F12 containing 2% horse serum) and a differentiation induction medium containing horse serum and ethanolamine (DMEM / F12 containing 2% horse serum and 0.5, 1, 2 or 5 μg / ml ethanolamine), it was confirmed that as the ethanolamine concentration in the differentiation induction medium increased, the expression of Desmin, a muscle differentiation marker, was superior, and long, uniformly shaped muscle fibers were formed overall.

[0114] Following the same immunofluorescence staining method described above, cells were fixed and a blocking solution was applied. To quantify the expression level of Desmin, the following procedure was performed. According to the manufacturer's instructions, the primary antibody, the Desmin antibody, was prepared by diluting it in the blocking solution. The diluted primary antibody was placed in a cell culture plate from which the blocking solution had been removed, and the cells were incubated overnight at 4°C under light blockage. The cells were washed three times for 5 minutes each with a wash buffer (e.g., PBS) to remove the unbound primary antibody. According to the manufacturer's instructions, the fluorescently conjugated secondary antibody was diluted in the solution, and the cells were incubated with the diluted secondary antibody at room temperature for 1 hour under light blockage. The cells were washed three times for 5 minutes each with a wash buffer (e.g., PBS) to remove the unbound secondary antibody. To stain the cell nuclei, the cells were incubated with a diluted DAPI solution at room temperature for 5 minutes under light blockage. The cells were washed three times for 5 minutes each with a wash buffer (e.g., PBS) to remove the unbound DAPI solution. Using a fluorescence microscope, wavelengths matching the secondary antibody and DAPI fluorescence were set, and after imaging, cells expressing the marker were quantified and represented as a fusion index. The fusion index was calculated using the following formula 1.

[0115] [Formula 1]

[0116] Fusion Index (%) = (Nuclei in Desmin) / (Total nuclei) x 100

[0117] As shown in Figure 2 and Table 1, Desmin expression in muscle stem cells cultured in a differentiation-inducing medium containing ethanolamine increased up to 18-fold compared to Desmin expression in muscle stem cells cultured in an undifferentiated control group (DMEM / F12 containing 10% FBS and 10 ng / ml FGF2), and Desmin expression increased by approximately 3 to 22% even when compared to muscle stem cells cultured in a differentiation-inducing medium without ethanolamine. Through this, it was confirmed that ethanolamine increases the differentiation efficiency into myotubes.

[0118] Undifferentiated Group Differentiated Group (Ethanolamine Excluded) Ethanolamine 0.5 μg / ml Treatment Group Ethanolamine 1 μg / ml Treatment Group Ethanolamine 2 μg / ml Treatment Group Ethanolamine 5 μg / ml Treatment Group Convergence Index 2% 14% 17% 24% 33% 36%

[0119] [Example 2]

[0120] Confirmation of muscle growth gene expression in muscle stem cells following ethanolamine treatment

[0121] Cells were lysed, and total RNA was extracted using an RNA extraction kit (Quigen). The extracted RNA was converted into cDNA using a reverse transcription kit. This cDNA was used for qRT-PCR analysis. Specific primers (Table 2) for normalization housekeeping genes (e.g., GAPDH) along with MyoD, MyoG, and MyHC genes were designed, and a qRT-PCR reaction mixture was prepared using the SYBR Green system. The cDNA template, primers, and master mix were then mixed to perform qRT-PCR.

[0122] Gene Direction Primer Sequence (5'→3') Sequence Number Amplification Size MYOD Forward TAGGAGAGGCGAAGGAACTGTTGT1137 Reverse TCTGGCCCACGGAGTAACATCAAA2MYOG Forward AGCCTCCAAATCCACTCCCTGAAA3107 Reverse AGCCACTGGCATAGGAAGAGATGA4MYHC Forward AGAGCAGCAAGTGGATGACCTTGA5116 Reverse TGGACTCTTGGGCCAACTTGAGAT6

[0123] The qRT-PCR instrument was set to 39 cycles, with one cycle consisting of denaturation at 94°C, annealing at 59°C, and elongation at 72°C. The relative expression levels of MyoD, MyoG, and MyHC were quantified by comparing the undifferentiated control group with the differentiation-induced experimental group using the ΔΔCt method.

[0124] As confirmed in Figure 3, not only were the expression levels of MyoD, MyoG, and MyHC in muscle stem cells of the differentiation-induced group treated with ethanolamine significantly increased compared to the undifferentiated group, but the expression levels of MyoD and MyHC genes were also significantly improved compared to the differentiation group not treated with ethanolamine.

[0125] Additionally, the results of converting the relative expression levels of each of the above genes into percentages (%) are shown in Figure 4 and Table 3. In this case, the ethanolamine-treated group in Figure 4 and Table 3 is the group treated with 2 μg / ml ethanolamine.

[0126] Undifferentiated Group Differentiated Group (Ethanolamine-free) Ethanolamine-treated Group MyoD 7% 35% 59% MyoG 5% 47% 49% MyHC 8% 35% 57%

[0127] As shown in Figure 4 and Table 3, the expression rates of each gene in the ethanolamine-treated group increased significantly compared to the undifferentiated group, and even compared to the differentiated group not treated with ethanolamine, the expression rates of MyoD and MyHC genes increased by approximately 24% and 22%, respectively, confirming that ethanolamine increases the efficiency of differentiation into myotubes.

[0128] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A composition for promoting differentiation from muscle stem cells into myotube cells, comprising ethanolamine.

2. A composition for promoting differentiation from muscle stem cells into myotube cells, wherein the ethanolamine according to claim 1 is selected from the group consisting of monoethanolamine (MEA), diethanolamine (DEA), and triethanolamine (TE).

3. A composition for promoting differentiation from muscle stem cells into myotube cells, wherein the composition does not include one or more selected from the group consisting of insulin, transferrin, and selenium.

4. The composition of claim 1, wherein the composition is a composition for promoting differentiation from muscle stem cells into myotubes, which increases the expression of one or more genes selected from the group consisting of MyoD, MyoG, and MyHC genes of muscle stem cells and the Desmin protein.

5. A culture medium composition for muscle stem cells comprising the composition according to claim 1.

6. A culture medium composition for muscle stem cells according to claim 5, further comprising serum or serum replacements.

7. A culture medium composition for muscle stem cells according to claim 6, wherein the serum is one or more selected from the group consisting of fetal bovine serum (FBS), human platelet lysate (hPL), human serum (HS), platelet-rich plasma (PRP), platelet poor plasma (PPP), calf serum, horse serum, porcine serum, and sheep serum.

8. A culture medium composition for muscle stem cells according to claim 5, further comprising one or more selected from the group consisting of chicken embryo extract, albumin, growth factors, hormones, amino acids, and vitamins.

9. A method for differentiating muscle stem cells into myotube cells, comprising treating muscle stem cells with a composition for promoting differentiation from muscle stem cells into myotube cells according to any one of claims 1 to 4, or culturing muscle stem cells in a culture medium composition for muscle stem cells according to any one of claims 5 to 8.

10. A myotube cell culture obtained by the method of differentiation from muscle stem cells into myotube cells according to paragraph 9.

11. Cultured meat obtained by culturing a myotube cell culture according to paragraph 10.

12. A food composition comprising the cultured meat of claim 11.

13. Use of ethanolamine for promoting differentiation from muscle stem cells into myotube cells.

14. Use of ethanolamine for the preparation of a culture medium to promote differentiation of muscle stem cells into myotube cells.

15. A method for producing cultured meat, comprising the step of producing cultured meat by culturing the myotube cell culture of claim 10.

16. A step of producing cultured meat by culturing the myotube cell culture of claim 10; and A step of manufacturing food by processing the cultured meat produced above; A food manufacturing method comprising 17. Use of the myotube cell culture of paragraph 10 for use in the manufacture of cultured meat or food.

Citation Information

Patent Citations

  • Method for providing mediation about behavioral and psychological symtoms of dementia and apparatus using the same

    KR1020240123211A

  • Method for preparing pixel define layer

    KR1020250042512A

  • Method for preparing of remolding rice for topping and remolding rice prepared thereby

    KR1020250052600A

  • Polymer nanodisc with angiotensin converting enzyme 2 and its antiviral usage

    KR102540331B1

  • KR20190070437A