Improved AON for RNA editing

Oligonucleotides with CRNs and mismatch-forming nucleotides enhance ADAR-mediated RNA editing, correcting genetic mutations in MECP2, Frataxin, and SLC20A2 genes, improving protein expression and offering therapeutic solutions for Rett Syndrome, Friedreich Ataxia, and Primary Familial Brain Calcification.

WO2026077951A1PCT designated stage Publication Date: 2026-04-16VICO THERAPEUTICS BV
View PDF 24 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/078767
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-09-02
Filing Date
2025-10-07
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

Current RNA editing technologies, such as antisense oligonucleotides (AONs), are inefficient in correcting disease-causing mutations in neurological disorders like Rett Syndrome, Friedreich Ataxia, and Primary Familial Brain Calcification, due to low editing efficiency and complex chemical modifications that affect ADAR recruitment and catalytic activity.

Method used

Development of oligonucleotides with conformationally restricted nucleotides (CRNs) and mismatch-forming nucleotides to enhance ADAR-mediated RNA editing, targeting specific adenosines in therapeutic codons to correct mutations in MECP2, Frataxin, and SLC20A2 genes, thereby increasing protein expression.

Benefits of technology

The oligonucleotides effectively induce RNA editing, leading to increased protein levels by correcting stop codons and missense mutations, addressing the genetic causes of these disorders and providing a potential disease-modifying treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000195_0001
    Figure IMGF000195_0001
  • Figure IMGF000195_0002
    Figure IMGF000195_0002
  • Figure IMGF000195_0003
    Figure IMGF000195_0003
Patent Text Reader

Abstract

Provided herein are RNA editing oligonucleotides capable of effecting ADAR-mediated deamination of a target adenosine comprised in a target RNA, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA comprising said target adenosine, and wherein the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN) positioned at the 5' and / or at the 3' terminus of the oligonucleotide and / or internally. In particular, the target adenosine may be part of a therapeutic target codon in the MECP2 protein-coding RNA. Provided herein are RNA editing oligonucleotides capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a codon encoding a posttranslational modification site in the target protein. In particular, the target adenosine may be part of a ubiquitination site in the frataxin (FXN) protein. Provided herein are RNA editing oligonucleotides capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a start codon in the 5' untranslated region of the target RNA molecule. In particular, the target adenosine may be part of the start codon of an untranslated ORF (uORF) in the human Sodium-dependent phosphate transporter 2 protein (SLC20A2).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Improved AON for RNA editing

[0002] Field

[0003] Aspects and embodiments described herein relate to the field of medicine, particularly to the field of RNA editing as a therapeutic tool. Aspects and embodiments described herein are directed to the treatment of neurological disorders associated with insufficient target protein expression, specific examples of such disorders being the treatment of MECP2 deficiency-linked neurological disorders such as the Rett syndrome. An example of another neurological disorder is Friedreich Ataxia and other brain disorders. Another example of neurological disorder is Primary Familial Brain Calcification (PFBC)

[0004] Background

[0005] Adenosine Deaminases Acting on RNA (ADARs) offer a promising strategy for correcting disease-causing mutations through targeted RNA editing. Rett Syndrome (RTT), a severe neurodevelopmental disorder primarily affecting females, is a compelling example of how ADAR-based approaches could be utilized therapeutically. RTT has a global prevalence of 5 to 10 cases per 100,000 females and is characterized by apparently normal early development followed by developmental regression, resulting in intellectual disability, loss of speech and motor function, ataxia, seizures, and respiratory abnormalities.

[0006] Approximately 96% of classic RTT cases are linked to sporadic loss-of-function mutations in the X-linked MECP2 gene, which encodes methyl CpG-binding protein 2 (MECP2), a transcriptional regulator essential for neuronal function. Most of these mutations are C-to-T nonsense mutations, which introduce premature stop codons, leading to truncated, non-functional MECP2 protein. Other pathogenic mutations include missense, frameshift, splice site, and start codon mutations, all of which disrupt MECP2 function and contribute to the disease phenotype.

[0007] ADAR-mediated RNA editing has emerged as a potential approach to correct pathogenic MECP2 mutations at the RNA level. ADAR enzymes catalyze adenosine (A) to inosine (I) deamination within double-stranded RNA (dsRNA), and since inosine is functionally interpreted as guanosine (G) by the cellular machinery, this process can be leveraged to revert disease-causing G-to-A missense mutations back to the wild-type sequence. Additionally, targeted ADAR recruitment could enable the correction of C-to-T nonsense mutations, effectively restoring full-length MECP2 expression by recoding premature stop codons.

[0008] Several studies disclosed in WO2021231680A1 , WO2023049477A2, W02023220440A1 , W02024013361 A1 , and WO2022253810A1 , incorporated herein by reference in their entireties, have demonstrated that antisense oligonucleotides ( e.g. AONs or ASOs) designed to recruit endogenous ADAR enzymes can correct nonsense mutations in MECP2 mRNA. However, RNA editing efficiency in endogenous mRNA remains low, and current ASO designs have not yet been shown to achieve efficient in vivo editing in the brain. Furthermore, RNA- editing ASOs require complex chemical modifications, which influence ADAR recruitment and catalytic activity. Given these challenges, there remains a critical need in the art to optimize ASO chemistries to enhance ADAR- mediated RNA editing both in vitro and in vivo, thereby advancing the therapeutic potential of this approach for Rett Syndrome and other genetic disorders. Friedreich ataxia (FA) is an example of another genetic disorder that can be treated using the technology of the invention. FA is an inherited neurodegenerative disorder characterized by widespread metabolic changes affecting the central and peripheral nervous systems, heart and pancreas (Burk et al. Cerebellum Ataxias, 2017, 4:4). Typical symptoms are progressive gait and limb ataxia, loss of lower limb reflexes, impaired speech and oculomotor dysfunction. The majority of patients develop heart problems such as hypertrophic cardiomyopathy, heart murmurs or atrial fibrillation. Other non-neurological manifestations can also include diabetes.

[0009] Friedreich Ataxia is caused by a GAA repeat expansion in intron 1 of the frataxin (FXN) gene and patients typically present with over 60 copies of the repeat. The GAA repeat is present in both alleles and causes epigenetic changes that reduce transcription and translation of the gene leading to lower protein levels. It is estimated that patients express 5 - 35% of total levels of frataxin (FXN) (Doni et al. Cell Death & Disease, 202314(12):805). Heterozygous carriers of the mutant FXN gene with 50% protein levels are not symptomatic.

[0010] Frataxin is a mitochondrial protein involved in biogenesis of iron-sulfur clusters in the mitochondria. Depletion of frataxin can therefore negatively impact cellular energy production, increase oxidative stress and lead to cell death (Anzovino et al. British Journal of Pharmacology, 2014, 171 (8):2174-2190). Within the central nervous system, the cell populations more severely impacted by this are sensory neurons and, to a lower extent, motor neurons (Viventi et al. STEM CELLS Translational Medicine, 2021 , 10:1157-1169).

[0011] Currently, there is no effective disease-modifying treatment on the market for Friedreich ataxia targeting the primary genetic cause of the disease. Current therapies for Friedreich ataxia are mostly based on symptom management and include physical therapy, occupational therapy, and orthopedic devices. Medication treatment primarily focuses on pain management, heart failure, and prevention of infection.

[0012] Omaveloxolone was approved in February 2023 in the USA for the treatment of Friedreich ataxia. In Friedreich ataxia patients, the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway is suppressed, which is associated with oxidative stress, mitochondrial dysfunction and damage to cells, including central and peripheral neurones. The Nrf2 pathway may be activated by omaveloxolone as it blocks the ubiquitination and degradation of Nrf2.

[0013] Etravirine, an antiviral drug currently in use as an anti-human immunodeficiency virus therapy, has been shown to be capable of increasing frataxin levels in cells derived from Friedreich ataxia patients, by enhancing frataxin messenger RNA translation (Alfedi et al. Mov Disord. 2019;34(3):323-334).

[0014] Antisense oligonucleotide (ASO)-based approaches aiming for frataxin stabilization and accumulation have been described. These approaches predominantly target the GAA repeats (e.g. as described in WO2017 / 186815 or WO2019 / 126641 ).

[0015] In view of all the above, there is still a need for FA therapies targeting the primary genetic cause of the disease.

[0016] As is described in detail below, and as is demonstrated in the experimental section herein, the current inventors have developed oligonucleotides capable of inducing RNA editing at a specific ubiquitination site in the frataxin (pre-)mRNA, leading to decreased ubiquitination and increased protein levels. Accordingly, the aspects and embodiments of the present invention as described herein solve at least some of the problems and needs discussed herein.

[0017] Primary familial brain calcification (PFBC) is an example of another genetic disorder that can be treated using the technology ofthe invention. PFBC is an inherited neurodegenerative disease characterised by progressive bilateral microvascular calcium deposits, accompanied by various symptoms, such as dystonia, ataxia, parkinsonism, dementia, depression, headaches, and epilepsy. The first symptoms appear at mid-age, in persons 30 to 50 years old. Currently, there is no disease modifying treatment for PFBC (Chen et al. Int. J. Mol. Sci., 2023. p. 10886. Vol. 24(13)).

[0018] PFBC is caused by autosomal dominant mutations in SLC20A2, SLC53A1 , PDGFB and / or PDGFRB; or by autosomal recessive mutation in MYORG and / or JAM2. Between 40-65% of PFBC cases are caused by loss of function mutations in one of the alleles of the SLC20A2 gene. SLC20A2 encodes the type III sodiumdependent phosphate (Na+ / Pi) transporter 2 (SLC20A2; Pit2). Pit2 regulates the transport of inorganic phosphate (Pi) from the extracellular compartment to inside the cells. In vitro and in vivo data show that mutations in SLC20A2 dysregulate phosphate homeostasis in the brain. Specifically, mutations impair Pit2 function, which reduces Pi cellular uptake and leads to increase levels of Pi in the Cerebrospinal fluid (CSF), and to the formation of calcifications (calcium / hydroxyapatite deposits) on the vascular extracellular matrix. The main cell types involved in the disease pathology are cells from the vascular system (endothelial cells and vascular smooth muscle cells (VSMC)), and cells that regulate the production and flow of CSF (choroid plexus epithelium and ependymal cells). SLC20A2 is also expressed in neurons and astrocytes, disruption of SLC20A2 function in those cells might also contribute to the increased Pi levels in CSF (Wang et al. Nature Genetics, 2012. pp. pages254-256. Vol. 44.; Hsu et al. Neurogenetics, 2013. pp. 11-22. Vol. 14(1 ); Sekine et al.Biochem Biophys Res Commun, 2019 . pp. 303-308. Vol. 10(2); Wallingford et al. Brain Pathol, 2017. pp. 64-76. Vol. 27(1 ).).

[0019] More than 160 heterozygous mutations in SLC20A2 have been identified in PFBC patients. The severity of the mutations influences the number of calcified brain areas, which in turn correlates with the clinical status of the patients. In fact, it is estimated that the risk of developing symptoms more than doubled for each additional region with calcifications (Balck et al. Mov Disord, 2021 . pp. 2468-2480. Vol. 36(11 )).

[0020] There is currently no effective treatment for PFBC aiming for increasing SLC20A2 protein expression. Current therapies for PFBC are based on symptom reduction, including tremor, headaches, mood swings, and psychotic symptoms, or on generic bone disease drugs like bisphosphonates.

[0021] In view of all of the above, there is still a need for PFBC therapies targeting the primary genetic cause of the disease. As is described in detail below, and as is demonstrated in the experimental section herein, the current inventors have developed oligonucleotides capable of inducing RNA editing at a specific start codon in the 5’ UTR of Sodium-dependent phosphate transporter 2 (SLC20A2) (pre-)mRNA, leading to increased protein levels by increased translation. Accordingly, the aspects and embodiments of the present invention as described herein solve at least some of the problems and needs as discussed herein. Summary of the invention

[0022] In a first aspect, an oligonucleotide for RNA editing is provided, capable of effecting Adenosine Deaminase Acting on RNA (ADAR)-mediated deamination of a target adenosine comprised in a target RNA, said target RNA preferably encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region of the target RNA, the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN) positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or internally, and the oligonucleotide comprises a mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated.

[0023] In one embodiment, the invention provides an oligonucleotide in which the target adenosine is located within a therapeutic codon. Such therapeutic codons may include a start codon, a stop codon, a post-translational modification site, or a codon carrying a G-A, C-A, or T-A missense mutation. In these embodiments, all codons comprising the target adenosine are correctable by ADAR-mediated deamination of the target adenosine.

[0024] In an embodiment, according to the first aspect, the target adenosine is part of a codon also called a therapeutic codon: a start codon, a stop codon, a post-translational modification site or a codon comprising a G to A missense mutation, wherein all codons comprising said target adenosine are correctable by ADAR-mediated deamination of the target adenosine.

[0025] In an embodiment, according to the first aspect, the target RNA is a protein-coding or a non-coding RNA.

[0026] In an embodiment, according to the first aspect, the target adenosine is part of a codon comprised in a target RNA, wherein the target RNA is or comprises an endogenous protein coding MECP2 RNA encoding a human MECP2, or is or comprises Frataxin pre-mRNA or mRNA and the target protein is Frataxin, or is or comprises a Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a Sodium-dependent phosphate transporter 2 protein.

[0027] In an embodiment, according to the first aspect, the therapeutic target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both codons are correctable by ADAR-mediated deamination of the target adenosine.

[0028] In an embodiment, according to the first aspect, the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably, wherein the posttranslational modification site is an ubiquitination site and preferably wherein said ubiquitination site is a lysine ubiquitination site, more preferably wherein the codon encoding the lysine ubiquitination site is an AAG or AAA codon.

[0029] In an embodiment, according to the first aspect, the invention provides an oligonucleotide in which deamination of the target adenosine results in the loss of a post-translational modification site in the target protein. In certain embodiments, the post-translational modification site may include, for example, a phosphorylation, acetylation, succinylation, glycosylation, nitrosylation, methylation, lipidation, amidation, hydroxylation, and / or sulfation site. In an embodiment, according to the first aspect, the deamination of the target adenosine causes disruption of a start codon, preferably wherein the start codon is an AUG start codon, more preferably wherein the start codon is part of an open reading frame (ORF) in the 5’ untranslated region of the target RNA molecule.

[0030] In an embodiment, according to the first aspect, the conformationally restricted nucleotide (CRN) is a Bridged Nucleic Acid (BNA) and preferably is a Locked Nucleic Acid (LNA).

[0031] In an embodiment, according to the first aspect, the oligonucleotide is such that:

[0032] - the oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide,

[0033] - said CRN, (preferably LNA), is part of the sequence capable of hybridizing with a region of the target RNA,

[0034] - wherein the oligonucleotide does not comprise any 2’F nucleotide and / or

[0035] - when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other.

[0036] In an embodiment, according to the first aspect, the oligonucleotide comprises at least one internal CRN, preferably an internal LNA.

[0037] In an embodiment, according to the first aspect, the oligonucleotide comprises at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide, preferably wherein each CRN is an LNA.

[0038] In an embodiment, according to the first aspect, the oligonucleotide comprises at least one internal CRN and at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide, preferably wherein each CRN is an LNA.

[0039] In an embodiment, according to the first aspect, the CRN, preferably an LNA, further comprises a modified base, more preferably a 5-methylcytosine.

[0040] In an embodiment, according to the first aspect, a modified or artificial internucleoside linkage links the CRN, preferably an LNA, to its neighbour nucleotide, more preferably wherein the modified or artificial internucleoside linkage is a phosphorothioate (PS) internucleoside linkage and / or a PNdmi linkage.

[0041] In an embodiment, according to the first aspect, the oligonucleotide comprises at least one LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising at least one LNA at the 5’ terminus and / or the most terminal nucleotides comprising one LNA at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PNdmi linkage.

[0042] In an embodiment, according to the first aspect, the oligonucleotide comprises two contiguous LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising two contiguous LNAs at the 5’ terminus and / or the most terminal nucleotides comprising two contiguous LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PNdmi linkage.

[0043] In an embodiment, according to the first aspect, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6- amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0044] In an embodiment, according to the first aspect, the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target RNA molecule.

[0045] In an embodiment, according to the first aspect, the oligonucleotide has a length of 26 to 50 nucleotides, preferably 30 to 45 nucleotides, more preferably 32 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

[0046] In an embodiment, according to the first aspect, the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably wherein the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, even more preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or wherein the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of the target adenosine and / or at the 5’ and / or 3’termini of the oligonucleotide.

[0047] In an embodiment, according to the first aspect, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base.

[0048] In an embodiment, according to the first aspect, an oligonucleotide is provided wherein the target RNA comprises an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with the target region in the endogenous MECP2 target RNA, the oligonucleotide comprises at least one, and preferably two LNAs at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or at least one internal LNA, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage, and the oligonucleotide comprises a mismatch-forming nucleotide opposite of the target adenosine, wherein the target adenosine is part of the therapeutic target codon comprised in the endogenous MECP2 target RNA

[0049] In an embodiment, according to the first aspect, an oligonucleotide is provided wherein the target RNA comprises an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, wherein the oligonucleotide further comprises at least one of the following features: the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides capable of forming a wobble base pair with the target RNA, said target RNA comprising an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleoside linkage), preferably a PN-dmi-phosphoramidate internucleoside linkage, the oligonucleotide further comprises at least one internal LNAs located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides

[0050] In an embodiment, according to the first aspect, the oligonucleotide is represented by a sequence comprising or consisting of SEQ ID NOs: SEQ ID NOs: 90-98, 130-140, 400-420, 423, 424, 25-59, 102-129, 223-234, 245-248, 253-254, 259-260, 265-269, 274-275, 280, 282-283, 288-331 , 332-334, 338-339, 340-341 , 344-345, 153-179, 184-187, 347, 349, 351-361 , 363, 196-198, 200, 202-205..

[0051] In a second aspect, a composition is provided comprising an oligonucleotide of the first aspect.

[0052] In a third aspect, an oligonucleotide or a composition comprising it is provided according to the first and second aspect respectively for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with the target RNA, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by lacking or insufficient expression of the genes encoding

[0053] Methyl CpG Binding Protein 2 (MECP2),

[0054] Frataxin or

[0055] Sodium-dependent phosphate transporter 2 (SLC20A2) in a human subject, and most preferably wherein the disease is Rett syndrome, Friedreich Ataxia or Primary Familial Brain Calcification (PFBC).

[0056] In a fourth aspect, an in vitro or an ex vivo method is provided for deaminating a target adenosine, which is comprised in a target RNA encoding a target protein in a cell, said method comprising contacting the cell with an oligonucleotide or a composition as described in the first aspect, and wherein the cell is a human cell, preferably a cell of the vascular system and / or a cell of the central nervous system.

[0057] In an embodiment, according to the fourth aspect, the target adenosine is part of a codon encoding a posttranslational modification site in the target protein, said method comprising contacting the cell with an oligonucleotide as described in the first aspect, preferably wherein the posttranslational modification site is an ubiquitination site, and / or the method is an in vitro or an ex vivo method, and / or the cell is a CNS cell, a heart cell, or a pancreas cell, preferably a CNS cell.

[0058] In an embodiment, according to the fourth aspect, the target adenosine is part of a start codon in the 5’ untranslated region of the target RNA molecule, said method comprising contacting the cell with an oligonucleotide as described in the first aspect, preferably wherein the method is an in vitro or an ex vivo method, and / or the cell is a cell of the vascular system or a cell of the nervous system.

[0059] In a fifth aspect, an RNA editing oligonucleotide is provided capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a codon selected from a codon encoding a posttranslational modification site in the target protein, or a start codon in the 5’ untranslated region of the target RNA molecule.

[0060] In an embodiment, according to the fifth aspect, deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably an ubiquitination site, more preferably a lysine ubiquitination site, even more preferably wherein the codon encoding the lysine ubiquitination site is an AAG or AAA codon.

[0061] In an embodiment, according to the fifth aspect, the target adenosine is the middle nucleotide of a codon encoding a lysine ubiquitination site, preferably wherein said lysine is converted to arginine.

[0062] In an embodiment, according to the fifth aspect, deamination of the target adenosine causes disruption of a start codon, preferably an AUG start codon, more preferably an AUG start codon located in an open reading frame (ORF) in the 5’ untranslated region. In an embodiment, according to the fifth aspect, the oligonucleotide comprises a nucleotide forming a mismatch at the target adenosine, preferably wherein the nucleotide forming a mismatch comprises a cytosine base or a cytosine base analog, more preferably wherein the cytosine base analog is a pyridine base, most preferably wherein the pyridine base is 6-amino-5-nitropyridin-2-one.

[0063] In an embodiment, according to the fifth aspect, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog, preferably wherein the uracil analog is a purine, more preferably wherein the purine is an N3-uridine.

[0064] In an embodiment, according to the fifth aspect, the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar, and / or wherein the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar.

[0065] In an embodiment, according to the fifth aspect, the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary with a sequence of the target RNA molecule.

[0066] In an embodiment, according to the fifth aspect, the oligonucleotide is such that:

[0067] - the oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide,

[0068] - if it comprises a CRN, (preferably LNA), said CRN, (preferably LNA), is part of the sequence capable of hybridizing with a region of the target RNA,

[0069] - wherein the oligonucleotide does not comprise any 2’F nucleotide and / or

[0070] - when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other.

[0071] In an embodiment, according to the fifth aspect, the oligonucleotide has a length of 25-60 nucleotides, preferably 30-55 nucleotides, more preferably 37-41 nucleotides, most preferably 39 nucleotides.

[0072] In an embodiment, according to the fifth aspect, the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably phosphorothioate (PS) linkages and / or phosphoryl guanidine (PN) linkages, preferably dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (PN-dmi-phosphoramidate).

[0073] In an embodiment, according to the fifth aspect, the oligonucleotide comprises one or more modified or artificial sugars, preferably selected from 2’-O-methyl, 2’-0-methoxyethyl, 2’-Fluoro, locked nucleic acid (LNA), or unlocked nucleic acid (UNA), more preferably 2’-O-methyl and / or LNA, preferably located at the 5’ and / or 3’ termini.

[0074] In an embodiment, according to the fifth aspect, the oligonucleotide comprises one or more modified or artificial bases, preferably inosine, hypoxanthine, 5-methylcytosine, or 5-methyluracil.

[0075] In an embodiment, according to the fifth aspect, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA molecule, preferably wherein the residue forming a wobble base pair P62041914WQ comprises a hypoxanthine base, even more preferably wherein the residue forming a wobble base pair is inosine.

[0076] In an embodiment, according to the fifth aspect, the target RNA molecule is

[0077] Frataxin pre-mRNA or mRNApreferably wherein the human Frataxin pre-mRNA or mRNA and the target protein is a human Frataxin, such as wherein the human Frataxin comprises or consists of the sequence of SEQ ID NO: 141 or 142, and / or wherein the human frataxin pre-mRNA or mRNA comprises or consists of the sequence of SEQ ID NO: 143 or 144, and even more preferably wherein the ubiquitination site is the lysine at the position corresponding to position 147 in SEQ ID NO: 141 or 142, or

[0078] Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA SLC20A2, preferably human pre-mRNA or mRNA encoding SLC20A2 protein, even more preferably wherein the human SLC20A2 pre-mRNA or mRNA comprises or consists of the sequence of any one of SEQ ID NOs: 189-191.

[0079] In an embodiment, according to the fifth aspect, the oligonucleotide comprises or consists of the base sequence of any one of SEQ ID NOs: 145-152, 180-183, or SEQ ID NOs: 192-195, 208-213, or a sequence having up to 10 mutations with any one of SEQ ID NOs: 145-152, 180-183, or SEQ ID NOs: 192-195, 208- 213.

[0080] In an embodiment, the invention provides an oligonucleotide that comprises or consists of a sequence selected from SEQ ID NOs: 153-179, 184-187, 196-205, or 214-222.

[0081] In a sixth aspect, an oligonucleotide is provided according to the fifth aspect for use in medicine, preferably for use in the treatment of Friedreich Ataxia or of Primary Familial Brain Calcification (PFBC).

[0082] In a seventh aspect, a pharmaceutical composition is provided comprising an oligonucleotide according to the fifth aspect, preferably for use in medicine, more preferably for use in the treatment of Friedreich Ataxia or Primary Familial Brain Calcification (PFBC).

[0083] In an eighth aspect, a method is provided for deaminating a target adenosine in a target RNA molecule encoding a target protein in a cell, the method comprising contacting the cell with an oligonucleotide according to the fifth aspect, wherein the target adenosine is part of a codon as defined in the fifth aspect, and wherein the method is an in vitro or ex vivo method, and / or the cell is a central nervous system (CNS) cell, vascular cell, heart cell, or pancreas cell.

[0084] Invention 1

[0085] In a further aspect, described herein is an oligonucleotide for RNA editing capable of effecting Adenosine Deaminase Acting on RNA (ADAR)-mediated deamination of a target adenosine comprised in a target RNA, said target RNA preferably encoding a target protein, wherein - the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA,

[0086] - the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN) positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or internally, and

[0087] - the oligonucleotide comprises a mismatch-forming nucleotide positioned opposite of the target adenosine to be deaminated.

[0088] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the target RNA is a protein-coding RNA or a non-coding RNA.

[0089] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the target adenosine is part of a therapeutic target codon comprised in a target RNA, said target RNA comprising an endogenous protein-coding MECP2 RNA encoding a human Methyl CpG Binding Protein 2 (MECP2).

[0090] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the therapeutic target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both codons are correctable by ADAR-mediated deamination of the target adenosine.

[0091] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises at least one internal CRN.

[0092] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide.

[0093] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises at least one internal CRN and at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide.

[0094] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the CRN further comprises a modified base, preferably a 5- methylcytosine.

[0095] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises a conformationally restricted nucleotide which is a Bridged Nucleic Acid (BNA) and preferably is a Locked Nucleic Acid (LNA).

[0096] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage.

[0097] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the modified or artificial internucleoside linkage is a phosphorothioate (PS) linkage. In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0098] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide further comprises at least one internal LNA located upstream of the mismatch-forming nucleotide.

[0099] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target RNA molecule.

[0100] Thus, in a preferred embodiment, provided is an oligonucleotide related to a first aspect disclosed herein, wherein the oligonucleotide further comprises additional mismatches upstream or downstream of the mismatch-forming nucleotide opposite of the target adenosine.

[0101] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide has a length of 26 to 50 nucleotides, preferably 30 to 45 nucleotides, more preferably 32 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

[0102] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably wherein: the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or wherein the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of the target adenosine

[0103] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base.

[0104] In a further aspect, described herein is an oligonucleotide for RNA editing capable of effecting Adenosine Deaminase Acting on RNA (ADAR)-mediated deamination of a target adenosine which is part of a therapeutic target codon comprised in a target region of a target RNA, said target RNA comprising an endogenous proteincoding MECP2 RNA encoding a MECP2 protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with the target region in the endogenous MECP2 target RNA, the oligonucleotide comprises at least one, and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or internally, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage, and the oligonucleotide comprises a mismatch-forming nucleotide opposite of the target adenosine, wherein the target adenosine is part of the therapeutic target codon comprised in the endogenous MECP2 RNA molecule

[0105] In a particular embodiment, provided is an oligonucleotide relating to a second aspect disclosed herein, wherein the oligonucleotide further comprises at least one of the following features: the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-d ifluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, said target RNA comprising an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleoside linkage), preferably a PN-dmi-phosphoramidate internucleoside linkage, the oligonucleotide further comprises at least one internal LNA located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0106] In a particular embodiment, provided is an oligonucleotide according to a first and a second aspect disclosed herein, wherein the oligonucleotide is represented by a sequence comprising or consisting essentially of SEQ ID NOs: 25-59, 90-98, 102-129, 130-138, 130-140, preferably SEQ ID NOs: 25-59 and 102-129 and even more preferably SEQ ID NOs: 54-59 and 102-129.

[0107] In a further aspect, provided herein are compositions comprising the oligonucleotides disclosed herein. A composition is preferably a pharmaceutical composition.

[0108] In a particular embodiment, provided is an oligonucleotide relating to a first and second aspect disclosed herein or a composition comprising said oligonucleotide for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with the target RNA, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by mutations of the gene encoding MECP2 in a subject, and most preferably wherein the disease is Rett syndrome.

[0109] A further aspect disclosed herein relates to an in vitro or an ex vivo method for deaminating a target adenosine which is comprised in a target RNA in a cell, said method comprising contacting the cell with an oligonucleotide as described earlier herein, wherein the cell is a human cell, preferably a cell of the central nervous system.

[0110] Invention 2

[0111] In a further aspect of the invention, there is provided an RNA editing oligonucleotide capable of effecting ADAR- mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a codon encoding a posttranslational modification site in the target protein.

[0112] In an embodiment, the oligonucleotide wherein the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein,

[0113] In an embodiment, the posttranslational modification site is an ubiquitination site and preferably said ubiquitination site is a lysine ubiquitination site, more preferably the codon encoding the lysine ubiquitination site is an AAG or AAA codon.

[0114] In an embodiment, the oligonucleotide wherein the target adenosine is the middle nucleotide of the codon encoding the ubiquitination site, preferably the lysine ubiquitination site is converted to an arginine.

[0115] In an embodiment, the oligonucleotide comprises a nucleotide forming a mismatch at the target adenosine, preferably said the nucleotide forming a mismatch comprises a cytosine base or a cytosine base analog, more preferably the cytosine base analog is a pyridine base, most preferably the pyridine base is 6-amino-5- nitropyridin-2-one.

[0116] In an embodiment, the oligonucleotide wherein the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog, preferably the uracil analog is a purine, more preferably the purine is an N3-uridine.

[0117] In an embodiment, the oligonucleotide wherein the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar, and / or wherein the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar. In an embodiment, the oligonucleotide wherein the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary with a sequence of the target RNA molecule, and / or does not comprise a sequence aimed at forming an intramolecular stem-loop structure, and / or is capable of recruiting an endogenous ADAR, and / or has a length of 25 to 60 nucleotides, preferably 30 to 55 nucleotides, more preferably 35 to 49 nucleotides, most preferably 37 to 41 nucleotides.

[0118] In an embodiment, the oligonucleotide wherein the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably wherein, the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, and / or wherein the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi)- phosphoramidate (PN-dmi-phosphoramidate).

[0119] In an embodiment, the position of the one or more phosphorothioate internucleoside linkages is as follows: between the terminal two, three, four, five, or six residues at the 5’ terminus and / or between the terminal two, three, four, five, or six residues at the 3’ terminus.

[0120] In an embodiment, the position of the one or more phosphoryl guanidine (PN) internucleoside linkages is as follows: It occurs adjacent to the 5’ terminus, adjacent to the 3’ terminus, and / or between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine

[0121] In an embodiment, the oligonucleotide wherein the oligonucleotide comprises one or more modified or artificial sugars.

[0122] In an embodiment the one or more modified or artificial sugars are selected from the group consisting of: 2’- O-methyl, 2’-0-methoxyethyl, 2’-Fluoro, and locked nucleic acid (LNA), preferably wherein the one or more sugar modifications are selected from the group consisting of 2’-O-methyl and locked nucleic acid (LNA), and / or wherein the one or more modified or artificial sugars comprise one or more LNAs, preferably wherein the one or more LNAs occur at the 5’ and / or 3’ terminus of the oligonucleotide.

[0123] In an embodiment, t the oligonucleotide comprises one or more modified or artificial bases, preferably one or more inosines, or one or more 5-methylcytosines. In an embodiment, the 5’ terminal residue comprises a 5- methylcytosine.

[0124] In an embodiment, the oligonucleotide is capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, said oligonucleodide is such that the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and the target adenosine is part of a codon encoding a posttranslational modification site in the target protein, and the oligonucleotide has at least one of the following features: the base of the nucleotide of the oligonucleotide forming a mismatch at the target adenosine comprises a cytosine base or a cytosine base analog, preferably a pseudoisocytosine, a 6-amino-5- nitro-2(1 H)-pyridinone (Benner’s Z base) or a is 2', 2’-difluoro 2'deoxycytidine (gemcitabine) (preferably the cytosine analog is a Benner’s Z base), the base of the nucleotide of the oligonucleotide forming a mismatch at the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine, the 2’ position of the sugar of the nucleotide opposite the target adenosine and / or of the nucleotide 3’ adjacent to the nucleotide opposite the target adenosine is not substituted, preferably it comprises an -H (sugar is a 2’-deoxyribose and nucleotide is DNA nucleotide) or an -OH sugar is ribose and nucleotide is RNA nucleotide),

[0125] One or more sugar modifications which are preferably selected from the group consisting of 2’-O- methyl (2’-OMe) and locked nucleic acid (LNA), preferably located at the 5’ and / or 3’ terminus of the oligonucleotide. the internucleotide linkage adjacent to the 5’ and / or 3’ terminus and the one between the first and the second nucleotide residue 3’of the nucleotide residue opposite the target adenosine is a phosphoryl guanidine linkage (PN internucleotide linkage), preferably a PN-dmi-phosphoramidate internucleotide linkage and the length of the oligonucleotide is from 37 to 41 , preferably 39 nucleotides.

[0126] In an embodiment, the oligonucleotide comprises one or more residues forming a wobble base pair with the target RNA molecule.

[0127] In an embodiment, the residue forming a wobble base pair comprises a hypoxanthine base, preferably wherein the residue forming a wobble base pair is inosine.

[0128] In an embodiment, the target RNA molecule is a frataxin pre-mRNA or mRNA and the target protein is frataxin. In an embodiment, the target RNA molecule is human frataxin pre-mRNA or mRNA and the target protein is human frataxin.

[0129] In an embodiment, human frataxin comprises or consists of the sequence of SEQ ID NO: 141 or 142, and / or wherein the human frataxin pre-mRNA or mRNA comprises or consists of the sequence of SEQ ID NO: 143 or 144.

[0130] In an embodiment, the ubiquitination site is the lysine at the position corresponding to position 147 in SEQ ID NO: 141 or 142.

[0131] In an embodiment, the oligonucleotide comprises or consists of the base sequence of any one of SEQ ID NOs: 145-152 or 180-183, or a sequence having up to 10 mutations with any one of SEQ ID NOs: 145-152 or 180- 183.

[0132] In an embodiment, the oligonucleotide provided is for use in medicine, preferably the for use in the treatment of Friedreich Ataxia.

[0133] In a further aspect of the invention, there is provided a pharmaceutical composition comprising an oligonucleotide as described in the first aspect. In an embodiment, the pharmaceutical composition is for use in medicine, preferably for use in the treatment of Friedreich Ataxia.

[0134] In a further aspect of the invention, there is provided an method for deaminating a target adenosine in a target RNA molecule encoding a target protein in a cell, wherein the target adenosine is part of a codon encoding a posttranslational modification site in the target protein, said method comprising contacting the cell with an oligonucleotide as described in the first aspect.

[0135] In an embodiment, the method wherein the posttranslational modification site is an ubiquitination site.

[0136] In an embodiment, the method is an in vitro or an ex vivo method, and / or the cell is a CNS cell, a heart cell, or a pancreas cell, preferably a CNS cell.

[0137] Invention 3

[0138] In a further aspect of the invention, there is provided an RNA editing oligonucleotide capable of effecting ADAR- mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and said the target adenosine is part of a start codon in the 5’ untranslated region of the target RNA molecule.

[0139] In an embodiment, the oligonucleotide wherein the deamination of the target adenosine causes disruption of the start codon, preferably the start codon is an AUG start codon.

[0140] In an embodiment, the start codon is part of an open reading frame (ORF) in the 5’ untranslated region of the target RNA molecule, and / or the oligonucleotide comprises a nucleotide forming a mismatch at the target adenosine, preferably the nucleotide forming a mismatch comprises a cytosine base or a cytosine base analog. In a preferred embodiment, the cytosine base analog is a pyridine base, most preferably the pyridine base is 6-amino-5-nitropyridin-2-one.

[0141] In another embodiment, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog, preferably the uracil analog is a purine, more preferably the purine is an N3-uridine.

[0142] In an embodiment, the oligonucleotide wherein the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar and / or the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar.

[0143] In an embodiment, the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary with a sequence of the target RNA molecule.

[0144] In an embodiment, the oligonucleotide does not comprise a sequence able to form an intramolecular stemloop structure. In an embodiment, the oligonucleotide does not form an intramolecular stem-loop structure. In an embodiment, the oligonucleotide does not form an intramolecular stem-loop structure or forms an intramolecular stem-loop structure which is not necessary for the ADAR-mediated deamination.

[0145] In an embodiment, the oligonucleotide is capable of recruiting an endogenous ADAR.

[0146] In an embodiment, the oligonucleotide has a length of 25 to 60 nucleotides, preferably 30 to 55 nucleotides, more preferably 33 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

[0147] In an embodiment, the oligonucleotide comprises one or more modified or artificial internucleoside linkages. In an embodiment, the oligonucleotide comprises one or more phosphodiester internucleoside linkages.

[0148] In an embodiment, the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (PN-dmi-phosphoramidate).

[0149] In an embodiment, the oligonucleotide comprises one or more modified or artificial sugars. In an embodiment, the one or more modified or artificial sugars: are selected from the group consisting of: 2’-O-methyl, 2’-0-methoxyethyl, 2’-Fluoro, locked nucleic acid (LNA), and an unlocked nucleic acid (UNA) monomer, preferably wherein the one or more sugar modifications are selected from the group consisting of 2’-O-methyl and locked nucleic acid (LNA), and / or comprise one or more LNAs. In one embodiment, the one or more LNAs occur at the 5’ and / or 3’ terminus of the oligonucleotide.

[0150] In an embodiment, the oligonucleotide comprises one or more modified or artificial bases. In one embodiment, the one or more modified or artificial bases comprise one or more inosines. In one embodiment, the one or more modified or artificial bases comprise 5-methyluracil or 5-methylcytosine, preferably 5-methyluracil.

[0151] In an embodiment, the oligonucleotide comprises one or more residues forming a wobble base pair with the target RNA molecule. In an embodiment, the residue forming a wobble base pair comprises a hypoxanthine base, leading to the presence of inosine in the oligonucleotide.

[0152] In an embodiment, the target RNA molecule is a gene associated with PFBC, preferably wherein the target RNA molecule is a Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a Sodium-dependent phosphate transporter 2.

[0153] In an embodiment, the target RNA molecule is a human Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a human Sodium-dependent phosphate transporter 2, preferably wherein the human sodium-dependent phosphate transporter 2 (SLC20A2).

[0154] In an embodiment, the oligonucleotide is capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, and is such that the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and the target adenosine is part of a start codon in the 5’ untranslated region of the target RNA molecule site in the target protein, and the oligonucleotide has at least one of the following features: the base of the nucleotide of the oligonucleotide forming a mismatch at the target adenosine comprises a cytosine base or a cytosine base analog, preferably a pseudoisocytosine, a 6-amino-5- nitro-2(1 H)-pyridinone (Benner’s Z base) or a is 2', 2'-difluoro 2'deoxycytidine (gemcitabine) (preferably the cytosine analog is a Benner’s Z base), the base of the nucleotide of the oligonucleotide forming a mismatch at the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine, the 2’ position of the sugar of the nucleotide opposite the target adenosine and / or of the nucleotide 3’ adjacent to the nucleotide opposite the target adenosine is not substituted, preferably it comprises an -H (sugar is a 2’-deoxyribose and nucleotide is DNA nucleotide) or an -OH (sugar is ribose and nucleotide is RNA nucleotide)

[0155] One or more sugar modifications which are preferably selected from the group consisting of 2’-O- methyl (2’-OMe) and locked nucleic acid (LNA), and which as preferably located at the 5’ and / or 3’ terminus of the oligonucleotide. the internucleotide linkage adjacent to the 5’ and / or 3’ terminus and the one between the first and the second nucleotide residue 3’of the nucleotide residue opposite the target adenosine is a phosphoryl guanidine linkage (PN internucleotide linkage), preferably a PN-dmi-phosphoramidate internucleotide linkage and the oligonucleotide has a length of 25 to 60 nucleotides, preferably 30 to 55 nucleotides, more preferably 33 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

[0156] In an embodiment, the oligonucleotide wherein the human SLC20A2 pre-mRNA or mRNA comprises or consists of the sequence of any one of SEQ ID NOs: 189-191.

[0157] In an embodiment, the oligonucleotide comprises or consists of the base sequence of any one of SEQ ID NOs: 192-195, 208-213, or a sequence having up to 10 mutations with any one of SEQ ID NOs: 192-195, 208-213.

[0158] In an embodiment, the oligonucleotide comprises or consists of the sequence of any one of SEQ ID NOs: 196- 205 and 214-222.

[0159] In an embodiment, the oligonucleotide is for use in medicine, preferably for use in the treatment of primary familial brain calcification (PFBC).

[0160] In a further aspect of the invention, there is provided an pharmaceutical composition comprising an oligonucleotide of the first aspect, preferably for use in medicine, more preferably for use in the treatment of primary familial brain calcification (PFBC). In a further aspect of the invention, there is provided a method for deaminating a target adenosine in a target RNA molecule encoding a target protein in a cell, wherein the target adenosine is part of a start codon in the 5’ untranslated region of the target RNA molecule, said method comprising contacting the cell with an oligonucleotide of the first aspect.

[0161] In an embodiment, the method is an in vitro or an ex vivo method, and / or.

[0162] In an embodiment, the method wherein the cell is a cell of the vascular system or a cell of the nervous system.

[0163] Description of the figures

[0164] Description of the figures

[0165] Figure 1. Quantification of ASO induced mMECP2 R255X RNA editing with plasmid assay. (A) RNA-editing of the premature stop codon in MECP2 R255X from TGA to TGG results in full-length MECP2 protein with an Arginine (R) to Tryptophan (W) substitution at position 255. (B) Plasmid with mMECP2 R255X fused to a 3xFLAG-tag is transfected to NIH3T3 cells with or without ASOs. The FLAG-tag is expressed with the truncated R255X mMECP2 protein and full-length mMECP2. (C) Representative image of WES analysis of protein recovery by ASO. Full-length (-103 kDa) and truncated (-60 kDa) FLAG-mMECP2 proteins are detected using anti-FLAG-tag antibody. No full-length protein was observed without ASO (NT). (D) Full-length mMECP2 protein recovery expressed as % of total FLAG-mMECP2 protein expression (average + / - SD, n=3). NT=none- treated.

[0166] Figure 2: ASOs with LNAs at each termini show higher percentage of full-length mMECP2 protein recovery. Graph comparing the efficacy of 4 sets of ASOs with and without LNAs at both termini. RNA-editing efficacy is measured by assessing the percentage of Full-length FLAG-mMECP2 protein after treatment. The percentage of full-length FLAG-mMECP2 is expressed relative to the percentage obtained with ASO-1 (n=1 ).

[0167] Figure 3: ASOs with internal LNAs show higher percentage of full-length mMECP2 protein. Graph comparing the efficacy of 4 sets of ASOs with none or two internal LNAs. RNA-editing efficacy is measured by assessing the percentage of full-length FLAG-mMECP2 protein after treatment (n=1 ).

[0168] Figure 4: Wobbles increase the percentage of full-length FLAG-MECP2 in mouse and human MECP2 R255X targeting ASOs. Graph comparing the efficacy of 2 sets of ASOs with and without wobbles targeting mouse (A) or human (B) R255X MECP2. RNA-editing efficacy is measured by assessing the percentage of Full-length FLAG-MECP2 protein recovery after treatment (average + / - SD, n=4).

[0169] Figure 5: RNA-editing in patient-derived fibroblasts recovers full-length MECP2 protein

[0170] (A) Characterization by ddPCR of MECP2 expression in cell clones generated through limiting dilution of a parental cell line from a Rett Syndrome female patient. High-purity hMECP2 WT and mutant R255X populations were obtained. (B) RNA-editing of hMECP2 in 3 cell clones after ASO transfection. RNA-editing is measured with a ddPCR SNP assay and it is expressed as % TGG copies of the total copies (TGG+TGA) (average + / - SD, n=2 / 3). (C) On the left, representative WES image showing full-length edited hMEPC2 only after ASO-35 treatment. The graph on the right shows hMECP2 protein levels normalized by total protein (TP) P62041914WQ

[0171] (n=1 ) (D) Representative images of full-length edited hMECP2 immunostainings in clone D after ASO treatment. DAPI was used to stain nucleus.

[0172] Figure 6. Percentage of R255X Mecp2 RNA editing in the hippocampus, cortex, and spinal cord of R255X females after receiving 4 ICV infusions of ASO-4. Bars indicate the mean and standard deviation, while dots indicate the individual values. RNA editing percentage was calculated by dividing the number of TGG copies by the total number of mutant and edited copies (TGA+TGG).

[0173] Figure 7. % RNA editing per ASO as quantified by ddPCR. Variations in base and linkage in the editing enabling region are denoted in the legend as well as absence or presence of wobbles in the ADAR binding region. Abbreviations: C: cytosine, Z: 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base), PO: phosphodiester, PS: phosphorothioate, PNdmi: dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate, NT: no treatment.

[0174] Figure 8. RNA editing detected through Sanger sequencing in FXN positions K195 and K208 in Hela cells after ASO treatment. Arrow indicates changes in height of the ‘G’ peak seen in different ASO treated cells. Graph shows % RNA editing quantified by the ratio of ‘G’ peak height. Abbreviations: NT : no treatment.

[0175] Figure 9. Quantification of % RNA editing of FXN K147R by ddPCR in different healthy and FA patient fibroblasts. Abbreviations: FA: Friedreich’s Ataxia, NT: no treatment.

[0176] Figure 10. Quantification of % RNA editing of FXN K195R by ddPCR in different healthy and FA patient fibroblasts. Abbreviations: FA: Friedreich’s Ataxia, NT: no treatment.

[0177] Figure 11 : Prediction of active uORF in the 5’UTR of SLC20A2 mRNA. (A) Alignment of 5’UTR SLC20A2 human transcript variants. Predicted uORF is indicated in grey and the translation initiation site of the pORF is underlined. The sequence of hSLC20A2_variant 1 is included as SEQ ID NO: 189. The sequence of hSLC20A2_variant 2 is included as SEQ ID NO: 190. The sequence of hSLC20A2_variant 3 is included as SEQ ID NO: 191. (B) Alignment of the 5’UTR from human, mouse and NHP SLC20A2 transcripts. NCBI or Ensembl sequence identifiers including version numbers are shown. NM_001257180.2 is also included as SEQ ID NO: 189. NM_011394.3 is also included as SEQ ID NO: 206. ENSMFAT00000020680.2 is also included as SEQ ID NO: 207. Predicted uORF is indicated in grey and the translation initiation site of the pORF is underlined. In A and B, Starts indicate conserved nucleotides in the three sequences. (C,D) Visualization of ribosomal profiling in the uORF of human (C) and mouse (D) SLC20A2. First row shows position of initiating ribosomes, second row shows position of all ribosomes, third row show RNA-sequencing coverage. Y-axes indicate the number of sequencing reads detected.

[0178] Figure 12. uATG>uGTG mutation in SLC20A2 uORF increases translation of downstream Renilla pORF. (A) Scheme of the vectors used in plasmid assay. (B) Firefly and Renilla Luminescence signal measured with each vector. (C) Renilla I Firefly Ratio relative to the uATG vector.

[0179] Figure 13. RNA-editing of endogenous SLC20A2 uORF in VSMCs.

[0180] Figure 14: % RNA editing of human R255X MECP2 per ASO as quantified by dPCR. Abbreviations: PO: phosphodiester, PS: phosphorothioate, PNdmi: PNdmi: dimethylimidazolidin-2-ylidene (dmi)- P62041914WQ phosphoramidate, G: Guanine, C: Cytosine, LNA: Locked nucleic acid , MOE: 2'-O-(2- Methoxyethyl). Data represented as average and standard deviation.

[0181] Figure 15: % RNA editing of human R255X MECP2 per ASO with various LNA modifications as quantified by dPCR. ASO 176 (SEQ ID NO: 284) represents and ASO without LNAs. Graph illustrates that one internal LNA is enough to increase RNA editing of human R255X MECP2. Data represented as average and standard deviation. Abbreviations: LNA: Locked nucleic acid.

[0182] Figure 16: %RNA editing quantified by dPCR of (A) human FXN K147, (B) human FXN K208 with a PNdmi EER and wings design, (C) FXN K208 PS EER and wings design, (D) PNdmi EER and wings design without inosines. For both K147 and K208, designs with one LNA per wing lead to the best editing efficacy. Data is represented as average and standard deviation. Abbreviations: LNA: Locked nucleic acid, PNdmi: PNdmi: dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate, EER: editing enabling region.

[0183] Figure 17: % RNA editing of SLC20A2 uORF, quantified by ddPCR. One LNA per wing increases RNA editing of SLC20A2 uORF. Data represented as average of two technical replicates. Abbreviations: LNA: Locked nucleic acid

[0184] Figure 18: % RNA editing of STAT1 Y701 and IFNGR1 Y457, quantified by dPCR. 25-mer RNA editing ASOs with or without LNA modifications do not edit STAT1 (SEQ ID NO: 421 ) or IFNGR1 (SEQ ID NO: 422). Data represented as average of two technical replicates.

[0185] Figure 19: % RNA editing of R255X MECP2, quantified by dPCR. Highest RNA editing obtained with 39-mer ASOs containing LNAs (ASOs 172 and 125, SEQ ID NO: 280 and 233) and without 2’ Fluoro modifications. Data represented as average of two technical replicates. Abbreviations: 2’oMe: 2'-O-methyl, LNA: Locked nucleic acid, 2’F: 2’Fluoro.

[0186] Detailed description

[0187] Various features of the aspects and embodiments of this invention are further described below. It is noted that headings used throughout this specification are to assist navigation only and should not be interpreted as definitive, and that features described in different sections may be relevant for all aspects and embodiments described herein and may thus be combined as appropriate.

[0188] Invention 1 relating to an oligonucleotide comprising at least one CRN and which is capable of effecting ADAR-mediated deamination of a target adenosine comprised in a target RNA

[0189] Introduction

[0190] The present inventors have developed improved RNA editing oligonucleotides to enhance the efficiency of intracellular ADAR-mediated deamination of a target adenosine, which is comprised in a target RNA. In some embodiments the target RNA is a protein-coding RNA. In some embodiments, the protein-coding RNA is the target molecule for the oligonucleotide of the invention. In these embodiments, the target molecule may be identified as the precursor messenger RNA (e.g. pre-mRNA) or the mature coding messenger RNA (e.g. mRNA). In some other embodiments, the target RNA molecule of the oligonucleotide of the invention is a noncoding RNA. In these embodiments, the target molecule may be identified as a precursor long non-coding RNA (e.g. pre-lnc RNA). In some embodiments, the non-coding RNA results from alternative splicing of a pre- mRNA. In an embodiment, an RNA editing oligonucleotide according to the invention exhibits improved RNA editing efficiency by virtue of a conformationally restricted nucleotide positioned at the 5’ and / or 3’ termini of the oligonucleotide . In an embodiment, an RNA editing oligonucleotide according to the invention exhibits improved RNA editing efficiency by virtue of a conformationally restricted nucleotide positioned internally. Thus, in an embodiment, an oligonucleotide according to the invention outperforms a control oligonucleotide lacking a conformationally restricted nucleotide at its 5’ and / or 3’ termini and / or positioned internally. Thus, in an embodiment, an oligonucleotide according to the invention outperforms a control oligonucleotide lacking a conformationally restricted nucleotide positioned internally. The improvement of RNA editing efficiency may translate to improvement of target protein levels and / or function relative to oligonucleotide-based strategies for ADAR-mediated RNA editing known in the art. RNA editing oligonucleotides described herein present at least one of the following benefits over the oligonucleotide of the prior art:

[0191] • improved RNA editing efficiency in vitro and in vivo

[0192] • higher levels of full length protein restoration in vitro and / or in vivo

[0193] • improved stability of the oligonucleotide in vivo.

[0194] In the context of the invention, the expression “improved RNA editing efficiency” may mean that the RNA editing efficiency is higher than the one of a counterpart oligonucleotide not having any conformationally restricted nucleotide at its 5’ and / or 3’ termini. In this context, “higher” may mean at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more. The RNA editing efficiency may be assessed in a cellular assay or in an animal model. Suitable cellular assays may be a plasmid assay comprising the mutated target RNA in a cellular system such as NIH3T3 cells. Alternatively a cellular assay may comprise patient cells such as fibroblast patient cells. Suitable animal model are known to the skilled person and depend on the identity of the mutated target RNA. In the case of the RETT syndrome, a suitable animal model may be Mecp2*R255X adult female mice as used in example 5. The RNA editing efficiency may be quantified by the percentage of full-length protein as a read out. Preferred assays have been further described later herein.

[0195] In addition, in the context of the invention, the word “higher” when used in relation with full length protein level may mean that the full length protein level is higher than the one at the onset of the treatment with an oligonucleotide as disclosed herein or is higher than after treatment with a counterpart oligonucleotide not having any conformationally restricted sugar moiety at its 5’ and / or 3’ termini. In this context, “higher” may mean at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% higher or more. The full length protein level may be assessed in a cellular assay or in an animal model. Protein level is synonymous with protein expression level. Protein level may be quantified at the protein or RNA level. Full length in the context of the invention may refer to the healthy protein or protein which does no longer have the mutation leading to a disease or condition or to the edited protein. These assays and models have been earlier described herein. Preferred assays have been further described later herein.

[0196] In the context of the invention, the expression “improved stability” may mean that the stability of the oligonucleotide of the invention is higher than the one of a counterpart oligonucleotide not having any conformationally restricted sugar nucleotide at its 5’ and / or 3’ termini. In this context, “higher” may mean at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% higher or more. The stability may be assessed in a cell-free assay or in a cellular assay or in an animal model. In a preferred embodiment, the stability is assessed in a cell-free assay. In a cell-free assay, oligonucleotide stability is evaluated by measuring the ratio of full-length oligonucleotide to the oligonucleotide fragments that accumulate during incubation with nucleases capable of degrading the oligonucleotide. These models have been described earlier. Oligonucleotides

[0197] In a first aspect, described herein is an oligonucleotide for RNA editing capable of effecting Adenosine Deaminase Acting on RNA (ADAR)-mediated deamination of a target adenosine which is comprised a target RNA, said target RNA preferably encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA, the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN)positioned at the 5’ and / or at the 3’ terminus and / or internally, and the oligonucleotide comprises a mismatch-forming nucleotide positioned opposite of the target adenosine to be deaminated

[0198] RNA editing is a natural process involving the posttranscriptional modification of an RNA nucleotide sequence at one or more positions. Typically, RNA editing reactions are classified into two broad categories based on their reaction mechanisms. One type, insertion / deletion RNA editing, involves the insertion or deletion of nucleotides and changes the length of the target RNA. The second type, RNA editing by base modification, substitutes a nucleotide into a different nucleotide, without changing the overall length of the RNA. Examples of RNA editing are adenosine (A) to inosine (I) and cytidine (C) to uridine (U) conversions through enzymes called adenosine deaminase and cytidine deaminase, respectively. Adenosine-to-inosine (A-to-l) modifications contribute to nearly 90% of all editing events in RNA. The deamination of adenosine is catalysed by the doublestranded RNA-specific adenosine deaminase (ADAR; adenosine deaminase acting on RNA). Inosine (I) is structurally similar to guanosine (G) so preferentially base pairs with cytosine (C) and is translated by the ribosome as G. Accordingly, if an edited adenosine is in a coding region of a (pre-)mRNA, it can recode the protein sequence.

[0199] In mammals, there are three types of ADAR enzymes, ADAR (ADAR1 ), ADARB1 (ADAR2) and ADARB2 (ADAR3), but evidence suggests that ADAR3 is inactive. ADAR1 and ADAR2 are found in many tissues in the body. ADAR2 is expressed to high levels in the brain. The natural RNA editing system has been harnessed for inducing the editing of target RNAs in cells. Different approaches have been described. In one approach, engineered ADAR enzymes or fusion proteins are provided to a cell, together with an oligonucleotide or guide RNA that comprises a specific recruitment portion recognized by the engineered enzyme. For example, Montiel-Gonzalez et al. (Montiel-Gonzalez et al. PNAS 2013, 110(45): 18285-18290) described an RNA editing system based on a genetically engineered fusion protein, comprising an adenosine deaminase domain of the human ADAR2 protein, fused to a bacteriophage lambda N protein, which recognises a boxB RNA hairpin sequence in the guide RNA.

[0200] Other approaches are based on recruiting endogenous ADAR enzymes present in the cell. These approaches have a clear advantage, because the cells do not have to be provided with exogenous engineered protein. For example, WO2016 / 097212 describes oligonucleotides comprising a “targeting portion” complementary to the target RNA and a non-complementary “recruitment portion” capable of forming a stem-loop structure. In addition, later work such as WO2017 / 220751 suggested that it may be possible for endogenous ADAR to be recruited by antisense oligonucleotides (AONs) that lack non-complementary regions or “recruitment portions”. Without being bound by theory and as understood herein, any oligonucleotide capable of effecting ADAR- mediated deamination of a target adenosine in a target RNA comprising a protein-coding or a non-coding RNA is denoted as an “RNA editing oligonucleotide”. The term “oligonucleotide” is defined in the section of the P62041914WQ detailed description entitled General definitions, and throughout this disclosure the terms “oligonucleotide” and “RNA editing oligonucleotide” may be used interchangeably. In a particular embodiment, an oligonucleotide described herein is an antisense RNA-editing oligonucleotide.

[0201] As described hereinabove, RNA editing oligonucleotides of the prior art often comprise non-complementary “recruitment portions”, e.g. ADAR-recruiting sequences capable of forming a stem-loop structure. Recruitment portions comprising stem-loop structures can be used for recruitment of endogenous ADAR enzymes as well as engineered ADAR variants. In this context, it is clear to the skilled person that an engineered ADAR refers to an exogenous and / or recombinant ADAR.

[0202] Examples of mammalian sequences suitable for recruitment of endogenous ADAR enzymes include the R / G binding site from the human Glucagon Receptor 2 (GluR2) and have been described previously (Fukuda, M., Umeno, H., Nose, K. et al. Construction of a guide-RNA for site-directed RNA mutagenesis utilising intracellular A-to-l RNA editing. Sci Rep 7, 41478 (2017). Example of such a sequence comprises: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 99) (SEQ ID NO: 70 from WO2019 / 071274).

[0203] In addition, stem-loop structures can be used to recruit engineered ADAR variants. For example, a sequence capable of recruiting an engineered ADAR may comprise a BoxB sequence as disclosed in details in WO 2019 / 071274, which is incorporated herein by reference in its entirety. Notably, Box-B sequences are used alongside engineered ADAR enzymes for site-directed deamination of a target RNA. In this setup, the A N- peptide (from lambda phage) is fused to the deaminase domain of an ADAR enzyme, while the guide RNA is fused to a Box-B sequence. The Box-B sequence is specifically recognized by the A N-peptide, which allows recruitment of the engineered ADAR to the target mRNA.

[0204] The oligonucleotide of the prior art may comprise a tandem of two BoxB sequences, located upstream and downstream of the target deamination site, respectively. BoxB sequences may comprise the following sequences GCCCUGAAAAAGGGC (SEQ ID NQ:100) (SEQ ID NO: 48 from WQ2019 / 071274) or GGCCCUGAAAAAGGGCC (SEQ ID NO: 101 ) (SEQ ID NO: 49 from WO2019 / 071274). Alternatively or in combination with one or all of the ADAR-recruitment sequences disclosed above, the oligonucleotide of the prior art may exhibit a secondary structure that allows ADAR recruitment and thus indirectly allows ADAR- mediated deamination. Such structures include internal loops. Internal loops may comprise 4, 6, 8, 10 or more mismatched nucleotides. Such loops have been disclosed in WO 2019 / 071274 and in Lehman et al, (1999), J. Mol. Biol., 29(1 ):1-13. In addition to sequences forming stem-loop structures, other strategies for recruitment of engineered ADAR variants include the SNAP-tag, which is a protein domain that covalently binds to nucleotide analogues comprising a benzylguanine (BG) group, referred to as BG-linker (Vogel, P., Moschref, M., Li, Q. et al. Efficient and precise editing of endogenous transcripts with SNAP-tagged ADARs. Nat Methods 15, 535-538 (2018)). An oligonucleotide sequence of the prior art (e.g. an oligonucleotide) may be chemically modified at its 5' end with a BG linker and designed to be complementary to the target RNA sequence. When introduced into cells, the SNAP-tagged ADAR binds covalently to the BG-modified oligonucleotide, forming a stable complex. This complex is guided to the target site on the RNA, where the ADAR domain performs site-specific editing by deaminating the target. In this context, it is clear to the skilled person that an engineered ADAR refers to an exogenous and / or recombinant ADAR.

[0205] In preferred embodiments, oligonucleotides as described herein do not comprise “recruitment portions”, such as sequences capable of forming an intramolecular stem-loop structure capable of recruiting endogenous and / or engineered ADAR. In a preferred embodiment, oligonucleotides described herein do not comprise chemically modified nucleotide analogues comprising a BG group capable of covalent binding to engineered ADAR enzymes. In more preferred embodiments, oligonucleotides of the invention do not comprise the R / G binding site from the human Glucagon Receptor 2 (GluR2), nor Box-B sequences, internal loops, BG-linkers or variants thereof. Therefore, in an embodiment, an oligonucleotide does not comprise SEQ ID NO: 99, SEQ ID NO: 100 and / or SEQ ID NO: 101. In preferred embodiments, an oligonucleotide according to the invention does not comprise a BG-linker or any other variant thereof.

[0206] In a preferred embodiment, an oligonucleotide of the invention is not able to recruit an engineered ADAR (e.g. an exogenous and / or recombinant ADAR).

[0207] Surprisingly, despite lacking ADAR-recruiting sequences or ADAR-recruiting chemical linkers (e.g. BG linker), the oligonucleotides of the invention retain the capacity of recruiting endogenous ADAR and inducing target adenosine deamination, while they have the advantage of being shorter, easier and cheaper to manufacture. In embodiments, an oligonucleotide according to the invention is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, and preferably 75% shorter than an oligonucleotide that comprises ADAR-recruitment portions. Typically the oligonucleotide may be comprised from 26 to 50 nucleotides, or comprises 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. Accordingly, in some embodiments, oligonucleotides as described herein may comprise, consist of or essentially consist of a sequence that is capable of hybridizing with a region in the target RNA molecule (e.g. target region) comprising the target adenosine to be deaminated, said target RNA comprising a protein-coding or a non-coding RNA. As used herein, the wording “capable of hybridizing ” does not mean that the sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, needs to be 100% complementary to the target RNA molecule. Rather, the sequence - not including the mismatch at the target adenosine to be edited - may be at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementary, particularly at least 95%, 97%, 99%, or 100% complementary to the target RNA. In embodiments, an oligonucleotide according to the invention comprises the reverse complement (e.g. is reverse complementary to) of the a region of the target RNA, said target RNA comprising the adenosine to be deaminated. In preferred embodiments, an oligonucleotide according to the invention consists of or essentially consists of the reverse complement (e.g. is reverse complementary to) to a region of said target RNA, said target RNA comprising the adenosine to be deaminated.

[0208] In preferred embodiments, oligonucleotides described herein are thus antisense oligonucleotides ( e.g. AONs or ASOs). In some embodiments, an oligonucleotide as described herein is capable of recruiting an endogenous ADAR. More particularly, it may also be said that the double-stranded complex formed between the oligonucleotides according to the invention and the target RNA recruits an endogenous ADAR. The double stranded complex may form a further complex with the ADAR enzyme. In exemplary embodiments, the minimal length of an oligonucleotide according to the invention that is able to form a double-stranded complex with the target RNA and recruit ADAR is at least 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38 and preferably 39 nucleotides. Such complex comprising the oligonucleotide, the target RNA and an ADAR enzyme is subsequently capable of effecting ADAR-mediated deamination of a target adenosine in the target RNA molecule. In the context of the invention, ADAR recruitment refers to the process in which an endogenous ADAR enzyme is attracted to and binds with a double-stranded complex formed between an oligonucleotide according to the invention and a target RNA. This recruitment facilitates the formation of a further complex that includes the ADAR enzyme, the oligonucleotide, and the target RNA. Once recruited, the ADAR enzyme catalyses the deamination of the target adenosine in the target RNA, converting it to inosine (I) in an ADAR- mediated RNA editing process.

[0209] In some embodiments, the ADAR enzyme is ADAR1 or ADAR2, preferably ADAR2. Human ADAR enzymes are preferred. Target adenosine and target RNA

[0210] As understood herein, the target adenosine is the adenosine nucleotide which is amenable to ADAR-mediated deamination through the formation of a complex between the oligonucleotide described herein, the target RNA, and an ADAR enzyme. An oligonucleotide described herein is capable of forming a double-stranded RNA structure with a region within a target RNA molecule, wherein said double-stranded RNA structure is capable of recruiting the endogenous ADAR enzyme or a functional fragment thereof to a “target adenosine”. For the purposes described herein, such target adenosine is comprised (e.g. is part of) in a target RNA.

[0211] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the target RNA is a protein-coding RNA or a non-coding RNA.

[0212] In some embodiments, a non-coding RNA is a functional RNA that does not encode a protein. In these embodiments, the target molecule may be identified as a precursor long non-coding RNA (e.g. pre-lnc RNA). In some embodiments, the non-coding RNA results from alternative splicing of a precursor mRNA (pre-mRNA). In some embodiments, the non-coding RNA is a long non-coding RNA (IncRNA), a microRNA (miRNA), a circular RNA (circRNA), small nucleolar RNA (snoRNA) and / or a small nuclear RNA (snRNA).

[0213] In some embodiments, a target RNA is a protein-coding RNA, for instance a precursor mRNA (pre-mRNA) or a mature messenger RNA (mRNA). ADAR could in theory act on both pre-mRNA and on mature mRNA. Thus, in exemplary embodiments, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine comprised in a region of a target pre-mRNA, wherein the pre-mRNA is processed to an mRNA encoding a target protein. In embodiments, the target adenosine is comprised in a region of target mRNA encoding a target protein.

[0214] In a particular embodiment, the target adenosine is part of a therapeutic target codon, which is comprised in a target pre-mRNA comprising an mRNA encoding a target protein.

[0215] As further understood herein, a therapeutic target codon is a sequence of three nucleotides comprised in a target region of a target RNA encoding a target protein, wherein deamination of the target adenosine in said therapeutic target codon results in a therapeutic modification of the codon. Alternatively, the therapeutic target codon may be said to be “edited”, “corrected”, “mutated”, “modified”, “deleted”, “changed”, “restored”, “reversed” orthe like. All ofthese expressions may be used interchangeably herein and indicate that the edited (pre-)mRNA will be translated to a functional protein, whose expression pattern is sufficient to ameliorate, delay, prevent, inhibit, cure and / or treat a disease. In a particular embodiment, the edited (pre-)mRNA will be translated to a functional protein, whose spatio-temporal expression pattern is sufficient to ameliorate, delay, prevent, inhibit and / or treat a disease. For purposes disclosed herein, “a spatio-temporal expression pattern” refers to the specific developmental stage or circadian phase within a particular cell or tissue type that influences the protein's function. In exemplary embodiments and as described later herein, the human MECP2 gene is expressed at specific developmental stages and in distinct brain regions, where it plays a key role in neuronal function. Disruptions in its timing or location of expression lead to the neurological deficits characteristic of Rett syndrome. In one embodiment, the target adenosine is part of a codon also called a therapeutic codon: a start codon, a stop codon, a post-translational modification site or a codon comprising a G to A, a C to A or a T to A missense mutation, wherein all codons comprising said target adenosine are correctable by ADAR-mediated deamination of the target adenosine.

[0216] In another embodiment, the target adenosine is part of a codon also called a therapeutic codon. A therapeutic codon may be a start codon, a stop codon, a post-translational modification site or a codon comprising a G to A missense mutation. All codons comprising said target adenosine are correctable by ADAR-mediated deamination of the target adenosine. In a particular embodiment, the therapeutic target codon is a premature stop codon, wherein ADAR-mediated deamination of the target adenosine restores the open reading frame of the edited RNA molecule and thus leads to restoration of protein levels. In a particular embodiment, the therapeutic target codon carries a mutation, for example a mis-sense mutation, which leads to a disease-causing amino acid substitution in the protein. Thus, in a particular embodiment, a target adenosine is part of a disease-causing codon that carries a mis-sense mutation resulting in a dysfunctional protein. In embodiments, an oligonucleotide described herein is capable of restoring protein levels and / or restoring protein function through ADAR-mediated deamination of a target adenosine comprised in a therapeutic target codon, wherein said therapeutic target codon may be a premature stop codon or a codon carrying a missense mutation. In some embodiments, an oligonucleotide described herein is capable of correcting a defective splice site through ADAR-mediated deamination of a target adenosine comprised in a therapeutic target codon, wherein the therapeutic target codon comprises a mutation in a splice site.

[0217] In another embodiment, the target adenosine is comprised in a posttranslational modification site of the protein, whose target RNA is edited by ADAR, wherein the posttranslational modification site may be involved in the protein glycosylation, ubiquitination, nitrosylation, methylation, and / or lipidation pathway. Examples of sites encoding posttranslational modifications that can be targeted with an RNA-editing oligonucleotide according to the invention include the frataxin (FXN) gene, which is linked to the disease Friedreich Ataxia. Friedreich ataxia (FA) is an inherited neurodegenerative disorder characterized by widespread metabolic changes affecting the central and peripheral nervous systems, heart and pancreas (Burk et al. Cerebellum Ataxias, 2017, 4:4). Friedreich Ataxia is caused by a GAA repeat expansion in intron 1 of the frataxin (FXN) gene and patients typically present with over 60 copies of the repeat. The GAA repeat is present in both alleles and causes epigenetic changes that reduce transcription and translation of the gene leading to lower protein levels. An oligonucleotide according to the invention is capable of inducing RNA editing at a specific ubiquitination site in the frataxin (pre-)mRNA, leading to decreased ubiquitination and to increased protein levels.

[0218] In another embodiment, the target adenosine is part of a regulatory site comprising an alternative start codon, a splice donor site, a splice acceptor site, an RNA-binding protein recognition site, a microRNA-binding site, or a ribosome binding site, each of which is comprised in a target RNA and each of which can influence gene expression or translation and are correctable through ADAR-mediated editing of the target adenosine.

[0219] In an embodiment, when the target adenosine is part of a start codon in the 5' untranslated region of a target RNA, its editing by ADAR-mediated deamination can prevent aberrant initiation of translation and thereby restore proper regulation of protein expression. In an embodiment, such editing of a start codon in the 5' untranslated region of the SLC20A2 mRNA (SEQ ID NOs: 189-191 ) provides a therapeutic approach for Primary Familial Brain Calcification (PFBC).

[0220] Accordingly in a preferred embodiment, the oligonucleotide of the invention is such that the target adenosine is part of a codon comprised in a target RNA, wherein the target RNA:

[0221] - is or comprises an endogenous protein coding MECP2 RNA encoding a MECP2 protein, preferably a human MECP2 protein

[0222] - is or comprises Frataxin pre-mRNA or mRNA and the target protein is Frataxin, preferably a human Frataxin protein or

[0223] - is or comprises a Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a Sodium-dependent phosphate transporter 2 protein, preferably a human Sodium-dependent phosphate transporter 2 protein

[0224] In an embodiment, the therapeutic target codon is a stop codon or a codon comprising a G to A, a C to A or a T to A missense mutation, wherein both the stop codon and the codon comprising the missense mutation are correctable by ADAR-mediated deamination of the target adenosine . In an embodiment, the therapeutic target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both codons are correctable by ADAR-mediated deamination of the target adenosine.

[0225] In an embodiment, the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably, wherein the posttranslational modification site is an ubiquitination site and preferably wherein said ubiquitination site is a lysine ubiquitination site, more preferably wherein the codon encoding the lysine ubiquitination site is an AAG or AAA codon.

[0226] In an embodiment, the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably, wherein the posttranslational modification site further comprises a phosphorylation, acetylation, succinylation, glycosylation, nitrosylation, methylation, lipidation, amidation, hydroxylation and / or sulfation site.

[0227] In an embodiment, the deamination of the target adenosine causes disruption of a start codon, preferably wherein the start codon is an AUG start codon, more preferably wherein the start codon is part of an open reading frame (ORF) in the 5’ untranslated region of the target RNA molecule.

[0228] Features relating to MECP2, Frataxin and SLC20A2 are later described herein.

[0229] Conformationally restricted nucleotide (CRN)

[0230] The ability of an oligonucleotide described herein to effect ADAR-mediated deamination of a target adenosine within a target RNA is significantly enhanced due to the presence of at least one conformationally restricted nucleotide (e.g. CRN).

[0231] In one embodiment, an oligonucleotide according to the invention comprises an internal CRN located within the base sequence of the oligonucleotide, preferably an internal LNA

[0232] As used herein, the term “internal CRN” refers to a CRN that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide. Thus, internal CRNs are positioned at any other positions within the base sequence. In embodiments, an internal CRN comprised in an oligonucleotide according to the invention may be positioned 5’ and / or 3’ relative to the mismatch-forming nucleotide, for example:

[0233] Internal CRNs upstream to the mismatch-forming nucleotide (5') are assigned negative positions (-1 , -2, -3, etc.). An internal CRN 5' to the mismatch-forming nucleotide may occupy the -1st through -13th positions upstream the mismatch-forming nucleotide

[0234] Internal CRNs downstream to the mismatch-forming nucleotide (3') are assigned positive positions (+1 , +2, +3, etc.). An internal CRN 3' to the mismatch-forming nucleotide may occupy the +1st through +13th positions downstream from the mismatch-forming nucleotide.

[0235] Unless stated otherwise, the terms “internal CRN”, “internal CRN positioned 5' to the mismatch-forming nucleotide”, and “internal CRN positioned 3' to the mismatch-forming nucleotide” are used interchangeably herein.

[0236] In another embodiment, the oligonucleotide comprises a (or at least one) CRN positioned at the 5’ and / or the 3’ terminus of the oligonucleotide, preferably each CRN is a LNA.

[0237] In an embodiment, the oligonucleotide only comprises a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide, meaning it does not comprise an internal CRN. Preferably each CRN is a LNA

[0238] In another embodiment, the oligonucleotide comprises an internal CRN. In an embodiment, the oligonucleotide only comprises an internal CRN, meaning it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide. Preferably each CRN is a LNA. In yet another embodiment, the oligonucleotide comprises an internal CRN and at least one CRN positioned at the 5’ and / or the 3’ terminus of the oligonucleotide. Preferably each CRN is a LNA.

[0239] As understood herein, the term “conformationally restricted nucleotide” refers to a chemically modified nucleotide (e.g. nucleotide analogue), wherein the sugar moiety is altered to impose steric or electronic constraints that restrict its conformational flexibility. In an embodiment, these modifications typically stabilize a preferred non-planar conformation of the sugar moiety (such as the 3’-endo conformation) and therefore may lead to enhanced binding affinity, nuclease resistance, and / or selectivity in hybridization with complementary nucleic acid target sequences. In preferred embodiments, the terms CRN and "a nucleotide comprising a conformationally restricted sugar moiety” are used interchangeably.

[0240] In embodiments, an activity of an oligonucleotide according to the invention may be further enhanced when a modified or an artificial internucleoside linkage links the CRN (i.e nucleotide comprising a conformationally restricted sugar moiety) to its neighbour nucleotide. In an embodiment, the internal CRN is linked to one of its 5’ or 3’ neighbour nucleotides by at least one modified or artificial internucleoside linkage. In an embodiment, the internal CRN is linked to both of its 5’ and 3’ neighbour nucleotides by a modified or artificial internucleoside linkage. In another embodiment, a modified or artificial internucleoside linkage links the CRN positioned at the 5’ and / or 3’ termini of the oligonucleotide to a neighbour nucleotide. If there are more than one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) at the 5’ and / or 3’ termini, the modified or artificial internucleotide linkage may link both CRNs (i.e. nucleotides comprising said conformationally restricted sugar moieties). The term “internucleoside linkage” is defined later herein in the section “General definitions”. Preferred internucleoside linkages in this context are a phosphorothioate (PS) or a phosphoryl guanidine (PN) (preferably a dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi- phosphoramidate, or PN-dmi)) linkage.

[0241] Examples of nucleotides that cannot be considered conformationally restricted nucleotides in the context of the invention are nucleotides comprising sugar moieties that do not belong to the group of conformationally restricted sugars, and include the group of 2’-O-substituted RNA nucleotide analogues comprising 2’-O-methyl, 2’-0-(2-cyanoethyl), 2’-0-(2-methoxy)ethyl (2 -MOE), 2’-0-(2-thiomethyl)ethyl, 2’-O-butyryl, 2’-O-propargyl, 2’- O-allyl, and 2’-0-(2S-methoxypropyl), 2’-0-(N-(aminoethyl)carbamoyl)methyl (2’-AECM), 2’-O-(2- carboxyethyl), 2’-0-(3-amino)propyl, 2’-0-(3-(dimethylamino)propyl), 2’-0-(2-amino)ethyl, 2’-O-(2- (dimethylamino)ethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457).

[0242] Also included is the group of 2’-0-alkoxycarbonyl derivatives such as 2’-0-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-0-[2-(N-methylcarbamoyl)ethyl] (MCE), 2’-0-[2-(N,N-dimethylcarbamoyl)ethyl] (DOME), 2’-O-[2- (methylthio)ethyl] (2’-MTE), 2’-(co-0-serinol). Other ribose modifications that are considered to be non- conformationally restricted comprise 2’-halo: e.g., 2’-fluoro, including FANA (2’-F arabinosyl nucleic acid), 2’, 4’- difluoro-2’-deoxy, carbasugar and azasugar modifications and unlocked nucleic acid (UNA) monomer (Lankjaer et al., Bioorg. Med. Chem., 2009). The following nucleotides comprising modifications at alternative sugar positions are also considered to be non-conformationally restricted: 3’-O-substituted: e.g., 3’-O-methyl, 3’-O-butyryl, 3’-O-propargyl, 4’-substituted: e.g., 4’-aminomethyl-2’-0-methyl, 4’-aminomethyl-2’-fluoro and 5’- substituted: e.g., 5’-methyl, or CNA (Ostergaard et al., ACS Chem. Biol., 2014). Furthermore, nucleotides comprising non-conformationally restricted sugar moieties are 2’-deoxy (i.e., DNA), 2’-0-(haloalkoxy)methyl (Arai et al., Bioorg. Med. Chem., 2011 ), such as 2’-0-(2-chloroethoxy)methyl (MCEM) and 2’-O-(2,2- dichloroethoxy)methyl (DCEM). In preferred embodiments, oligonucleotides according to the invention display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2 -O-M ethyl (2’-OMe) or 2’-0-Methoxyethyl (2’-MOE).

[0243] In preferred embodiments, oligonucleotides comprising at least one internal CRN according to the invention display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-M ethyl (2’-OMe) or 2’-0-Methoxyethyl (2’-MOE) at the same position.

[0244] In some embodiments, oligonucleotides comprising at least one CRN positioned at the 5’ and / or 3’ termini display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-M ethyl (2’-OMe) or 2’-0-Methoxyethyl (2’-MOE) at their 5’and / or 3’termini

[0245] In further embodiments, oligonucleotides comprising at least one internal CRN and at least one terminal CRN positioned at the 5’ and / or 3’ termini display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-Methyl (2’-OMe) or 2’-0-Methoxyethyl (2’-MOE) at the corresponding positions.

[0246] As understood herein, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) may be selected from the group of bridged nucleic acids (BNA). Bridged nucleic acids (BNAs) are types of nucleotides in which the pucker of the ribose sugar is constrained in the 3’-endo conformation via a bridge between the 2’ and 4’ carbon atoms. The group of BNAs may comprise a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an a-LNA monomer, an a-L-LNA monomer, a p-D-LNA monomer, a 2’-amino-LNA monomer, a 2’- (alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’-N-substituted-2’-amino-LNA monomer, a 2’- thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’,4’-BNANC(N-H) monomer, a 2’,4’-BNANC(N-Me) monomer, a 2’ ,4’- BNANC(N-Bn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba LNA (cLNA) monomer, a 3,4-dihydro-2H-pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl-linked), an amido-bridged BNA monomer, an urea-bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-L-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an abcDNA monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino-LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene-bridged nucleic acid (scpBNA) monomer, cyclohexenyl nucleic acid (CeNA) monomer , altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer, fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer, 3'-deoxypyranosyl-DNA (p-DNA) monomer.

[0247] The most commonly used variations are locked nucleic acid (LNA), 2’,4’-constrained 2’-O-ethyl (constrained ethyl) BNA (cEt) and, 2’-O,4’-C-ethylene-bridged nucleic acid (ENA).

[0248] In a preferred embodiment, the CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety or called Conformationally Restricted Nucleotide) is a BNA and may be 2’,4’-Constrained 2’-O-ethyl BNA (cEt- BNA), a 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and preferably is a Locked Nucleic Acid (LNA).

[0249] In embodiments, the oligonucleotide is a single-stranded oligonucleotide that does not comprise a sequence capable of forming an intramolecular stem-loop structure for ADAR recruitment. In some embodiments, the oligonucleotide is free of any internal complementarity that would promote intramolecular secondary structure formation. Accordingly in a preferred embodiment, in the absence of ADAR-recruiting features, the oligonucleotide comprises at least one CRN within the sequence that is capable of hybridizing with a region of the target RNA, such that the CRN contributes directly to the targeting function. In particular embodiments, the CRN is a locked nucleic acid (LNA). In some embodiments, the CRN or LNA is located within the central portion of the hybridizing region. In other embodiments, the CRN or LNA is positioned at one or both termini of the hybridizing region. In yet further embodiments, more than one CRN or LNA may be present within the hybridizing region.

[0250] In additional embodiments, the oligonucleotide does not comprise any 2’-fluoro (2’F) nucleotide. In embodiments, the sequence of the oligonucleotide is entirely devoid of 2’F nucleotides. In other embodiments, the oligonucleotide comprises ribonucleotides and / or other modified nucleotides, provided that no 2’F nucleotide is included.

[0251] Thus, in an embodiment, an oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide, wherein the CRN, preferably the LNA, is part of the sequence capable of hybridizing with a region of the target RNA, wherein the oligonucleotide does not comprise any 2’F nucleotide and / or when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other.

[0252] In short, in a preferred embodiment, an oligonucleotide is such that:

[0253] - the oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide,

[0254] - wherein the CRN, preferably the LNA, is part of the sequence capable of hybridizing with a region of the target RNA,

[0255] - wherein the oligonucleotide does not comprise any 2’F nucleotide and / or

[0256] - when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other.

[0257] The oligonucleotide according to the invention comprising a CRN may further comprise a modified base. The term “base modification” or “modified base” as identified herein refers to the modification of a naturally occurring base in RNA (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as “modified” by comparison to an existing base. If such a base is a modified base or if a base analogue is being used, said modified base or base analogue should preferably keep the same base pair specificity as the base it replaces. “Base pairing” refers to the binding of two bases (or nucleobases) to each other by hydrogen bonds. Specifically, a nucleobase analogue replacing cytosine is capable of base pairing with guanine, a nucleobase analogue replacing guanine is capable of base pairing with cytosine, a nucleobase analogue replacing adenine is capable of base pairing with uracil and a nucleobase analogue replacing uracil is capable of base pairing with adenine. Modified or artificial bases as used herein may include modified versions of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine (as present in e.g. inosine), orotic acid, agmatidine, lysidine, pseudouracil, N1-methylpseudouracil, dihydrouracil, N3-uracil, N1-methyl-pseudouracil, 5- formylcytosine, 5-acetylcytosine, 5-hydroxycytosine, N6-methyladenine, 8-oxoadenine, 7-methyladenine, 1- methylguanine, 7-methylguanine, N2,N2-dimethylguanine, N2,N2,7-trimethylguanine, N2,7-dimethylguanine, 6-amino-5-nitropyridin-2-one 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5- substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5- hydroxymethyluracil, 5-methyluracil (thymine), 5-methylcytosine, 5-aminomethylcytosine, 5- hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 2,6-diaminopurine, 7-aza-2,6- diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2- aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1-deoxyribose, 1 ,2- dideoxyribose, l-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US patent 6,683,173 (Epoch Biosciences), which is incorporated here by reference.

[0258] Preferred modified bases include 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues. Non-limiting examples of cytosine and uracil analogues are discussed hereinbelow in the context of the mismatch-forming nucleotide.

[0259] In an embodiment disclosed herein, an oligonucleotide comprising a CRN, preferably an LNA with a modified base, even more preferably an internal LNA comprising 5-methylcytosine, exhibits an improved parameter over an oligonucleotide comprising an LNA without a modified base. Such parameter may include improved duplex stability, improved hybridization specificity, enhanced nuclease resistance and / or reduced immune stimulation.

[0260] In an embodiment, at least one and preferably two internal CRNs are present. In exemplary embodiments, such an oligonucleotide further comprises at least one additional CRN positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of CRNs:

[0261] • at least one internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0262] • at least two internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0263] • at least three internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0264] • at least one internal CRN and at least one CRN positioned at the 3’ terminus of the oligonucleotide

[0265] • at least one internal CRN and at least one CRN positioned at the 5’ terminus of the oligonucleotide

[0266] • at least one internal CRN and two additional CRNs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0267] • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide

[0268] • at least one internal CRN and two CRNs positioned at the 5’ terminus of the oligonucleotide

[0269] • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide as well as two CRNs positioned at the 5’ terminus of the oligonucleotide

[0270] In a preferred embodiments, an oligonucleotide according to the invention comprises two internal CRNs and may further comprise at least one terminal CRN positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0271] In the context of the invention “internal CRN” means that the CRN is not located at one or at both termini of the oligonucleotide. It means said CRN is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal CRN” refers to a CRN that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0272] In each of these embodiments, the CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) may be a BNA such as a 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA), a 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and preferably the BNA is a Locked Nucleic Acid (LNA). In an embodiment, at least one and preferably two CRNs (i.e. nucleotide comprising a conformationally restricted sugar moiety) are positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide described herein. In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at the 5’ terminus of an oligonucleotide according to the invention. In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at the 3’ terminus of an oligonucleotide according to the invention. In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at both the 5’ and 3’ termini of an oligonucleotide according to the invention. In an embodiment, two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) are positioned at the 5’ terminus of an oligonucleotide according to the invention. In an embodiment, two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) are positioned at the 3’ terminus of an oligonucleotide according to the invention. In yet another embodiment, two CRNs (i.e. nucleotide comprising conformationally restricted sugar moieties) are positioned at both the 5’ and 3’ termini of an oligonucleotide according to the invention.

[0273] In an embodiment, the oligonucleotide comprises at least one LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising at least one LNA at the 5’ terminus and / or the most terminal nucleotides comprising one LNA at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PN-dmi linkage.

[0274] In yet further embodiments, the oligonucleotide comprises two CRNs at one terminus or at each terminus. Preferably each CRN is a LNA. In some embodiments, the two CRNs positioned at a given terminus are directly adjacent to each other in the nucleotide sequence, i.e., without any intervening nucleotide, and are thus referred to as “contiguous.” Preferably each CRN is a LNA.

[0275] In other embodiments, two CRNs are positioned at each terminus of the oligonucleotide in a contiguous manner. In particular embodiments, the contiguous CRNs are located at the 5' terminus. In other embodiments, the contiguous CRNs are located at the 3' terminus. In yet further embodiments, contiguous CRNs are located at both the 5' and the 3' termini of the oligonucleotide. Preferably each CRN is a LNA.

[0276] In an embodiment, the oligonucleotide comprises two contiguous LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising two contiguous LNAs at the 5’ terminus and / or the most terminal nucleotides comprising two contiguous LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PN-dmi linkage.

[0277] In one embodiment, at least one internal CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) comprises a Bridged Nucleic Acid (BNA), such as 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA) or 2’- O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and preferably the BNA is a Locked Nucleic Acid (LNA.)

[0278] In one embodiment, at least one, and preferably two, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) positioned at the 5’ and / or 3’ termini of an oligonucleotide described herein comprise a Bridged Nucleic Acid (BNA), such as 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA) or 2’-O,4’-C-Ethylene- Bridged Nucleic Acid (ENA), and preferably the BNA is a Locked Nucleic Acid (LNA.) In an embodiment, a phosphorothioate (PS) internucleoside linkage links the CRN of the oligonucleotide of the invention to its neighbour nucleotide, with each PS and CRN being , at the 5’ and / or 3’ termini of the oligonucleotide or at both positions. In an embodiment, if there are two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) at the 5’and / or 3’ termini of the oligonucleotide, the PS internucleoside linkage may link each of the CRNs at the 5’ and / or at the 3’termini together.

[0279] In an embodiment, a PN internucleoside linkage links the nucleotide of the oligonucleotide of the invention that comprises a CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) to its neighbour nucleotide, with each PN and CRN being positioned either 5’ to the mismatch-forming nucleotide, at the 5’ and / or 3’ termini of the oligonucleotide, or at both positions. In an embodiment, if there are two conformationally restricted sugar moieties at the 5’and / or 3’ termini of the oligonucleotide, the PN internucleoside linkage may link each of the nucleotides comprising a conformationally restricted sugar molecule at the 5’ and / or at the 3’termini together.

[0280] In a preferred embodiment, the PN internucleoside linkage is a PNdmi internucleoside linkage.

[0281] In an embodiment, a PN and a PS internucleoside linkages are present at such positions in the oligonucleotide of the invention. In an embodiment, a PN internucleoside linkage links the internal CRN to a neighbouring nucleotide. In an embodiment, the internal CRN is linked to one of its 5’ or 3’ neighbour nucleotides by at least one PS and / or PS internucleoside linkage. In an embodiment, the internal CRN is linked to both of its 5’ and 3’ neighbour nucleotides by a PS and / or PS internucleoside linkage. In an embodiment, a PN internucleoside linkage links the nucleotide of the oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 5’ terminus and a PS internucleoside linkage links the nucleotide of the oligonucleotide ofthe invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 3’ terminus. In an embodiment, if there are two CRNs (i.e. nucleotides with conformationally restricted sugar moieties) at the 5’ and / or 3’ termini of the oligonucleotide, the PN internucleoside linkage may link each of the CRNs (i.e. nucleotides comprising a conformationally restricted sugar molecule) at the 5’ terminus and the PN internucleoside linkage may link each ofthe CRN at the 3’terminus together. The reverse position of the internucleotide linkage is also encompassed by the invention.

[0282] In a preferred embodiment, the PN internucleoside linkage is a PNdmi internucleoside linkage.

[0283] In one embodiment, at least one, and preferably two, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) of the oligonucleotide, each positioned internally and / or at the 5’ and / or 3’ termini of an oligonucleotide described herein are Bridged Nucleic Acids (BNAs), such as 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA), 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and / or Locked Nucleic Acid (LNA). A preferred conformationally restricted sugar moiety is a LNA.

[0284] In another embodiment, the CRN (i.e. nucleotide comprising conformationally restricted sugar moiety) positioned internally and / or at one or both termini of the oligonucleotide is a BNA, such as LNA, and a modified internucleoside linkage, such as a Phosphorothioate (PS) linkage links said CRN (i.e. nucleotide comprising said conformationally restricted sugar moiety) to its neighbour nucleotide.

[0285] In another embodiment, the conformationally restricted sugar moieties positioned internally and / or at one or both termini of the oligonucleotide are a BNA, such as LNA, and a modified internucleoside linkage, such as a PN linkage links said nucleotide comprising said conformationally restricted sugar moiety to its neighbour nucleotide. In an embodiment the PN linkage is a PN-dmi linkage.

[0286] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention, wherein the conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNAs), and preferably is a Locked Nucleic Acid (LNA).

[0287] In an embodiment, an oligonucleotide according to the invention comprises at least one conformationally restricted sugar moiety, which is a BNA, and preferably an LNA, and is positioned internally. Preferably, the oligonucleotide only comprises internally CRN (preferably BNA, more preferably LNA), meaning the oligonucleotide does not comprise any CRN (preferably BNA, more preferably LNA) that is positioned at the 5’ and / or 3’ terminus of the oligonucleotide.

[0288] In an embodiment, at least one conformationally restricted sugar moiety is a BNA, and preferably an LNA, and is positioned at the 5’ terminus of an oligonucleotide according to the invention. In an embodiment, at least one conformationally restricted sugar moiety is a BNA, and preferably an LNA, and is positioned at the 3’ terminus of an oligonucleotide according to the invention. Preferably, the oligonucleotide only comprises CRN (preferably BNA, more preferably LNA) that are positioned at the 5’ terminus and / or 3’ terminus of the oligonucleotide, meaning this oligonucleotide does not comprise any internal CRN (preferably BNA, more preferably LNA)

[0289] In an embodiment, at least one conformationally restricted sugar moiety is a BNAs, and preferably an LNA, and is positioned at both the 5’ and 3’ termini of an oligonucleotide according to the invention.

[0290] In an embodiment, two conformationally restricted sugar moieties are BNAs, and are preferably LNAs, and are positioned at the 5’ terminus of an oligonucleotide according to the invention. In an embodiment, two conformationally restricted sugar moieties, are BNAs, and preferably are LNAs and are positioned at the 3’ terminus of an oligonucleotide according to the invention.

[0291] In one embodiment, at least one and preferably two Bridged Nucleic Acids (BNAs), even more preferably two LNAs are positioned at the 5’ and / or 3’ termini of an oligonucleotide described herein.

[0292] In one embodiment, at least two Bridged Nucleic Acids (BNAs), even more preferably two LNAs are positioned at the 5’ and 3’ termini of an oligonucleotide described herein.

[0293] In an embodiment, at least one and preferably two internal LNAs are present. In some embodiments, this oligonucleotide does not comprise any LNA positioned at the 5’ and / or at the 3’ terminus. In some other embodiments, such an oligonucleotide further comprises at least one additional LNA positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of internal and terminal LNAs:

[0294] • at least one internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0295] • at least two internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0296] • at least three internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0297] • at least one internal LNA and at least one LNA positioned at the 3’ terminus of the oligonucleotide

[0298] • at least one internal LNA and at least one LNA positioned at the 5’ terminus of the oligonucleotide

[0299] • at least one internal LNA and two additional LNAs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0300] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide • at least one internal LNA and two LNAs positioned at the 5’ terminus of the oligonucleotide

[0301] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide as well as two LNAs positioned at the 5’ terminus of the oligonucleotide

[0302] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0303] In preferred embodiments, an oligonucleotide according to the invention comprises two internal LNAs. In an embodiment, this oligonucleotide does not comprise other LNAs, meaning it does not comprise any LNA positioned at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0304] In another embodiment, the oligonucleotide comprising two internal LNAs may further comprise at least one terminal LNA positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0305] In an embodiment, an oligonucleotide comprising at least one, and preferably two internal BNAs (more preferably two LNAs) leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full-length protein following ADAR-mediated deamination of a target adenosine comprised in a target RNA. In an embodiment, the activity of an oligonucleotide comprising at least one, and preferably two internal BNAs (more preferably two internal LNAs) may be further enhanced by the presence of an additional BNA (preferably an LNA) positioned at the 5’ and / or 3’ terminus of the oligonucleotide. In preferred embodiments, an oligonucleotide according to the invention comprises at least one internal BNA (preferably an LNA), which is combined with a 5’ terminal BNA (preferably an LNA)

[0306] In an embodiment, an oligonucleotide comprising at least one, and preferably two BNAs (more preferably two LNAs) at both its 5’ and 3’ termini leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full length protein following ADAR-mediated deamination of a target adenosine comprised in a target RNA.

[0307] In an embodiment, an oligonucleotide comprising at least one, and preferably two internal LNAs leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full-length protein restoration following ADAR-mediated deamination of a target adenosine comprised in a target RNA. In an embodiment, the activity of an oligonucleotide comprising at least one, and preferably two internal LNAs may be further enhanced by the presence of an additional LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide. In preferred embodiments, an oligonucleotide according to the invention comprises at least one internal LNA, which is combined with a 5’ terminal LNA.

[0308] In an embodiment, an oligonucleotide comprising at least one, and preferably two LNAs at both its 5’ and 3’ termini leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full length protein restoration following ADAR-mediated deamination of a target adenosine comprised in a target RNA.

[0309] In an embodiment, protein restoration (or full length protein expression level restoration) is assessed after overexpression of mutant flag-tag protein by western blot with an antibody targeting the Flag at the N-terminal portion ofthe protein, wherein the level of protein restoration is expressed as a percentage of full-length protein over total protein (truncated protein and full length) (Example 1 ). In another embodiment, endogenous protein restoration (or full-length protein expression level) is assessed by western blot with an antibody targeting the endogenous full-length protein, wherein the level of protein restoration is expressed as full-length protein levels compared to untreated samples (Example 4). In an embodiment, protein restoration (or full length protein expression level) is a consequence of ADAR-mediated target RNA (e.g. pre-mRNA or mRNA) editing in a human cell, wherein said editing is effected by an oligonucleotide described herein. In an embodiment, an oligonucleotide described herein has at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and preferably 100% RNA editing efficiency in vitro. In an embodiment, in vitro editing is performed in a cell line transfected with R255X mutant allele of murine or human MECP2 (Example 1 , 2 and 3). In another embodiment, in vitro editing is performed in cultured cells obtained from patients that carry the R255X mutant allele of human MECP2 (Example 4). In an embodiment, an oligonucleotide described herein has at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and preferably 100% RNA editing efficiency in vivo. In an embodiment, an oligonucleotide described herein is delivered in vivo to the brain of mice that harbour the R255X mutant allele of murine MECP2 trough intraventricular infusion (Example 5). In an embodiment, RNA editing efficiency is assessed by digital droplet PCR (ddPCR) and is expressed as the copies of edited alleles over the sum of edited and mutant alleles per reaction volume (copies / pl). In an embodiment, RNA editing efficiency is synonymous with full length protein level (or control protein level or wild type protein level) restoration. In an embodiment, the efficacy of the oligonucleotide has been assessed in the cortex, and in the hippocampus, and in the Spinal Cord.

[0310] In an embodiment, ADAR-mediated deamination of a target adenosine with an oligonucleotide comprising one and preferably two internal LNAs enhances protein restoration by at least 40% (1.4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8-fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1-fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an LNA-free oligonucleotide. In a further embodiment, such oligonucleotide further comprises at least one terminal LNA positioned at its 5’ and / or 3’ termini.

[0311] In an embodiment, ADAR-mediated deamination of a target adenosine with an oligonucleotide comprising oneand preferably two LNAs at both its 5’ and 3’ termini enhances protein restoration by at least 40% (1.4- fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1 .7-fold), 80% (1 .8-fold), 90% (1 .9-fold), 100% (2.0-fold), 110% (2.1- fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an oligonucleotide with LNA-free termini.

[0312] In an embodiment, functional full-length protein restoration is achieved with an oligonucleotide comprising two LNAs (e.g. 2 internal LNAs or 2 LNAs at the 5’ terminus or 2 LNAs at the 3’ terminus or one LNA at both the 5’ and the 3’ termini). In another embodiment, detectable levels of full-length protein restoration are achieved with an oligonucleotide comprising one LNA (e.g. one internal LNA or one LNA positioned either at the 5’ or at the 3’ terminus of the oligonucleotide). In the context of the invention, "functional” and / or "detectable” levels of full-length protein restoration achieved with an oligonucleotide described herein means a measurable increase of full-length protein levels using an assay known to a person skilled in the art. A functional level of full-length protein restoration may be at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and preferably is 100% relative to a control. A detectable level of full-length protein restoration may be at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and preferably is 50% relative to a control. In an embodiment, a control used to assess the level of full-length protein restoration obtained with an oligonucleotide according to the invention is a sample from an untreated patient. In another embodiment, a control used to assess the level of full-length protein restoration is a sample from a healthy individual. In an embodiment, both the functional and detectable levels of full-length protein restoration obtained using an oligonucleotide according to the invention have a therapeutic effect (e.g. are sufficient to ameliorate, delay, prevent, inhibit, cure and / or treat a disease). In embodiments, an oligonucleotide comprising at least one internal LNA may further comprise at least one terminal LNA positioned at the 5’ and / or 3’ termini of the oligonucleotide. In another embodiment, oligonucleotides described herein may comprise only terminal LNAs and no internal LNAs.

[0313] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0314] In an embodiment, ADAR-mediated deamination of a target adenosine with an oligonucleotide comprising one, and preferably two LNAs at both its 5’ and 3’ termini enhances protein restoration by at least 40% (1 .4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8-fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1-fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an LNA-ends free oligonucleotide.

[0315] The expression “LNA-ends free oligonucleotide” or “LNA-free termini” as understood herein denotes oligonucleotides that do not comprise any LNA in their 3’ and / or 5’ termini. It is not ruled out that a LNA may be present internally. In the context of the invention, an oligonucleotide that lacks an internal LNA and an LNA positioned at its 5’ and / or 3’ termini, is referred to as an “LNA-free” oligonucleotide.

[0316] The efficiency of ADAR-mediated target adenosine deamination with an oligonucleotide described herein may be further enhanced by the number of LNAs positioned at the oligonucleotide’s 5’ and / or 3’ termini and / or by the number of internal LNAs and by the type of internucleoside linkage linking nucleotides comprising said LNA at the 5’ terminal (and / or at the 3’terminus) and / or internal LNA.

[0317] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of this disclosure, wherein the oligonucleotide comprises at least one and preferably two LNAs positioned at both the 5’ and 3’ termini of the oligonucleotide, wherein the most terminal one or two LNAs at the 5’ terminus and the most terminal one or two LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage.

[0318] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of this disclosure, wherein the oligonucleotide comprises at least one and preferably two LNAs positioned at both the 5’ and 3’ termini of the oligonucleotide, wherein the most terminal one or two LNAs at the 5’ terminus and the most terminal one or two LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, which is a PN internucleoside linkage, preferably a PN-dmi internucleoside linkage.

[0319] In one embodiment, an oligonucleotide described herein comprises one LNA at the 5’ terminus or one LNA at the 3’ terminus. In a particular embodiment, the oligonucleotide comprises at least one LNA at both the 5’ and 3’ termini. In another embodiment, the oligonucleotide comprises two LNAs at the 5’ terminus or two LNAs at the 3’ terminus. In a particular embodiment, the oligonucleotide comprises two LNAs at both the 5' and 3' termini. In a further embodiment, the oligonucleotide comprises one LNA at the 5'terminus and two LNAs at the 3' terminus. In a further embodiment, the oligonucleotide comprises two LNAs at the 3' terminus and one LNA at the 5' terminus.

[0320] In further embodiments, the most terminal LNA at one or both termini is linked via a modified or artificial internucleoside linkage. In further embodiments, the two most terminal LNAs at one or both termini of the oligonucleotide are linked via a modified or artificial internucleoside linkage. Types of internucleoside linkages are described earlier hereinabove.

[0321] In an embodiment, at least one and preferably two internal LNAs are present. In exemplary embodiments, such an oligonucleotide further comprises at least one additional terminal LNA positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of LNAs:

[0322] • at least one internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0323] • at least two internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0324] • at least three internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0325] • at least one internal LNA and at least one LNA positioned at the 3’ terminus of the oligonucleotide

[0326] • at least one internal LNA and at least one LNA positioned at the 5’ terminus of the oligonucleotide

[0327] • at least one internal LNA and two additional LNAs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0328] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide

[0329] • at least one internal LNA and two LNAs positioned at the 5’ terminus of the oligonucleotide

[0330] • at least one internal LNA and two LNAs, positioned at the 3’ terminus of the oligonucleotide, whereas the other two are positioned at the 5’ terminus of the oligonucleotide

[0331] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0332] In preferred embodiments, an oligonucleotide according to the invention comprises two internal LNAs and may further comprise at least one terminal LNA positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0333] In a particular embodiment, an oligonucleotide described herein comprises one LNA at the 5’ terminus or one LNA at the 3’ terminus, wherein the nucleotide comprising the LNA is linked via another nucleotide via a phosphorothioate (PS) linkage. In another embodiment, an oligonucleotide comprises one LNA at both the 5’ and 3’ termini, wherein each nucleotide comprising said LNA is linked via another nucleotide via a phosphorothioate (PS) linkage. In further embodiments, an oligonucleotide comprises two LNAs at either the 5’ or 3’ terminus, or two LNAs at both the 5' and 3' termini, wherein the nucleotides comprising the two most terminal LNAs positioned at the 5' and 3' termini are linked via a phosphorothioate (PS) linkage.

[0334] In a further embodiment, an oligonucleotide described herein comprises one LNA at the 5' terminus and two LNAs at the 3' terminus, wherein the most terminal nucleotide comprising the LNA at the 5' terminus is linked to another nucleotide via a PS linkage and the two most terminal nucleotide comprising the LNAs at the 3' terminus are linked together via a phosphorothioate (PS) linkage. In a further embodiment, an oligonucleotide described herein comprises one LNA at the 3' terminus and two LNAs at the 5' terminus, wherein the most terminal nucleotide comprising the LNA at the 3' terminus is linked to another nucleotide via a PS linkage and the two most terminal nucleotide comprising the LNAs at the 5' terminus are linked together via a phosphorothioate (PS) linkage. In further embodiments, the efficiency of ADAR-mediated deamination of a target adenosine with an oligonucleotide described herein is further improved by the presence of additional LNAs positioned away from the 5’ and / or 3’ termini of the oligonucleotide. As understood herein, the term “away” refers to at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22 nucleotide residues away from the one or two most terminal LNAs positioned at the 5’ and / or 3’ termini of an oligonucleotide described herein.

[0335] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention, wherein the oligonucleotide further comprises at least one and preferably two internal LNAs located upstream of the mismatch-forming nucleotide. Oligonucleotides according to this embodiment may exhibit functional full-length protein restoration as earlier defined herein (see Example 2). In an embodiment, it is expected that oligonucleotides comprising an LNA at one or at both of their termini in combination with an internal LNA have a higher editing activity compared to oligonucleotides with only LNA at one or both of their termini or oligonucleotides with only internal LNA. In one embodiment, an oligonucleotide according to the invention does not comprise an internal stretch of 2’-MOE nucleotide residues, wherein said nucleotide residues are joined with PS linkages.

[0336] As understood herein, nucleotides positioned 5’, the mismatch-forming oligonucleotide are denoted as having the -nth position from the mismatch-forming nucleotide. Similarly, nucleotides positioned 3’ to the mismatchforming nucleotide are denoted as having the +nth position from the mismatch-forming nucleotide.

[0337] For example, an internal LNA may occupy the -1 st, -2nd, -3rd, -4th, -5th , -6th, -7th, -8th, -9th, -10th, -11th, - 12th, -13th position 5’ to the mismatch-forming nucleotide. In embodiments, an oligonucleotide provided herein has one internal LNA positioned at the -1 st, -2nd, -3rd, -4th, -5th , -6th, -7th, -8th, -9th, -10th, -11th, -12th, -13th position 5’ to the mismatch-forming nucleotide. In a particular embodiment, an oligonucleotide provided herein has two internal LNAs, preferably positioned at the -2nd and -8th position upstream from the mismatch-forming oligonucleotide. In embodiments, two additional LNAs positioned upstream ofthe mismatch-forming nucleotide improve the efficiency of target adenosine deamination when combined with a C or G nucleotide placed in the + 1 st position from the mismatch-forming nucleotide. As shown in Example 2, oligonucleotides comprising two additional LNAs positioned upstream of the mismatch-forming nucleotide, wherein a C or G is nucleotide placed in the +1 st position from the mismatch-forming oligonucleotide, higher target RNA-editing efficacy (e.g. target adenosine deamination), which results in a higher percentage of full-length target protein measured with a plasmid assay. Thus, in embodiments, oligonucleotides comprising additional LNAs positioned upstream of the mismatch-forming nucleotide result in at least 10% (1 .1x), 20% (1.2x), 30% (1.3x), 40% (1.4x), 50% (1.5x), 60% (1.6x), 70% (1.7x), 80% (1.8x), 90% (1.9x), and preferably 100% (2.0x) increase of full-length target protein restoration relative to oligonucleotides comprising only 5’ and 3’ LNAs. In embodiments, oligonucleotides comprising two LNAs positioned upstream of the mismatch-forming nucleotide result in at least 10% (1 .1x), 20% (1.2x), 30% (1.3x), 40% (1.4x), 50% (1.5x), 60% (1.6x), 70% (1.7x), 80% (1.8x), 90% (1.9x), and preferably 100% (2. Ox) increase of full-length target protein restoration relative to oligonucleotides lacking internal LNAs. In embodiments, the level of full-length target protein restoration is assessed by western blotting and is directly correlated to the levels of RNA editing (e.g. target adenosine deamination).

[0338] Sequence capable of hybridizing with a region in the target pre-mRNA

[0339] An oligonucleotide described herein comprises a sequence that is capable of hybridising with a region in the target RNA comprising a target adenosine. “Hybridisation” as used herein typically refers to specific hybridisation, and excludes non-specific hybridisation. Thus, in some embodiments, the oligonucleotides disclosed herein comprise a sequence that is capable of specifically hybridising with a region in the target RNA comprising said target adenosine. Preferably, hybridisation is assessed under physiological conditions in a cell as described herein, more preferably in a human cell as described herein. Typically, a sequence that is capable of hybridising with a region in the target RNA comprising the target adenosine may be a sequence that has a certain level of complementarity with the target RNA. Perfect complementarity is not required, as long as the complementarity is sufficient to allow hybridisation, i.e. the formation of a double-stranded complex with the target RNA. In some embodiments, oligonucleotides as described herein comprise a sequence that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary with a sequence of the target RNA. A preferred level of complementarity is at least 80%. Another preferred level of complementarity is at least 85%. Another preferred level of complementarity is at least 90%.

[0340] Therefore, in a preferred embodiment, provided herein is an oligonucleotide relating to a first aspect of this disclosure, wherein the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target RNA.

[0341] In some embodiments, oligonucleotides as described herein comprise up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 non- complementary bases. For example, oligonucleotides as described herein may comprise 1 , 2, 3 or 4 non- complementary bases . Non-complementary bases may include both mismatches (“mismatch bases”) and wobbles (“wobble bases”). It is understood that a mismatch or mismatch base refers to a base forming a mismatch at an opposite nucleotide in the target RNA.

[0342] Thus, in a preferred embodiment, provided herein is an oligonucleotide relating to a first aspect of this disclosure, wherein the oligonucleotide further comprises additional mismatches upstream or downstream of the mismatch-forming nucleotide opposite of the target adenosine.

[0343] Said additional mismatches (e.g., a G mismatch) may be comprised in the sequence that is capable of hybridising with a region in the target RNA, and serve to reduce off-targeting editing. In some embodiments, oligonucleotides as described herein are complementary to the target sequence, preferably perfectly complementary to the target sequence, except for the presence of up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 (for example 1 , 2, 3, or 4) mismatches or wobble bases. In embodiments of oligonucleotides as described herein that comprise a nucleotide forming a mismatch at the target adenosine, up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 additional non-complementary residues (including mismatches and / or wobbles) may be present. For example, 1 , 2, or 3 additional non-complementary residues (including mismatches and / or wobbles, preferably wobbles) may be present. It is understood that a wobble or wobble base refers to a base forming a wobble base pair with an opposite nucleotide in the target RNA.

[0344] Therefore, in a preferred embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention wherein the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base.

[0345] As described earlier herein, wobble base pairs and mismatches have been suggested to enhance the specificity of the editing reaction. Accordingly, in some embodiments, an oligonucleotide as described herein comprises one or more residues forming a wobble base pair with the target RNA. In some embodiments, the oligonucleotides contain at least 1 , 2, 3 or 4 bases forming a wobble base pair at an opposite nucleotide in the target RNA. In preferred embodiments, the residue forming a wobble base pair comprises a hypoxanthine base. In more preferred embodiments, the nucleotide comprising a wobble base pair is inosine. In a most preferred embodiment, 1 , 2, 3 or preferably 4 inosines are positioned at the 5’ terminus of an oligonucleotide described herein. In embodiments further described herein, the presence of 5’-terminal inosines in an oligonucleotide described herein results in at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9- fold, and preferably 10-fold increase in protein restoration relative to an oligonucleotide that does not comprise inosines (Example 3). In an embodiment, the effect of human protein restoration is 1-fold, 2-fold, 3-fold, 4-fold, and preferably 5-fold higher compared to the mouse protein (Example 3). In an embodiment, protein restoration is assessed by western blot with an antibody targeting the N-terminal portion of the protein produced in transfected cells, preferably human cells. In an embodiment, the level of full-length protein restoration is expressed as a percentage of full-length protein over total protein (Truncated and full-length) (Example 1 and Example 3).

[0346] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention, wherein the oligonucleotide has a length of 26 to 50 nucleotides, preferably 30 to 45 nucleotides, more preferably 32 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

[0347] As shown in the examples section, advantageous effects are achieved with oligonucleotides ofvarious lengths. Thus, the length of oligonucleotides as described herein is not particularly limited. For example, an oligonucleotide as described herein may have a minimum length of 26, 27, 28, 29 or 30 nucleotides. In preferred embodiments, an oligonucleotide as described herein is longer than 26 nucleotides. In more preferred embodiments, an oligonucleotide as described herein is longer than 30 nucleotides, for example, it may have a minimal length of 30, 31 , 32, 33, 34, or 35 nucleotides. Typically, oligonucleotides described herein may be shorter than 50 nucleotides. For example, an oligonucleotide as described herein may have a maximum length of 50, 49, 48, 47, or 46 nucleotides. In some embodiments, oligonucleotides described herein may be shorter than 45 nucleotides. For example, an oligonucleotide as described herein may have a maximum length of 45, 44, 43, 42, 41 , 40, 39, 38, 37, or 36 nucleotides. In preferred embodiments, an oligonucleotide as described herein is shorter than 50 nucleotides. In more preferred embodiments, an oligonucleotide as described herein is shorterthan 45 nucleotides, for example, it may have a maximum length of 4 45, 44, 43, 42, 41 , 40 or 39 nucleotides.

[0348] In some embodiments, an oligonucleotide as described herein has a minimum length according to the preferences described above, and a maximum length according to the preferences described above.

[0349] In some embodiments, an oligonucleotide as described herein has a preferred length of 26 to 50 nucleotides, preferably 30 to 50 nucleotides, more preferably 35 to 45 nucleotides. Thus, in some embodiments, an oligonucleotide as described herein has a length of 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,

[0350] 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides, preferably 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ,

[0351] 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides, more preferably 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46,

[0352] 47, 48, or 49 nucleotides. In a preferred embodiment, an oligonucleotide as described herein has a length of

[0353] 37, 38, 39, 40, 41 , more preferably 39 nucleotides.

[0354] Oligonucleotides according to the invention may comprise “natural” phosphodiester linkages as well as modified linkages (including artificial linkages). Combinations of distinct modified or artificial linkages within one molecule are encompassed. Modified or artificial linkages as disclosed herein may include modified versions of the phosphodiester present in natural DNA and RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphonoacetamide (PACA), phosphorodithioate pyranosyl-RNA (p-RNA), (PS2), phosphonoacetate 3'-deoxypyranosyl-DNA (PACE), (p- DNA), phosphorodiamidate morpholino oligomers, peptide-conjugated phosphorodiamidate morpholino oligomers, modified phosphorodiamidate morpholino oligomers, thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, chiral phosphonate, phosphinate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, and other alkyl phosphonate (such as 3’-alkylene phosphonate and 5’-alkylene phosphonate, chiral phosphonate, thionoalkylphosphotriester, phosphinate, selenophosphate), thionophosphoramidate, ethyl phosphate, thionoalkylphosphonate, ethyl phosphorothioate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate, 3’-alkylene phosphonate, 5’-alkylene phophonate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and their derivatives. Among these, phosphorothioate (PS) is preferred.

[0355] Modified or artificial linkages as disclosed herein may also include phosphoryl guanidines (PN), acylphosphoramidates, sulfonylphosphoramidates, phosphoramidite, phosphoramidate, N3’->P5’ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methylene formacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamido nucleic acid (TANA); and their derivatives. Among these, phosphoryl guanidines are preferred. A preferred example of a phosphoryl guanidine (PN) internucleoside linkage is dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (i.e. PN-dmi).

[0356] In some embodiments, an oligonucleotide as described herein comprises one or more modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 10 or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 10 or 11 modified or artificial internucleoside linkages.

[0357] Depending on the target, the position of the modified or artificial internucleoside linkages may vary. In some embodiments, modified or artificial internucleoside linkages may preferably occur in the 5’ and 3’ termini of the oligonucleotides. Another preferred location for a modified or artificial internucleoside linkages is between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine. In preferred embodiments, modified or artificial internucleoside linkages may be selected from the group consisting of: phosphorothioate internucleoside linkages and phosphoryl guanidine internucleoside linkages.

[0358] A preferred example of a phosphoryl guanidine (PN) internucleoside linkage is dimethylimidazolidin-2-ylidene (dmi)phosphoramidate (PNdmi).

[0359] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention, wherein the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably wherein: the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, even more preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or wherein the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of the target adenosine In preferred embodiments, an oligonucleotide as described herein comprises one or more phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate internucleoside linkages.

[0360] In some embodiments, an oligonucleotide as described herein comprises 10 phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 10 phosphorothioate internucleoside linkages.

[0361] In some embodiments, all internucleotide linkages of an oligonucleotide as described herein may also consist of phosphorothioate internucleoside linkages. This means that all internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages. Alternatively, an oligonucleotide as described herein may predominantly contain phosphorothioate internucleoside linkages. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages may be phosphorothioate internucleoside linkages. In preferred embodiments of oligonucleotides comprising one or more phosphorothioate linkages, phosphorothioate linkages occur in the 5’ and 3’ termini of the oligonucleotides. Thus, in some embodiments, an oligonucleotide as described herein comprises phosphorothioate internucleoside linkages between the terminal two, three, four, five, or six residues at the 5’ terminus and / or between the terminal two, three, four, five, or six residues at the 3’ terminus. Phosphorothioate linkages preferably occur both at the 5’ terminus and the 3’ terminus.

[0362] In preferred embodiments, an oligonucleotide as described herein comprises one or more phosphoryl guanidine internucleoside linkages (PN internucleoside linkages), preferably wherein the phosphoryl guanidine is dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (PN-dmi-phosphoramidate).

[0363] In some embodiments, an oligonucleotide as described herein comprises 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi-phosphoramidate internucleoside linkages). In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi- phosphoramidate internucleoside linkages). In some embodiments, an oligonucleotide as described herein comprises 3 phosphoryl guanidine internucleoside linkages (PN internucleosides linkages) (preferably (dmi) phosphoramidate internucleoside linkages) (PN-dmi-phosphoramidate) internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 3 phosphoryl guanidine internucleoside linkage (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi-phosphoramidate internucleoside linkages).

[0364] In preferred embodiments of oligonucleotides comprising one or more phosphoryl guanidine linkages (PN linkages) (preferably (dmi)-phosphoramidate also called (PN-dmi-phosphoramidate), the phosphoryl guanidine linkages (PN linkages) (preferably (dmi)-phosphoramidate, also called PN-dmi-phosphoramidate) occur adjacent to the 5’ terminus, adjacent to the 3’ terminus, and / or between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine.

[0365] Preferably, the oligonucleotides comprise a phosphoryl guanidine linkage (PN linkage) (preferably (dmi)- phosphoramidate, (PN-dmi-phosphoramidate)) adjacent to the 5’ terminus, a phosphoryl guanidine linkage (PN linkage) (preferably (dmi)-phosphoramidate (PN-dmi-phosphoramidate)) adjacent to the 3’ terminus, and a phosphoryl guanidine linkage (PN linkage) (preferably (dmi)-phosphoramidate (PN-dmi-phosphoramidate)) between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine. Mismatch-forming oligonucleotide opposite of the target adenosine to be deaminated

[0366] As explained above, deamination of the target adenosine will cause the target RNA to comprise an inosine which, for most purposes, is interpreted by the cell as a G. For this reason, the deamination reaction may be enhanced by providing a mismatch opposite the adenosine to be edited, which mismatch is resolved after deamination. Therefore, in some embodiments, an oligonucleotide as described herein comprises a mismatchforming nucleotide positioned opposite of the target adenosine to be edited.

[0367] The mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated may occur at various positions in the oligonucleotides described herein. As understood herein, the region comprising the mismatch-forming nucleotide positioned opposite of the target adenosine to be deaminated as well as the nucleotides adjacent to said mismatch-forming nucleotide may be called the editing region of the oligonucleotide. In an embodiment, the editing region comprises the mismatch-forming nucleotide opposite of the adenosine to be deaminated.

[0368] In another embodiment, the editing region comprises a triplet (e.g. a group of three nucleotides), said triplet comprising the mismatch-forming nucleotide opposite of the adenosine to be deaminated as well as 1 nucleotide upstream (denoted as -1 ) and 1 nucleotide downstream (denoted as +1 ) from the mismatch-forming nucleotide.

[0369] In another embodiment, the editing region may comprise 2, 1 nucleotides at the 5’ terminus side of the nucleotide opposite the adenosine to be edited and 1 , 2, 3, 4, 5 nucleotides at the 3’ terminus side of the nucleotide opposite the adenosine to be deaminated.

[0370] Thus, in embodiments, the editing region may comprise at least 3, 4, 5, 6, 7, 8 or 9 nucleotides including the mismatch-forming nucleotide opposite of the adenosine to be deaminated.

[0371] The editing region may also occur at or nearthe middle of the oligonucleotide, but also closerto the 5’ terminus or closer to the 3’ terminus. The editing oligonucleotide described herein may be further optimized by optimizing its editing region. The editing region may be optimised by optimising its position within the oligonucleotide. In some embodiments, the editing region is not within the first 1 , 2, 3, 4 or 5 residues at the 5’ terminus and not within the last 5, 4, 3, 2 or 1 residues at the 3’ terminus. In a particular embodiment, the length of the 5’ sequence preceding the mismatch-forming nucleotide of the oligonucleotide may be at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26 and preferably 23, 24, and most preferably 25 residues. In a particular embodiment, the length of the 3’ sequence downstream from the mismatch-forming nucleotide of the oligonucleotide may be at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 and preferably 13 residues. In a particular embodiment, the length of the 3’ sequence downstream from the mismatch-forming nucleotide of the oligonucleotide is 13 residues. In exemplary embodiments, an oligonucleotide described herein has a preferred length of 39 residues, wherein the length of the 5’ sequence preceding the mismatch-forming nucleotide is 25 residues, followed by the mismatch-forming nucleotide, and by a sequence of 13 residues downstream from the mismatch-forming nucleotide (see Figure 1 , Example 1 , ASO-1 and ASO-5, corresponding to SEQ ID NO: 25 and 29, respectively; see also Figure 5, Example 4, ASO- 34 and ASO-35 corresponding to SEQ ID NO: 58 and 59, respectively) . In other exemplary embodiments, an oligonucleotide described herein has a length of 49 residues, wherein the length of the 5’ sequence preceding the mismatch-forming nucleotide is 35 residues, followed by the mismatch-forming nucleotide, and by a sequence of 13 residues downstream from the mismatch-forming nucleotide (see Figure 1 , Example 1 , ASO- 2 and ASO-4 corresponding to SEQ ID NO: 26 and 28, respectively). In some embodiments, the mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated comprises a cytosine base or a cytosine base analogue. The type of cytosine analogue used in this context is not particularly limited. For example, suitable cytosine analogues are described in WO2020 / 252376, which is incorporated herein by reference in its entirety.

[0372] In an embodiment, provided herein is an oligonucleotide relating to a first aspect of the invention, wherein the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0373] In some embodiments, the cytosine analogue is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analogue which is a pyrimidine base is pseudoisocytosine. A particular example of a cytosine analogue which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as 6- amino 5-nitro-2(1 H)-pyridinone or Benner’s Z base). Therefore, in preferred embodiments, the base of mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated is 6-amino-5- nitropyridin-2-one. In some other preferred embodiments, the base of mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated is 2', 2'-difluoro 2'deoxycytidine (gemcitabine).

[0374] Increased deamination efficiencies may also be attained by providing a uracil base (or an analogue thereof) opposite the adenosine to be edited. Accordingly, in some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analogue. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analogue which is a uridine. A particular example of a uracil analogue which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0375] In some embodiments, the mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated comprises an adenine base or an adenine base analogue. In some embodiments, the mismatchforming nucleotide positioned opposite the target adenosine to be deaminated comprises an adenine base analogue which is a purine. A particular example of an adenine analogue which is a purine base is a 7,8- Dihydro-8-oxoadenine (also known as 8-oxoadenine). Therefore, in preferred embodiments, the mismatchforming nucleotide within the editing region is 8-oxoadenine.

[0376] Apart from the base, particular sugar chemistries of the mismatch-forming nucleotide within the editing region may also enhance the deamination reaction. In particular, the 2’ position of the sugar group is preferably not substituted, meaning that it comprises an -H at this position (e.g. in the case of a DNA residue) or an -OH at this position (e.g. in the case of an RNA residue). Preferably, the 2’ position of the sugar group comprises -H (e.g. in the case of a DNA residue). Thus, in some embodiments, the mismatch-forming nucleotide opposite of the target adenosine to be deaminated comprises a 2’-deoxyribose sugar. In some embodiments the mismatch-forming nucleotide opposite of the target adenosine to be deaminated is a DNA nucleotide. The same optional preferences apply to the sugar chemistry of the residue that is 3’ adjacent to the mismatchforming nucleotide opposite the target adenosine. In this context, “adjacent” means directly next (or contiguous) to the nucleotide residue opposite the target adenosine. Thus, in some embodiments, the 2’ position of the sugar group of the residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine is not substituted, meaning that it comprises an -H at this position (e.g. in the case of a DNA residue) or an -OH at this position (e.g. in the case of an RNA residue). Preferably, the 2’ position of the sugar group comprises -H (e.g. in the case of a DNA residue). In some embodiments, the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose sugar. In some embodiments, the nucleotide residue that is 3’ adjacent to the mismatch-forming nucleotide opposite of the target adenosine is a DNA nucleotide. In some embodiments, the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide opposite the target adenosine has a G base, and preferably has a C base. In some embodiments, the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide opposite the target adenosine to be deaminated comprises a modified thymine base (e.g. 5-methyl-uracil), preferably 5-methyl-4- pyrimidinone.

[0377] Apart from the sugar scaffold of the mismatch-forming nucleotide or of the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide, particular internucleoside linkage in the editing region of the oligonucleotide may also enhance the deamination reaction. In a particular embodiment, the phosphoryl guanidine linkage (PN linkage), preferably the (dmi)-phosphoramidate internucleoside linkage (also called PN-dmi-phosphoramidate linkage) is present between the first and second nucleotide residues positioned 3’ of the mismatch-forming nucleotide. In a particular embodiment, the phosphorothioate linkage (PS linkage), is present between the first and second nucleotide residues that are 3’ adjacent to the mismatch-forming nucleotide. In a particular embodiment, a combination of a PN and a PS linkages is present between the first and second nucleotide residues that are 3’ of the mismatch-forming nucleotide.

[0378] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the target adenosine is part of a therapeutic target codon comprised in a target RNA, said target RNA comprising a protein-coding MECP2 RNA encoding a human Methyl CpG Binding Protein 2 (MECP2).

[0379] Generally, a target RNA comprising a protein-coding RNA encoding a protein according to the invention comprises a target adenosine which can be edited by ADAR-mediated deamination. Examples of such target RNAs comprising a target adenosine editable by ADAR-mediated deamination are the transcripts of the frataxin (FXN) and the SLC20A2 genes. The GAA repeat expansion in intron 1 of the frataxin (FXN) gene causes an inherited neurodegenerative disorder termed Friedreich ataxia (FA) and characterized by widespread metabolic changes affecting the central and peripheral nervous systems, heart and pancreas.

[0380] SLC20A2 encodes the type III sodium dependent phosphate (Na+ / Pi) transporter 2 (SLC20A2; Pit2). Pit2 regulates the transport of inorganic phosphate (Pi) from the extracellular compartment to the cytoplasm. In vitro and in vivo data show that mutations in SLC20A2 dysregulate phosphate homeostasis in the brain and cause Primary familial brain calcification (PFBC), which is an inherited neurodegenerative disease characterised by progressive bilateral microvascular calcium deposits, accompanied by various symptoms, such as dystonia, ataxia, parkinsonism, dementia, depression, headaches, and epilepsy.

[0381] More features relating to the target RNA FXN or target RNA SLC20A2 and oligonucleotide targeting it are given in the part of the description entitled invention 2 (FXN) and invention 3 (SLC20A2).

[0382] In an embodiment, a target RNA that is generally preferred according to the invention is Methyl CpG binding protein 2protein-coding RNA encoding MECP2 protein. Similarly, a target protein that is generally preferred herein is Methyl CpG binding protein 2 (MECP2). In embodiments, the Mecp2 may be human or mouse, particularly human. Thus, in exemplary embodiments, an oligonucleotide as described herein is capable of effecting ADAR-mediated deamination of a target adenosine in a MECP2 (pre-)mRNA molecule encoding a MECP2 protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the MECP2 (pre-)mRNA molecule comprising said target adenosine, and wherein the target adenosine is part of a therapeutic target codon. The cDNA sequences encoding the two recognised transcript variants of the murine MECP2 protein are represented by SEQ ID NO: 1 and SEQ ID NO: 2, respectively. They correspond to murine MECP2 protein isoform 1 (SEQ ID NO: 3) and 2 (SEQ ID NO: 4). In humans, there are ten transcript variants of MECP2 (SEQ ID NO: 5- 14) that encode four protein isoforms (SEQ ID NO: 15-18). As understood herein, a MECP2 RNA or a MECP2 protein encompasses the totality of known splice variants and protein isoforms identified forthe murine and more preferably forthe human MECP2 locus. In an embodiment, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine within a therapeutic target codon, which may be present in all ten transcript variants of the human MECP2 gene (SEQ ID NO: 5-14) that encode the corresponding four MECP2 protein isoforms (SEQ ID NO:15-18). In a particular embodiment, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine within a therapeutic target codon, which is present in transcript variants 1 and 2 (SEQ ID NO: 5-6) of human MECP2 that encode MECP2 protein isoforms 1 and 2, respectively (SEQ ID NO: 15-16).

[0383] In an embodiment, provided is an oligonucleotide relating to a first aspect disclosed herein, wherein the therapeutic target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both codons are correctable by ADAR-mediated deamination of the target adenosine.

[0384] In a particular embodiment, the therapeutic target codon comprising the target adenosine to be deaminated is a stop codon caused by a non-sense mutation in the target RNA comprising MECP2 protein-coding RNA encoding MECP2 protein. In a particular embodiment, said stop codon comprises a C to T non-sense mutation which generates a truncated MECP2 protein. In a particular embodiment, an oligonucleotide as described herein is capable of correcting a stop codon by effecting ADAR-mediated deamination of a target adenosine positioned in the 3’ position of said codon in a MECP2 (pre-)mRNA molecule encoding a MECP2 protein. In embodiments, a non-sense mutation resulting from a C to T substitution is a R168X, R270X, R294X, and preferably is R255X. In preferred embodiments, a C to T substitution results in a R255X mutation leading to a premature stop codon of the human MECP2 protein or its murine orthologue. In a particular embodiment, the correction of a target adenosine, which is a part of a therapeutic target codon, and preferably a stop codon, is able to restore the function and / or levels of MECP2 protein. In a particular embodiment, the mouse ortholog of MECP2 has a R255X mutation leading to a premature stop codon, which is corrected to R255W by means of an ADAR-mediated deamination with an oligonucleotide described herein. The cDNA sequences encoding the two recognised transcript variants of the murine MECP2 protein comprising a R255X mutation are represented by SEQ ID NO: 19 and SEQ ID NO: 20, whereas the corresponding truncated protein isoforms are represented by SEQ ID NO: 21 and SEQ ID NO: 22. The corrected versions of the two transcript isoforms of the murine MECP2 protein as well as their corresponding full-length protein isoforms are represented by SEQ ID NO: 23- 24 and SEQ ID NOs: 60-61 , respectively. In a particular embodiment, the human MECP2 protein has a R255X mutation leading to a premature stop codon, which is corrected to R255W by means of an ADAR-mediated deamination with an oligonucleotide described herein. The cDNA sequences encoding the ten recognised transcript variants of the human MECP2 protein comprising a R255X mutation are represented by SEQ ID NO: 62-71 , whereas the corresponding truncated protein isoforms are represented by SEQ ID NO: 72-75. The corrected versions of the ten transcript isoforms of the human MECP2 protein as well as their corresponding four full-length protein isoforms are represented by SEQ ID NO: 76-89. In embodiments, an oligonucleotide according to the invention is capable of effecting ADAR-mediated of a target adenosine within a therapeutic target codon R255X , which is present in transcript variants 1 -10 of human MECP2 (SEQ ID NO: 62-71 ) that encode MECP2 disease-causing protein isoforms 1 - 4, respectively (SEQ ID NO: 72-75). In embodiments, ADAR-mediated deamination of a target adenosine within a therapeutic target codon R255X results in edited human MECP2 transcript variant 1-10 (SEQ ID NO: 76-85) encoding the corresponding restored full-length MECP2 protein (SEQ ID NO: 86-89). In a particular embodiment, an oligonucleotide P62041914WQ according to the invention is capable of effecting ADAR-mediated of a target adenosine within a therapeutic target codon R255X , which is present in transcript variants 1 and / or 2 of human MECP2 protein (SEQ ID NO: 62-63) that encode MECP2 disease-causing protein isoforms 1 and / or 2, respectively (SEQ ID NO: 72-73). In a particular embodiment, ADAR-mediated deamination of a target adenosine within a therapeutic target codon R255X results in edited human MECP2 transcript variant 1 and / or 2 (SEQ ID NO: 76-77) encoding the corresponding restored full-length MECP2 protein (SEQ ID NO: 86-87).

[0385] In some embodiments, the therapeutic target codon comprising the target adenosine to be deaminated is a codon comprising a G to A mis-sense mutation in the target RNA comprising a MECP2 protein-coding RNA encoding a dysfunctional MECP2 protein. In a particular embodiment, an oligonucleotide as described herein is capable of correcting a codon comprising a missense G to A mutation by effecting ADAR-mediated deamination of the mutated target adenosine comprised in a MECP2 (pre-)mRNA molecule encoding a MECP2 protein. In embodiments, missense mutations resulting from a G to A substitution are R106Q (CAA), W104X (UAG), and R306H (CAC). In a particular embodiment, missense mutations resulting from a G to A substitution affect the Methyl DNA Binding Domain (MBD) of human MECP2 protein (e.g. MeCP2 R106Q and MeCP2 W104X) or the NCoR interaction domain (NID) of human MECP2 protein (e.g. R306H), and are all correctable by ADAR-mediated deamination of the mutated target adenosine using an oligonucleotide described herein. In a particular embodiment, missense mutations resulting from a G to A substitution are R106Q (CAA), W104X (UAG), and R306H (CAC), and are found in the murine ortholog of MECP2 protein.

[0386] Oligonucleotides targeting MECP2

[0387] In a second aspect, described herein is an antisense oligonucleotide for RNA editing capable of effecting Adenosine Deaminase Acting on RNA (ADAR)-mediated deamination of a target adenosine which is part of a therapeutic target codon comprised in a target RNA, said target RNA comprising an endogenous MECP2 protein-coding RNA encoding a MECP2 protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a target region in the endogenous MECP2 target RNA encoding the MECP2 protein, the oligonucleotide comprises at least one, and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or internally, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage, and the oligonucleotide comprises a mismatchforming nucleotide opposite of the target adenosine, wherein the target adenosine is part of the therapeutic target codon comprised in the endogenous MECP2 target RNA

[0388] In a particular embodiment, an oligonucleotide described herein comprises a sequence that is capable of hybridizing with a target region in a target RNA encoding mouse, and preferably human MECP2 protein. In embodiments, oligonucleotides as described herein comprise a sequence that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary with a sequence of the target (pre)- mRNA molecule encoding mouse, and preferably human MECP2 protein. In embodiments, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine within a therapeutic target codon present in transcript variants 1 and 2 (SEQ ID NO: 5-6) of mouse MECP2 (SEQ ID NO: 1-2), and preferably in transcript variants 1 and 2 (SEQ ID NO: 5-6) of human MECP2. A preferred level of complementarity with mouse and / or human MECP2-encoding target (pre)-mRNA is at least 80%, at least 85%, at least 90%. Therefore, in a preferred embodiment, an oligonucleotide disclosed herein comprises or consists or essentially consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target RNA encoding mouse, and preferably human MECP2 protein. As explained hereinabove, an oligonucleotide described herein may not be perfectly complementary with its MECP2-encoding target RNA. In a particular embodiment, an oligonucleotide described herein comprises a mismatch-forming nucleotide opposite of the target adenosine, wherein the target adenosine is part of the therapeutic target codon comprised in the endogenous MECP2 RNA molecule.

[0389] In a particular embodiment, the therapeutic target codon is a premature stop codon caused by a C to T substitution in the mouse and / or human MECP2 protein-coding target RNA. In a particular embodiment, ADAR- mediated deamination of the 3’ target adenosine comprised in a premature stop codon restores the open reading frame of the edited MECP2 RNA molecule and thus leads to restoration of MECP2 protein levels. In a particular embodiment, the therapeutic target codon comprises a missense mutation caused by a G to A substitution which leads to a disease-causing amino acid substitution in the MECP2 protein. Thus, in a particular embodiment, a target adenosine is part of a disease-causing codon that carries a mis-sense mutation resulting in a dysfunctional MECP2 protein. In embodiments, an oligonucleotide described herein is capable of restoring protein levels and / or restoring protein function through ADAR-mediated deamination of a target adenosine comprised in a therapeutic target codon, wherein said therapeutic target codon is comprised in the mouse and / or human MECP2 protein-coding target RNA.

[0390] In a particular embodiment, an oligonucleotide targeting MECP2-protein coding RNA comprises at least one internal LNA. In a preferred embodiment, such an oligonucleotide comprises two internal LNAs, wherein the internal LNAs occupy the -2ndand the -8thposition 5’ upstream to the mismatch-forming nucleotide. In yet another embodiment, the oligonucleotide may comprise three internal LNAs. An oligonucleotide targeting MECP2-protein coding RNA may only comprise at least one internal LNA, and preferably up to three internal LNAs. Alternatively, in some embodiments, an oligonucleotide comprising at least one internal LNA may further comprise at least one additional LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide. Depending on the number and placement of LNAs within the oligonucleotide targeting MECP2-protein coding RNA, the following configurations are possible:

[0391] • one internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0392] • two internal LNAs (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0393] • three internal LNAs (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0394] • at least one internal LNA and at least one LNA positioned at the 3’ terminus of the oligonucleotide

[0395] • at least one internal LNA and at least one LNA positioned at the 5’ terminus of the oligonucleotide

[0396] • at least one internal LNA and two additional LNAs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0397] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide

[0398] • at least one internal LNA and two LNAs positioned at the 5’ terminus of the oligonucleotide

[0399] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide as well as two LNAs positioned at the 5’ terminus of the oligonucleotide In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0400] In a particular embodiment, an oligonucleotide targeting MECP2-protein coding RNA comprises at least one, and preferably two LNAs at both its 5’ and 3’ termini, wherein a phosphorothioate internucleoside linkage links the nucleotide comprising the one LNAs at the 5’ terminus to its neighbor nucleotide (the same holds for the nucleotide comprising the one LNA at the 3’terminus) and a phosphorothioate internucleoside linkage links the two LNAs at the 3’ terminus (the same holds for the linkage between the two nucleotides comprising the two LNAs at the 5’terminus).

[0401] In one embodiment, an oligonucleotide described herein and targeting MECP2-protein coding RNA comprises one LNA at the 5’ terminus or one LNA at the 3’ terminus. In a particular embodiment, an oligonucleotide described herein and targeting MECP2-protein coding RNA oligonucleotide comprises at least one LNA at both the 5’ and 3’ termini. In another embodiment, an oligonucleotide described herein and targeting MECP2- protein coding RNA comprises two LNAs at the 5’ terminus or two LNAs at the 3’ terminus. In a particular embodiment, an oligonucleotide described herein and targeting MECP2-protein coding RNA comprises two LNAs at both the 5' and 3' termini. In a further embodiment, an oligonucleotide described herein and targeting MECP2-protein coding RNA comprises one LNA at the 5'terminus and two LNAs at the 3' terminus. In a further embodiment, an oligonucleotide described herein and targeting MECP2-protein coding RNA comprises two LNAs at the 3' terminus and one LNA at the 5' terminus.

[0402] As shown in Example 1 , such an oligonucleotide leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% protein restoration following ADAR-mediated deamination of a 3’ target adenosine in a premature R225X stop codon comprised in a MECP2 protein-coding target RNA. In an embodiment, protein restoration is assessed by western blot with an antibody targeting the N-terminal FLAG tag of the murine version of the truncated MECP2 protein, wherein the level of protein restoration is expressed as a percentage of full-length protein over total protein (truncated + full-length) (Example 1 ). In another embodiment, protein restoration is assessed by western blot with an antibody targeting the full-length human protein, wherein the level of protein restoration is expressed as full-length protein levels compared to untreated samples (Example 4).

[0403] As shown in example 2, ADAR-mediated deamination of a target adenosine in MECP2-coding RNA with an oligonucleotide comprising one, and preferably two LNAs at both its 5’ and 3’ termini, wherein a phosphorothioate internucleoside linkage links the nucleotide comprising the one LNA at the 5’ terminus to its neighbor nucleotide (the same holds for the nucleotide comprising the one LNA at the 3’terminus) and a phosphorothioate internucleoside linkage links the nucleotides comprising the two LNAs at the 3’ terminus (the same holds for the linkage between the two nucleotides comprising the two LNAs at the 5’terminus), enhances MECP2 full-length protein restoration.

[0404] More specifically as shown in example 2, ADAR-mediated deamination of a target adenosine in MECP2-coding RNA with an oligonucleotide comprising one, and preferably two internal LNAs as well as terminal LNAs at both its 5’ and 3’ termini, wherein a phosphorothioate internucleoside linkage links the nucleotide comprising the one LNA at the 5’ terminus to its neighbor nucleotide (the same holds for the nucleotide comprising the one LNA at the 3’terminus) and a phosphorothioate internucleoside linkage links the nucleotides comprising the two LNAs at the 3’ terminus (the same holds for the linkage between the two nucleotides comprising the two LNAs at the 5’terminus), enhances MECP2 full-length protein restoration by at least 40% (1 .4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8-fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1-fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an oligonucleotide with LNA-free termini and / or relative to an LNA-free oligonucleotide. Oligonucleotides said to have “LNA-free termini” or said to be “LNA-free oligonucleotides” have been defined hereinabove.

[0405] Generally, the efficiency of MECP2 RNA editing and full-length MECP2 protein restoration and / or restoration of MECP2 protein function can be improved by additional chemical modifications of the editing oligonucleotide. Such chemical modifications may encompass, for example, the number, type and placement of artificial or modified internucleoside linkages, the presence of wobbles (as shown in Example 3), the presence and placement of nucleotide analogues with modified sugar scaffolds or modified bases, the presence and placement of additional LNAs, and the overall length of the oligonucleotide.

[0406] In a particular embodiment, provided herein is an oligonucleotide relating to a second aspect of the invention, wherein the oligonucleotide further comprises at least one of the following features: the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)- pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides capable of forming a wobble base pair with the target RNA, said target RNA comprising an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleoside linkage), preferably a PN-dmi-phosphoramidate internucleoside linkage the oligonucleotide further comprises at least one internal LNA located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0407] In a particular embodiment, the base of the mismatch-forming nucleotide of an oligonucleotide disclosed herein comprises a 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base). In a particular embodiment, an oligonucleotide disclosed herein comprises 1 , 2, 3, 4, and preferably 5 nucleotides forming a wobble base pair with the target RNA, wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base. In a particular embodiment, oligonucleotide disclosed herein further comprises two internal LNAs located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base. In a particular embodiment, the preferred length of an oligonucleotide disclosed herein is from 32 to 49, even more preferably 39 nucleotides.

[0408] As shown in Example 4, a MECP2-targ eting oligonucleotide as described herein is able to effect ADAR- mediated deamination of a target adenosine in order to edit human MECP2 RNA comprising a R255X premature stop codon in a human cell.

[0409] Thus, in an embodiment, human MECP2 full-length protein restoration is the result of ADAR-mediated deamination of a target adenosine in human MECP2 RNA (e.g. the result of pre-mRNA or mRNA editing in a human cell), wherein said editing is effected by a MECP2 oligonucleotide described herein (Example 4). In an embodiment, an oligonucleotide described herein has at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% MECP2 RNA editing efficiency in vitro. In embodiments, RNA editing efficiency refers to the fraction of target mRNA that has undergone deamination of a target adenosine comprised in a therapeutic target codon. In embodiments, the level of RNA editing efficiency is used as a proxy for the levels of target protein restoration. In embodiments, protein restoration refers to correcting a mutant protein, for example by correcting a G to A missense mutation. In preferred embodiments, protein restoration refers to recovery of full-length protein. In an embodiment, an oligonucleotide described herein has at least 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% MECP2 RNA editing efficiency in vivo (Example 5). In an embodiment, MECP2 RNA editing efficiency is assessed by digital droplet PCR (ddPCR) and is expressed as the copies of edited alleles over the sum of edited and mutant alleles per reaction volume (copies / pl). In an embodiment, MECP2 RNA editing efficiency translates to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% full-length human MECP2 protein restoration. As shown in Example 4, in one embodiment, the level of MECP2 protein restoration is assessed by western blot with an antibody targeting the full-length human protein, and is expressed as full-length protein levels compared to untreated samples. In another embodiment, the restoration of full-length human MCEP2 protein also results in successful nuclear localization of human MECP2 as evidenced by immunohistochemistry with a MECP2-specific antibody (Example 4). In embodiments, MECP2 RNA editing occurs in vitro or in vivo. In embodiments, MECP2 RNA editing occurs in mouse, and preferably it occurs in a human.

[0410] In a particular embodiment, provided is an oligonucleotide according to a first and a second aspect of the invention, wherein the oligonucleotide is represented by a sequence comprising, consisting of or essentially consisting of SEQ ID NOs: 25-59, 90-98, 102-129, 130-138, 223-363 and 400-420, preferably SEQ ID NOs: 25-59 and 102-129 and even more preferably SEQ ID NOs: 54-59 and 102-129.

[0411] As indicated elsewhere, the target RNA preferably comprises a protein-coding MECP2 mRNA encoding the MECP2 target protein. A preferred therapeutic target codon in the context of MECP2 is a premature stop codon arising from a C to T non-sense mutation. Thus, as disclosed herein, a preferred therapeutic target codon is a R255X stop codon in the MECP2 protein. This section discloses preferred oligonucleotides of the disclosure, which are capable of effecting ADAR-mediated deamination of a target adenosine in a MECP2 (pre-)mRNA molecule encoding MECP2, said oligonucleotides comprising a sequence that is capable of hybridizing with a region in MECP2 (pre-)mRNA comprising said target adenosine, and the target adenosine being part of a codon encoding a therapeutic target codon, which is a premature stop codon caused by a C to T non-sense mutation. P62041914WQ

[0412] In some embodiments, an oligonucleotide disclosed herein comprises or consists of the following base sequence: TGGCCIGIIGGICAGCUTCAGCUTUNGACUUUCUGCCAG (SEQ ID NO: 90) or is a derivative thereof. An oligonucleotide whose base sequence is represented by SEQ ID NO: 90 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0413] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analogue, uracil, and a uracil analogue. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine. In an embodiment, an oligonucleotide derived from SEQ ID NO: 90 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0414] In an embodiment, this conformationally restricted sugar moiety is present internally and may further be positioned at the 5’ and / or at the 3’ terminus of the oligonucleotidep. In an embodiment, oligonucleotides derived from SEQ ID NQ:90 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0415] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0416] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0417] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs . In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0418] In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi-phosphoramidate internucleostide linkage.

[0419] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0420] In an embodiment, the oligonucleotide further comprises at least one internal LNA located upstream of the mismatch-forming nucleotide.

[0421] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises two internal LNAs located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the length of the oligonucleotide is from 32 to 49, preferably 39 nucleotides.

[0422] The oligonucleotides represented by SEQ ID NOs: 31 , 32, 33, 40, and 41 are considered to be preferred oligonucleotides derived from the base sequence TGGCCIGIIGGICAGCUTCAGCUTUNGACUUUCUGCCAG (SEQ ID NO: 90) and are shown below :

[0423] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom UsdZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsLAsLG (SEQ ID NO: 31 )

[0424] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom UsdZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 32) mUsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom

[0425] UsdZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsmG (SEQ ID NO: 33) P62041914WQ

[0426] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom

[0427] UsdZsfGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 40) mUsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom UsdZsfGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsmG (SEQ ID NO: 41 )

[0428] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may comprise a deoxyribose sugar and a G-base (denoted by dG) or a 2'-fluoroarabino ribose or deoxyribose sugar and a G-base (2’-FANA; denoted by fG).

[0429] Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide); C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0430] In some embodiments, an oligonucleotide described herein comprises or consists of the following base sequence: TGGCCIGIIGGICAGCTTCAGCTTUNGACUUUCUGCCAG (SEQ ID NO: 91 ) or is a derivative thereof. An oligonucleotide whose base sequence is represented by SEQ ID NO: 91 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0431] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0432] In an embodiment, an oligonucleotide derived from SEQ ID NO: 91 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0433] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0434] In an embodiment, oligonucleotides derived from SEQ ID NO:91 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0435] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0436] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0437] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide , wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi- phosphoramidate internucleostide linkage. In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0438] In an embodiment, the oligonucleotide further comprises two internal LNAs located upstream of the mismatchforming nucleotide.

[0439] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, P62041914WQ the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises at least one internal LNAs located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0440] The oligonucleotides represented by SEQ ID NOs: 34 , 35, 36, 37, 38 and 39 are considered to be derived from the base sequence TGGCCIGIIGGICAGCTTCAGCTTUNGACUUUCUGCCAG and are shown below:

[0441] LT sLGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seT sLT seC*seAseGseC*seT sLT omUsd ZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsLAsLG (SEQ ID NO: 34)

[0442] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seTsLTseC*seAseGseC*seTsLTomUsd ZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 35) mUsmGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seTsLTseC*seAseGseC*seTsLTomUs dZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsmG (SEQ ID NO: 36)

[0443] LT sLGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seT sLT seC*seAseGseC*seT sLT omUsd ZsfGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsLAsLG (SEQ ID NO: 37)

[0444] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seTsLTseC*seAseGseC*seTsLTomUsd ZsfGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 38) mUsmGsmGsmCsmCsmlomGsmlomlsmGomGsmloeC*seAseGseC*seTsLTseC*seAseGseC*seTsLTomUs dZsfGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsmG (SEQ ID NO: 39)

[0445] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA, e = 2’-MOE . An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may comprise a deoxyribose sugar and a G-base (denoted by dG) or a 2'-fluoroarabino ribose or deoxyribose sugar and a G-base (2’-FANA; denoted by fG).

[0446] Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide); C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar P62041914WQ modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0447] In some embodiments, an oligonucleotide described herein comprises or consists of the following base sequence: TGGCCIGIIGGICAGCUTCAGCUTUNCACUUUCUGCCAGG (SEQ ID NO: 92) or is a derivative thereof. An oligonucleotide whose base sequence is represented by SEQ ID NO: 92 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0448] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0449] In an embodiment, an oligonucleotide derived from SEQ ID NO: 92 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0450] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0451] In an embodiment, oligonucleotides derived from SEQ ID NO:92 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0452] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA). In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0453] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide. In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi-phosphoramidate internucleostide linkage.

[0454] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0455] In an embodiment, the oligonucleotide further comprises two internal LNAs located upstream of the mismatchforming nucleotide.

[0456] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises at least one internal LNA located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0457] The oligonucleotides represented by SEQ ID NOs: 42 43, 46, and 47 are considered to be derived from the base sequence TGGCCIGIIGGICAGCUTCAGCUTUNCACUUUCUGCCAGG and are shown below:

[0458] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTsmU sdZsdCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 42)

[0459] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsdCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 43) P62041914WQ

[0460] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTsmU sdZsfCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 46)

[0461] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsfCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 47)

[0462] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L =LNA. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may be comprise a deoxyribose sugar and a C-base (denoted by dC) or a 2'-fluoroarabino ribose or deoxyribose sugar and a C-base (2’-FANA; denoted by fC). Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l=hypoxanthine base (comprised in an inosine nucleotide); C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: se=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0463] In some embodiments, the base sequence of an oligonucleotide as described herein comprises or consists of: TGGCCIGIIGGICAGCUTCAGCUTUNGACUUUCUGCCAGG (SEQ ID NO: 93) or is a derivative thereof.

[0464] An oligonucleotide whose base sequence is represented by SEQ ID NO: 93 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatch-forming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatch-forming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0465] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0466] In an embodiment, an oligonucleotide derived from SEQ ID NO: 93 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0467] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0468] In an embodiment, oligonucleotides derived from SEQ ID NO:93 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0469] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0470] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0471] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’ and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi- phosphoramidate internucleostide linkage.

[0472] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0473] In an embodiment, the oligonucleotide further comprises two internal LNAs located upstream of the mismatchforming nucleotide.

[0474] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises at least one internal LNA located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0475] The oligonucleotides represented by SEQ ID NOs: 44, 45, 48, and 49 are considered to be derived from the base sequence TGGCCIGIIGGICAGCUTCAGCUTUNGACUUUCUGCCAGG and are shown below:

[0476] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTsmU sdZsdGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 44)

[0477] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsdGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 45)

[0478] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTsmU sdZsfGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 48)

[0479] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsfGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 49)

[0480] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may be comprise a deoxyribose sugar and a G-base (denoted by dG) or a 2'-fluoroarabino ribose or deoxyribose sugar and a G-base (2’-FANA; denoted by fG). Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide); C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: se=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0481] In some embodiments, an oligonucleotide described herein comprises or consists of the following base sequences: TGGCCIGIIGGICAGCUUCAGCUUUNCACUUUCUGCCAGG (SEQ ID NO: 94 and 96) or TGGCCIGIIGGICAGCUUCAGCUUUNGACUUUCUGCCAGG (SEQ ID NO: 95), or is a derivative thereof. An oligonucleotide whose base sequence is represented by SEQ ID NO: 94 and SEQ ID NO: 95 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0482] In other embodiments, an oligonucleotide described herein comprises or consists of the following base sequences: TGGCCIGIIGGICAGCUUCAGCUUUNCACUUUCUGCCAGG (SEQ ID NO: 94 and 96) or TGGCCIGIGGGICGGCCUCAGCUUUNGACUUCCUGCCGGG (SEQ ID NO: 97), or is a derivative thereof. An oligonucleotide whose base sequence is represented by SEQ ID NO: 94 and 96 and SEQ ID NO: 97 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatch-forming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatch-forming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0483] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0484] The oligonucleotide represented by SEQ ID NOs: 51 is considered to be derived from the base sequence TGGCCIGIIGGICAGCUUCAGCUUUNCACUUUCUGCCAGG. The oligonucleotide represented by SEQ ID NOs: 50, is considered to be derived from the base sequence

[0485] TGGCCIGIIGGICAGCUUCAGCUUUNCACUUUCUGCCAGG but is lacking I (inosine); in SEQ ID NO 50, the inosine has been replaced with uracil (U).

[0486] The oligonucleotide represented by SEQ ID NOs: 53, is considered to be derived from the base sequence TGGCCIGIIGGICAGCUUCAGCUUUNGACUUUCUGCCAGG. The oligonucleotide represented by SEQ ID NOs: 52, is considered to be derived from the base sequence

[0487] TGGCCIGIIGGICAGCUUCAGCUUUNGACUUUCUGCCAGG but is lacking I (inosine); in SEQ ID NO 52, the inosine has been replaced with uracil (U).

[0488] The oligonucleotide represented by SEQ ID NO: 55, is considered to be derived from the base sequence TGGCCIGIGGGICGGCCUCAGCUUUNCACUUCCUGCCGGG. The oligonucleotide represented by SEQ ID NO: 54, is considered to be derived from the base sequence P62041914WQ

[0489] TGGCCIGIGGGICGGCCUCAGCUUUNCACUUCCUGCCGGG but is lacking I (inosine); in SEQ ID NO 54, the inosine has been replaced with uracil (U).

[0490] The oligonucleotide represented by SEQ ID NO: 57, is considered to be derived from the base sequence TGGCCIGIGGGICGGCCUCAGCUUUNGACUUCCUGCCGGG. The oligonucleotide represented by SEQ ID NO: 56, is considered to be derived from the base sequence

[0491] TGGCCIGIGGGICGGCCUCAGCUUUNGACUUCCUGCCGGG but is lacking I (inosine); ); in SEQ ID NO 56, the inosine has been replaced with uracil (U).

[0492] In an embodiment, an oligonucleotide derived from SEQ ID NOs: 94-97 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0493] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, oligonucleotides derived from SEQ ID NOs:94-97 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0494] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0495] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’ and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0496] In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi-phosphoramidate internucleostide linkage.

[0497] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0498] In an embodiment, the oligonucleotide further comprises at least one internal LNA located upstream of the mismatch-forming nucleotide.

[0499] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises two internal LNAs located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0500] The Inosine-bearing oligonucleotides represented by SEQ ID NOs: 51 , 53, 55 and 57 are shown below:

[0501] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsdCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 51 )

[0502] LTsLGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsmUs mUsdZsdGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 53)

[0503] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmUsmCsmAsmGsmCsmUsmUs mUsdZsdCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLGsLG (SEQ ID NO: 55)

[0504] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmUsmCsmAsmGsmCsmUsmUs mUsdZsdGsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLGsLG (SEQ ID NO: 57)

[0505] The oligonucleotides lacking inosine and represented by SEQ ID NOs: 50, 52, 54 and 56 as shown below:

[0506] LTsLGsmGsmCsmCsmUomGsmGomGsmGomGsmUomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsm UsmUsdZsdCsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 50)

[0507] LTsLGsmGsmCsmCsmUomGsmGomGsmGomGsmUomCsmAsmGsmCsmUsmUsmCsmAsmGsmCsmUsm UsmUsdZsdGsmAsmCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLGsLG (SEQ ID NO: 52)

[0508] LTsLGsmGsmCsmCsmUomGsmAomGsmGomGsmUomCsmGsmGsmCsmCsmUsmCsmAsmGsmCsmUsm

[0509] UsmUsdZsdCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLGsLG (SEQ ID NO: 54) LTsLGsmGsmCsmCsmUomGsmAomGsmGomGsmUomCsmGsmGsmCsmCsmUsmCsmAsmGsmCsmUsm

[0510] UsmUsdZsdGsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLGsLG (SEQ ID NO: 56)

[0511] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA. I denotes a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or the 3’ termini of the oligonucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the +1 position from the mismatch-forming nucleotide) may be comprise a deoxyribose sugar and a G-base (denoted by dG) or a 2'-fluoroarabino ribose or deoxyribose sugar and a G-base (2 -FANA; denoted by fG).

[0512] Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide); C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0513] In preferred embodiments, an oligonucleotide described herein comprises or consists of the following base sequence: TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NOs: 98, 132, 138) or is derived thereof. An oligonucleotide whose base sequence is represented by SEQ ID NOs: 98, 132, 138 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatch-forming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatch-forming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0514] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0515] In preferred embodiments, an oligonucleotide described herein comprises or consists of the following base sequence: TGGCCIGIGGGICGGCTCAGCTTUZNACUUCCUGCCGG (SEQ ID NO: 140) or is derived thereof. An oligonucleotide whose base sequence is represented by SEQ ID NOs: 140 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatch- forming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0516] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is a uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0517] In an embodiment, oligonucleotides derived from SEQ ID NOs: 98, 132, 138 and 140 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0518] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA). In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’ and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0519] In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide , wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi-phosphoramidate internucleostide linkage.

[0520] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0521] In an embodiment, the oligonucleotide further comprises two internal LNAs located upstream of the mismatchforming nucleotide.

[0522] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises at least one internal LNA located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides.

[0523] The oligonucleotides represented by SEQ ID NO: 58 and SEQ ID: 59 are considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NO: 98) and are shown below:

[0524] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTo mUodZodComAomComUsmUomCsmComUsmGsmCsmCsLGsLG (SEQ ID NO: 58)

[0525] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTo mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID: 59)

[0526] In some embodiments, oligonucleotides used throughout herein may further comprise oligonucleotides represented by SEQ ID NO: 25-30, shown below:

[0527] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAomGsmCsmUsLTsmCsmAsmGsmCsmUsLTom UodZodTomAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 25)

[0528] LTsmUsmCsmUsmUsmAomGsmGomAsmAomUsmGomGsmComCsmlomGsmGomGsmGolGsmlomCsmA omGsmComUsITomCsmAomGsmComUsITomUodZodTomAomCsmUomUsmUomCsmUomGsmCsmCsmA sLG (SEQ ID NO: 26)

[0529] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAomGsmCsmUsLTsmCsmAsmGsmCsmUsLTom

[0530] UodCodTomAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 27) LTsmUsmCsmUsmUsmAsmGsmGsmAsmAsmUsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAs mGsmCsmUsLTsmCsmAsmGsmCsmUsLTomUsdZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAs

[0531] LG (SEQ ID NO: 28)

[0532] LTsmGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUsLTom UsdZsdGsmAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAsLG (SEQ ID NO: 29)

[0533] LTPNdmimGsmGsmCsmCsmlomGsmlomlsmGomGsmlomCsmAsmGsmCsmUsLTsmCsmAsmGsmCsmUs LTomUsdZsdGPNdmimAomCsmUsmUsmUsmCsmUsmGsmCsmCsmAPNdmiLG (SEQ ID NO: 30)

[0534] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA. I denotes a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may be comprise a deoxyribose sugar and a C-base (denoted by dC).

[0535] Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide) ; C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0536] In further embodiments, oligonucleotides of SEQ ID NOs 223-225, SEQ ID NOs 245-257 and of SEQ ID NO: 288-295 are derivatives of base sequences represented by SEQ ID NOs: 98, 132 and 138:

[0537] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTom UsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 223)

[0538] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 224) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 225)

[0539] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTo mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 245) mT smGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLT omCsmAomGsmComUsLT o mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 246) LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmTo mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 247)

[0540] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmT omUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 248) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmT omUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 249) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCseT omCsmAomGsmComUseT o mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 250) eTseGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmTo mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 251 ) mT smGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCseT omCsmAomGsmComUseT o mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 252)

[0541] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 253)

[0542] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 254) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 255) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseT smCsmAsmGsmCsmUseT om UsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 256) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 257)

[0543] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmTo mUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 288)

[0544] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmT omUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 289) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmT omUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 290) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsmTomCsmAomGsmComUsmT omUodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 291 ) P62041914WQ

[0545] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 292)

[0546] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 293) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 294) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdCsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 295)

[0547] In the sequences depicted above (SEQ ID NOs 223-225 and SEQ ID NOs 245-257), without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, e = 2’-MOE, L=LNA. I denotes a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine. Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; capital l= hypoxanthine base (comprised in an inosine nucleotide) ; C*=5- methylcytosine; Z= Benner’s base. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar - modification base - linkage.

[0548] In some embodiments (see Example 3, also Table 3), an oligonucleotide described herein leads to at least 25%, 30%, 35%, 40%, 45%, 50%, 55% full-length human MECP2 protein restoration, it comprises or consists of the following base sequences or is a derivative thereof:

[0549] TGGCCIGIGGGICGGCCTCAGCUTUNTACGUCCUGCCGG (SEQ ID NO: 130) TGGCCIGIGGGICGGCCTCAGCUTUNPACUUCCUGCCGG (SEQ ID NO: 131 ) TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NOs: 98, 132, 138) TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 133, 134) TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 134, 133) TGGCCIGIGGGICGGCCTCAGCTTUNPACUUCCUGCCGG (SEQ ID NO: 135) TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 136) TGGCCIGIGGGICGGCCTCAGCTTTNCACUUCCUGCCGG (SEQ ID NO: 137) TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NOs: 98, 132, 138) TGGCCIGIGGGICGGCTCAGCTTUZNACUUCCUGCCGG (SEQ ID NO: 140)

[0550] An oligonucleotide whose base sequence is represented by SEQ ID NO: 130 - SEQ ID NO: 138 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatch- forming nucleotide. I denotes a nucleotide comprising a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0551] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-d ifluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog, which is a uridine, is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine. P denotes a derivative of thymine (5-methyluracil) and preferably is 5-methyl-4- pyrimidinone.

[0552] In an embodiment, oligonucleotides derived from SEQ ID NO: 130-138, and SEQ ID NO: 140 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0553] Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0554] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0555] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0556] In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi-phosphoramidate internucleostide linkage.

[0557] In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0558] In an embodiment, the oligonucleotide further comprises at least one internal LNA located upstream of the mismatch-forming nucleotide.

[0559] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises two internal LNAs located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the length of the oligonucleotide is from 32 to 49, preferably 39 nucleotides

[0560] An oligonucleotide represented by SEQ ID NO: 102 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCUTUNTACGUCCUGCCGG (SEQ ID NO: 130) and is shown below:

[0561] LtsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTom UodZodTomAomComGsmUomCsmComUsmGsmCsmCsLGsLG (SEQ ID NO: 102)

[0562] An oligonucleotide represented by SEQ ID NO: 103 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCUTUNPACUUCCUGCCGG (SEQ ID NO: 131 ) and is shown below:

[0563] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTo mUodZodP*omAomComUsmUomCsmComUsmGsmCsmCsLGsLG (SEQ ID NO: 103)

[0564] Oligonucleotides represented by SEQ ID NO: 104 and 109 are considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NO: 132) and are shown below:

[0565] LtsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTom UodCodComAomCsmUomUsmComCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 104)

[0566] LtsLGsmGsmCsmCsmlomGsmlomGsmGoLGsmlomCsmGomGsmComCsLTomCsmAomGsmComUsLTom UodCodComAomCsmUomUsmComCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 109)

[0567] An oligonucleotide represented by SEQ ID NO: 105 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 133) and is shown below: LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oeT oeC*oeAoeGoeC*oeT oLT om UodCodComAomCsmUomUsmComCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 105)

[0568] Oligonucleotides represented by SEQ ID NO: 106-108, SEQ ID NO: 110, 112, SEQ ID NO: 114-123 and SEQ ID NO: 125-127 are considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 134) and are shown below:

[0569] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT oeC*oeAoeGoeC*oeT oLT om UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 106)

[0570] LT sLGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT oeC*oeAoeGoeC*oeT oLT om UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 107)

[0571] LT sLGseGoeC*omCsmlomGsmlomGsmGoLGsmloeC*oeGoeGoeC*oeC*oLT oeC*oeAoeGoeC*oeT oLT omU odZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 108)

[0572] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 110)

[0573] LT sLGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 112)

[0574] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLTseC*oeAoeGoeC*oeToLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 114)

[0575] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 115)

[0576] LT seGseGoeC*omCsmlsmGsmlsmGsmGsmGsmlseC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT smU odZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 116)

[0577] LT seGseGoeC*omCsmlsmGsmlomGsmGomGsmlseC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 117)

[0578] LT seGseGoeC*omCsmlomGsmlsmGsmGsmGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 118)

[0579] LT seGseGoeC*omCsmlsmGsmlsmGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 119)

[0580] LT seGseGoeC*omCsmlomGsmlomGsmGsmGsmlseC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 120)

[0581] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm

[0582] UodZodComAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 121 ) LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm

[0583] UodZodCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 122)

[0584] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZsdCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 123)

[0585] LT seGseGoeC*omCsmlsmGsmlsmGsmGsmGsmlseC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT smU sdZsdCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 125)

[0586] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oeToeC*oeAoeGoeC*oeToLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 126)

[0587] LTsLGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oeToeC*oeAoeGoeC*oeToLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 127)

[0588] Oligonucleotides represented by SEQ ID NO: 111 and 113 are considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTUNPACUUCCUGCCGG (SEQ ID NO: 135).

[0589] In an embodiment, an oligonucleotide derived from SEQ ID NO: 111 and 113 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0590] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0591] Oligonucleotides represented by SEQ ID NO: 111 and 113 are considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTUNPACUUCCUGCCGG (SEQ ID NO: 135) and are shown below:

[0592] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodP*omAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 111 )

[0593] LT sLGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UodZodP*omAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 113)

[0594] An oligonucleotide represented by SEQ ID NO: 124 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTUNCACUUCCUGCCGG (SEQ ID NO: 136) and is shown below:

[0595] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT sm UsdZsdCsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 124) An oligonucleotide represented by SEQ ID NO: 128 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCTTTNCACUUCCUGCCGG (SEQ ID NO: 137) and is shown below:

[0596] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oeC*oLT seC*oeAoeGoeC*oeT oLT seT odZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 128)

[0597] An oligonucleotide represented by SEQ ID NO: 129 is considered to be derived from the base sequence TGGCCIGIGGGICGGCCTCAGCUTUNCACUUCCUGCCGG (SEQ ID NO: 138) and is shown below:

[0598] LtsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTsm UodZodComAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 129)

[0599] An oligonucleotide represented by SEQ ID NO: 139 is considered to be derived from the base sequence TGGCCIGIGGGICGGCTCAGCTTUZNACUUCCUGCCGG (SEQ ID NO: 140) and is shown below:

[0600] LT seGseGoeC*omCsmlomGsmlomGsmGomGsmloeC*oeGoeGoeC*oLT seC*oeAoeGoeC*oeT oLT smUsdZ NsmAsmCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 139)

[0601] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA. I denotes a hypoxanthine base, and is preferably an inosine nucleotide. In preferred embodiments I is inosine. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may be comprise a deoxyribose sugar and a C-base (denoted by dC).

[0602] Without other indications, the sugar is ribose as in RNA. Bases are indicated as A=adenine; G=guanine; C=cytosine; T=Thymine; U=uracil; l= hypoxanthine base (comprised in an inosine nucleotide) ; C*=5- methylcytosine; Z= Benner’s base; P*=5-methyl-4-pyrimidinone. Internucleoside linkage are indicated as: s=phosphorothioate (PS) linkage, o = phosphodiester (PO) linkage, PNdmi = (dmi)-phosphoramidate. The order of indication is sugar modification base - linkage. This nomenclature is used for all oligonucleotides of the present application, unless otherwise indicated.

[0603] In some embodiments presented herein, an oligonucleotide comprises or consists of any one of SEQ ID NOs: 25-59, 102-129. Also encompassed are oligonucleotides having a base sequence comprising or essentially consisting of or consisting of a sequence having up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mutation(s) compared to the (base) sequence of any one of SEQ ID NOs: 25-59, 102-129. Mutations include additions, insertions, deletions and substitutions. Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having at least 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NOs: 25-59, 102-129. A preferred level of sequence identity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 97%.

[0604] It is understood that, in the context of any of the oligonucleotides described throughout this disclosure, the term “comprising” may be replaced with the term “consisting essentially of” or “consisting”. In other words, in some embodiments, the oligonucleotides described herein consist essentially of a sequence that is capable of hybridizing with a region in the target RNA comprising said target adenosine, or consist of a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine.

[0605] In a particular embodiment, provided herein is an oligonucleotide relating to a first and a second aspect of this invention for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with the target RNA, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by mutations of the gene encoding MECP2 in a subject, and most preferably wherein the disease is Rett syndrome.

[0606] In some embodiments, effecting ADAR-mediated deamination of a target adenosine in a target RNA with the oligonucleotides and compositions described herein results in increased (pre)-mRNA levels and / or increased protein levels relative to an unedited state (increase compared to an abnormally low level of said (pre)mRNA and / or protein). In some embodiments, effecting ADAR-mediated deamination of a target adenosine in a target RNA with the oligonucleotides and compositions described herein results in restoration of (pre)mRNA function and / or restored protein function relative to an unedited state (increase compared to a dysfunctional (pre)mRNA and / or protein).

[0607] In some embodiments, deamination of a target adenosine in a target RNA with the oligonucleotides and compositions described herein results in increased (pre)-mRNA levels relative to an unedited state (increase compared to an abnormally low level of said (pre)-mRNA).

[0608] In some embodiments, deamination of a target adenosine in a target RNA with the oligonucleotides and compositions described herein results in increased protein levels relative to an unedited state (increase compared to an abnormally low level of said protein). In the context of the treatments described herein, the oligonucleotides and compositions presented herein allow for restoration of normal levels or at least near normal levels of protein expression and / or function relative to an untreated state. The disease or condition may be a condition or a disease of the central nervous system (e.g. brain disease). The expression “decreased” or “abnormally low” in this context may mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% lower than in a control, reference or healthy subject. A subject may be a human being.

[0609] The expression “restoration of normal levels or at least near normal levels” in this context may mean that the protein level is not less than 10%, 20%, 30%, 40%, 50% , 60%, 70% or 75% lower than in a control, reference or healthy subject. (Pre)-mRNA and protein expression may be assessed using any technique known to the skilled person (such as digital-droplet PCR, RNA sequencing, western blotting, FACS analysis, immunohistochemistry, respectively).

[0610] In some embodiments, deamination of a target adenosine in an endogenous MECP2 target RNA encoding a MECP2 protein with the oligonucleotides and compositions described herein results in increased MECP2 protein levels relative to an unedited state (increase compared to an abnormally low level of said protein). In some embodiments, the oligonucleotides and compositions as described herein are provided for use in treating or preventing a disease associated with mutations that affect the levels and / or function of MECP2 protein. In embodiments, the genetic disease associated with the MECP2 gene is a neonatal encephalopathy, P62041914WQ microcephaly, X-linked intellectual disability, PPM-X syndrome (manic depressive psychosis, pyramidal signs, parkinsonism, and macroorchidism, bipolar disorder, parkinsonism, increased muscle tone, exaggerated reflexes, and macroorchidism, or combinations thereof. In embodiments, the genetic disease associated with the MECP2 gene effects a male or female subject. Accordingly, in some embodiments, the oligonucleotides and compositions as described herein are provided for use in treating or preventing Rett syndrome or a symptom, including classical Rett syndrome and variant Rett syndrome (a.k.a. atypical Rett syndrome). In embodiments, the Rett syndrome is the Zappella variant, Hanefeld variant, Rolando variant, and / or ‘forme fruste’ variant.

[0611] In some embodiments, an oligonucleotide described herein comprises or consists of the following base sequence: TGGCCIGIGGGICGGCCTCAGCUTUNGACUUCCUGCCGG (SEQ ID NO: 400) or is a derivative thereof. Preferably, an oligonucleotide whose base sequence is represented by SEQ ID NO: 400 has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ terminus of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatchforming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. I denotes a nucleotide comprising a hypoxanthine base and is preferably an inosine nucleotide. In preferred embodiments I is inosine.

[0612] N denotes the base of the mismatch-forming nucleotide opposite of the target adenosine to be deaminated and may preferably be selected from the group consisting of cytosine, a cytosine analog, uracil, and a uracil analog. Preferably, N is cytosine or a cytosine analog. In some embodiments, the cytosine analog is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. Another particular example of a cytosine analog which is a pyrimidine base is 2'-difluoro 2'deoxycytidine (gemcitabine). A particular example of a cytosine analog which is a pyridine base is 6-amino-5-nitropyridin-2-one (also known as Benner’s Z base). Preferably, N denotes 6- amino-5-nitropyridin-2-one. In some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analog which is a uridine. A particular example of a uracil analog which is uridine is N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine.

[0613] In an embodiment, an oligonucleotide derived from SEQ ID NO: 400 comprises at least one (at least two or at least three or at least four) conformationally restricted sugar moieties. In an embodiment, this conformationally restricted sugar moiety may be present internally. In an embodiment, this conformationally restricted sugar moiety may be present internally and there is no other conformationally restricted sugar moiety present in the oligonucleotide, especially no conformationally restricted sugar moiety present at the 5’ and / or 3’ termini of the oligonucleotide. In an embodiment, this conformationally restricted sugar moiety may be present at the 5’ and / or at the 3’ termini of the oligonucleotide.

[0614] In embodiments, this conformationally restricted sugar moiety is present internally and may further comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0615] In an embodiment, oligonucleotides derived from SEQ ID NO: 400 comprise at least one conformationally restricted sugar moiety positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. Preferred conformationally restricted sugar moiety is a Bridged Nucleic Acids (BNA)s and preferably is a Locked Nucleic Acid (LNA).

[0616] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the nucleotide comprising a restricted sugar moiety to its neighbour nucleotide.

[0617] In an embodiment, the oligonucleotide comprises at least one and preferably two, three or four LNAs. In an embodiment, said one and preferably said two LNAs are internally present and are not present at the 5’and / or 3’ termini of the oligonucleotide. In other embodiments, the oligonucleotide comprises at least one and preferably two internal LNAs and may further comprise at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide. In an embodiment, the oligonucleotide comprises at least one and preferably two LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide , wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. A preferred PN linkage is a PN-dmi- phosphoramidate internucleostide linkage. In an embodiment, the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0618] In an embodiment, the oligonucleotide further comprises two internal LNAs located upstream of the mismatchforming nucleotide.

[0619] In an embodiment, the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'- difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleostide linkage), preferably a PN-dmi-phosphoramidate internucleostide linkage the oligonucleotide further comprises at least one internal LNAs located upstream of the mismatch-forming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides. The oligonucleotides represented by SEQ ID NOs: 226-234, 259-263, 265-279 and 282-287, 296-317, 319- 321 , 323-331 are considered to be derived from the base sequence

[0620] TGGCCIGIGGGICGGCCTCAGCUTUNGACUUCCUGCCGG (SEQ ID NO: 400) and are shown below:

[0621] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTom UsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 226)

[0622] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 227) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 228)

[0623] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUs LTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 229)

[0624] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmU sLTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 230) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmU sLTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 231 )

[0625] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUs LTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 232)

[0626] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmU sLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 233) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmU sLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 234)

[0627] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 259)

[0628] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 260) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 261 ) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseT smCsmAsmGsmCsmUseT om

[0629] UsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 262) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 263)

[0630] LTsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTom

[0631] UsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 265)

[0632] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 266) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmUsLTo mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 267)

[0633] LT sLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 268)

[0634] LTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 269) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 270) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseT smCsmAsmGsmCsmUseT om

[0635] UsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 271 ) eT seGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmT smCsmAsmGsmCsmUsmT o mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCseGseG (SEQ ID NO: 272) mT smGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseT smCsmAsmGsmCsmUseT o mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 273)

[0636] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 274)

[0637] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 275) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0638] UsmTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 276) eTPNdmieGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseTsmCsmAsmGsmCsmUs eTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGPNdmieG (SEQ ID NO: 277) eTPNdmieGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCseGPNdmieG (SEQ ID NO: 278) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseTsmCsmAsmGsmCsmU seTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 279)

[0639] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 282)

[0640] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 283) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0641] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 284) eTPNdmieGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseTsmCsmAsmGsmCsmUs eTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCseGPNdmieG (SEQ ID NO: 285) eTPNdmieGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCseGPNdmieG (SEQ ID NO: 286) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCseTsmCsmAsmGsmCsmU seTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 287)

[0642] LtsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 296)

[0643] LtsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 297) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 298) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 299)

[0644] LtsLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 300)

[0645] LtsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmTo mUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsmG (SEQ ID NO: 301 ) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGsLG (SEQ ID NO: 302) mTsmGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmUsmT omUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGsLG (SEQ ID NO: 303)

[0646] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 304)

[0647] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 305) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0648] UsmTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 306) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0649] UsmTomUsdZsdGsmAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 307)

[0650] LTPNdmiLGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 308)

[0651] LTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 309) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0652] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsLGPNdmiLG (SEQ ID NO: 310) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm

[0653] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmiLG (SEQ ID NO: 311 ) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsLC*smTsmCsmAsmGsmCsm

[0654] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 312) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 313) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsLC*smAsmGsmCsm

[0655] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 314) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsLAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 315) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsLGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 316) P62041914WQ mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsLC*sm

[0656] UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 317) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsmCsm UsLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 319) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsLC*smTsLC*smAsmGsmCsm UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 320) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsLC*smAsLGsmCsm UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 321 ) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsLAsmGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 323) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsLAsmGsLC*sm UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 324) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsmGsLC*sm UsLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 325) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsLGsmCsmU smTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 326) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsmTsmCsmAsLGsmCsmU sLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 327) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsLGsmCsmU sLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 328) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsLAsmGsmCsmU sLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 329) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsmCsLTsmCsmAsmGsLC*sm UsLTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 330) mTPNdmimGsmGsmCsmCsmlomGsmlomGsmGomGsmlomCsmGsmGsmCsLC*smTsLC*smAsLGsmCsm UsmTomUsdZsdGPNdmimAomCsmUsmUsmCsmCsmUsmGsmCsmCsmGPNdmimG (SEQ ID NO: 331 )

[0657] In the sequences depicted above, without other indications, the sugar is ribose as in RNA. Sugar modifications are indicated as d=DNA, m= 2’-OMe, L=LNA, e = 2’-MOE. An oligonucleotide described herein has at least one, and preferably two LNAs positioned at the 5’ and / or 3’ termini of the oligonucleotide. More preferably, an oligonucleotide described herein further comprises two internal LNAs positioned upstream of the mismatch- P62041914WQ forming nucleotide (here denoted by N), and preferably in the -8th and -2th positions from the mismatchforming nucleotide. The nucleotide positioned downstream from the mismatch-forming nucleotide (e.g. in the + 1 position from the mismatch-forming nucleotide) may comprise a deoxyribose sugar and a G-base (denoted by dG.

[0658] Without other in...

Claims

Claims1. An oligonucleotide for RNA editing capable of effecting Adenosine Deaminase Acting on RNA (ADAR)- mediated deamination of a target adenosine comprised in a target RNA, said target RNA preferably encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region of the target RNA, the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN) positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or internally, and the oligonucleotide comprises a mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated2. An oligonucleotide according to claim 1 , wherein the target adenosine is part of a codon also called a therapeutic codon: a start codon, a stop codon, a post-translational modification site or a codon comprising a G to A, a C to A or a T to A missense mutation, wherein all codons comprising said target adenosine are correctable by ADAR-mediated deamination of the target adenosine.

3. An oligonucleotide according to claim 1 or 2, wherein the target adenosine is part of a codon also called a therapeutic codon: a start codon, a stop codon, a post-translational modification site or a codon comprising a G to A missense mutation, wherein all codons comprising said target adenosine are correctable by ADAR- mediated deamination of the target adenosine.

4. An oligonucleotide according to any one of claims 1-3, wherein the target RNA is a protein-coding or a noncoding RNA.

5. An oligonucleotide according to any one of claims 1-4, wherein the target adenosine is part of a codon comprised in a target RNA, wherein the target RNA:- is or comprises an endogenous protein-coding Methyl CpG-binding Protein 2 (MECP2) RNA encoding MECP2 protein, preferably a human MECP2 protein,- is or comprises Frataxin pre-mRNA or mRNA and the target protein is Frataxin, preferably a human Frataxin protein or- is or comprises a Sodium-dependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a Sodium-dependent phosphate transporter 2 protein, preferably a human Sodium-dependent phosphate transporter 2 protein.

6. An oligonucleotide according to any one of the preceding claims, wherein the therapeutic target codon is a stop codon or a codon comprising a G to A, a C to A or a T to A missense mutation, wherein both the stop codon and the codon comprising a missense mutation are correctable by ADAR-mediated deamination of the target adenosine.

7. An oligonucleotide according to any one of the preceding claims, wherein the therapeutic target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both the stop codon and the codon comprising a missense mutation are correctable by ADAR-mediated deamination of the target adenosine.

8. An oligonucleotide according to any one of the preceding claims, wherein the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably, wherein the posttranslational modification site is an ubiquitination site and preferably wherein said ubiquitination site is a lysine ubiquitination site, more preferably wherein the codon encoding the lysine ubiquitination site is an AAG or AAA codon.2759. An oligonucleotide according to claim 8, wherein the deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably, wherein the posttranslational modification site further comprises a phosphorylation, acetylation, succinylation, glycosylation, nitrosylation, methylation, lipidation, amidation, hydroxylation and / or sulfation site.

10. An oligonucleotide according to any one of the preceding claims, wherein the deamination of the target adenosine causes disruption of a start codon, preferably wherein the start codon is an AUG start codon, more preferably wherein the start codon is part of an open reading frame (ORF) in the 5’ untranslated region of the target RNA molecule.

11. An oligonucleotide according to any one of the preceding claims, wherein the conformationally restricted nucleotide (CRN) is a Bridged Nucleic Acid (BNA) and preferably is a Locked Nucleic Acid (LNA).

12. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises at least one internal CRN, preferably an internal LNA.

13. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide, preferably wherein each CRN is an LNA.

14. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises at least one internal CRN and at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide, preferably wherein each CRN is an LNA.

15. An oligonucleotide according to any one of the preceding claims, wherein:- the oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide,- wherein the CRN, preferably the LNA, is part of the sequence capable of hybridizing with a region of the target RNA,- wherein the oligonucleotide does not comprise any 2’F nucleotide and / or- when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other16. An oligonucleotide according to any one of the preceding claims, wherein the CRN, preferably an LNA, further comprises a modified base, more preferably a 5-methylcytosine.

17. An oligonucleotide according to any one of the preceding claims, wherein a modified or artificial internucleoside linkage links the CRN, preferably an LNA, to its neighbour nucleotide, more preferably wherein the modified or artificial internucleoside linkage is a phosphorothioate (PS) internucleoside linkage and / or a PN-dmi linkage.

18. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises at least one LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising at least one LNA at the 5’ terminus and / or the most terminal nucleotides comprising one LNA at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PN-dmi linkage.

19. An oligonucleotide according to claim 15, wherein the oligonucleotide comprises two contiguous LNAs positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the most terminal nucleotides comprising two contiguous LNAs at the 5’ terminus and / or the most terminal nucleotides comprising twocontiguous LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage and / or a PN-dmi linkage.

20. An oligonucleotide according to any one of the preceding claims, wherein the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

21. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target RNA molecule.

22. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide has a length of 26 to 50 nucleotides, preferably 30 to 45 nucleotides, more preferably 32 to 49 nucleotides, even more preferably 37 to 41 nucleotides, most preferably 39 nucleotides.

23. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably wherein: the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, even more preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or wherein the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of the target adenosine and / or at the 5’ and / or 3’ termini of the oligonucleotide24. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base.

25. An oligonucleotide for RNA editing according to claim 1 , wherein the target RNA comprises an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with the target region in the endogenous MECP2 target RNA, the oligonucleotide comprises at least one, and preferably two LNAs at the 5’ and / or at the 3’ terminus of the oligonucleotide and / or at least one internal LNA, wherein a modified or an artificial internucleoside linkage links the most terminal nucleotide comprising one LNA at the 5’ and / or 3’ terminus to its neighbour nucleotide, and the most terminal two nucleotides comprising two LNAs at the 5’ and / or 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage, and the oligonucleotide comprises a mismatch-forming nucleotide opposite of the target adenosine, wherein the target adenosine is part of the therapeutic target codon comprised in the endogenous MECP2 target RNA26. An oligonucleotide according to claim 25, wherein the oligonucleotide further comprises at least one of the following features:the base of the mismatch-forming nucleotide opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, preferably a pseudoisocytosine, more preferably is 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), the base of the mismatch-forming nucleotide opposite of at the target adenosine comprises an uracil base or an uracil base analogue, preferably is N3-Uridine, the oligonucleotide comprises one or more nucleotides capable of forming a wobble base pair with the target RNA, said target RNA comprising an endogenous protein-coding MECP2 RNA encoding a MECP2 protein, preferably wherein the nucleotide forming a wobble base pair comprises a hypoxanthine base, the internucleoside linkage between the first and the second nucleotides positioned in the 3’ position from the mismatch-forming nucleotide is a phosphoryl guanidine linkage (PN internucleoside linkage), preferably a PN-dmi-phosphoramidate internucleoside linkage, the oligonucleotide further comprises at least one internal LNAs located upstream of the mismatchforming nucleotide, preferably wherein the mismatch-forming nucleotide is flanked in the 3’ position with a nucleotide that has a cytosine base, and / or the preferred length of the oligonucleotide is from 32 to 49, more preferably 39 nucleotides27. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is represented by a sequence comprising or consisting of SEQ ID NOs: 90-98, 130-140, 400-420, 423, 424, 25- 59, 102-129, 223-234, 245-248, 253-254, 259-260, 265-269, 274-275, 280, 282-283, 288-331 , 332-334, 338- 339, 340-341 , 344-345, 153-179, 184-187, 347, 349, 351-361 , 363, 196-198, 200, 202-205.

28. A composition comprising an oligonucleotide according to any one of the preceding claims.

29. An oligonucleotide according to any one of the preceding claims or a composition comprising said oligonucleotide for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with the target RNA, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by lacking or insufficient expression of the genes encodingA) Methyl CpG Binding Protein 2 (MECP2),B) Frataxin orC) Sodium-dependent phosphate transporter 2 (SLC20A2) in a human subject, and most preferably wherein the disease is Rett syndrome, Friedreich Ataxia or Primary Familial Brain Calcification (PFBC).

30. An in vitro or an ex vivo method for deaminating a target adenosine, which is comprised in a target RNA encoding a target protein in a cell, said method comprising contacting the cell with an oligonucleotide or a composition as described in any one of claims 1-29, and wherein the cell is a human cell, preferably a cell of the vascular system and / or a cell of the central nervous system.

31. A method according to claim 30, wherein the target adenosine is part of a codon encoding a posttranslational modification site in the target protein, said method comprising contacting the cell with an oligonucleotide or a composition as described in any one of claims 1-29, preferably wherein the posttranslational modification site is an ubiquitination site, and / orthe method is an in vitro or an ex vivo method, and / or the cell is a CNS cell, a heart cell, or a pancreas cell, preferably a CNS cell.27832. A method according to claim 30, wherein the target adenosine is part of a start codon in the 5’ untranslated region of the target RNA molecule, said method comprising contacting the cell with an oligonucleotide as described in any one of claims 1-29, preferably wherein the method is an in vitro or an ex vivo method, and / or the cell is a cell of the vascular system or a cell of the nervous system.

33. An RNA editing oligonucleotide capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a codon selected from:(i) a codon encoding a posttranslational modification site in the target protein, or(ii) a start codon in the 5’ untranslated region of the target RNA molecule34. An oligonucleotide according to claim 33, wherein deamination of the target adenosine causes loss of the posttranslational modification site in the target protein, preferably an ubiquitination site, more preferably a lysine ubiquitination site, even more preferably wherein the codon encoding the lysine ubiquitination site is an AAG or AAA codon.

35. An oligonucleotide according to claim 33 or 34, wherein the target adenosine is the middle nucleotide of a codon encoding a lysine ubiquitination site, preferably wherein said lysine is converted to arginine.

36. An oligonucleotide according to claim 33, wherein deamination of the target adenosine causes disruption of a start codon, preferably an AUG start codon, more preferably an AUG start codon located in an open reading frame (ORF) in the 5’ untranslated region.

37. An oligonucleotide according to any one of claims 33-36, wherein the oligonucleotide comprises a nucleotide forming a mismatch at the target adenosine, preferably wherein the nucleotide forming a mismatch comprises a cytosine base or a cytosine base analog, more preferably wherein the cytosine base analog is a pyridine base, most preferably wherein the pyridine base is 6-amino-5-nitropyridin-2-one.

38. An oligonucleotide according to any one of claims 33-37, wherein the nucleotide residue opposite the target adenosine comprises uracil or an uracil analog, preferably wherein the uracil analog is a purine, more preferably wherein the purine is an N3-uridine.

39. An oligonucleotide according to any one of claims 33-38, wherein the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar, and / or wherein the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose or ribose sugar.

40. An oligonucleotide according to any one of claims 33-39, wherein the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary with a sequence of the target RNA molecule.

41. An oligonucleotide according to any one of claims 33-40, wherein279- the oligonucleotide does not comprise a sequence aimed at forming an intramolecular stem-loop structure for ADAR recruitment and / or the oligonucleotide is a single stranded oligonucleotide,- if it comprises a CRN, (preferably a LNA), said CRN, (preferably LNA), is part of the sequence capable of hybridizing with a region of the target RNA,- wherein the oligonucleotide does not comprise any 2’F nucleotide and / or- when the oligonucleotide comprises 2 CRN at one or at each terminus, they are contiguous to each other.

42. An oligonucleotide according to any one of claims 33-41 , wherein the oligonucleotide has a length of 25- 60 nucleotides, preferably 30-55 nucleotides, more preferably 37-41 nucleotides, most preferably 39 nucleotides.

43. An oligonucleotide according to any one of claims 33-42, wherein the oligonucleotide comprises one or more modified or artificial internucleoside linkages, preferably phosphorothioate (PS) linkages and / or phosphoryl guanidine (PN) linkages, preferably dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (PN- dmi-phosphoramidate).

44. An oligonucleotide according to any one of claims 33-43, wherein the oligonucleotide comprises one or more modified or artificial sugars, preferably selected from 2’-O-methyl, 2’-0-methoxyethyl, 2’-Fluoro, locked nucleic acid (LNA), or unlocked nucleic acid (UNA), more preferably 2’-O-methyl and / or LNA, preferably located at the 5’ and / or 3’ termini.

45. An oligonucleotide according to any one of claims 33-44, wherein the oligonucleotide comprises one or more modified or artificial bases, preferably inosine, hypoxanthine, 5-methylcytosine, or 5-methyluracil.

46. An oligonucleotide according to any one of claims 33-45, wherein the oligonucleotide comprises one or more nucleotides forming a wobble base pair with the target RNA molecule, preferably wherein the residue forming a wobble base pair comprises a hypoxanthine base, even more preferably wherein the residue forming a wobble base pair is inosine.

47. An oligonucleotide according to any one of claims 33-46, wherein the target RNA molecule is: a) A Frataxin pre-mRNA or mRNA and the target protein is Frataxin, preferably wherein the human Frataxin pre-mRNA or mRNA and the target protein is a human Frataxin, such as wherein the human Frataxin comprises or consists of the sequence of SEQ ID NO: 141 or 142, and / or wherein the human frataxin pre-mRNA or mRNA comprises or consists of the sequence of SEQ ID NO: 143 or 144, and even more preferably wherein the ubiquitination site is the lysine at the position corresponding to position 147 in SEQ ID NO: 141 or 142, or b) Encoded by a gene associated with PFBC, preferably the target RNA molecule is a Sodiumdependent phosphate transporter 2 (SLC20A2) pre-mRNA or mRNA and the target protein is a SLC20A2, preferably a human pre-mRNA or mRNA encoding a human SLC20A2 and the target protein is a human SLC0A2, even more preferably wherein the human SLC20A2 pre-mRNA or mRNA comprises or consists of the sequence of any one of SEQ ID NOs: 189-19148. An oligonucleotide according to any one of claims 33-47, wherein the oligonucleotide comprises or consists of the base sequence of any one of SEQ ID NOs: 145-152, 180-183 or SEQ ID NOs: 192-195, 208-213, or a 280sequence having up to 10 mutations with any one of SEQ ID NOs: 145-152, 180-183, or SEQ ID NOs: 192- 195, 208-213.

49. An oligonucleotide according to any one of claims 33-48, wherein the oligonucleotide comprises or consists of the sequence of any one of SEQ ID NOs: 153-179, 184-187 or SEQ ID NOs: 196-205, 214-22250. An oligonucleotide according to any one of claims 33 — 49 for use in medicine, preferably for use in the treatment of Friedreich Ataxia or of Primary Familial Brain Calcification (PFBC).

51. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 33-50, preferably for use in medicine, more preferably for use in the treatment of Friedreich Ataxia or Primary Familial Brain Calcification (PFBC).

52. A method for deaminating a target adenosine in a target RNA molecule encoding a target protein in a cell, the method comprising contacting the cell with an oligonucleotide or a composition according to any one of claims 33-51 , wherein the target adenosine is part of a codon as defined in claim 33, and wherein the method is an in vitro or ex vivo method, and / or the cell is a central nervous system (CNS) cell, vascular cell, heart cell, or pancreas cell.281

Citation Information

Patent Citations

  • Tm leveling methods

    US6683173B2

  • Methods and compositions useful in treatment of diseases or conditions related to repeat expansion

    WO2011097641A1

  • Frataxin mutants

    WO2012014083A2

  • Asymmetric auxiliary group

    WO2014010250A1

  • Nucleoside and nucleotide having sulfonamide structure

    WO2014112463A1