Engineered cell with enhanced tumor killing ability and use thereof

Abstract

Provided are an engineered cell with enhanced tumor killing ability and use thereof. The engineered cell is site-specifically integrated with a polynucleotide encoding and expressing a secretory protein. The secretory protein comprises: (1) a first secretory protein and a second secretory protein, the first secretory protein being an inhibitor of immune checkpoint molecule PD1, and the second secretory protein being different from the first secretory protein; or (2) a double-antibody, multi-antibody, or fusion protein comprising a domain that specifically binds to the immune checkpoint molecule PD1. The engineered cell is prepared in a non-viral manner. The engineered cell efficiently kills tumor cells at a tumor site, has higher safety, and has stronger tumor killing ability.

Description

An engineered cell that enhances tumor-killing ability and its application

[0001] Cross-reference to related applications

[0002] This application claims priority to an earlier application filed on October 9, 2024, with patent application number 202411401811.2 and entitled "An engineered cell for enhancing tumor killing ability and its application thereto". The entire contents of the earlier application are incorporated herein by reference. Technical Field

[0003] This invention relates to the field of cell therapy technology, and in particular to an engineered cell that enhances tumor-killing ability and its applications. Background Technology

[0004] Cancer has always been a key research focus in the medical field, and cell therapy is increasingly being used in cancer treatment. Cell therapy can generally be categorized into immunotherapy, stem cell therapy, and gene-editing cell therapy, and has been applied to various cancers, such as leukemia, breast cancer, liver cancer, and cervical cancer.

[0005] Mesenchymal stem cells (MSCs), as adult pluripotent stem cells, possess self-renewal capacity and multi-lineage differentiation potential. MSCs can be obtained from various adult tissues, including bone marrow, umbilical cord blood, and adipose tissue. MSCs exhibit certain immunomodulatory capabilities and tumor homing characteristics, playing a crucial role in tumor development and progression. Extensive evidence suggests that MSC migration to tumor sites is driven by their own affinity, often migrating via the bloodstream to participate in tumor development. Once inside the tumor microenvironment, MSCs interact with tumor cells and immune cells, participating in immune regulation, tumor cell proliferation, and inflammatory factor secretion. Furthermore, MSCs can differentiate into endothelial cells through various molecular regulatory mechanisms and signal transduction pathways, further contributing to tumor development. Therefore, tumor therapeutic factors can be loaded into MSCs, leveraging their inherent advantages to achieve targeted killing of tumor cells.

[0006] The most representative target among immune checkpoints is programmed death-protein 1 (PD-1, or PD1). PD-1, also known as CD279, is a type I transmembrane glycoprotein with a molecular weight of approximately 55 kDa, expressed on activated T cells, natural killer cells, B cells, macrophages, dendritic cells, and monocytes. PD-1 ligands include PD-L1 and PD-L2, with PD-L1 being the predominant ligand. In normal organisms, PD-L1 is widely expressed in various cell types, including T cells, dendritic cells, macrophages, vascular endothelial cells, and keratinocytes. After binding to its ligand, PD-1 inhibits T cell proliferation, activation, and cytokine secretion, thereby suppressing the immune response and effectively maintaining immune stability in normal organisms. However, PD-L1 is also widely expressed in various tumor cells. Tumor cells can utilize the immunosuppressive function of PD-1 / PD-L1 by binding to PD-1 molecules on the surface of lymphocytes, achieving immune escape. Therefore, by applying antibody inhibitors that competitively bind to PD-1, thereby blocking the binding of PD-1 to PD-L1 on the surface of tumor cells, it is possible to help reverse the tumor microenvironment, relieve the immunosuppressive state of T cells, dendritic cells, macrophages, and NK cells, and restore the endogenous anti-tumor immune response.

[0007] Currently, site-specific gene integration technology holds significant potential in cancer treatment. By precisely inserting or modifying specific genes, it helps enhance the immune system's anti-tumor capabilities and provides more efficient treatment methods targeting tumor cells. However, site-specific gene integration faces challenges such as difficulty in integration into the cellular genome, lack of expression after integration, and unsatisfactory expression levels, hindering its application in actual cancer treatment. Furthermore, single PD-1 inhibitors have limited and incomplete tumor-killing capabilities, leading to a higher risk of tumor recurrence. Therefore, enhancing their tumor-killing ability is a pressing issue that needs to be addressed. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this invention provides an engineered cell with enhanced tumor-killing ability and its application, which has enhanced tumor cell killing ability.

[0009] In a first aspect, the present invention provides an engineered cell that enhances tumor-killing ability, wherein the engineered cell is site-specifically integrated with a polynucleotide encoding a secreted protein; the secreted protein includes:

[0010] (1) First secretory protein and second secretory protein; the first secretory protein is an inhibitor of the immune checkpoint molecule PD1; the second secretory protein is different from the first secretory protein;

[0011] Or (2) contain a bispecific antibody, polyclonal antibody, or fusion protein with a domain that specifically binds to the immune checkpoint molecule PD1;

[0012] The engineered cells were prepared using a non-viral method.

[0013] In one embodiment of the present invention, the inhibitor of the immune checkpoint molecule PD1 is an antibody or antibody fragment, preferably a full-length antibody or single-chain antibody against PD1.

[0014] In one embodiment of the present invention, the second secretory protein can enhance the biological activity or functional effect of the first secretory protein. For example, the second secretory protein can enhance the antitumor activity or tumor-killing properties of the first secretory protein.

[0015] In one embodiment of the present invention, the second secretory protein includes at least one of immune checkpoint inhibitors, interleukins, tumor necrosis factor, interferon, growth factor inhibitors, TNF-α inhibitors, chemokines, GLP-1 receptor agonists, growth hormone, coagulation factors, insulin, tumor necrosis factor, and enzymes.

[0016] In one embodiment of the present invention, the immune checkpoint inhibitor is selected from at least one of PD-L1 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, LAG-3 inhibitors, and TIM-3 inhibitors.

[0017] In one embodiment of the present invention, the interleukin includes wild-type or mutant interleukin, preferably, the interleukin is selected from at least one of IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23 and IL-24.

[0018] In one embodiment of the present invention, the tumor necrosis factor is selected from at least one of TNF, LTA, LTB, FASLG, TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, EDA, and TRAIL.

[0019] In one embodiment of the present invention, the interferon is selected from at least one of interferon α, β, and γ.

[0020] In one embodiment of the present invention, the growth factor inhibitor is selected from at least one of epidermal growth factor inhibitors, endothelial growth factor inhibitors, platelet-derived growth factor inhibitors, fibroblast growth factor inhibitors, GM-CSF inhibitors, or G-CSF inhibitors; preferably, the endothelial growth factor is a vascular endothelial growth factor inhibitor.

[0021] In one embodiment of the present invention, the TNF-α inhibitor is selected from TNF-α receptor or TNF-α antibody. Further, the TNF-α inhibitor is selected from at least one of etanercept, adalimumab, secukinumab, infliximab, golimumab, and pecelizumab.

[0022] In one embodiment of the present invention, the chemokine is selected from at least one of CXC chemokine, CC chemokine, and CX3C chemokine. In a specific embodiment of the present invention, the CXC chemokine is selected from at least one of CXCL1 (GROα), CXCL2 (GROβ), CXCL3 (GROγ), CXCL4 (PF-4), CXCL5 (ENA-78), CXCL9 (MIG), CXCL10 (IP-10), and CXCL12 (SDF-1); the CC chemokine is selected from at least one of CCL1 (I-309), CCL2 (MCP-1), CCL3 (MIP-1α), CCL4 (MIP-1β), CCL5 (RANTES), CCL11 (Eotaxin), CCL17 (TARC), and CCL22 (MDC); and the CX3C chemokine is selected from CX3CL1 (Fractalkine).

[0023] In one embodiment of the present invention, the GLP-1 receptor agonist is a polypeptide GLP-1 receptor agonist, such as exenatide, benaglutide, dulaglutide, abiglutide, etc., whose polypeptide chains are either unmodified or chemically modified.

[0024] In one embodiment of the present invention, the growth hormone is selected from natural or recombinant human growth hormone (rhGH), which is divided into short-acting recombinant human growth hormone or long-acting recombinant human growth hormone.

[0025] In one embodiment of the present invention, the coagulation factor is selected from at least one of prothrombin complex, fibrinogen, antifibrinolytic, recombinant factor VIIa, recombinant factor VIII, recombinant factor IX, and coagulation factor X.

[0026] In one embodiment of the present invention, the enzyme is selected from at least one of lipase, amylase, trypsin, chymotrypsin, lysozyme, urokinase, L-asparaginase, glutaminase, and neuraminidase.

[0027] In one embodiment of the present invention, the bispecific antibody includes bispecific antibodies against PD-1 and other targets. In a specific embodiment of the present invention, the other targets are selected from at least one of the following: immune checkpoints, growth factors, interleukins, interferons, tumor necrosis factor, TNF-α, chemokines, and immune receptors (CD3, CD28, CD20), tumor antigens (HER2, EGFR, MUC1). Examples include anti-PD-1 / PD-L1 bispecific antibodies and anti-PD-1 and anti-CTLA-4 bispecific antibodies.

[0028] In one embodiment of the present invention, the polyclonal antibody includes a multispecific antibody against PD-1 and at least two other targets. In a specific embodiment of the present invention, the other targets are selected from at least one of the following: immune checkpoints, growth factors, interleukins, interferons, tumor necrosis factor, TNF-α, chemokines, and immune receptors (CD3, CD28, CD20), tumor antigens (HER2, EGFR, MUC1).

[0029] In one embodiment of the present invention, the fusion protein includes a fusion protein targeting anti-PD-1 and other targets. In a specific embodiment of the present invention, the other targets are selected from at least one of the following: immune checkpoints, growth factors, interleukins, interferons, tumor necrosis factor, TNF-α, chemokines, and immune receptors (CD3, CD28, CD20), tumor antigens (HER2, EGFR, MUC1). Examples include anti-PD-1 / PD-L1 fusion protein, anti-PD-1 / VEGF fusion protein, anti-PD-1 / IL-2 fusion protein, and anti-PD-1 / IL-15 fusion protein.

[0030] In one embodiment of the present invention, the site of the polynucleotide integration encoding the first secretory protein is located at the B2M locus.

[0031] In one embodiment of the present invention, the site of the polynucleotide integration encoding the second secretory protein is selected from one or more of the following: B2M locus, AAVS1, CCR5, HTRP, H11, GAPDH, TCR, ROSA26, RUNX1, HLA-II class molecule-related genes or rDNA regions; preferably, the site of integration is the B2M locus.

[0032] In one embodiment of the present invention, the site of integration of the multinucleotide encoding bispecific antibody, polyclonal antibody, or fusion protein is located at the B2M locus.

[0033] In one embodiment of the present invention, the amount of the first secretory protein secreted is greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, and preferably greater than 500 nanograms per 24 hours by one million engineered cells.

[0034] In one embodiment of the present invention, the engineered cells secrete an effective amount of a second secretory protein.

[0035] In one embodiment of the present invention, the amount of the second secretory protein secreted is at least one ten-thousandth, one thousandth, or one hundredth of the amount of the first secretory protein secreted, preferably more than one hundredth.

[0036] In one embodiment of the present invention, the secretion amount of the bispecific antibody, polyclonal antibody, or fusion protein is greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, and preferably greater than 500 nanograms per 24 hours by one million engineered cells.

[0037] In this invention, the polynucleotide encoding secretory proteins is not limited to functional regions, but may include at least one of expression repression regions, coding regions, leader sequences, exons, introns, reading frames, and expression cassettes.

[0038] In one embodiment of the present invention, the polynucleotide encoding the secretory protein includes one or more of the following: an operably linked promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding the secretory protein, a screening marker or tag, and a Poly(A) tail.

[0039] In one embodiment of the present invention, the signal peptide is an exogenous signal peptide. In another embodiment, the signal peptide is one or more of a combination of strongly secretory signal peptides suitable for secretory proteins. In yet another embodiment, the strongly secretory signal peptide is selected from at least one of secrecon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), and Igκlight chain signal peptide 1.

[0040] In one embodiment of the present invention, the promoter sequence is located upstream of the nucleic acid sequence, and the promoter controls the expression of the secretory protein.

[0041] In one embodiment of the present invention, the promoter is selected from CMV promoter, EF1α promoter, SV40 promoter, CAG promoter, PGK promoter or UBC promoter.

[0042] In one embodiment of the present invention, the screening marker is selected from, for example, ampicillin (Ampr), chloramphenicol (Camr), kanamycin (Kanr), tetracycline (Tetr), puromycin (Puro), G418, hygromycin β (Hygr), zeocin, and blasticidin.

[0043] In one embodiment of the present invention, the tag is selected from, for example, FLAG, His, GST, HA, c-Myc, HSV, V5, SUMO, eGFP / eCFP / eYFP / mCherryeGFP.

[0044] In one embodiment of the present invention, the engineered cells include engineered mesenchymal stem cells and / or engineered IPSC cells and their derivative cells.

[0045] In one embodiment of the present invention, the engineered mesenchymal stem cells are derived from adult cells or stem cells.

[0046] In a preferred embodiment of the present invention, the engineered mesenchymal stem cells are derived from pluripotent stem cells; more preferably, the pluripotent stem cells are selected from induced pluripotent stem cells (iPSCs).

[0047] In a preferred embodiment of the present invention, the engineered mesenchymal stem cells are derived from bone marrow, fat, muscle, heart, umbilical cord blood, or umbilical cord.

[0048] In one embodiment of the present invention, the derived cells include CAR-iNK, dopaminergic neural progenitor cells, CAR-iMac, cardiomyocytes, endothelial progenitor cells, iNK cells, retinal cells, nerve cells, osteoblasts, hematopoietic stem cells, blood cells, T cells, β cells, fibroblasts, hair cells, monocytes, macrophages, Treg cells, renal progenitor cells, lung epithelial cells, endothelial cells, megakaryocytes, smooth muscle cells, skeletal muscle cells, chondrocytes, osteocytes, adipocytes, hepatocytes, pancreatic islet cells, keratinocytes, melanocytes, and dendritic cells.

[0049] In one embodiment of the present invention, engineered cells with polynucleotides encoding the expression of a first secretory protein and a second secretory protein have significantly better biological activity or functional effects than engineered cells with polynucleotides encoding the expression of the first secretory protein alone, and significantly better than engineered cells with polynucleotides encoding the expression of the second secretory protein alone.

[0050] In one embodiment of the present invention, the secretory protein further includes one or more other secretory proteins, which include at least one of the following: immune checkpoint inhibitors, interleukins, tumor necrosis factor, interferon, growth factor inhibitors, TNF-α inhibitors, chemokines, GLP-1 receptor agonists, growth hormone, coagulation factors, insulin, tumor necrosis factor, and enzymes.

[0051] In one embodiment of the present invention, the one or more other secretory proteins are different from the first secretory protein and the second secretory protein.

[0052] In one embodiment of the present invention, the other secretory proteins include a third secretory protein and a fourth secretory protein.

[0053] In one embodiment of the present invention, the first, second, third, and fourth secretory proteins are all different from each other.

[0054] In a second aspect, the present invention provides a method for preparing the above-described engineered cells, comprising introducing a polynucleotide encoding the secretory protein into a site of integration of the engineered cells.

[0055] In one embodiment of the present invention, an expression cassette encoding a secreted protein is introduced into a site-specific integration site of the cell via a meganuclease, zinc finger nuclease (ZFNs), transcription activator-like effector nuclease (TALEN), and / or a CRISPER / Cas system; more preferably, a CRISPER / Cas system.

[0056] In one embodiment of the present invention, the method includes introducing a polynucleotide encoding the secretory protein into iPSCs cells for site-specific integration, followed by directed differentiation to obtain derived cells;

[0057] Preferably, the derived cells are engineered mesenchymal stem cells.

[0058] In one embodiment of the present invention, the fixed-point integration includes dual-copy integration or single-copy integration.

[0059] In one embodiment of the present invention, the method of introduction is a non-viral method; preferably, the method of introduction is selected from: vector transformation, transfection, heat shock, electroporation, transduction, and microinjection.

[0060] In a third aspect, the present invention provides a formulation comprising the above-described engineered cells and pharmaceutically acceptable excipients.

[0061] In one embodiment of the present invention, the excipients include buffer solutions selected from, for example, acetates, Tris, phosphates, citrates, and other organic acids; antioxidants selected from, for example, ascorbic acid and methionine; preservatives selected from, for example, octadecyl dimethyl benzyl ammonium chloride, hexamethyl ammonium chloride, benzalkonium chloride, phenol, butylbenzyl alcohol, alkyl p-hydroxybenzoates such as methyl or propyl p-hydroxybenzoates, catechol, resorcinol, and cyclohexanol; proteins selected from, for example, serum albumin, gelatin, or immunoglobulins; and hydrophilic polymers selected from, for example, polyethylene glycol. Pepperl ketone; amino acids selected from, for example, glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates selected from, for example, glucose, mannose, or dextrin; chelating agents selected from, for example, EDTA; sugars selected from, for example, sucrose, mannitol, trehalose, or sorbitol; surfactants selected from, for example, polysorbates; metal complexes selected from, for example, zinc protein complexes; nonionic surfactants selected from, for example, Tween or polyethylene glycol (PEG); liposomes, albumin microspheres, polyesters, micelles, sustained-release matrices, etc.

[0062] In a fourth aspect, the present invention provides a pharmaceutical composition comprising the above-described engineered cells.

[0063] In one embodiment of the present invention, the pharmaceutical composition further includes one or more other therapeutic agents, including antipyretics, analgesics, antibiotics, antidepressants, antidiabetic drugs, anti-inflammatory drugs, antitumor drugs, anti-anxiety drugs, immunomodulators, sedative-hypnotics, antianginal drugs, antipsychotics, antimanic drugs, antiarthritis drugs, antiarrhythmic drugs, antigout drugs, anticoagulants, thrombolytics, antifibrinolytics, hemorheological agents, antiplatelet drugs, anticonvulsants, anti-Parkinson's drugs, antihistamines, drugs for calcium regulation, antiviral drugs, bronchodilators, hormones, lipid-lowering drugs, proteins, peptides, nucleic acids, antiulcer or antireflux drugs, antiemetics, diagnostic agents, and nutritional products. Preferably, the drugs include antitumor drugs, specifically including but not limited to paclitaxel and its derivatives, docetaxel, camptothecin and its derivatives, etoposide, teniposide, doxorubicin hydrochloride, cyclophosphamide, actinomycin, bleomycin, fenofibrate, doxorubicin, epirubicin, mitomycin, methotrexate, 5-fluorouracil, carboplatin, carmustine, lomustine, cisplatin, vincristine, tamoxifen, piperazine, and benzethonol.

[0064] In one specific embodiment of the present invention, the one or more other therapeutic agents are administered in combination with the engineered cells. The combined administration includes administration in any order or at any time interval, such that two or more therapeutic agents exert their biological activity simultaneously. Preferably, the combined administration produces a synergistic therapeutic effect.

[0065] In a fifth aspect, the present invention provides the use of the above-described engineered cells, formulations, and pharmaceutical compositions in the preparation of drugs for the diagnosis, prevention, and treatment of diseases; said diseases include, but are not limited to, cell proliferative diseases such as tumors, melanoma, non-small cell lung cancer, renal cell carcinoma, colorectal cancer, breast cancer, pancreatic cancer, head and neck cancer, and other solid tumors; hematologic diseases such as leukemia, anemia, lymphoma, hemophilia, leukopenia, thrombocytopenia, angiogenesis disorders, Kaposi's sarcoma, etc.; autoimmune diseases such as Crohn's disease, ulcerative colitis, allergies, inflammatory bowel disease, arthritis, psoriasis, and respiratory tract inflammation, asthma, and organ transplant rejection, etc.; metabolic diseases such as diabetes, growth hormone deficiency, and growth retardation in children, etc.; infections, including viral infections, bacterial infections, fungal infections, and parasitic infections, such as hepatitis B, hepatitis B and hepatitis C, etc.; digestive system diseases such as indigestion, pancreatic diseases, etc.; and skin injuries such as trauma, burns, etc.

[0066] In one embodiment of the present invention, the drug is administered via intravenous, intramuscular, peritoneal, cerebrospinal, subcutaneous, intramedullary, intrathecal, oral, local, or inhalation routes.

[0067] Compared with the prior art, the present invention has the following beneficial effects:

[0068] (1) This invention utilizes experimental screening to specifically target the integration of polynucleotides expressing inhibitors of the immune checkpoint molecule PD1 into the B2M locus of mesenchymal stem cells, overcoming the problems of inability to integrate or difficulty in achieving high expression after integration when targeting other sites (such as AAVS1, CCR5, rDNA region, ROSA26, HTRP, H11, TCR, etc.). Furthermore, a second secretory protein is introduced to assist the PD1 inhibitor in enhancing the tumor-killing ability of mesenchymal stem cells.

[0069] (2) This invention employs a non-viral method to specifically integrate polynucleotides expressing inhibitors of the immune checkpoint molecule PD1 (preferably scFvs of PD-1 blocking antibodies, abbreviated as αPD1-scFv or α-PD1 scFv) into the B2M locus of iPSCs, thereby obtaining iPSCs capable of stably and highly secreting PD1 inhibitors. Furthermore, polynucleotides expressing a second secretory protein are also targeted, enhancing the killing ability of mesenchymal stem cells against tumor cells.

[0070] (3) This invention utilizes the ability of mesenchymal stem cells to migrate to the tumor site, and can release multiple therapeutic factors in a high-density concentration at the tumor site. Compared with the method of directly injecting multiple therapeutic factors, the scheme adopted in this application has low toxicity, greatly reduces the toxic side effects when multiple therapeutic factors are used in combination, and enables it to efficiently kill tumor cells at the tumor site, with higher safety and stronger tumor killing ability. Attached Figure Description

[0071] Figures 1-2 are schematic diagrams of the targeting of anti-human PD1 scFv into the B2M locus and rDNA region locus in Example 1.

[0072] Figures 3-4 show the PCR identification of αPD1 iPSCs that are site-directedly integrated with αPD1 scFv.

[0073] Figure 5-6 shows the sequencing results of the site-directed integration PCR products.

[0074] Figure 7. Morphology of fixed-point integrated αPD1 iPSCs.

[0075] Figure 8 shows the difference in protein expression levels between rDNAαPD1 iPSCs and B2MαPD1 iPSCs detected by Western Blot.

[0076] Figure 9 shows the core elements of the plasmid vector in Embodiment 2 of the present invention.

[0077] Figure 10 is a schematic diagram of the plasmid vector and site-specific integration in Embodiment 2 of the present invention.

[0078] Figure 11 shows the protein expression results of α-PD1-scFv plasmid transiently transduced to 293T in the embodiments of the present invention.

[0079] Figure 12 shows the results of transient conversion of IL-24 plasmid to 293T protein expression in the embodiments of the present invention.

[0080] Figure 13 shows the results of transient conversion of IL-2 plasmid to 293T protein expression in the embodiments of the present invention.

[0081] Figure 14 shows the results of transient transduction of α-VEGF-scFv plasmid to 293T RNA and protein expression in the embodiments of the present invention.

[0082] Figure 15 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-PD1-scFv-iPSCs clone identified by the B2M site in this embodiment of the invention, as well as the B2M PCR product.

[0083] Figure 16 shows the electrophoresis diagram of the upstream and downstream homologous arms of the IL-24-iPSCs clone identified by the B2M site and the B2M PCR product in the embodiment of the present invention.

[0084] Figure 17 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-PD1-scFv-IL-24-iPSCs clone identified by the B2M site in this embodiment of the invention, as well as the B2M PCR product.

[0085] Figure 18 shows the electrophoresis diagram of the upstream and downstream homologous arms of the WT-IL-2-iPSCs clone identified by the B2M site in this embodiment of the invention, as well as the B2M PCR product.

[0086] Figure 19 shows the electrophoresis diagram of the upstream and downstream homologous arms of the IL-2v-iPSCs clone identified by the B2M site and the B2M PCR product in the embodiment of the present invention.

[0087] Figure 20 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-PD1-scFv-WT-IL-2-iPSCs clone identified by the B2M site in this embodiment of the invention, as well as the B2M PCR product.

[0088] Figure 21 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-PD1-scFv-IL-2v-iPSCs clone identified by B2M site integration in this embodiment of the invention, as well as the B2M PCR product.

[0089] Figure 22 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-VEGF-scFv-iPSCs clone identified by the B2M site in this embodiment of the invention, as well as the B2M PCR product.

[0090] Figure 23 shows the electrophoresis diagram of the upstream and downstream homologous arms of the α-PD1-scFv-α-VEGF-scFv-iPSCs clone identified by B2M site integration in this embodiment of the invention, as well as the electrophoresis diagram of the B2M PCR product.

[0091] Figure 24 shows the Sanger sequencing results of iPSC cloning at the B2M site and the PCR products across the upstream homologous arm in Example 4 of this invention.

[0092] Figure 25 shows the editing status of the B2M site in each group of iPSCs clones in Example 4 of the present invention.

[0093] Figure 26 shows the morphology of each iMSC cell in Example 5 of the present invention.

[0094] Figure 27 shows the identification of surface markers on each iMSC in Embodiment 5 of the present invention.

[0095] Figure 28 shows the expression and secretion of α-PD1-scFv in each iMSC containing the α-PD1-scFv expression cassette in Example 5 of the present invention.

[0096] Figure 29 shows the IL-24 expression and secretion of each iMSC containing the IL24 expression cassette in Example 5 of the present invention.

[0097] Figure 30 shows the IL-2 expression and secretion of each iMSC containing the IL-2 expression cassette in Example 5 of the present invention.

[0098] Figure 31 shows the expression and secretion of α-VEGF-scFv in each iMSC containing the α-VEGF-scFv expression cassette in Example 5 of the present invention.

[0099] Figure 32 shows the in vitro tumor cell killing results of iMSCs co-expressing α-VEGF-scFv and IL-24 in Example 6 of the present invention.

[0100] Figure 33 is a flowchart of the in vivo experiment of iMSCs co-expressing α-VEGF-scFv and IL-24 in Example 6 of the present invention.

[0101] Figure 34 shows the in vivo experimental results of iMSCs co-expressing α-VEGF-scFv and IL-24 in Example 6 of the present invention.

[0102] Figure 35 shows the results of CTLL-2 proliferation promoted by each iMSC containing the IL-2 expression cassette in the embodiments of the present invention.

[0103] Figure 36 shows the in vitro tumor cell killing results of iMSCs co-expressing α-VEGF-scFv and IL-2 in Example 7 of the present invention. Detailed Implementation

[0104] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0105] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0106] Unless otherwise stated, the definitions of groups and terms recorded in this application specification and claims, including definitions as examples, exemplary definitions, preferred definitions, definitions recorded in tables, and definitions of specific compounds in the examples, can be arbitrarily combined and combined with each other. Such combinations and combinations of group definitions and compound structures should be understood as being within the scope of this application specification and / or claims.

[0107] The term “antibody” is used in the broadest sense herein to refer to a protein that contains an antigen-binding site, encompassing natural and artificial antibodies of various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, intact antibodies, and antibody fragments.

[0108] iPSCs or ipsc (Induced pluripotent stem cells) refer to induced pluripotent stem cells. iMSCs or iMSC refer to mesenchymal stem cells differentiated from induced pluripotent stem cells.

[0109] Programmed Death 1 (PD-1, or PD1): A member of the immunoglobulin superfamily receptors, PD-1, upon binding to its ligands PD-L1 / PD-L2, can inhibit the proliferation of immune cells such as T cells and the secretion of cytokines. In the tumor microenvironment, PD-1 binding to its ligands can weaken the function of tumor-specific T cells, leading to incomplete tumor eradication.

[0110] In this article, αPD1, α-PD1, and anti-PD1 have the same meaning, all referring to antibodies targeting the PD1 immune checkpoint. αPD1-FLAG refers to PD1 antibodies with a FLAG detection tag to facilitate the detection of PD1 antibodies.

[0111] Single-chain antibodies (scFv): These are formed by connecting the variable regions of the light chain and the variable regions of the heavy chain of an antibody through a hinge region, thus retaining the ability to bind antigens.

[0112] Tumor necrosis factor-alpha (TNF-α) is a cytokine that plays a core regulatory role in processes such as inflammation, apoptosis, and immune regulation. On the one hand, it can resist infection and prevent tumor formation; on the other hand, it is closely related to the progression of various diseases, such as malignant tumors, rheumatoid arthritis (RA), psoriatic arthritis, and diabetes. In RA, excessive TNF-α production promotes disease development and joint destruction. Therefore, anti-TNF-α drugs are widely used in the treatment of rheumatoid arthritis to reduce inflammation, alleviate joint symptoms, and improve joint damage. In the specific embodiments of this invention, sTNFRII is a tumor necrosis factor receptor, and anti-TNF-αscFv is a single-chain antibody against tumor necrosis factor-α; both can treat diseases caused by TNF-α overdose.

[0113] Fusion proteins are single proteins formed by linking two or more different proteins or peptide chains through gene recombination technology. Fusion proteins typically consist of protein fragments from different sources, aiming to combine their respective properties to achieve advantages in function, stability, or purifurability. Non-fusion proteins are proteins formed by linking two or more different proteins or peptide chains without gene recombination technology. For example, multiple genes or proteins are transcribed and translated independently to achieve their respective functions or properties, without being linked together through fusion or other means. In a specific embodiment of the present invention, the secretory protein can be either a fusion protein or a non-fusion protein. For example, the first secretory protein and the second secretory protein can be linked together through gene recombination technology to form a fusion protein. Alternatively, the first secretory protein and the second secretory protein can be expressed separately. Furthermore, at least two of the first, second, third, and fourth secretory proteins may be in fusion protein form, or at least two may be in non-fusion protein form.

[0114] Signal peptide: A short peptide chain of 5-30 amino acids in newly synthesized polypeptide chains that guides the transfer of proteins into the secretory pathway. It is located at the N-terminus of secretory proteins and consists of three parts: the N-terminus is a positively charged basic amino terminus; the middle is the main functional region, a hydrophobic sequence formed by neutral amino acids; and the C-terminus is a negatively charged processing region, which is the cleavage site of the signal peptide. The newly synthesized protein is guided into the endoplasmic reticulum lumen by the signal peptide, and the signal peptide sequence is cleaved by signal peptidase. Subsequently, the protein continues to be translated, folded, and modified. In the specific embodiments of this invention, the signal peptide is selected from commonly used signal peptides in the art. However, the inventors of this application have found through research that different signal peptides will produce different effects on the secretion level for different proteins. The signal peptides selected in the specific embodiments of this application are all strongly secretory signal peptides suitable for secretory proteins. A strongly secretory signal peptide suitable for a secretory protein may be one or more in combination, as long as the desired expression level is achieved. Optionally, the strongly secreted signal peptide may be secrecon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), or Igκlight chain signal peptide 1. Alternatively, depending on the specific protein type, the signal peptide may be selected from other types of signal peptides known in the art, as long as they can achieve the desired expression level.

[0115] Endogenous signal peptides: Signal peptides derived from the corresponding target gene (protein) within an organism.

[0116] Exogenous signal peptides are signal peptides that are not inherent to the target gene (protein) within the organism, but rather other signal peptides added artificially during gene expression. Exogenous signal peptides include any signal peptide that can be utilized to promote the secretion of secreted proteins from the cell. Examples include signal peptides derived from immunoglobulins (e.g., IgG heavy chain or IgG-Kappa light chain), cytokines (e.g., interleukin-2 (IL-2) or CD33), serum albumin (e.g., HSA or albumin), azurocidin progenitourin, luciferase, trypsinogen (e.g., trypsinogen or trypsinase protein), or other signal peptides capable of effectively secreting proteins from the cell.

[0117] The B2M locus refers to the location of the Beta-2-Microglobulin gene in the human genome. Located on chromosome 15, the B2M locus encodes Beta-2-Microglobulin, a small protein that typically binds to the major histocompatibility complex (MHC I) molecules on the surface of most human cells. In a specific embodiment of this invention, the B2M locus is located at coordinates NC_000015.10:44711391-44721145 on the Human Reference Genome 38 (GRCh38 / hg38) human genome. In a specific embodiment of the present invention, the site-specific integration sites of the B2M locus are NC_000015.10:44711496-44711616, NC_000015.10:44712633-44712758, NC_000015.10:44714254-44714367, NC_000015.10:44716166-44716285, NC_000015.10:44717129-44717251 or NC_000015.10:44718022-44718131.

[0118] Vector: refers to a polynucleotide or other molecule capable of transferring at least one nucleic acid fragment into a cell. A vector may optionally contain components / elements that mediate vector maintenance and / or the realization of its intended use (e.g., origin of replication, antibiotic resistance gene, multiple cloning site, and / or operatively linked promoter / enhancer elements for the expression of the target gene). Vectors include plasmids, bacteriophages, plant or animal viruses. In specific embodiments of the present invention, the polynucleotide encoding a first secretory protein and the polynucleotide encoding a second secretory protein may be cloned into the same vector or separately into two vectors. When cloned into the same vector, the polynucleotide encoding the first secretory protein and the polynucleotide encoding the second secretory protein are operatively linked. In specific embodiments of the present invention, at least two of the polynucleotides encoding the first, second, third, and fourth secretory proteins may be cloned into different vectors; or at least two may be cloned into the same vector. When cloned into the same vector, at least two of the polynucleotides encoding the first secretory protein, the second secretory protein, the third secretory protein, and the fourth secretory protein are operatively linked.

[0119] Expression frames (FFS) are operatively linked polynucleotide sequences that can be expressed in a specific host. For example, polynucleotide sequences expressed in prokaryotes include, but are not limited to, promoters, operator genes, ribosome binding sites, and sequences encoding target genes. Polynucleotide sequences expressed in eukaryotes include, but are not limited to, promoters, enhancers, termination signals, sequences encoding target genes, and polyadenylation signals (and other sequences).

[0120] Promoter: A promoter is a region of DNA, typically located upstream (5' end) of a nucleic acid, that enhances transcription of that nucleic acid. Promoters appropriately activate or inhibit the nucleic acid to which they are operatively linked. Promoters contain specific sequences that are recognized by transcription factors. When a transcription factor binds to the promoter DNA sequence, it leads to the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the nucleic acid.

[0121] Introduction: refers to the incorporation of nucleic acids into cells using any method known in the art, including but not limited to transfection, transformation, and transduction. Examples include viral vector transfection; plasmid vector transformation; electroporation (Fromm et al. (1986) Nature 319:791-3); liposome transfection (Felgner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; and particle bombardment (Klein et al. (1987) Nature 327:70), etc.

[0122] Operable ligation: When the first and second nucleic acid sequences are functionally related, they are operably ligated. For example, when a promoter affects the transcription or expression of a coding sequence, the promoter and coding sequence are operably ligated. When recombination occurs, the operably ligated nucleic acid sequences are generally adjacent and, when two protein-coding regions need to be ligated, are within the same reading frame.

[0123] Nucleic acid: refers to the polymeric form of nucleotides (i.e., ribonucleotides, deoxyribonucleotides, and / or modified forms of any of the foregoing). As used herein, “nucleic acid,” “nucleic acid molecule,” “polynucleotide,” and “nucleotide sequence” are synonymous. A nucleotide sequence or polynucleotide may include double-stranded DNA or single-stranded DNA (i.e., the sense and antisense strands that make up double-stranded DNA) or RNA. Nucleic acids include any topological conformation, including single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin-shaped, circular, and padlock conformations. Nucleic acids may include any one or both of naturally occurring and modified nucleotides. Modifications include, but are not limited to, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, and internucleotide modifications such as methylphosphonates, triphosphates, aminophosphates, and carbamates; for example, thiophosphates and dithiophosphates. Furthermore, a fragment of a polynucleotide refers to a portion of a polynucleotide that encodes a polypeptide that provides substantially the same function as the polypeptide encoded by the complete polynucleotide. Examples of mutants of a specific polynucleotide sequence include naturally occurring allelic mutants, artificial mutants, and polynucleotide sequences obtained by deleting, substituting, adding, and / or inserting one or more nucleotides into the specific polynucleotide sequence. It should be understood that such fragments and / or mutants of a specific polynucleotide sequence encode polypeptides that have substantially the same function as the polypeptide encoded by the original specific polynucleotide sequence.

[0124] Site-specific integration refers to the insertion or integration of all or part of a desired sequence (e.g., the target sequence) into a desired site or locus within the genome. Methods for site-specific integration are various and well-known to those skilled in the art. Examples include calcium phosphate-mediated integration: integrating a foreign gene into a cell by binding it to a calcium ionophore (e.g., CaPO4) and activating it with electrical stimulation or ultraviolet light. Transposon-mediated integration: integrating a foreign gene into the cell chromosome using transposons (e.g., Tn7, Tn5). CRISPR / Cas9-mediated integration: integrating a foreign gene into the cell chromosome using the CRISPR / Cas9 system. Direct DNA ligation: directly ligating a foreign gene to a specific location on the cell chromosome using DNA ligase. In some embodiments, site-specific integration is performed using the CRISPR / Cas9 system.

[0125] Homologous arms: These are sequences that are substantially identical or substantially complementary to sequences located at or near a target site (or target sequence) within the genome. In some implementations, the number of homologous arms is at least approximately 2, at least approximately 3, at least approximately 4, at least approximately 5, at least approximately 6, at least approximately 7, at least approximately 8, at least approximately 9, at least approximately 10, at least approximately 20, at least approximately 25, at least approximately 30, at least approximately 35, at least approximately 40, at least approximately 45, at least approximately 50, at least approximately 55, at least approximately 60, at least approximately 65, at least approximately 70, and at least approximately 75. At least approximately 80, at least approximately 85, at least approximately 90, at least approximately 95, at least approximately 100, at least approximately 150, at least approximately 200, at least approximately 250, at least approximately 300, at least approximately 350, at least approximately 400, at least approximately 450, at least approximately 500, at least approximately 600, at least approximately 700, at least approximately 800, at least approximately 900, at least approximately 1000 or more nucleotides. Homologous arms can integrate target sequences into target sites (or target sequences) within the genome through homologous recombination, where the homologous arms are substantially identical or substantially complementary to the sequences at or near the target sites (or target sequences) within the genome.

[0126] PAM sequence: "Protospacer Adjacent Motif" is a sequence located next to the target sequence recognized and cleaved by a CRISPR RNA-guided Cas protein (such as Cas9). The PAM sequence is typically a short nucleic acid sequence that is not directly recognized by the CRISPR RNA-guided Cas protein but serves as an essential auxiliary sequence to help the Cas protein determine its binding site on the target sequence. In some embodiments, the PAM sequence is 5'-NGG-3', where N is A, T, C, or G. Preferably, the PAM sequence is TGG.

[0127] Target sequence: This is the region that integrase recognizes and inserts into a foreign DNA sequence. It is the binding site of the integrase and is usually located in the coding region of a gene or near the promoter. The target sequence can be a naturally occurring sequence or a sequence that is artificially designed or synthesized. In some embodiments, the target sequence is located n bases upstream of the PAM sequence, where n is a natural number. In some embodiments, n = 1-20 bp.

[0128] The terms "sgRNA," "guide RNA," or "sgRNA of this invention" are used interchangeably and all refer to sgRNAs that target sequences at the site of integration. In some embodiments, the sgRNA is an sgRNA that targets sequences in the B2M gene.

[0129] High expression: In this article, high expression refers to the secretion of the first secretory protein at a rate greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, preferably greater than 500 nanograms per 24 hours by one million engineered cells. Alternatively, the secretion of bispecific antibodies, polyclonal antibodies, or fusion proteins at a rate greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, preferably greater than 500 nanograms per 24 hours by one million engineered cells. The secretion level of the second secretory protein is not specifically limited, but it still needs to reach an effective level.

[0130] Effective amount: In this article, engineered cells secrete an effective amount of the second secretory protein, which is the amount required to assist PD1 inhibitors in enhancing the killing ability of engineered cells against tumor cells. For example, optionally, the secretion amount of the second secretory protein is greater than one ten-thousandth, eight ten-thousandths, one thousandth, five thousandths, or one hundredth of the secretion amount of the first secretory protein, preferably greater than one percent.

[0131] In this article, the first, second, third, and fourth secretory proteins are all therapeutic or adjuvant therapeutic factors, and they are not identical to each other. The terms "different" or "not identical" in this article refer to differences in their amino acid sequences. In the specific embodiments of this invention, the timing of the polynucleotides expressing the first, second, third, and fourth secretory proteins being introduced into the genome of the target cell is not particularly limited, and includes, but is not limited to, simultaneous or non-simultaneous introduction.

[0132] Furthermore, in some embodiments, the secretory protein in this application may be a bispecific antibody, polyclonal antibody, or fusion protein containing a domain that specifically binds to the immune checkpoint molecule PD1, which has a further enhanced tumor-killing ability compared to a single PD1 inhibitor. For example, it may be a bispecific antibody that simultaneously targets PD1 and other targets, such as immune checkpoints, growth factors, interleukins, interferons, tumor necrosis factor, TNF-α, chemokines, and immune receptors (CD3, CD28, CD20), tumor antigens (HER2, EGFR, MUC1), etc.; it may also be a fusion protein of PD1 antibody and IL-2, a fusion protein of PD1 antibody and IL-15, etc.

[0133] The inventors of this application discovered in experiments that when targeting genes expressing immune checkpoint molecule PD1 inhibitors in the cell genome using site-directed integration, not all integration sites are suitable for site-directed integration, and the expression levels vary considerably. Therefore, in this specific embodiment of the invention, the inventors first experimentally screened for integration sites capable of site-directed integration and high expression of immune checkpoint molecule PD1 inhibitors, namely the B2M locus. Based on this, the inventors simultaneously targeted a second secretory protein that assists PD1 inhibitors in enhancing the tumor-killing performance of engineered cells, obtaining engineered cells with enhanced tumor-killing ability. Preferably, the engineered cells are mesenchymal stem cells.

[0134] Example 1: Construction of a targeting vector carrying anti-PD1 scFv and screening of integration sites

[0135] 1. Construction of a targeting vector carrying anti-PD1 scFv

[0136] In this embodiment, the inventors first selected five target sites—AAVS1, B2M, CCR5, CIITA, and the rDNA region—and constructed corresponding anti-PD1 scFv targeting vectors. Using CRISPR / Cas9 gene editing tools, the anti-human PD1 scFv sequence was site-directedly integrated into the AAVS1, B2M, CCR5, or CIITA loci, respectively. Using TALENickase editing tools, the anti-human PD1 scFv sequence was site-directedly integrated into the rDNA region. Taking the targeting vector corresponding to the B2M locus as an example, the main components and the site-directed integration process are shown in Figure 1. The main components of the rDNA region anti-human PD1 scFv targeting vector and the combined site-directed integration process are shown in Figure 2. A 1531 bp sequence from site 4533 upstream to site 6064 downstream of site 5468 in the human rDNA transcription region was used as the homologous arm sequence. The upstream homologous arm is 935 bp long, and the downstream homologous arm is 596 bp long. The two homologous arms contain the screening gene NEO to assist in the screening of site-specific integration clones (see existing literature: Targeting of the IL24 gene in the ribosomal gene region of human iPSCs and its anti-tumor effect on differentiated MSCs, Liu Bo, graduation thesis, Central South University, 2017: 19-25; the TALENickase editing tools in the specific embodiments of this invention are all constructed with reference to this existing literature). In this embodiment, the targeting vector sequences were all synthesized by Sangon Biotech (i.e., Sangon Biotech (Shanghai) Co., Ltd.), and the endotoxin-free target plasmid was obtained for subsequent experiments.

[0137] Suitable sgRNAs were selected, and approximately 600 bp sequences upstream and downstream of the PAM site were taken as the upstream and downstream homologous arms, respectively. aPD1 scFv is driven by the EF1α promoter, and a FLAG tag was added for detection.

[0138] The nucleotide sequence of the sgRNA used in the CRISPR / Cas9 gene editing tool in a specific embodiment of the present invention is as follows:

[0139] AAVS1 sgRNA:GTCCCCTCCACCCCACAGTG

[0140] B2M sgRNA:GGCCGAGATGTCTCGCTCCG

[0141] CCR5 sgRNA:GACTATGCTCGCCGCCCAGT

[0142] CIITA sgRNA:GAGATTGAGCTCTACTCAGG

[0143] The corresponding sgRNA was ligated into the PX330 plasmid (from Addgene) to form a CRISPR / Cas9 gene editing tool plasmid targeting each site.

[0144] The homologous arm nucleotide sequences of the different site-targeting vectors involved in this embodiment are as follows:

[0145] The nucleotide sequence of AAVS1 LHA is shown in SEQ ID NO:1;

[0146] The nucleotide sequence of AAVS1 RHA is shown in SEQ ID NO:2;

[0147] The nucleotide sequence of B2M LHA is shown in SEQ ID NO:3;

[0148] The nucleotide sequence of B2M RHA is shown in SEQ ID NO:4;

[0149] The nucleotide sequence of CCR5 LHA is shown in SEQ ID NO:5;

[0150] The nucleotide sequence of CCR5 RHA is shown in SEQ ID NO:6;

[0151] The nucleotide sequence of CIITA LHA is shown in SEQ ID NO:7;

[0152] The nucleotide sequence of CIITA RHA is shown in SEQ ID NO:8;

[0153] The homologous arm nucleotide sequences of the rDNA region targeting vector are as follows:

[0154] The nucleotide sequence of rDNA LHA is shown in SEQ ID NO:9;

[0155] The nucleotide sequence of rDNA RHA is shown in SEQ ID NO:10;

[0156] The amino acid sequence of the heavy chain variable region of αPD1 scFv (derived from WO2018 / 020476 A1) used in the specific embodiments of the present invention is shown in SEQ ID NO:11; the amino acid sequence of the hinge region is shown in SEQ ID NO:12; and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:13.

[0157] The heavy chain variable region nucleotide sequence of αPD1 scFv (derived from WO2018 / 020476 A1) used in specific embodiments of the present invention is shown in SEQ ID NO:14. The hinge region nucleotide sequence is shown in SEQ ID NO:15; and the light chain variable region nucleotide sequence is shown in SEQ ID NO:16.

[0158] The amino acid sequence of the FLAG tag is shown in SEQ ID NO:17;

[0159] The FLAG-tagged nucleotide sequence is shown in SEQ ID NO:18.

[0160] SP is the signal sequence, and its amino acid sequence is shown in SEQ ID NO:19;

[0161] The nucleotide sequence of the SP signal sequence is shown in SEQ ID NO:20.

[0162] 2. Nuclear-transfer iPSCs carrying anti-PD1 scFv targeting vectors

[0163] The nuclear transfer methods for the AAVS1, B2M, CCR5, CIITA, and rDNA regions are as follows:

[0164] (1) Inoculate healthy iPSCs into Matrigel (Corning) coated 6-well plates and use mTeSR TM Plus culture, change the medium daily;

[0165] (2) When the cell confluence reaches 80%-90%, prepare for targeting. Two hours before targeting, replace the cells with mTeSR containing 10 μM Y-27632 (Stem Cell). TM Add medium and place in an incubator for further incubation;

[0166] (3) After changing the medium for 2 hours, discard the culture medium, add 1 mL of DPBS to gently rinse, repeat twice, and then add 1 mL of TrypLE. TM Express, place in an incubator at 37°C for 3 minutes to digest;

[0167] (4) Discard the digestion fluid, blow the cells into a single-cell suspension using culture medium, collect them in a 15mL centrifuge tube, count them using a hemocytometer, take a suspension containing 1 million cells based on the count concentration, centrifuge at 1000rpm at room temperature for 5min, and prepare for nuclear transfer.

[0168] (5) Simultaneously prepare the ThermoFisher Neon nuclear transfer instrument and Neon TMFor the transfection system 100μL kit (ThermoFisher, #MPK10096), install the nuclear transfection tube into the base, add 3ml of buffer E2, and select program 14 for later use;

[0169] (6) Resuspend the centrifuged cells in 100 μL buffer R and transfer them to a sterile EP tube. Add the plasmid to be transfected and mix well in the EP tube for later use.

[0170] (7) Take out the pipette and tip that come with the kit, push the pipette to the bottom, insert the tip tightly, and then draw 100 μL of the mixed cell plasmid suspension.

[0171] (8) Insert the pipette and tip into the nuclear transfer tube and secure it. Click "Start" to perform nuclear transfer.

[0172] (9) Take out the pipette and tip, slowly drip the cell suspension into the culture medium, add Y-27632 to the well plate with a final concentration of 10 μM, gently shake the cells, and put them into the incubator for culture.

[0173] (10) Cells after nuclear transfer were used with mTeSR TM Plus (Stemcell, #05825) cultured with daily medium changes;

[0174] (11) After the cells have proliferated normally, discard the culture medium, add 1 mL of DPBS to gently wash, repeat twice, and then add 1 mL of TrypLE. TM Express (Gibco, #12604-021), digested in an incubator at 37°C for 3 minutes;

[0175] (12) Discard the digestion fluid, blow the cells into a single-cell suspension using the culture medium, collect them into a 15mL centrifuge tube, count them using a hemocytometer, take an appropriate amount of cell suspension according to the concentration counted, centrifuge at 1000rpm at room temperature for 5min, and take 300 cells to prepare for single-cell inoculation.

[0176] (13) Seed cells in a 6cm dish pre-coated with Matrigel, add 3mL Clone R (Stemcell, #05888) medium, gently shake the cells, and incubate in an incubator.

[0177] (14) After approximately 6-8 days of culture, when the single-cell clones have grown to the size of a 10x microscope field of view, use a small tip to separate the clones into small pieces and aspirate them into 48-well plates pre-coated with Matrigel. When the selected single clones reach 80%-90% confluence, subculture and amplify them, extracting DNA to identify the site-specific integration of the single clones. Positive clones are expanded and cultured for further experiments and then cryopreserved. iPS gDNA extraction was performed according to the instructions of the genomic DNA extraction kit (Novizan, #DC112-01).

[0178] 3. Identification of nuclear-transformed iPSCs monoclonal antibodies by PCR

[0179] 3.1 PCR identification across upstream and downstream homologous arms

[0180] (1) Using extracted iPSCs monoclonal gDNA as templates, PCR amplification was performed using primers LHA-F / R across the upstream homologous arm region and primers RHA-F / R across the downstream homologous arm region. For AAVS1, B2M, CCR5, and CIITA, if it is a monoclonal clone with site-directed integration, a product of approximately 1100 bp in length can be amplified by PCR. For rDNA regions, if it is a monoclonal clone with site-directed integration, a product of approximately 1600 bp in length can be amplified by PCR.

[0181] The primer nucleotide sequences used in the embodiments of this invention are as follows:

[0182] AAVS1 LHA-F: gccattgtcactttgcgctgc (SEQ ID NO: 21)

[0183] AAVS1 LHA-R:gggaaccacacacggcacttac (SEQ ID NO:22)

[0184] AAVS1 RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO: 23)

[0185] AAVS1 RHA-R: ggcatgagatggtggacgagg (SEQ ID NO: 24)

[0186] B2M LHA-F: tagagggcgctggaagctctaa (SEQ ID NO: 25)

[0187] B2M LHA-R:gggaaccacacacggcacttac (SEQ ID NO:22)

[0188] B2M RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO:23)

[0189] B2M RHA-R: gcaaagcacataaagtccttggcac (SEQ ID NO:26)

[0190] CCR5 LHA-F: aattagcttggtgtggtggcg (SEQ ID NO:27)

[0191] CCR5 LHA-R: gggaaccacacacggcacttac (SEQ ID NO:22)

[0192] CCR5 RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO:23)

[0193] CCR5 RHA-R: gtccgtgtcacaagcccaca (SEQ ID NO:28)

[0194] CIITA LHA-F: gtcaggatatttgaggtatccacatttggg (SEQ ID NO:29)

[0195] CIITA LHA-R: gggaaccacacacggcacttac (SEQ ID NO:22)

[0196] CIITA RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO:23)

[0197] CIITA RHA-R: gggtaggtcgtttcacctctctaaacc (SEQ ID NO:30)

[0198] rDNA LHA-F: cctgagaaacggctaccaca (SEQ ID NO:31)

[0199] rDNA LHA-R: gaactgcttccttcacgacat (SEQ ID NO:32)

[0200] (2) The PCR system is as shown in Table 1:

[0201] Table 1 PCR System

[0202] (3) PCR cycling conditions:

[0203] (4) Perform agarose gel electrophoresis on the PCR products and observe whether there is a target band;

[0204] (5) Select cells with the target band identified upstream, repeat the PCR process, and send the product for sequencing.

[0205] Ninety-six iPSC clones were selected from each of the AAVS1, B2M, CCR5, and CIITA sites for amplification and genomic DNA (gDNA) extraction. PCR amplification and identification were performed using primers LHA-F / R across the upstream homologous arm and RHA-F / R across the downstream homologous arm. In the rDNA region targeting experiment, ten G418 resistant clones were selected, five of which produced fragments approximately 1600 bp in size (Figure 3). Sequencing of the PCR products with the correct fragment size confirmed that the product sequences were consistent with expectations (Figure 5), confirming successful site-directed integration and yielding five rDNA αPD1 iPSCs. However, PCR identification of the iPSC clones from the AAVS1, CCR5, and CIITA sites confirmed that none of them yielded iPSC clones with site-directed integration of anti-PD1 scFv. Two iPSC clones from the B2M site were amplified by PCR, producing products of the appropriate size (Figure 4). Sequencing confirmed that the product sequences matched the theoretical sequences (Figure 6). Two site-directedly integrated B2M-anti-PD1 scFv iPSCs were identified by PCR, and their clonal morphology is shown in Figure 7. The two iPSCs were named αPD1 iPSC-1 and αPD1 iPSC-2. Thus, under the same operating conditions, the gene expressing anti-PD1 scFv was not integrated into the AAVS1, CCR5, and CIITA sites, while the B2M site and rDNA region were successfully integrated.

[0206] 3.2 Western Blot detection of αPD1-FLAG protein expression levels in rDNA αPD1 iPSCs and B2M αPD1 iPSCs

[0207] (1) Collect iPSCs, add 100 μL of cell lysis buffer, and lyse on ice for 30 min;

[0208] (2) After lysis, the cell lysis buffer was transferred to an EP tube and sonicated on ice; centrifuged at 12000g for 10 min at 4℃.

[0209] (3) Transfer the supernatant after centrifugation to a new EP tube, and then use Thermo Pierce tubes. TM BCA Protein Assay Kit for BCA protein quantification;

[0210] (4) Preparation of SDS-PAGE gel: 12% separating gel and 4% stacking gel were prepared using the SDS-PAGE gel rapid preparation kit from Beyotime.

[0211] (5) Sample loading: Place the prepared SDS-PAGE gel in the electrophoresis tank and add fresh 1× running buffer to the electrophoresis tank. Add the prepared protein samples to the wells in order; run at a constant current of 80V for 30min, and then at 120V for 60min.

[0212] (6) Transfer: Prepare 1×transfer buffer in advance and pre-cool it in a -20℃ refrigerator. Cut off the stacking gel, measure the length and width of the separating gel, cut out PVDF membranes of the same size with a ruler, soak them in methanol for 5 min, and then place them in the transfer buffer for equilibration for 20 min. Then follow the "sandwich sequence": black tank end: sponge pad + filter paper + separating gel + membrane + filter paper + sponge pad: red tank end. The entire operation is carried out in the transfer buffer, and air bubbles are constantly removed; constant pressure 252mA for 90 min. This process is carried out on ice.

[0213] (7) Sealing: After the transfer is completed, the membrane is immersed in TBST from top to bottom and then transferred to 5% skim milk and sealed on a shaker for 1 hour;

[0214] (8) Antibody incubation: Dilute the primary antibody with TBST or 5% skim milk powder to an appropriate concentration, pour it into a small box, incubate overnight at 4°C, and wash 3 times with TBST at room temperature using a shaker for 10 minutes each time;

[0215] (9) Remove the primary antibody, add the secondary antibody to the box, incubate on a shaker for 1 hour, wash 3 times with TBST for 10 minutes each time, and then develop.

[0216] The imaging results are shown in Figure 8. No aPD1-FLAG protein expression was detected in the cell lysates of any of the five site-specific integration clones of rDNAαPD1 iPSCs. Significant aPD1-FLAG protein secretion was detected in the cell lysates of the two site-specific integration clones of B2M aPD1 iPSCs. Furthermore, the intracellular aPD1-FLAG protein expression level of B2M aPD1 iPSC-1 was higher than that of B2M aPD1 iPSC-2. Therefore, although the gene expressing anti-PD1 scFv was successfully integrated into the rDNA region, the rDNA region itself could not express aPD1-FLAG protein, and no protein expression was observed. In contrast, the B2M site showed both successful site-specific integration and significant protein expression.

[0217] The experimental results above show that the B2M locus has a significant advantage in integration and expression compared to other sites for PD1 inhibitor expression. Based on this, in order to obtain engineered cells with enhanced tumor-killing capabilities, the inventors of this application, through the following embodiments, simultaneously targeted a second secretory protein that assists PD1 inhibitors in enhancing tumor-killing performance, thereby obtaining mesenchymal stem cells with enhanced tumor-killing capabilities.

[0218] Example 2: Construction of a therapeutic factor targeting vector (in this specific embodiment of the invention, "targeting vector" is also referred to as "plasmid")

[0219] In a specific embodiment of the present invention, the structure of the therapeutic factor expression cassette is designed as promoter-signal peptide-target gene-polyA (as shown in Figure 9), wherein each part adopts a known sequence disclosed in the prior art. Based on the experimental results of Example 1, a corresponding targeting vector is constructed using the B2M locus. Using a CRISPR / Cas9 gene editing tool (purchased from Genscript Biotech Co., Ltd., Z03702), the polynucleotide sequences expressing one or two therapeutic factors are site-directedly integrated into the B2M site, as shown in Figure 10. Specifically, the therapeutic factor expression cassettes in this embodiment have nucleotide sequences as shown in SEQ ID NO:33-41, wherein SEQ ID NO:33 is the nucleotide sequence of the α-PD1-scFv expression cassette, SEQ ID NO:34 is the nucleotide sequence of the IL-24 expression cassette, SEQ ID NO:35 is the nucleotide sequence of the α-PD1-scFv-IL24 expression cassette, SEQ ID NO:36 is the nucleotide sequence of the WT-IL-2 expression cassette, SEQ ID NO:37 is the nucleotide sequence of the IL-2v expression cassette, SEQ ID NO:38 is the nucleotide sequence of the α-PD1-scFv-WT-IL-2 expression cassette, SEQ ID NO:39 is the nucleotide sequence of the α-PD1-scFv-IL-2v expression cassette, SEQ ID NO:40 is the nucleotide sequence of the α-VEGF-scFv expression cassette, and SEQ ID NO:41 is the nucleotide sequence of the α-PD1-scFv-a-VEGF-scFv expression cassette. More specifically, the EF1α promoter nucleotide sequence is shown in SEQ ID NO:42. The CMV promoter nucleotide sequence is shown in SEQ ID NO:43. The CAG promoter nucleotide sequence is shown in SEQ ID NO:44. The signal peptide amino acid sequence is shown in SEQ ID NO:45 (SP1) and SEQ ID NO:47 (SP3), and the nucleotide sequence is shown in SEQ ID NO:46 (SP1) and SEQ ID NO:48 (SP3). The PD1 antibody scFv (α-PD1-scFv) sequence is preferably derived from Keytruda, with the heavy chain variable region amino acid sequence shown in SEQ ID NO:49 and the nucleotide sequence shown in SEQ ID NO:52; the hinge region amino acid sequence shown in SEQ ID NO:50 and the nucleotide sequence shown in SEQ ID NO:53; and the light chain variable region amino acid sequence shown in SEQ ID NO:51 and the nucleotide sequence shown in SEQ ID NO:54. The IL-24 amino acid sequence is shown in SEQ ID NO:55 and the nucleotide sequence is shown in SEQ ID NO:56. The wild-type IL-2 (WT-IL-2) amino acid sequence is shown in SEQ ID NO:57 and the nucleotide sequence is shown in SEQ ID NO:58.The amino acid sequence of the IL-2 variant (IL-2v) is shown in SEQ ID NO:59, and the nucleotide sequence is shown in SEQ ID NO:60. The VEGF antibody scFv (α-VEGF-scFv) sequence is derived from Bevacizumab. The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:61, and the nucleotide sequence is shown in SEQ ID NO:64; the amino acid sequence of the hinge region is shown in SEQ ID NO:62, and the nucleotide sequence is shown in SEQ ID NO:65; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:63, and the nucleotide sequence is shown in SEQ ID NO:66. For convenient detection, α-PD1-scFv is coupled with a Flag tag, which is the same as in Example 1. α-VEGF-scFv is coupled with a His tag, the amino acid sequence of which is shown in SEQ ID NO:67, and the nucleotide sequence is shown in SEQ ID NO:68. All the above sequences are from Beijing Qingke Biotechnology Co., Ltd. The therapeutic factor expression cassette sequence was ligated to the pre-synthesized B2M site homologous arm backbone via homologous recombination using enzyme digestion. (The B2M targeting vector homologous arm was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the nucleotide sequence of the synthesized B2M homologous arm backbone was the same as that in Example 1.) The vector was transformed into E. coli, and positive clones were obtained by ampicillin screening.

[0220] Example 3: Targeting vector transiently transfected into 293T cells for expression.

[0221] 1. Endotoxin-free plasmid extraction: The targeting vector plasmid was extracted using the OMEGA EZNA Endo-free Plasmid mini Kit II (catalog number: D6950). The specific extraction steps were performed in accordance with the kit instructions.

[0222] 2. Transfection of 293T cells

[0223] (1) Digest cells with trypsin and count them. Take 180,000 cells and seed them into 24-well plates. Add 500 μl of culture medium and allow them to reach 60%-80% confluence after 24 hours.

[0224] (2) The transfection reagent was Polyplus. Transfection reagent (catalog number: 1011000046), according to the instructions, resuspend 250 ng plasmid in 50 μl buffer, mix well, and then add 1 μl. After mixing the reagent, let it stand at room temperature for 15 minutes.

[0225] (3) Add the above mixture dropwise into the cell culture system evenly.

[0226] (4) After incubating at 37℃, 5% CO2, and 100% saturated humidity for 12 hours, replace with 293T complete medium and continue culturing. Collect cells for Western blot or ELISA 48 hours after transfection to detect the expression of therapeutic factors.

[0227] 3. Western blot analysis of protein expression in the culture supernatant of therapeutic factor cell lysate.

[0228] (1) Collect 293T cells, add 100 μL of cell lysis buffer, and lyse on ice for 30 min;

[0229] (2) After lysis, the cell lysis buffer was transferred to an EP tube and sonicated on ice; centrifuged at 12000g for 10 min at 4℃.

[0230] (3) Transfer the supernatant after centrifugation to a new EP tube, and then use Thermo Pierce tubes. TM BCA Protein Assay Kit for BCA protein quantification;

[0231] (4) Protein loading using precast gel (FuturePAGE) TM Protein precast gel (ACE, ET12012Gel). Prepare fresh 1× running buffer by mixing the running buffer powder provided with the gel with 1L ddH2O, add it to the electrophoresis tank, and add the prepared protein samples to the wells in sequence; run at a constant current of 100V for 90 minutes.

[0232] (6) Transfer: Prepare 1×transfer buffer in advance and pre-cool it in a -20℃ refrigerator. Cut off the stacking gel, measure the length and width of the separating gel, cut out PVDF membranes of the same size with a ruler, soak them in methanol for 5 min, and then place them in the transfer buffer for equilibration for 20 min. Then follow the "sandwich sequence": black tank end: sponge pad + filter paper + separating gel + membrane + filter paper + sponge pad: red tank end. The entire operation is carried out in the transfer buffer, and air bubbles are constantly removed; constant pressure 252mA for 90 min. This process is carried out on ice.

[0233] (7) Sealing: After the transfer is completed, the membrane is immersed in TBST from top to bottom and then transferred to 5% skim milk and sealed on a shaker for 1 hour;

[0234] (8) Antibody incubation: Dilute the primary antibody with TBST or 5% skim milk powder to an appropriate concentration, pour it into a small box, incubate overnight at 4°C, and wash 3 times with TBST at room temperature using a shaker for 10 minutes each time;

[0235] (9) Remove the primary antibody, add the secondary antibody to the box, incubate on a shaker for 1 hour, wash 3 times with TBST for 10 minutes each time, and then develop.

[0236] The primary antibody catalog numbers used are shown in the table below:

[0237] The results are shown in Figures 11-13. Specifically, as shown in Figure 11, a specific band of α-PD1-scFv-FLAG (theoretical size 29KD) was detected in both the culture supernatant and cell lysate. Furthermore, the protein content in the supernatant significantly increased after the addition of the signal peptide, with the SP3 signal peptide showing the highest level. This demonstrates that the α-PD1-scFv-FLAG plasmid expression cassette works well. As shown in Figure 12, a specific band of IL24 (theoretical size 24KD; the specific band around 35KD is theoretically a multimer) was detected in both the culture supernatant and cell lysate. Furthermore, the protein content in the supernatant significantly increased after the addition of the SP1 signal peptide, demonstrating that the IL24 plasmid expression cassette works well. As shown in Figure 13A, a specific band of IL-2 (theoretical size 15.5KD) was detected in both the culture supernatant and cell lysate. Furthermore, the protein content in the supernatant significantly increased after the addition of the SP1 signal peptide, demonstrating that the IL2 plasmid expression cassette works well. No suitable Western blot antibody was found for α-VEGF-scFv-His expression, and its expression results were presented by QP and ELISA.

[0238] 4. ELISA detection of protein expression in the culture supernatant of therapeutic factors

[0239] The amount of IL-2 protein in the culture supernatant was detected using an ELISA kit (Human IL-2 ELISA Kit, KIT11848, Sino Biological), and the specific operation steps were performed exactly according to the ELISA kit instructions. The results are shown in Figure 13B, where the amount of IL-2 protein produced by cells transfected in a 12-well plate was 90 ng 24-48 hours later.

[0240] The amount of His tag (α-VEGF-scFv coupled with His tag protein) in the culture supernatant was detected using an ELISA kit (His Tag ELISA Detection Kit, L00436, GenScript Biotech). The specific operation steps were performed exactly according to the ELISA kit instructions. The results are shown in Figure 14B. In the specific implementation of this application, the code 1002 represents α-PD1-scFv. The amount of α-VEGF-scFv protein produced 24-48 hours after transfection of cells with α-VEGF-scFv and α-PD1-scFv-α-VEGF-scFv in a 12-well plate was 228 ng and 137 ng, respectively.

[0241] 5. RT-qPCR detection of therapeutic factor transcription

[0242] (1) Extraction of total RNA from cells

[0243] ① After discarding the culture medium, wash the cells twice with 1×DPBS. Add 500μL of Trizol Reagent to each well to lyse the cells. Mix the cell lysis buffer with a 1mL pipette tip and transfer it to an RNase-free 1.5mL centrifuge tube. Place the tube in an ice-water mixture. If extraction is not performed immediately, transfer the tube to a -80℃ ultra-low temperature freezer immediately.

[0244] ② Add 250 μL of chloroform to each sample and mix vigorously by inverting. Let stand in an ice-water mixture for 5 min, then centrifuge at 13000 g for 10 min at 4 °C. The liquid will separate into layers; gently collect the upper aqueous phase.

[0245] ③ Add 200 μL of pre-cooled isopropanol and gently vortex to mix. After standing in the ice-water mixture for 10 min, centrifuge at 13000g for 10 min at 4℃. The white precipitate at the bottom of the tube is RNA.

[0246] ④ Carefully aspirate the supernatant, add 500 μL of pre-cooled 0.1% DEPC water to each sample to prepare 75% ethanol, gently vortex to mix and wash the RNA, then centrifuge at 13000g for 5 min at 4°C.

[0247] ⑤ Carefully aspirate the supernatant, open the lid and let it stand in a clean bench at room temperature (25℃) for 15-20 minutes to allow the RNA precipitate to dry naturally. After the RNA becomes transparent, add 20-50 μL of RNase-free water to dissolve the RNA.

[0248] ⑥ After measuring the OD value of the RNA, store it at -80℃.

[0249] (2) RNA reversal

[0250] Prepare unopened 200μL PCR tubes, 100μL, 20μL, and 10μL pipette tips, disposable sterile latex gloves, nuclease-free water, and an ice box. After spraying the surface with alcohol, sterilize the tubes under UV light in a laminar flow hood for 30 minutes. RNA reverse transcription is then performed. IIQ-RT SuperMix-for qPCR kit (purchased from Novizan, R223-01). Follow the kit instructions for reversal procedures. The reversal amount is 1 μg. Dilute the reversed cDNA product 5-fold with Nuclease-Free Water. It can be used directly for RT-qPCR reactions or stored at -20°C for 3 months.

[0251] (3) RT-qPCR

[0252] The transcription of α-VEGF-scFv in cells was detected, with GAPDH as an internal reference gene. The primer sequences are shown in the table below.

[0253] The cDNA obtained in the previous step was used as a template. The assay was prepared according to the instructions of the Novizan ChamQ Universal SYBR qPCR Master Mix (Q711) kit and detected on a BioRad CFX.

[0254] The qPCR system was prepared as follows:

[0255] The results are shown in Figure 14A. The a-VEGF-scFv plasmid expression cassette can successfully transcribe α-PD1-scFv. Combined with the results of ELISA detection, this indicates that the α-PD1-scFv plasmid expression cassette works well.

[0256] Example 4: Targeting vector nuclear transfection of human iPSCs single cells

[0257] 1. Nuclear transfer at the B2M site

[0258] Single-cell nuclear transfer of iPSCs was performed using Thermo's Neon™ Transfection kit.

[0259] (1) Two hours before nuclear transformation, replace the iPSCs culture wells with fresh mTeSR-Plus (purchased from STEMCELL, catalog number: 100-0276) medium and add 10 μM Y27632.

[0260] (2) Discard the mTeSR-Plus medium, add an appropriate amount of TrypLE Select enzyme (purchased from Thermo Fisher, catalog number: 12563029), digest the cells at 37℃ for 5 minutes, observe that the cells become round and gradually fall off, discard the TrypLE Select, and add 3-5 mL of mTeSR-Plus medium.

[0261] (3) Use a large tip to blow off the detached cells and resuspend them into a single-cell suspension. After counting the cells, centrifuge at 90g for 5 minutes at room temperature.

[0262] (4) After aspirating the supernatant, resuspend the cells in 1×DPBS, and then fold the cells at a density of 1.5×10⁻⁶. 6 The number of iPSCs in each tube was aliquoted into 15mL centrifuge tubes and centrifuged again.

[0263] (5) While centrifuging, prepare Cas9-RNP by adding 16.7 μl buffer R and 1 μl Cas9 protein (25 pmol) (purchased from Genscript Biotech Co., Ltd., catalog number: Z03702) and 2.3 μl sgRNA (50 pmol) (synthesized by Genscript Biotech Co., Ltd., with the same sequence as B2M sgRNA in Example 1) to a 1.5 mL EP tube, and incubate at 37 °C for 15 minutes to form RNP.

[0264] (6) Discard the 1×DPBS supernatant in the centrifuge tube, resuspend the iPSCs in 100μl buffer R, mix with RNP, and then add 4μg nuclear transplasmid (the targeting vector synthesized in Example 2) and mix well.

[0265] (7) The transfer procedure 14 is carried out.

[0266] (8) The nuclear-transformed iPSCs were inoculated into well plates pre-coated with Matrigel (from Corning, catalog number: 354277) and 10 μM Y27632 (from STEMCELL, catalog number: #72304) was added. After mixing in a cross shape, the plates were placed in a 37°C, 5% CO2 saturated humidity incubator and cultured in mTesR-Plus medium.

[0267] (9) Replace the culture medium with fresh medium and add 10 μM Y27632 12 h after nuclear transformation, and observe the cell adhesion under a microscope. Then replace the culture medium with fresh medium every day.

[0268] 2. Single-cell seeding and selection of monoclonal cells

[0269] (1) Seed cells as single cells and pick positive clones. Specifically, first digest the cells with 1-2 mL of TrypLE Select enzyme at room temperature for 5 minutes. When the cells become round and gradually fall off under a microscope, discard the TrypLE Select.

[0270] (2) Add 3-5 mL of mTesR-Plus medium, use a large tip to blow off the detached cells and resuspend them into a single-cell suspension, count the cells and centrifuge at 90 g for 5 min at room temperature.

[0271] (3) Take 1000 cells and seed them in a 6cm dish pre-coated with Matrigel. Incubate with 3mL of mTesR-Plus containing 10% CloneR additive (purchased from STEMCELL, catalog number: #05888). Subsequent medium changes should be performed according to the CloneR instructions.

[0272] (4) Single-cell clones in a 6cm dish were mechanically picked up with a small tip and inoculated into a 48-well plate pre-coated with Matrigel. The plates were cultured in mTesR-Plus medium, shaken well, and then placed in a 37℃, 5% CO2 saturated humidity incubator.

[0273] (5) After culturing single-cell clones for 4-5 days, transfer them from the 48-well plate to two wells of the 48-well plate. One well is used for cell expansion culture, and the other well is used for crude cell lysis for subsequent identification.

[0274] 3. Cloning identification

[0275] (1) Crude cell lysis

[0276] Prepare a 20 mL crude cell lysis buffer by adding 2 mL of 1 M Tris-HCl (pH = 8.2), 0.2 mL of Triton-x100, and 18.8 mL of H2O, and add proteinase K at a 1:100 ratio. After collecting the cells, wash once with DPBS and discard the supernatant. Resuspend the cells in 50 μL of the lysis buffer and lyse overnight at 56 °C. Then heat at 95 °C for 10 min to inactivate proteinase K.

[0277] (2) PCR identification of single-cell clones

[0278] PCR amplification and identification were performed using primers spanning the upstream and downstream homologous arm regions. A positive clone would show a band approximately 1 bp upstream or downstream. Simultaneously, B2M-F and B2M-R primers were designed approximately 200 bp before and after the cleavage site to identify site-specific integration in positive clones. Single-copy integration would show a 460 bp band, while double-copy integration would not. Further sequencing of this band could determine the editing status of unintegrated copies at that site.

[0279] The primer sequences used are shown in Table 2:

[0280] Table 2 Primer sequences

[0281] Single-clonal PCR amplification and identification were performed using primers spanning upstream and downstream homologous arms as shown in Table 2. The identification results are shown in Figures 15-23. Specifically, as shown in Figure 15, α-PD1-scFv had four positive PCR results in both upstream and downstream regions: 44, 56, 61, and 87, of which 44, 61, and 87 were single copies, and 56 was a double copy. As shown in Figure 16, IL24 had three positive PCR results in both upstream and downstream regions: 30, 33, and 44 were single copies. As shown in Figure 17, α-PD1-scFv-IL24 had two positive PCR results in both upstream and downstream regions: 22 and 35 were single copies. As shown in Figure 18, WT-IL-2 had six positive PCR results in both upstream and downstream regions: 13, 15, 46, 89, 90, and 95 were single copies. As shown in Figure 19, IL-2v had two positive PCR results in both upstream and downstream regions: 2 and 114 were single copies. As shown in Figure 20, α-PD1-scFv-WT-IL-2 had 5 positive PCR results for both upstream and downstream sequences, with clones 15, 25, 35, 45, and 46 being single copies. As shown in Figure 21, α-PD1-scFv-IL2v had 2 positive PCR results for both upstream and downstream sequences, with clones 13 and 114 being single copies. As shown in Figure 22, α-VEGF-scFv had 3 positive PCR results for both upstream and downstream sequences, with clones 21, 23, and 34 being single copies. As shown in Figure 23, α-PD1-scFv-α-VEGF-scFv had 3 positive PCR results for both upstream and downstream sequences, with clones 19, 20, and 44 being single copies. The upstream and downstream sequencing results are shown in Figure 24, with the sequencing results of one single clone from each cell line presented. The results show that the upstream and downstream sequences of the identified positive clones were correctly sequenced. The sequencing results of the B2M site are shown in Figure 25. Except for one cell with 23 bases knocked out and one cell with T bases knocked out, most cells were edited with T insertion, indicating that the B2M site of the selected cells was completely destroyed and no longer expressed functional B2M protein.

[0282] Example 5: Site-directed integration clone induction and differentiation into iMSCs and characterization

[0283] 1. Site-directed integration of clones to induce differentiation into iMSCs

[0284] According to STEMDiff of STEMCELL Technology TMUsing the Mesenchymal Progenitor Kit (Catalog #05240), site-integrated iPSC clones were directed to differentiate into iMSCs according to the methods described in the instruction manual. The differentiation process was performed according to the methods described in the instruction manual.

[0285] After differentiation, all clones exhibited typical characteristics of MSCs, including cell growth morphology and surface markers. All iMSCs showed a fibroblast-like morphology, exhibiting a distinct fingerprint-like spiral distribution trend when they merged (as shown in Figure 26). Flow cytometry analysis of the surface markers in all iMSCs revealed that their cell surface markers were CD44+, CD73+, CD90+, CD105+, and CD34- / CD45- / HLA-DR-, consistent with the characteristics of tissue-derived MSCs and meeting the ISCT identification criteria (as shown in Figure 27).

[0286] 2. Identification of factor secretion levels in iMSCs plasmids

[0287] Cells were Tryple digested, counted to 100,000, and then seeded into 6cm dishes pre-coated with gelatin. After 24 hours of culture, the supernatant was collected and centrifuged at 13000g for 20 minutes at 4°C to remove dead cells and cell debris, thus avoiding false positives. All target proteins were detected according to the corresponding kit steps, as shown in the table below:

[0288] The results are shown in Figures 28-31. All iMSCs successfully secreted the corresponding therapeutic factors. Specifically, as shown in Figure 28, all iMSCs containing αPD1-scFv, including αPD1-scFv, αPD1-scFv-IL24, αPD1-scFv-WT-IL-2, αPD1-scFv-IL-2v, and αPD1-scFv-α-VEGF-scFv, successfully secreted αPD1-scFv. The secretion amount per 100,000 cells over 24 hours ranged from 3.6 μg to 8.2 μg, while blank iMSCs did not secrete any. As shown in Figure 29, all iMSCs containing IL-24, including IL-24 and αPD1-scFv-IL24, successfully secreted IL-24. The secretion amount per 100,000 cells over 24 hours was around 40 ng, while blank iMSCs secreted almost nothing. As shown in Figure 30, all iMSCs containing IL-2 (including WT-IL-2 and IL-2v), including WT-IL-2, IL-2v, αPD1-scFv-WT-IL-2, and αPD1-scFv-IL-2v, successfully secreted IL-2, with the secretion amount per 100,000 cells ranging from 1.5 to 3.5 ng over 24 hours. As shown in Figure 31, all iMSCs containing α-VEGF-scFv, including α-VEGF-scFv and αPD1-scFv-α-VEGF-scFv, successfully secreted α-VEGF-scFv, with the secretion amount per 100,000 cells being approximately 1 μg over 24 hours.

[0289] In this invention, the polynucleotides expressing secretory proteins are all targeted into the genome of target cells via site-directed integration. The integration site of the second secretory protein is not particularly limited; its expression level only needs to be sufficient to assist PD1 inhibitors in enhancing the tumor-killing ability of engineered cells. The second secretory protein is selected from immune checkpoint inhibitors, interleukins, tumor necrosis factor, growth factor inhibitors, interferons, or TNF-α inhibitors. In some embodiments of this application, IL-24 (also known as IL24, interleukin 24), wild-type IL-2 (WT-IL-2), mutant IL-2 (IL-2v), and vascular endothelial growth factor antibody (α-VEGF) were used as the second secretory proteins in experiments, and mesenchymal stem cells with enhanced tumor-killing properties were constructed in all cases. In this embodiment, the second secretory protein was targeted into the B2M locus along with αPD1-scFv, but it can also be targeted into other optional integration sites that can achieve the expression level required by this invention.

[0290] Example 6: Validation of the antitumor function of α-PD1-scFv combined with IL-24

[0291] 1. In vitro experimental verification

[0292] (1) PBMC separation

[0293] ① Take freshly drawn peripheral blood into a 50mL tube, add an equal volume of 1×DPBS to dilute and mix well.

[0294] ② Take a 50mL centrifuge tube, add 20mL of separation solution (10771, Sigma), and then slowly add 20mL of peripheral blood diluent along the wall.

[0295] ③ After centrifugation, discard the first plasma layer and transfer the second milky white lymphocyte layer into a new 15mL centrifuge tube.

[0296] ④ Add 1×DPBS to 12mL of lymphocytes, mix the cells, and centrifuge at 300g for 10min at room temperature (25℃). Wash twice.

[0297] ⑤ Aspirate the supernatant, add 3 mL of erythrocyte lysis buffer (C3702, Shanghai Beyotime Biotechnology Co., Ltd.) to the tube, disperse the cells and mix well, incubate at room temperature.

[0298] ⑥ After standing for 10 minutes, add 10 mL of 1×DPBS and centrifuge at 300 g for 10 minutes at room temperature (25℃).

[0299] ⑦ Discard the supernatant, add 3-4 mL of 1640 medium and gently mix the cells (take 10 μL for cell counting).

[0300] ⑧ Inoculate into a 10cm dish, add 1640 medium to 10mL and mix well, then incubate in an incubator.

[0301] ⑨ After 24 hours, count the cells and add CD3 / CD28 magnetic beads (11131D, Thermo Fisher Scientific (China) Co., Ltd.) at a cell:magnetic bead ratio of 10:1 to activate the cells. Supplement with IL-2 (H7041, Sigma Aldrich) to a final concentration of 100 IU / ml. After 72 hours of activation, use the cells for co-culture.

[0302] (2) Tumor cell markers

[0303] Using CellTrace TM Violet (C34557, Thermo Fisher Scientific (China) Co., Ltd.) is used for fluorescent labeling of tumors. This dye is a stable intracellular dye that can remain in cells for a very long time. Tumor cells can be distinguished in co-culture systems by dye labeling.

[0304] Tumor cells were digested with 0.25% trypsin for 3 min, digestion was stopped by adding culture medium, and the cells were resuspended and counted. The cells were centrifuged at room temperature (25℃) at 175g for 5 min. The supernatant was discarded, and the cells were counted at a rate of 1×10⁻⁶ cells / min. 6Resuspend cells in 1 ml of 1×DPBS, then add CellTrace to a final concentration of 5 μM. TM Violet's dye was used to stain at room temperature in the dark for 20 minutes, followed by washing once with complete medium and resuspending in complete medium for later use.

[0305] (3) Co-cultured cell inoculation

[0306] Stained tumor cells and iMSCs from each group were seeded simultaneously in 6-well plates at an effector-to-target ratio of 1:5 (30w iMSCs, 6w tumor cells). After 12 hours, when the cells adhered, 60w PBMCs were added (magnetic beads and IL-2 were removed 24 hours in advance). After co-culturing for 48 hours, the tumor cell apoptosis rate was detected.

[0307] (4) Flow cytometry detection of tumor cell apoptosis

[0308] Apoptosis detection was performed using BD Pharmingen. TM PE Annexin V Apoptosis Detection Kit I(559763)

[0309] ① Digest and collect co-cultured cells and centrifuge them at room temperature (25℃) for 175g for 5min.

[0310] ② Discard the culture medium supernatant, wash once with 1×DPBS, and centrifuge at room temperature (25℃) for 175g for 5min.

[0311] ③ Discard the supernatant, add 100 μL of Binding Buffer from the kit to resuspend the cells, and add 5 μL of PE-Annexin V dye and 5 μL of 7-ADD dye to each sample, and mix well. At the same time, prepare sample tubes for PE-Annexin V staining, 7-ADD staining, and blank control.

[0312] ④ Incubate in the dark at room temperature (25℃) for 15 minutes.

[0313] ⑤ Add 300 μL of 1×Binding Buffer to resuspend the cells and place on ice in the dark.

[0314] ⑥ Test on the machine within 1 hour.

[0315] In this embodiment, six experimental groups were set up: HCC827, HCC827+PBMC, HCC827+PBMC+iMSC, HCC827+PBMC+α-PD1-scFv-iMSC, HCC827+PBMC+IL24-iMSC, and HCC827+PBMC+α-PD1-scFv-IL24-iMSC. The experimental results are shown in Figure 32. After 48 hours of co-culture, the proportions of PE+7-ADD+ tumor cells in each group were 3.70%, 6.40%, 7.93%, 9.30%, 8.67%, and 11.4%, respectively. The tumor apoptosis rate was significantly increased in the α-PD1-scFv and IL-24 co-expression group, increasing by 22.5% compared to the α-PD1-scFv group and by 31.4% compared to the IL-24 group.

[0316] 2. In vivo experimental verification

[0317] (1) Establishment of subcutaneous xenograft tumors in mice

[0318] ① Cell preparation: Select the CT-26 tumor cell line in logarithmic growth phase and passage it continuously to expand to the required number. Digest, resuspend, and count the cells with 0.25% trypsin. Then wash the cells twice with 1×DPBS and discard the supernatant. Resuspend the cells with 1×DPBS, adding 1 ml of culture medium for every 2×10⁷ cells, and aliquot 100w (50μ) into 1.5 mL centrifuge tubes.

[0319] ② Mouse preparation: Select 6-week-old female BALB / C hPD1 mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.). Place 5-8 mice in each cage. To avoid confusion in numbering, mice in the same cage are treated in the same way.

[0320] ③ Subcutaneous injection of tumor cells: Transport the aliquoted cells on ice, disinfect them, and transfer them to the SPF (Special Treatment for Failure) housing. Gently resuspend the cells in a 1.5 mL centrifuge tube using a pipette, aspirate the cells with an insulin syringe, remove all air, and set aside. Hold the mouse, stabilize it with your left hand, expose the axilla, and disinfect the injection site with an alcohol swab. With your right hand, hold the syringe at a 45° angle and puncture the skin under the mouse's axilla. Gently lift the needle to ensure correct insertion, slowly inject the cell suspension, and after injection, slowly withdraw the needle. Gently press the puncture site with a cotton swab for 5-7 seconds to prevent bleeding or leakage of the cell suspension.

[0321] (2) Treatment with iMSC cell injection

[0322] Seven to nine days after subcutaneous tumor formation in mice, the tumors reached approximately 150 mm³ in size, ready for therapeutic cell injection. To highlight the efficacy of the combined treatment group, the initial tumor volume was selected as 150-180 mm³, compared to the typical injection volume of 60-80 mm³. 3 The tumor size is relatively large, and theoretically, it would be difficult to control tumor growth with single-factor therapy at this volume. The injection method is tail vein injection, administered every two days for a total of five injections, with each injection containing 200w of iMSCs (as shown in Figure 33).

[0323] (3) Mouse feeding and observation

[0324] After establishing subcutaneous tumors through tumor cell injection, mice were observed every other day, monitoring their activity level, movement, food and water intake, and body weight. The long and short axes of the subcutaneous tumor masses were measured. The formula for calculating mouse tumor volume is: Volume (mm²) 3 ) = (major axis × minor axis) 2 ) / 2.

[0325] The experimental results are shown in Figure 34. At an initial treatment volume of 150-180 mm³, neither B6-iMSC alone (in this paper, B6-iMSC refers to blank-iMSC without expressing the therapeutic factor) nor IL-24 alone could control tumor growth, and the tumor growth curves were not different from the DPBS group. However, the combined treatment group of α-PD1-scFv-IL24-iMSC, which co-expresses α-PD1-scFv and IL-24, significantly delayed tumor growth. At the experimental endpoint in this embodiment, the average tumor volumes of each group were as follows: DPBS: 1657 mm³, B6-iMSC: 1782.5 mm³, IL24-iMSC: 1868.6 mm³, and α-PD1-scFv-IL24-iMSC: 907.5 mm³. The tumor remission rate of the α-PD1-scFv-IL24-iMSC dual-factor combined treatment group reached 45%, which was significantly different from the other three groups.

[0326] Example 7: Validation of the antitumor function of α-PD1-scFv combined with IL-2

[0327] 1. IL-2iMSCs promote the proliferation of mouse T cells CTLL-2 (purchased from Shanghai Fuheng Biotechnology Co., Ltd.)

[0328] To determine whether the IL-2 secreted by iMSCs possesses the normal activity of IL-2, the culture supernatant of each IL-2-secreting iMSC was collected, concentrated, and co-cultured with CTLL-2 cells. The proliferation of CTLL-2 cells was detected using a CCK-8 assay kit (RM02823 ABclonal). The procedure was performed according to the kit instructions. The experimental results are shown in Figure 35. CTLL-2 is highly sensitive to IL-2 concentration; as the IL-2 concentration increases, CTLL-2 proliferation increases, the culture medium becomes darker, the absorbance increases, and the standard curve shows a good fit. Compared to B6-iMSCs, all IL-2-secreting iMSCs, including WT-IL-2, IL-2v, α-PD1-scFv-WT-IL-2, and α-PD1-scFv-IL2v, could stimulate CTLL-2 cell proliferation. By comparing with the standard curve, it can be calculated that each group of 100w cells can secrete 35.4IU, 18.24IU, 47.87IU, and 39.23IU of IL-2 active protein in 24h, respectively.

[0329] 2. In vitro experimental verification

[0330] The operation method is the same as in Example 6. This example sets up 6 experimental groups: A375+PBMC+iMSC, A375+PBMC+α-PD1-scFv-iMSC, A375+PBMC+WT-IL2-iMSC, A375+PBMC+IL2v-iMSC, A375+PBMC+α-PD1-scFv-WT-IL-2-iMSC, and A375+PBMC+α-PD1-scFv-IL-2v-iMSC. The experimental results are shown in Figure 36. After 48 hours of cell co-culture, the proportions of PE+7-ADD+ tumor cells in each group were 7.21%, 8.28%, 48.8%, 53.7%, 18.5%, and 29.6%, respectively. The tumor apoptosis rate was significantly increased in the α-PD1-scFv-WT-IL-2-iMSC combined treatment group, which was 6.5 times that of the α-PD1-scFv alone group. The combined treatment group of α-PD1-scFv-IL-2v-iMSC also significantly increased the apoptosis rate of tumor cells, which was 3 times that of the α-PD1-scFv group alone.

[0331] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. An engineered cell with enhanced tumor-killing ability, characterized in that: The engineered cells are site-specifically integrated with polynucleotides encoding secretory proteins; the secretory proteins include: (1) First secretory protein and second secretory protein; the first secretory protein is an inhibitor of the immune checkpoint molecule PD1; the second secretory protein is different from the first secretory protein; Or (2) contain a bispecific antibody, polyclonal antibody, or fusion protein with a domain that specifically binds to the immune checkpoint molecule PD1; The engineered cells were prepared using a non-viral method.

2. The engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The inhibitor of the immune checkpoint molecule PD1 is an antibody or antibody fragment, preferably a full-length antibody or single-chain antibody against PD1.

3. The engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The second secretory protein can enhance the biological activity or functional effect of the first secretory protein; preferably, the second secretory protein can enhance the antitumor activity or tumor-killing properties of the first secretory protein. Preferably, the second secreted protein includes at least one of the following: immune checkpoint inhibitors, interleukins, tumor necrosis factor, interferon, growth factor inhibitors, TNF-α inhibitors, chemokines, GLP-1 receptor agonists, growth hormone, coagulation factors, insulin, tumor necrosis factor, and enzymes. Preferably, the immune checkpoint inhibitor is selected from at least one of PD-L1 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, LAG-3 inhibitors, and TIM-3 inhibitors; Preferably, the interleukin includes wild-type or mutant interleukin; more preferably, the interleukin is selected from at least one of IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23 and IL-24. Preferably, the tumor necrosis factor is selected from at least one of TNF, LTA, LTB, FASLG, TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, and EDA, TRAIL; Preferably, the interferon is selected from at least one of interferon α, β, and γ; Preferably, the growth factor inhibitor is selected from at least one of epidermal growth factor inhibitors, endothelial growth factor inhibitors, platelet-derived growth factor inhibitors, fibroblast growth factor inhibitors, GM-CSF inhibitors, or G-CSF inhibitors; more preferably, the endothelial growth factor is a vascular endothelial growth factor inhibitor. Preferably, the TNF-α inhibitor is selected from TNF-α receptor or TNF-α antibody; more preferably, the TNF-α inhibitor is selected from at least one of etanercept, adalimumab, secukinumab, infliximab, golimumab, and pecelizumab. Preferably, the chemokine is selected from at least one of CXC chemokine, CC chemokine, and CX3C chemokine; more preferably, the CXC chemokine is selected from at least one of CXCL1 (GROα), CXCL2 (GROβ), CXCL3 (GROγ), CXCL4 (PF-4), CXCL5 (ENA-78), CXCL9 (MIG), CXCL10 (IP-10), and CXCL12 (SDF-1); the CC chemokine is selected from at least one of CCL1 (I-309), CCL2 (MCP-1), CCL3 (MIP-1α), CCL4 (MIP-1β), CCL5 (RANTES), CCL11 (Eotaxin), CCL17 (TARC), and CCL22 (MDC); and the CX3C chemokine is selected from CX3CL1 (Fractalkine). Preferably, the GLP-1 receptor agonist is a polypeptide GLP-1 receptor agonist, more preferably, it is selected from exenatide, benaglutide, dulaglutide, abiglutide polypeptide chains that are either unmodified or chemically modified. Preferably, the growth hormone is selected from natural or recombinant human growth hormone (rhGH), which is divided into short-acting recombinant human growth hormone or long-acting recombinant human growth hormone; Preferably, the coagulation factor is selected from at least one of prothrombin complex, fibrinogen, antifibrinolytic, recombinant factor VIIa, recombinant factor VIII, recombinant factor IX, and coagulation factor X; Preferably, the enzyme is selected from at least one of lipase, amylase, trypsin, chymotrypsin, lysozyme, urokinase, L-asparaginase, glutaminase, and neuraminidase.

4. The engineered cell with enhanced tumor-killing ability as described in claim 1, characterized in that: The bispecific antibody includes a bispecific antibody against PD-1 and other targets; the multispecific antibody includes a multispecific antibody against PD-1 and at least two other targets; the fusion protein includes a fusion protein against PD-1 and targeting other targets. Preferably, the other targets are selected from at least one of immune checkpoints, growth factors, interleukins, interferons, tumor necrosis factor, TNF-α, chemokines, and immune receptors (CD3, CD28, CD20) and tumor antigens (HER2, EGFR, MUC1).

5. The engineered cell with enhanced tumor-killing ability as described in claim 1, characterized in that: The site of the polynucleotide integration encoding the first secretory protein is located at the B2M locus.

6. The engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The site of the polynucleotide integration encoding the second secretory protein is selected from one or more genes or rDNA regions associated with the B2M locus, AAVS1, CCR5, HTRP, H11, GAPDH, TCR, ROSA26, RUNX1, and HLA-II class molecules; preferably, the site of integration is the B2M locus.

7. An engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The site of the polynucleotide integration encoding the bispecific antibody, multi-antibody, or fusion protein is located at the B2M locus.

8. An engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The amount of the first secretory protein secreted is greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, and preferably greater than 500 nanograms per 24 hours by one million engineered cells.

9. An engineered cell with enhanced tumor-killing ability as described in claim 1, characterized in that: The engineered cells secrete an effective amount of the second secretory protein; Preferably, the amount of the second secretory protein secreted is at least one ten-thousandth, one thousandth, or one hundredth of the amount of the first secretory protein secreted, and more preferably greater than one percent.

10. An engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The secretion amount of the bispecific antibody, polyclonal antibody, or fusion protein is greater than 20 nanograms, preferably greater than 30 nanograms, preferably greater than 40 nanograms, preferably greater than 50 nanograms, preferably greater than 100 nanograms, preferably greater than 200 nanograms, preferably greater than 300 nanograms, preferably greater than 400 nanograms, and preferably greater than 500 nanograms per 24 hours by one million engineered cells.

11. An engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The polynucleotide encoding the secretory protein includes at least one of the following: an expression repression region, a coding region, a leader sequence, an exon, an intron, a reading frame, and an expression cassette. Preferably, the polynucleotide encoding the secretory protein includes one or more of the following: an operably linked promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding the secretory protein, a screening marker or tag, and a Poly(A) tail.

12. An engineered cell for enhancing tumor killing ability as described in claim 11, characterized in that: The signal peptide is an exogenous signal peptide.

13. An engineered cell for enhancing tumor killing ability as described in claim 12, characterized in that: The signal peptide is one or more of a combination of strongly secretory signal peptides suitable for secretory proteins; Preferably, the strongly secreted signal peptide is selected from at least one of secretcon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), and Igκlight chain signal peptide 1.

14. An engineered cell with enhanced tumor-killing ability as described in claim 11, characterized in that: The promoter sequence is located upstream of the polynucleotide sequence, and the promoter controls the expression of the secreted protein; Preferably, the promoter is selected from CMV promoter, EF1α promoter, SV40 promoter, CAG promoter, PGK promoter or UBC promoter; Preferably, the screening marker is selected from at least one of ampicillin (Ampr), chloramphenicol (Camr), kanamycin (Kanr), tetracycline (Tetr), puromycin (Puro), G418, hygromycin β (Hygr), Zeocin, and Blasticidin; Preferably, the tag is selected from at least one of FLAG, His, GST, HA, c-Myc, HSV, V5, SUMO, eGFP / eCFP / eYFP / mCherryeGFP.

15. An engineered cell for enhancing tumor killing ability as described in claim 1, characterized in that: The engineered cells include engineered mesenchymal stem cells and / or engineered IPSC cells and their derivatives.

16. An engineered cell with enhanced tumor-killing ability as described in claim 15, characterized in that: The engineered mesenchymal stem cells are derived from adult cells or stem cells.

17. An engineered cell with enhanced tumor-killing ability as described in claim 16, characterized in that: The engineered mesenchymal stem cells are derived from pluripotent stem cells, and more preferably, the pluripotent stem cells are selected from induced pluripotent stem cells.

18. An engineered cell for enhancing tumor killing ability as described in claim 16, characterized in that: The engineered mesenchymal stem cells are derived from bone marrow, fat, muscle, heart, umbilical cord blood, or umbilical cord.

19. An engineered cell for enhancing tumor killing ability as described in claim 15, characterized in that: The derived cells include CAR-iNK, dopaminergic neural progenitor cells, CAR-iMac, cardiomyocytes, endothelial progenitor cells, iNK cells, retinal cells, nerve cells, osteoblasts, hematopoietic stem cells, blood cells, T cells, β cells, fibroblasts, hair cells, monocytes, macrophages, Treg cells, kidney progenitor cells, lung epithelial cells, endothelial cells, megakaryocytes, smooth muscle cells, skeletal muscle cells, chondrocytes, osteocytes, adipocytes, hepatocytes, pancreatic islet cells, keratinocytes, melanocytes, and dendritic cells.

20. An engineered cell with enhanced tumor-killing ability as described in claim 3, characterized in that: The secreted protein also includes one or more other secreted proteins, including at least one of immune checkpoint inhibitors, interleukins, tumor necrosis factor, interferon, growth factor inhibitors, TNF-α inhibitors, chemokines, GLP-1 receptor agonists, growth hormone, coagulation factors, insulin, tumor necrosis factor, and enzymes.

21. An engineered cell with enhanced tumor-killing ability as described in claim 20, characterized in that: The one or more other secretory proteins are different from the first secretory protein and the second secretory protein.

22. The engineered cell with enhanced tumor-killing ability as described in claim 21, characterized in that: The other secretory proteins include a third secretory protein and a fourth secretory protein; the first, second, third, and fourth secretory proteins are all different from each other.

23. A method for preparing engineered cells according to any one of claims 1-22, characterized in that: This includes introducing a polynucleotide encoding the secretory protein into a site of targeted integration into the engineered cell; Preferably, the method includes introducing an expression cassette encoding a secreted protein into a site of integration into the cell via a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and / or a CRISPER / Cas system; more preferably, a CRISPER / Cas system.

24. The method for engineered cells as described in claim 23, characterized in that: This includes introducing a polynucleotide encoding the secretory protein into iPSCs cells for site-specific integration, followed by directed differentiation to obtain derived cells; Preferably, the derived cells are engineered mesenchymal stem cells.

25. The method for engineered cells as described in claim 23, characterized in that: The fixed-point integration includes dual-copy integration or single-copy integration.

26. The method for engineered cells as described in claim 23, characterized in that: The method described is non-viral. Preferably, the introduction method is selected from: carrier conversion, transfection, heat shock, electroporation, transduction, and microinjection.

27. A formulation, characterized in that: Includes the engineered cells and pharmaceutically acceptable excipients of any one of claims 1-22.

28. A pharmaceutical composition, characterized in that, Includes the engineered cells according to any one of claims 1-22.

29. A pharmaceutical composition as claimed in claim 28, characterized in that, The pharmaceutical composition also includes one or more other therapeutic agents; Preferably, the one or more other therapeutic agents are administered in combination with the engineered cells; Preferably, the combined administration includes administration in any order or at any time interval, such that two or more therapeutic agents exert their biological activity simultaneously; more preferably, the combined administration produces a synergistic therapeutic effect.

30. The use of the engineered cells of any one of claims 1-22, the formulation of claim 27, or the pharmaceutical composition of claim 28 or 29 in the preparation of medicaments for the diagnosis, prevention, and treatment of cancer diseases.

Images