Recombinant expression vector comprising genes regulating lipopeptide metabolic pathway and method for producing daptomycin using same

Abstract

When employed, a recombinant expression vector carrying a daptomycin production gene including a foreign fatty acyl AMP ligase (FAAL) gene, a thioesterase (TE) gene, and a fatty acid synthase (FAS) gene according to the present invention can enhance specificity for decanoic acid, and produce daptomycin without supplementation of lipopeptides, such as decanoic acid, from the outside of the strain. In addition, no by-products are generated during the production process, thereby enabling production of daptomycin with high purity and high yield.

Description

Recombinant expression vector containing a gene regulating lipid peptide metabolism and method for producing daptomycin using the same

[0001] The present invention relates to a method for producing daptomycin with high purity and high yield by controlling primary and secondary metabolic processes during the production process of daptomycin.

[0002]

[0003] This patent is a result derived as part of the "Seoul Regional Innovation Center University Support System (RISE)," which was conducted with funding from the Ministry of Education and the Seoul Metropolitan Government and supported by the Seoul RISE Center in 2025. (2025-RISE-01-001-01)

[0004]

[0005] Lipopeptides are secondary metabolites produced by microorganisms, composed of molecules combining lipids and peptides; they possess antifungal and hemolytic activities and can be utilized as antibiotics. The production of lipopeptides is regulated by primary and secondary metabolic processes. In the primary metabolic process, fatty acid synthases (FAS) form a fatty acid pool, and thioesterases (TE) hydrolyze fatty acid acyl-CoA into free fatty acids. In the secondary metabolic process, fatty acid acyl AMP / CoA ligases (FAAL / FACL) transfer free fatty acids to holo-ACP or CoA. The resulting fatty acid acyl-ACP or fatty acid acyl-CoA are then used as the basic building blocks of peptides by nonribosomal peptide synthetases (NRPS).

[0006] Daptomycin, a cyclic lipopeptide, is an antibiotic derived from Streptomyces roseosporus (S. roseosporus). Daptomycin consists of one decanoic acid and 13 amino acids, with the decanoic acid connected to the first amino acid, tryptophan residue, by an N-amide bond. The decanoic acid is biosynthesized through an initiation step activated by enzymes such as FAAL and ACP, a peptide elongation step in which the chain is lengthened after binding to the peptide by NRPS enzymes, and a termination step in which it is finally released by cyclization and thioesterase.

[0007] Existing methods for producing daptomycin have involved modifying lipids within the lipid-peptide structure or supplying decanoic acid precursors during the fermentation culture of the strain. However, the lipid modification method is dependent on the supply of decanoic acid precursors within the strain, and the method of supplying decanoic acid precursors has limitations, such as toxic effects within the cell when the precursor is supplied in excess, the formation of byproducts due to unoptimized fatty acid specificity, and consequently low production purity and yield.

[0008] Against this background, the present invention was completed by confirming that in order to regulate the primary and secondary metabolic processes in the daptomycin biosynthesis process, fatty acid specificity is enhanced by introducing an exogenous FAAL gene, and when a strain is cultured by introducing exogenous fatty acid biosynthetase and thioesterase genes, the production of decanoic acid precursors increases, thereby enabling the abundant production of daptomycin.

[0009]

[0010] The object of the present invention is to provide a recombinant expression vector for the production of daptomycin comprising one or more foreign FAAL (fatty acyl AMP ligase) genes selected from the group consisting of HmqF (Burkholone), LptE (A54145), RthH (Rotihibin), CylA (Cylindrocyclophanes), Tem 18 (Telomycin 18), and Lpm (Laspartomycin).

[0011] Another objective of the present invention is to provide a strain into which the recombinant expression vector has been introduced.

[0012] Another object of the present invention is to provide a composition for producing daptomycin comprising the strain, its dried product, its culture, its lysed product, or its extract as an active ingredient.

[0013] Another objective of the present invention is to provide a method for producing daptomycin, comprising the step of culturing the strain in a medium.

[0014] Another object of the present invention is to provide a use of the recombinant expression vector, the strain, its dried product, its culture, its lysate, or its extract for the production of daptomycin.

[0015]

[0016] To achieve the above objective, the present invention provides a recombinant expression vector for the production of daptomycin comprising one or more foreign FAAL (fatty acyl AMP ligase) genes selected from the group consisting of HmqF (Burkholone), LptE (A54145), RthH (Rotihibin), CylA (Cylindrocyclophanes), Tem 18 (Telomycin 18), and Lpm (Laspartomycin).

[0017] The present invention also provides a strain into which the recombinant expression vector is introduced.

[0018] The present invention also provides a composition for producing daptomycin, comprising the strain, its dried product, its culture, its lysed product, or its extract as an active ingredient.

[0019] The present invention also provides a method for producing daptomycin, comprising the step of culturing the strain in a medium.

[0020]

[0021] When utilizing a recombinant expression vector comprising an exogenous FAAL (fatty acyl AMP ligase) gene, a thioesterase (TE) gene, and a fatty acid synthases (FAS) gene according to the present invention, substrate specificity for decanoic acid is improved, and daptomycin can be produced without an external supply of decanoic acid, and lipid peptides other than decanoic acid can also be used as substrates, thereby enabling the production of daptomycin with high purity and high yield.

[0022]

[0023] Figure 1a shows the transfer process of fatty acids to ACP via fatty acid acyl AMP intermediates catalyzed by FAAL and FAAL homologous genes, Figure 1b shows the structures of four selected FAAL enzymes LptE, RthH, CylA, and HmqF, Figure 1c shows the profile of lipopeptides produced by a gene construct (Biosynthetic Gene Cluster; BGC) after the dptE gene is replaced with an exogenous FAAL gene (the daptomycin peak is indicated as 1 on the graph, and other lipopeptide peaks are indicated separately), and Figure 1d shows the results of comparing the purity of daptomycin between the gene constructs. Figure 1e shows a fatty acid metabolic pathway reprogrammed for increased decanoic acid production.

[0024] Figure 2 shows an exogenous FAAL gene expected to have high specificity for decanoic acid and a gene structure containing the gene.

[0025] Figure 3a is a schematic diagram of the process of reconstructing a gene structure in yeast, showing the homologous recombination process of the foreign FAAL gene using CRISPR / Cas9, and Figure 3b shows the results of confirming the recombination results by PCR and Sanger sequencing analysis.

[0026] Figure 4a shows the results of measuring the daptomycin yield by analyzing a culture medium of Streptomyces roseosporos expressing HmqF using LCMS (daptomycin is indicated as peak 1), and Figure 4b shows the ESI-MS spectrum in which the mass signal of daptomycin was observed in both cation mode (1620.729) and anion mode (m / z: 1618.726) (daptomycin molecular weight: 1619.709 g / mol).

[0027] Figure 5a shows the results of comparing the catalytic activities of FAAL DptE and HmqF that convert decanoic acid into decanoyl-AMP, and Figure 5b shows the results of measuring the enzyme reaction product, decanoyl-AMP, by LC-MS analysis.

[0028] Figure 6a shows the results of HPLC analysis of Tem18 and Lpm, FAALs specific to short-chain (C8) or long-chain (C14-C15) fatty acids; Figure 6b shows lipopeptides produced by the existing intrinsic DptE and the extrinsic FAALs Tem18 and Lpm; and Figure 6c shows the results of HPLC analysis of lipid peptides produced after expressing Tem18, DptE, and Lpm in a culture medium of Streptomyces roseosporus.

[0029] Figure 7 shows a gene construct containing Tem18 (MiBiG: BGC0001406, NCBI: KT881498.1) which has high specificity for short-chain fatty acids and a gene construct containing Lpm (MiBiG: BGC0000379, NCBI: HM756254.1) which has high specificity for long-chain fatty acids.

[0030] Figures 8a and 8b show the molecular weight analyzed by LCMS and the mass signal analyzed by ESI-MS of lipid peptides produced in the culture medium of Streptomyces roseosporos expressing Tem18 (peak 5: iC8, peak 6: aiC9). Figures 8c and 8d show the molecular weight analyzed by LCMS and the mass signal analyzed by ESI-MS of lipid peptides produced in the culture medium of Streptomyces roseosporos expressing Lpm (peak 7: iC14, peak 8: aiC15).

[0031] Figure 9a shows the fusion process of the exogenous FAAL genes LptE, RthH, CylA, and HmqF with the endogenous ACP gene, Figure 9b shows the HPLC comparison results when exogenous FAAL and endogenous ACP proteins are expressed, and Figure 9c shows the comparison results of daptomycin yields of LptE, RthH, CylA, and HmqF.

[0032] Figure 10a shows the results of daptomycin production analysis with and without oleic acid supply, Figure 10b shows the transcription profiles of genes involved in fatty acid biosynthesis and the β-oxidation pathway after oleic acid supply, Figure 10c shows the degradation of straight-chain and long-chain fatty acids through the β-oxidation pathway and the release of decanoic acid by thioesterase (TE) specific to decanoyl CoA, and Figure 10d shows the LC / MS analysis results after oleic acid supply.

[0033] Figure 11a shows the results of a volcano plot representing genes whose expression changes depending on the presence or absence of oleic acid supply, and Figure 11b shows the read mapping results of genes fadA, fadB, and fadE related to the β-oxidation pathway depending on the presence or absence of oleic acid supply.

[0034] Figure 12a shows the LC / MS analysis results of a Streptomyces roseosporus culture medium supplied with isotope-labeled oleic acid, and Figure 12b shows the results of comparing the relative ratios of labeled and unlabeled daptomycin after the supply of oleic acid.

[0035] Figure 13a shows the process in which decanoic acid is produced through the r-BOX (reverse β-oxidation pathway) and biosynthesized into daptomycin, Figure 13b shows the results of RNA-seq confirmation of the transcription of r-BOX operon genes by the Streptomyces promoter KasO, and Figure 13c shows the HPLC analysis results of Streptomyces roseosporus expressing the r-BOX operon.

[0036] Figure 14 shows the process of fatty acid production by type I fatty acid biosynthesizing enzyme (FAS), the conversion of fatty acid acyl Coa, and decanoic acid released in the β-oxidation pathway by thioesterase.

[0037] Figure 15a shows the design image of the Type I FAS module for decanoic acid biosynthesis, Figure 15b shows the RNA-seq analysis results for transcription optimization of the Type I FAS module, Figure 15c shows the results of comparing daptomycin yields of the MvFAS-Ia and MvFAS-Ib modules, and Figure 15d shows the results of comparing daptomycin yields with and without the introduction of foreign thioesterase.

[0038] Figure 16a shows the process of cloning the type I FAS operon (MvFAS-I) BAC vector containing type I FAS and PPTase genes, and Figure 16b shows the results of confirming the cloning of the MVFAS-I operon through PCR-based genotyping and Sanger sequencing.

[0039] Figure 17 shows the process of replacing the ER domain using CRISPR / Cas9 and gRNA for transcriptional optimization of the MvFAS operon.

[0040] Figures 18a and 18b show the results of comparing daptomycin production and cell growth rates according to the medium, and Figures 18c and 18d show the results of comparing daptomycin production with and without fatty acid supply.

[0041]

[0042] The present invention will be described in detail below.

[0043] In the present invention, the term "recombinant expression vector" refers to a gene construct comprising an essential regulatory element operably linked to express a gene insert, which is a vector capable of expressing a target protein in a suitable host cell or strain.

[0044] The term "operably linked" above refers to a functional linkage between a transcriptional regulatory sequence of a gene and a nucleic acid sequence encoding a target protein to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein may be operably linked to influence the transcription and expression of the coding nucleic acid sequence. Operatory linkage with a recombinant vector can be prepared using synthetic biology and genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage utilize RNA and enzymes, etc., generally known in the art.

[0045] In the present invention, the term "transformation" refers to any act that causes genetically stable inheritance, enabling a gene structure or recombinant expression vector according to the present invention to move into the genome of a host cell and express a target protein. Any transformation method may be used, and it can be easily performed according to conventional methods in the art. Generally, transformation methods include transformation using CRISPR / Cas9, CaCl2 precipitation, electroporation, calcium phosphate precipitation, protoplasmic fusion, stirring using silicon carbide fibers, Agrobacterium-mediated transformation, transformation using PEG, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation methods.

[0046] In the present invention, when a component or step is described as "comprising," this means that, unless specifically stated otherwise, it does not exclude other components or steps but may include additional components or steps.

[0047] The amino acid sequences and nucleic acid sequences described in the present invention can be interpreted as extending to sequences having homology of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more with the provided sequences.

[0048]

[0049] The present invention provides a recombinant expression vector for the production of daptomycin comprising one or more foreign FAAL (fatty acyl AMP ligase) genes selected from the group consisting of HmqF (Burkholone), LptE (A54145), RthH (Rotihibin), CylA (Cylindrocyclophanes), Tem 18 (Telomycin 18), and Lpm (Laspartomycin).

[0050] The above HmqF gene may include the nucleotide sequence of SEQ ID NO. 1, LptE gene may include the nucleotide sequence of SEQ ID NO. 2, RthH gene may include the nucleotide sequence of SEQ ID NO. 3, CylA gene may include the nucleotide sequence of SEQ ID NO. 4, Tem 18 gene may include the nucleotide sequence of SEQ ID NO. 5, and Lpm gene may include the nucleotide sequence of SEQ ID NO. 6.

[0051] The above HmqF gene may be composed of the base sequence of SEQ ID NO. 1, LptE gene of SEQ ID NO. 2, RthH gene of SEQ ID NO. 3, CylA gene of SEQ ID NO. 4, Tem 18 gene of SEQ ID NO. 5, and Lpm gene of SEQ ID NO. 6.

[0052] The above HmqF may be derived from Burkholderia Thailandensis, LptE from Streptomyces fradiae, RthH from Streptomyces scabies, and CylA from Cylindrospermum licheniforme.

[0053] Among the above foreign FAAL genes, HmqF, LptE, RthH, and CylA were introduced to improve decanoic acid specificity, and Tem 18 and Lpm were introduced to improve specificity for substrates other than decanoic acid.

[0054] The above foreign FAAL gene may be combined with dptF, but is not limited thereto.

[0055] According to one embodiment of the present invention (Example 4), when the foreign FAAL gene is combined with dptF and expressed in the strain, the effect of improving the daptomycin yield by more than 4 times was confirmed.

[0056] The above recombinant expression vector for daptomycin production may additionally include one or more fatty acid synthases (FAS) genes selected from the group consisting of MvFAS-Ia and MvFAS-Ib.

[0057] The above fatty acid biosynthetic enzyme may be derived from Corynebacterium glutamicum.

[0058] The above MvFAS-Ia gene may include the nucleotide sequence of SEQ ID NO. 7, and the MvFAS-Ib gene may include the nucleotide sequence of SEQ ID NO. 8.

[0059] The above MvFAS-Ia gene may be composed of the nucleotide sequence of SEQ ID NO. 7, and the MvFAS-Ib gene may be composed of the nucleotide sequence of SEQ ID NO. 8.

[0060] The above recombinant expression vector for daptomycin production may additionally include an AcpS (Acyl Carrier Protein Synthase) gene derived from Mycobacterium vaccae.

[0061] The above AcpS is PPTase (phosphopantetheinyl transferase) and plays a role in binding the activation group required for ACP during the biosynthesis of fatty acids.

[0062] The above recombinant expression vector for daptomycin production may additionally include one or more thioesterase (TE) genes selected from the group consisting of CpTEII, EcFadM, and EcYigI.

[0063] The above CpTEII gene may include the nucleotide sequence of SEQ ID NO. 11, the EcFadM gene may include the nucleotide sequence of SEQ ID NO. 12, and the EcYigI gene may include the nucleotide sequence of SEQ ID NO. 13.

[0064] The above CpTEII gene may be composed of the nucleotide sequence of SEQ ID NO. 11, the EcFadM gene of SEQ ID NO. 12, and the EcYigI gene of SEQ ID NO. 13.

[0065] The above CpTEII gene may be derived from Cryptosporidium parvum, and the EcFadM and EcYigI genes may be derived from Escherichia coli.

[0066] The above recombinant expression vector may be one or more selected from the group consisting of plasmid vectors, cosmid vectors, bacterial artificial chromosome (BAC) vectors, and yeast artificial chromosome (YAC) vectors, but is not limited thereto.

[0067]

[0068] The present invention also provides a strain into which the recombinant expression vector is introduced.

[0069] The above introduction may involve, in the case of a recombinant expression vector containing an exogenous FAAL gene, chemically synthesizing an exogenous FAAL gene with optimized codons, transforming Saccharomyces cerevisiae with a CRISPR / Cas9 plasmid, performing homologous recombination to construct a gene construct, and then introducing the isolated plasmid into the strain using mini-prep, but is not limited thereto.

[0070] When the above gene construct is introduced, the dptE endowed in the strain may be replaced with the foreign FAAL gene. Since dptE has specificity for various substrates, it has the disadvantage of being able to produce a mixture of A21978C1-3 containing branched-chain fatty acids containing byproducts such as ante-iso undecanoic acid, n-iso-dodecanoic acid, and n-ante-iso tridecanoic acid.

[0071] According to one embodiment (Examples 2 and 3) of the present invention for improving specificity for decanoic acid, it was confirmed that when the dptE is replaced with an exogenous FAAL gene, the specificity for decanoic acid is improved and the production of daptomycin increases. In particular, it was confirmed that the production and purity of daptomycin are most improved when the exogenous FAAL gene is replaced with HmqF (Burkholone) derived from Burkholderia Thailandensis.

[0072] In addition, according to one example (Example 3) for improving specificity for short-chain or long-chain fatty acids other than decanoic acid of the present invention, it was confirmed that a lipid peptide having short-chain or long-chain fatty acids can be produced when dptE is replaced with Tem18 derived from telomycin BGC and Lpm derived from laspartomycin BGC.

[0073] In the case of a gene construct containing a thioesterase gene, it may be introduced by inserting it into a pIJBT1-MvFAS-Ib plasmid vector after codon optimization and transforming it into Streptomyces roseosporose.

[0074] According to the example (Example 6) for controlling the free fatty acid pool of the present invention, it was confirmed that when the thioesterase gene is introduced, the hydrolysis efficiency from fatty acid acyl-CoA to free fatty acids is improved, and the production of daptomycin increases. It was confirmed that when the CpTEII gene among the thioesterase genes is introduced, the yield of daptomycin is improved by 63%.

[0075] The above strain may be Streptomyces roseosporus.

[0076]

[0077] The present invention also provides a composition for producing daptomycin comprising the strain, its dried product, its culture, its lysed product, or its extract as an active ingredient.

[0078] The above composition has the advantage of being able to produce daptomycin with high purity and high yield without supplying decanoic acid from an external source, compared to existing compositions for producing daptomycin.

[0079]

[0080] The present invention also provides a method for producing daptomycin, comprising the step of culturing the strain in a medium.

[0081] The above medium may additionally include one or more selected from the group consisting of dextrin, peptone, sugarcane molasses, and ammonium sulfate ((NH4)2SO4), but is not limited thereto.

[0082] According to one embodiment of the present invention, the medium may be an FMB medium comprising dextrin, glucose, yeast extract, peptone, sugarcane molasses, (NH4)2SO4, K2SO4, casamino acid, and TMS, and it was confirmed that the productivity of daptomycin increased by 1.5 times compared to an R5A medium comprising sucrose, glucose, yeast extract, MgCl2·6H2O, 4-morpholinopropanesulfonic acid, K2SO4, casamino acid, and TMS.

[0083] The above method for producing daptomycin may further include a step of supplying a fatty acid mixture composed of decanoic acid and oleic acid in a weight ratio of 2:1 to 1:2, and preferably may further include a step of supplying a fatty acid mixture composed of decanoic acid and oleic acid in a weight ratio of 1:1, but is not limited thereto.

[0084] The above production method may further include the step of recovering daptomycin from one or more selected from the group consisting of the cultured strain, the dried product of the strain, the culture medium of the strain, the lysed product of the strain, and the extract of the strain.

[0085]

[0086] The present invention also provides the use of the recombinant expression vector for the production of daptomycin.

[0087] The present invention also provides the use of the strain, its dried product, its culture, its lysed product, or its extract for the production of daptomycin.

[0088]

[0089] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0090]

[0091] Example 1. Experimental Materials and Methods

[0092]

[0093] 1-1. Strain, Plasmid, and Culture Conditions

[0094]

[0095] All strains, plasmids, guide RNAs, and codon-optimizing genes used in this invention are listed in Tables 1 and 2. TAR-based DNA assembly or Gibson assembly (New England Biolabs) was used for plasmid construction. The Saccharomyces cerevisiae BY4727 yeast strain with genotype MAT his3△200 leu2△0 lys2△0 met15△0 trp1△63 ura3△0 (ATCC No. 200889) was used for all cloning and reconstitution experiments, and the yeast strain was maintained on YPD (yeast extract peptone dextrose) agar medium. The LiAc / single-stranded carrier DNA / PEG method was used for yeast transformation. Transformers were selected from appropriate SC agar dropout media. Escherichia coli ET12567 / pUZ8002 strain was used for gene-to-gene conjugation to modify plasmid DNA. Conjugates were selected by spreading them on agar medium supplemented with an appropriate antibiotic solution. Streptomyces roseosporus strains with various genotypes were stored on ISP4 agar medium and cultured in R5A liquid medium at 30°C with stirring at 200 rpm to produce metabolites.

[0096] 플라스미드설명pTARb-BAC-PE-dpt*Yeast-E.coli-Streptomycesshuttle BAC vector: ARS4 / CEN5,URA3,ori2,oriV, CmR,aph(3)II,φC31 int-attP, andoriT(RP4)pTARb-BAC-PE-dpt* / dptEF-KODerivative of pTARb-BAC-PE-dpt* withoutdptEanddptFgenespTARb-BAC-PE-dpt* / lptEDerivative of pTARb-BAC-PE-dpt*, exchangingdptEwithlptEgenepTARb-BAC-PE-dpt* / rthHDerivative of pTARb-BAC-PE-dpt*, exchangingdptEwithrthHgenepTARb-BAC-PE-dpt* / cylADerivative of pTARb-BAC-PE-dpt*, exchangingdptEwithcylAgenepTARb-BAC-PE-dpt* / hmqFDerivative of pTARb-BAC-PE-dpt*, exchangingdptEwithhmqFgenepTARb-BAC-PE-dpt* / tem18Derivative of pTARb-BAC-PE-dpt*, exchangingdptEwithtem18genepTARb-BAC-PE-dpt* / lpmDerivative of pTARb-BAC-PE-dpt*, exchangingdptEwithlpmgenepTARb-BAC-PE-dpt* / cylA-dptFDerivative of pTARb-BAC-PE-dpt*,cylAwas fused withdptFas single protein.pTARb-BAC-PE-dpt* / cylA-dptFDerivative of pTARb-BAC-PE-dpt*,hmqFwas fused withdptFas single protein.pIJPT1aIndigoidine synthetase (IndC)-based promoter assay vector pIJBT1-MvFAS-CAP01Derivative of pIJPT1a containing the 1kb homologous sequences of both ends of type I fatty acid synthase (MvFAS-Ia) from Mycobacterium vaccaeKCTC9966pIJBT1-B24-MvFAS-Ia (MvFAS01)Derivative of pIJBT1-MvFAS-CAP01 containing B24 promoter on the upstream of MvFAS-Ia genepIJBT1-A07-MvFAS-Ia (MvFAS01)Derivative of pIJBT1-MvFAS-CAP0 of pIJBT1-MvFAS-CAP01 containing A07 promoter on the upstream of MvFAS-Ia genepIJBT1-R01-MvFAS-Ia (MvFAS01)Derivative of pIJBT1-MvFAS-CAP01 pIJBT1-R01-MvFAS-Ia for deletion of ER domain of MvFAS-Ia by insertion of auxotrophicHIS3genepIJBT1-R01-MvFAS-IbDerivative of pIJBT1-MvFAS-ER-KO, exchanging the native DNA sequence of ER domain with codon-reprogrammed synthetic DNA seuqences.pIJBT1-A07-MvFAS-IbDerivative of pIJBT1-R01-MvFAS-Ib containing A07 promoter on the upstream of MvFAS-Ib genepIJBT1-B24-MvFAS-IbDerivative of pIJBT1-R01-MvFAS-Ib containing B24 promoter on the upstream of MvFAS-Ib genepCRCU / URA-dptECRISPR / Cas9 system for targetingdptE genepCRCU / HIS-dptFCRISPR / Cas9 system for targetingdptFgenepCRCU / TRP-FAS-IaCRISPR / Cas9 system for targetingMvFAS-IagenepIJPT1a-B45Derivative of pIJPT1a containing the B45 promoter on the upstream ofindCgenepIJPT1a-B24Derivative of pIJPT1a containing the B24 promoter on the upstream ofindCgenepIJPT1a-A07Derivative of pIJPT1a containing the A07 promoter on the upstream ofindCgenepIJPT1a-A26Derivative of pIJPT1a containing the A26 promoter on the upstream ofindCgenepIJPT1a-R01Derivative of pIJPT1a containing the R01 promoter on the upstream ofindCgene.

[0097]

[0098]

[0099]

[0100] 1-2. RNA Sequencing Analysis of Streptomyces roseosporus

[0101]

[0102] RNA samples were extracted from 4-day cultures of Streptomyces roseosporosus cultured in R5A with or without oleic acid addition using a previously published protocol (Bauer, JS et al. dRNA-seq transcriptional profiling of the FK506 biosynthetic gene cluster in Streptomyces tsukubaensis NRRL18488 and general analysis of the transcriptome. RNA Biology 14, 1617-1626 (2017).). Mycelial cells were collected by centrifugation (12,000 rpm, 10 min) in 2 ml of culture medium and then washed twice with dH2O. The resulting cell pellet was resuspended in 1 ml of lysozyme solution (1 μg / ml in 10 mM Tris-HCl, pH 8.0) and incubated at 30°C for 30 minutes for cell lysis. Subsequently, the cells were mechanically lysed by bead beating with a Tissue Lyzer (QIAGEN). The lysed cells were collected by centrifugation (13,000 rpm, 20 min), after which 1 mL of Trizol reagent was added for complete cell lysis. After adding 0.1 times the volume of chloroform to the lysed cells, the mixture was centrifuged at 4°C (13,000 rpm, 20 min). Subsequently, 500 μl of the aqueous layer was transferred to a new tube, and an equal volume of cold ethanol was added to precipitate the nucleic acids. The precipitated sample was collected by centrifugation at 4°C (13,000 rpm, 30 min), washed with cold 80% ethanol treated with diethylpyrocarbonate (DEPC), and dried at room temperature. The DNA contained in the samples was removed by DNAse-I (Thermo) treatment, and the resulting RNA samples were used for RNA-seq analysis using the Illumina sequencing platform (Macrogen).

[0103]

[0104] 1-3. Replacement of CRISPR / Cas9-mediated FAAL in Daptomycin BGC

[0105]

[0106] All BGC (biosynthetic gene cluster) reconstructions were performed in yeast using CRISPR / Cas9-mediated homologous recombination. Double-stranded DNA oligomers containing recognition sequences for BsaI restriction enzymes at both ends and a 20-base pair target cleavage site interval sequence in the middle were synthesized and cloned into pCRCU via golden gate cloning to generate CRISPR plasmids targeting specific sites. The codon-optimized DNA sequences for six fatty acid acyl-AMP ligases (FAAL) were manually designed and then chemically synthesized at Integrated DNA Technologies (IDT). For FAAL replacement, CRISPR / Cas9 plasmids containing interval sequences specialized for FAAL(dptE) and ACP(dptF) were transformed into yeast. Subsequently, synthesized FAAL dsDNA (100 ng) and PE-dpt* clusters (2 μg) within BAC were co-transformed into yeast already expressing Cas9 and gRNA, and the transformants were selected in appropriate amino acid dropout SC agar media. Ten colonies were selected from each medium and inoculated into 2 mL of the same dropout SC liquid medium. DNA mini-prep from yeast was performed using the Zymolyase lysis protocol. Correct FAAL gene replacement was confirmed by PCR-based genotyping using a primer set (Table 2) that generated a complex linking the dpt cluster and the newly inserted FAAL gene. The generated complex was analyzed by Sanger sequencing (Macrogen).

[0107]

[0108] 1-4. Supply of Isotope-Labeled Oleic Acid

[0109]

[0110] Fatty acid feeding experiments were performed using oleic acid (Sigma) and 13C-labeled oleic acid (13C-9,10 99%, Sigma). Unlabeled oleic acid or 13C-labeled oleic acid was added twice to 50 ml of R5A culture medium of Streptomyces roseosporosus, the first time after 48 hours and the second time after 72 hours. 1 ml of the culture medium was collected and centrifuged at 13,000 rpm for 10 minutes. LC-MS samples were prepared by mixing the culture medium with methanol in equal proportions, and cells were removed by centrifuging at 12,000 rpm for 10 minutes. The resulting culture medium samples were analyzed by LC-MS (UPLC-Q / TOF MS, Waters) using a Phenomenex Kinetex C18 column (100 mm x 2.1 mm, 2.6 μm). Each 10 μL sample was processed in an HPLC at a flow rate of 0.25 ml / min under the following gradient conditions: starting with 5% solvent A (0.1% formic acid in water) for the first 2 minutes, followed by a gradual transition to 100% solvent B (0.1% formic acid in acetonitrile) for 16 minutes, and then washing with 100% solvent B for 1 minute. The mass spectrometer was set to anion mode for analysis.

[0111]

[0112] 1-5. Direct TAR replication of Type I FAS

[0113]

[0114] The FAS-Ia (MvFAS-Ia) gene of Mycobacterium vaccae was cloned directly from the genomic DNA of yeast using TAR cloning. To construct the capture vector, a 500 bp homologous arm was amplified from the genomic DNA of Mycobacterium vaccae KCTC 9966. The capture vector was constructed using the Streptomyces / E.coli / yeast shuttle vector pIJPT1, which contains a Streptomyces promoter in the upstream region of the cloning site. The capture vector contains HpaI recognition sequences surrounded by 500 bp homologous arms in the upstream and downstream regions of the MvFASI operon, which consists of MvFAS-Ia (MVAC_RS00820) and MvAcpS (MVAC_RS00825). Capture vectors (200 ng) and Mycobacterium vacei genomic DNA (4 μg) were linearized with HpaI and BciVI, respectively, and co-transformed into yeast. Subsequently, transformants were selected on SC URA dropout agar medium, and positive colonies were identified by PCR genotyping using a primer set linking the vectors with the Type I FAS operon. For promoter engineering, weak promoter (B24) and strong promoter (R01) cassettes were amplified using a primer set containing a 40 bp homologous sequence and a 20 bp primer sequence in the region adjacent to the target promoter site (Table 2). pIJPT1 (pIJPT1-MvFASI), containing the MvFASI operon, was used to insert the promoter upstream of the operon. Promoter insertion was performed through yeast homologous recombination between pIJPT1-MvFASI cleaved with HpaI and the PCR-amplified promoter cassettes. Recombinant DNA clones were isolated via the zymolase lysis protocol and then transformed into E. coli EC100. After isolating the plasmid, Sanger sequencing (Macrogen) was used to verify that the promoter had been correctly inserted.

[0115]

[0116] 1-6. ER Domain Replacement using CRISPR in Type I FAS

[0117]

[0118] The 2,183 bp ER domain DNA sequence between the AT and DH domains was designed through codon redesign. This redesigned ER domain sequence was chemically synthesized in IDT as a double-stranded DNA fragment containing 40 bp homologous arms on both sides (Table 3).

[0119]

[0120]

[0121] Domain replacement was performed in yeast in two steps using mpCRISTAR. In the first step, the HIS3 histidine auxotrophic marker gene was amplified by PCR using a primer set (MvFAS_ER_HIS_F1 and MvFAS_ER_HIS_R1, Table 2) to include a 40 bp homologous arm and an AflII recognition sequence. The amplified PCR products were co-transformed with pIJPT-MvFASI to replace the original ER domain with the HIS3 marker, generating the pIJPT1-MvFASI-ERKO construct. Transformers were selected from SC agar medium deficient in both HIS and URA. In the second step, each of the three synthesized dsDNA fragments was transformed into yeast with pIJBT1-MvFAS-ER-KO linearized to AflII and then selected from SC agar medium deficient in URA. Each colony was back-selected from HIS-deficient SC agar medium. A total of 10 colonies were selected and cultured in 1.5 ml of URA-deficient SC liquid medium for one day, after which the plasmid was mini-preped using the zymolase lysis protocol. Replacement was confirmed by Sanger sequencing of the amplified ER domain using a set of primers that bind outside the ER domain.

[0122]

[0123] 1-7. Production and Quantification of Daptomycin

[0124]

[0125] Reconstituted daptomycin BGCs were transformed into E. coli ET12567 / pUZ8002 cells and then transferred to Streptomyces roseosporos strains via intergenic conjugation. Conjugates were selected from ISP4 agar medium supplemented with apramycin solution (final concentration 50 μg / mL). For metabolite production, spores of recombinant Streptomyces roseosporos were inoculated into 50 mL of R5A medium in a 125 mL baffle flask and cultured at 30°C for 7 days with shaking at 200 rpm. Starting 48 hours after the initial culture, decanosan (Sigma) was supplemented every 24 hours. 1 mL of each culture was collected every 24 hours and diluted with an equal volume of methanol. Subsequently, the cell pellet was removed from the culture sample by centrifugation at 12,000 rpm for 10 minutes, and 20 μL of the clear supernatant was analyzed using reverse-phase HPLC with a C18 analytical column (4.6 x 150 mm, 5 μm). The solvent gradient was set to 5% to 100% acetonitrile containing 0.1% trifluoroacetic acid in water, and the flow rate was set to 1 mL / min. The concentration of daptomycin was calculated from the HPLC peak area measured at 222 nm, which was converted to a concentration using a previously published calibration curve (Ji, C.-H et al, Top-down synthetic biology approach for titer improvement of clinically important antibiotic daptomycin in Streptomyces roseosporus. Metabolic Engineering 69, 40-49 (2022)).

[0126]

[0127] Example 2. Discovery of foreign FAAL analogs

[0128]

[0129] Lipidation processes involve both primary and secondary metabolism in lipopeptide biosynthesis. Primary metabolism generates a pool of free fatty acids, some of which are loaded into the first NRPS module according to FAAL / FACL substrate specificity. Therefore, FAAL / FACL are checkpoint enzymes that determine the lipid composition of lipopeptide antibiotics. In daptomycin biosynthesis, FAAL (DptE) loads medium-chain fatty acids into free ACP (DptF). Due to the broad substrate specificity of DptE, Streptomyces roseosporos naturally produces an A21978C1-3 mixture containing branched-chain fatty acids including ante-iso undecanoic acid, n-iso-dodecanoic acid, and n-ante-iso tridecanoic acid groups. Since FDA-approved daptomycin contains straight-chain decanoic acid (C10), supplementing decanoic acid to Streptomyces roseosporos cultures produces a mixture of daptomycin and A21987C1-3. To increase the purity of daptomycin, we investigated whether replacing DptE with an exogenous FAAL analog could alter fatty acid specificity in daptomycin biosynthesis.

[0130] To this end, the MiBIG database was searched for FAAL analogs with the potential to possess higher decanoic acid specificity. As a result of the database search using the DptE amino acid sequence as a query, 119 known FAAL sequences with more than 35% sequence similarity and 80% coverage were discovered (Fig. 1a). Subsequently, substrate specificity was predicted by analyzing the structures of biosynthetic products of FAAL-related BGCs. Through this analysis, four FAAL candidates with the potential to have higher decanoic acid specificity were selected: LptE (A54145) derived from Streptomyces fradiae, RthH (Rotihibin) derived from Streptomyces scabies, CylA (Cylindrocyclophanes) derived from Cylindrospermum licheniforme, and HmqF (Burkholone) derived from Burkholderia Thailandensis (Figs. 1b and 2). To evaluate whether the above foreign FAAL analogs could replace DptE in daptomycin biosynthesis, four genes were chemically synthesized with codons optimized for expression in Streptomyces roseosporose.

[0131]

[0132] Example 3. FAAL replacement for lipopeptide lipid profile modification

[0133]

[0134] 3-1. Introduction of the dpt cluster variant into Streptomyces roseosporus

[0135]

[0136] We tested whether replacing dptE with an alien FAAL-like gene could alter the lipid profile of daptomycin. In the previously reported (Ji, C.-H et al, Top-down synthetic biology approach for titer improvement of clinically important antibiotic daptomycin in Streptomyces roseosporus. Metabolic Engineering 69, 40-49 (2022)) promoter-engineered dpt cluster (PE-dpt* cluster), the dptE gene was replaced with four chemically synthesized FAAL genes to generate PE-dpt* / rthH, PE-dpt* / hmqF, PE-dpt* / lptE, and PE-dpt* / cylA (Fig. 3). These four dpt cluster variants were introduced into Streptomyces roseosporus, and the lipopeptide profiles were compared via LC-MS (Fig. 4). All engineered constructs produced daptomycin upon the addition of decanoic acid, but the production yield and purity varied significantly (Fig. 1c). LptE and RthH derived from Streptomyces NRPS BGC produced a significant amount of lipopeptide containing branched fatty acid groups, but consequently, the daptomycin purity was low at approximately 40%. On the other hand, CylA and HmqF showed high specificity for straight-chain decanoic acid, exhibiting daptomycin purity of 70% and 90%, respectively. A comparison of daptomycin production yields confirmed that daptomycin was produced in the order of 401 mg / L (DptE), 512 mg / L (LptE), 120 mg / L (RthH), 48 mg / L (CylA), and 451 mg / L (HmqF) (Fig. 1d). The above results indicate that FAAL derived from Streptomyces prefers branched-chain fatty acid substrates, whereas FAAL derived from other bacterial phyla prefers straight-chain fatty acid substrates.In an in vitro FAAL acyl transfer assay, HmqF showed approximately 5 times higher catalytic activity than DptE for decanoic acid substrates (Fig. 5).

[0137]

[0138] 3-2. Improvement of Daptomycin Productivity Using Fatty Acid Substrates Other than Decanoic Acid

[0139]

[0140] To confirm whether fatty acid substrates shorter or longer than decanoic acid (C10) can be used for the production of daptomycin lipopeptide, several FAAL candidates with potential specificity for short-chain (C8) or long-chain (C14 & C15) fatty acids were discovered in the MiBIG database (Fig. 6a). Among them, Tem18 derived from telomycin BGC and Lpm derived from laspartomycin BGC were selected, and the two FAAL genes were chemically synthesized. Subsequently, the dptE gene was replaced with the tem18 and lpm genes to produce PE-dpt* / tem18 and PE-dpt* / Lpm, respectively (Fig. 7). It was confirmed through LC / MS analysis that Streptomyces roseosporos modified with the above construct successfully produced lipopeptides with short-chain (numbers 5 and 6 in Fig. 6b) and long-chain (numbers 7 and 8 in Fig. 6b) lipid groups (Figs. 6c and 8). Collectively, the above results indicate that FAAL replacement can be a useful strategy for altering the lipid profile of lipopeptide natural products.

[0141]

[0142] Example 4. Yield improvement through FAAL and ACP gene fusion

[0143]

[0144] Replacing the dptE gene with the exogenous analogs cylA and hmqF significantly improved the purity of daptomycin; however, the production yield was lower than when dptE was used, indicating that maximum catalytic activity was not achieved. Previous studies have suggested that DptE (FAAL) recognizes the acylation target DptF (ACP) through protein-protein interactions. Therefore, the lack of protein-protein interactions between the exogenous HmqF (FAAL) and the existing DptF (ACP) may be a major cause of the reduced daptomycin yield. We investigated the potential to resolve this issue by promoting acyl transfer through gene fusion by physically placing FAAL and non-cognate ACP in close proximity. The exogenous FAAL genes, cylA and hmqF, were combined with the endogenous ACP gene, dptF, to generate hmqF-dptF and cylA-dptF fusion genes, respectively (Fig. 9a). The above hybrid genes were incorporated into the PE-dpt* cluster to produce PE-dpt* / hmqF-dptF and PE-dpt* / cylA-dptF, which were then conjugated to Streptomyces roseosporos. As expected, the gene fusion significantly improved the daptomycin yield while maintaining high specificity for decanoic acid (Fig. 9b). In the case of HmqF, the production yield increased fourfold, reaching 451 mg / L in flask culture (Fig. 9c). Since the PE-dpt* / hmqF-dptF construct produced daptomycin with the highest yield and purity, this construct was used in all subsequent experiments.

[0145]

[0146] Example 5. Analysis of fatty acid metabolism for potential pathways of decanoic acid biosynthesis

[0147]

[0148] Daptomycin is produced by precursor-induced biosynthesis by adding high concentrations of decanoic acid to a culture medium of Streptomyces roseosporos. Since decanoic acid is primarily produced industrially by extracting small amounts from plants, the industrial production of daptomycin relies heavily on the decanoic acid supply chain, which can be affected by unpredictable climatic or geographical factors. Therefore, to establish decanoic acid biosynthesis in Streptomyces roseosporos, the fatty acid metabolism of Streptomyces roseosporos was engineered. The fatty acid pool of Streptomyces roseosporos consists mainly of branched (iso or anteiso type) medium-chain fatty acids. This is mainly because FabH (β-Ketoacyl-ACP synthase III) in Type II FAS exhibits high substrate specificity for branch chain starting materials such as 2-methylbutyryl CoA, isovaleryl CoA, and isobutyryl CoA.

[0149] When the BKD (branched chain α-keto acid dehydrogenase) gene was deleted to remove the enzyme that catalyzes the conversion of amino acids into branched chain α-keto acids, the production of natural lipopeptides ceased and a small amount of daptomycin was produced. This suggests that FabH preferentially recognizes branched chain substrates. Therefore, we investigated whether decanoic acid could be produced through the β-oxidation pathway that degrades straight-chain long-chain fatty acids. Oleic acid (C18) was added to a culture medium of Streptomyces roseosporos containing PE-dpt* / HmqF-DptF instead of decanoic acid (C10), and LC-MS analysis showed that the daptomycin yield was nearly the same when oleic acid was added as when decanoic acid was added (Fig. 10a). Comparison of RNA-seq data between culture media with and without oleic acid added revealed that the transcription levels of genes associated with the β-oxidation pathway increased significantly when oleic acid was added (Figs. 10b and 11). To further confirm that the β-oxidation pathway is the primary pathway for decanoic acid production, a mass spectrometry-based stable isotope labeling experiment was performed using oleic acid-[9,10-13C2], which was biisotope-labeled (Fig. 10c). LC-MS analysis of the culture media with added oleic acid-[9,10-13C2] showed that the molecular weight of daptomycin increased by 2 Da, indicating that the labeled oleic acid was incorporated into daptomycin without altering the labeling site (Figs. 10d and 12). Taken together, these results suggest that implementing a biosynthetic system that produces long-chain fatty acids can increase cellular decanoic acid productivity.

[0150]

[0151] Example 6. Fatty acid metabolism reprogramming for decanoic acid biosynthesis

[0152]

[0153] We investigated whether the fatty acid metabolism inherent in Streptomyces roseosporus could be reprogrammed to produce straight-, long-chain fatty acids, which are major intermediates of decanoic acid biosynthesis. Since the Type II FAS inherent in Streptomyces roseosporus has high specificity for branched fatty acids, engineering the FabH fatty acid biosynthesis gene is known to significantly reduce the overall catalytic efficiency of fatty acid biosynthesis, which is not a desirable approach. Therefore, we first attempted the possibility of producing decanoic acid using the β-oxidation reversal pathway (r-BOX) used for decanoic acid production in E. coli. To establish the r-BOX pathway in Streptomyces roseosporus, four codon-optimizing genes required for initiation (thiolase, bktB), extension (hydroxyacyl-CoA dehydrogenase, FadB and trans-enoyl reductase, egTER), and termination (acyl-CoA TE, FadM) were chemically synthesized and organized into a single operon. However, when the r-BOX operon was overexpressed in Streptomyces roseosporus, daptomycin was not produced, confirming that the r-BOX pathway does not function to produce decanoic acid in Streptomyces (Fig. 13). Accordingly, the utilization of alternative FAS, known to produce straight-chain long-chain fatty acids, was explored. When introducing foreign Type II FAS, there is a possibility of interaction with the intrinsic Type II FAS, so it was expected that the Type I FAS system, in which all catalytic domains are included in a single polypeptide chain, could form an isolated and independent system and function better (Fig. 14).

[0154] Two bacterial Type I FAS, MvFAS-Ia from Mycobacterium vaccae and CgFAS-Ia from Corynebacterium glutamicum, are known to produce straight-chain long-chain fatty acids. Since the codons of the MvFAS-Ia gene are efficiently expressed in Streptomyces, MvFAS-Ia (FAS) was selected, and the MvAcpS (PPTase) gene, which expresses an enzyme that activates ACP (Acyl Carrier Protein) to transport fatty acids, was utilized. First, using the genomic DNA of the Mycobacterium vacay KCTC9966 strain, 1kb DNA fragments were amplified using primer combinations of MvFAS01-UPS-F / MvFAS01-UPS-R and MvFAS01-DWS-F / MvFAS01-DWS-R, respectively, and then the pIJBT1-MvFAS-CAP vector was constructed using homologous recombination in yeast. The Mycobacterium vacay genomic DNA was treated with BciV1 restriction enzyme, and then the pIJBT1-MvFAS01 vector was constructed using homologous recombination in yeast. In addition, to optimize the expression of the MvFAS01 fatty acid biosynthetic gene during heterogeneous expression, pIJBT1-B24-MvFAS01, pIJBT1-A07-MvFAS01, and pIJBT1-R01-MvFAS01, composed of synthetic promoters SEQ NOs. 17, 19, and 20, were constructed and transformed to produce recombinant production strains (Figs. 15a and 16). Subsequently, these constructs were transferred to Streptomyces roseosporos containing PE-dpt* / hmqF-dptF. All of these constructs produced daptomycin without the addition of decanoic acid, and higher production yields were observed when stronger promoters were used (Fig. 15c).

[0155] When MvFAS-Ia / MvAcpS was expressed using a strong promoter (R01), the daptomycin yield in flask culture reached 175 mg / L, which was lower than the yield obtained when oleic acid was added (Figs. 10a and 15c). Since the Type I FAS operon is approximately 10 kb long, RNA-seq analysis was performed to check for transcriptional bottlenecks. The results confirmed a significant decrease in transcription in the ER domain of MvFAS-Ia, suggesting the possibility of the existence of potential secondary structures that hinder transcriptional elongation (Fig. 15b). To address this issue, a double-stranded DNA fragment of the ER domain was chemically synthesized using reprogrammed codons and inserted in place of the wild-type ER to create the MvFAS-Ib / MvAcpS construct (Fig. 17). This engineered construct did not show transcriptional degradation in RNA-seq analysis, and the daptomycin yield increased significantly, reaching 412 mg / L (Fig. 15c). This is a level similar to the yield obtained when the maximum concentration of decanoic acid was added.

[0156] Thioesterase (TE) is an enzyme that hydrolyzes fatty acyl CoA to produce free fatty acids and plays an important role in regulating the intracellular free fatty acid pool. The genes EcFadM and EcYigI derived from Escherichia coli and CpTEII derived from Cryptosporidium parvum were codon-optimized to be efficiently expressed in Streptomyces roseosporos. Specifically, the three thioesterase enzyme proteins were re-encoded by codon optimization in which rare codons such as UUA codons were minimized and replaced with preferred codons in the Streptomyces roseosporos strain. After chemical synthesis, the proteins were inserted into the pIJBT1-MvFAS-Ib plasmid vector and transformed into Streptomyces roseosporos for heterologous expression. As a result, when the CpTEII gene was introduced among the three genes, the daptomycin yield increased to 673 mg / L, showing a 63% improvement (Fig. 15d). In summary, high concentrations of decanoic acid were successfully produced by reprogramming the fatty acid metabolism of Streptomyces roseosporose through the integration of foreign Type I FAS and TE genes.

[0157]

[0158] Example 7. Production of Daptomycin through Culture Medium Optimization

[0159]

[0160] 7-1. Optimization of Culture Medium

[0161]

[0162] Using the novel recombinant Streptomyces roseosporos strain prepared above, culture conditions affecting daptomycin productivity and cell growth were optimized. Daptomycin productivity and cell growth rates were compared and analyzed after culture using R5A and FMB culture media at a culture temperature of 30℃.

[0163] R5A medium (pH 6.5) was composed of 100 g sucrose, 10 g glucose, 5 g yeast extract, 10.24 g MgCl2·6H2O, 21 g 4-Morpholinopropanesulfonic acid, 0.25 g K2SO4, 0.1 g casamino acid, and 1 ml TMS (trace metal solution) per liter [containing 10 g FeSO4·7H2O, 2.25 g ZnSO4·7H2O, 1 g CuSO4·5H2O, 0.5 g MnSO4·5H2O, 0.23 g Na2B4O7·10H2O, 2 g CaCl2·2H2O, and 0.1 g (NH4)6Mo7O24 per liter of solution].

[0164] FMB medium (pH 6.5) was composed of 70 g dextrin, 10 g glucose, 5 g yeast extract, 1 g peptone, 6 g sugarcane molasses, 0.8 g (NH4)2SO4, 0.25 g K2SO4, 0.1 g casamino acid, and 1 ml TMS per liter [containing 10 g FeSO4·7H2O, 2.25 g ZnSO4·7H2O, 1 g CuSO4·5H2O, 0.5 g MnSO4·5H2O, 0.23 g Na2B4O7·10H2O, 2 g CaCl2·2H2O, and 0.1 g (NH4)6Mo7O24 per liter of solution].

[0165] As a result, when FMB medium was used instead of R5A medium, the productivity of daptomycin increased 1.5 times to 989 mg / L, and the cell density increased 3.4 times. Therefore, it was confirmed that the FMB culture medium is composed of nutrients optimized for daptomycin production and the producing strain, and this was intended to be applied to the mass production of daptomycin through 5L-scale fermenter culture (Fig. 18).

[0166]

[0167] Example 5-2. Production of Daptomycin via Fermenter Culture

[0168]

[0169] First, as a pre-culture step, the recombinant Streptomyces roseosporos strain was cultured in a 50 ml flask containing FMB culture medium for 72 hours, and then 5% of the culture medium was cultured again in a 250 ml flask for 72 hours.

[0170] 10% of the culture medium from the 250ml flask pre-culture was used for fermentation in a 5L-scale fermenter containing 2L of FMB culture medium, and 1ml to 2ml of the culture medium was sampled every 24 hours to analyze daptomycin productivity and cell growth rate. As a result, it was confirmed that the daptomycin production and cell growth rate increased further to 1320 (mg / L) and 3.12 (OD600), respectively (Fig. 12). To further increase daptomycin productivity, when a fatty acid mixture consisting of decanoic acid and methyloleic acid in a 1:1 weight ratio was supplied at a rate of 0.25mL / hrs per unit time, the daptomycin productivity and cell growth rate were confirmed to be 3520 (mg / L) and 3.23 (OD600), respectively, confirming a significant increase in daptomycin productivity (Fig. 18). It was confirmed that the recombinant production strain produced by genomic engineering of the present invention is a strain in which both the production yield and purity of daptomycin are significantly increased, and it is expected that this can be usefully applied to the industrial mass production of daptomycin.

[0171]

[0172] Sequence No. 1: HmqF-FAAL gene sequence

[0173]

[0174] GTCCGCTCCGCACGGTGTGCGTGGACCAGGCTGCCCTCCAGCAGCAGAAGGTCGTGATCCGGCGTGCGTTCGAGGGACTCGCGCCGCAGACGGACGAGAGGGACGGCGAACGCGTCCTGGTCAGCGTAGGTGTTCCCATCGGAGAACAGCGGGTGGTAGTGCGCGATCTGAACACGAACGAGCGGTGCGCTGACGATGAGATCGGTGAAATCTGCGTCGCGGGAGCGAGCGTCGCTCCCGGCTACTGGCAGCAGTACGAACAGACGCTGGCGACGTTCCAGCGCGGTATCGGCGGTGAAGCCGGTCAGGAATTCGCGGGCACGGGAGACCTGGGCTTCTACCACCGCGGTGATCTGTACGTCACGGGTCGCCTGAAGGACATGATCATCATCGCCGGTCGCAACTACTACTCGGAAGACGTCGAGTACGCTGTGATCGGGAGCCGTCCCGAGCTGGTCCCGAACGGTTGCGCCGCGTTCACGGTGGACGCCGGTGACGAGGAACGGCTCGTCGTCGTCGCCGAGATCGAGCGTACGCACCGCAAGGGCGATCTGGACGCCCTGCTCAAGGGCATCCGCGAAGCCATCTGGCTCCGGCACGACATCTCGCCGGGTGCGGTGCTGCTCGTCTCGCCTGGGAGCGTACCGAAGACCTCGTCCGGCAAGGTGAGGCGTTCCGAATGCCGCAAGCGCCTTCGCGACGGTGAACTGACGGTACTGGCCCGCTGGGATGCAGACGACCTGACGGCTGCTGCGACACGTGGTGCGGCCGCTGCACCGGCATCCAGCACGAGCCCGGCTTCGCCCGCGAGCTGATAA

[0175]

[0176] 서열번호 2: LptE-FAAL 유전자 서열

[0177]

[0178] GCTGGGCGGCCAACGGCTCCGAGCCCATCCGCGCCGAGACGCTGCGCGCCTTCGCCAAGGAGTTCGCCCCGGCCGGACTCCACCCGAACGCCACCACCCCTTGCTACGGACTGGCCGAGGCGACCCTGCTGGTGTCCCTGCCCACGGGTGAGCTGCGCACCCGACGGGTGGACGTCGCGGAACTGGAGAACCACCGCTTCGTCGAAGCGGCCGTGGGACGCCCCTCCCGCGAGATCGTGTCCTGCGGCCGGCCCCCGTCCCTGGAGATCCGCGTCGTCGACCCCGCGACCGGCAAGTCCGTCACGGGCGGCGACGGAGCCGGCGAGACCAGGGTGGGCGAGATCAGAGTGCGCGGCGCGAGCGTCGCCAGGGGCTACTGGCAGAAACCGGAGGCGACCGCCGAGACGTTCGTCATGGACGCGGACGGCTCCGGGCCCTGGCTGCGCACCGGCGACCTCGGCGCTCTGTACGAGGGCGAGCTGTACGTCACCGGCCGTATCAAGGAACTCCTCATCGTGCACGGCCGCAACATCTACCCCCATGACATCGAGCACGAACTGCGCGCCCGCCACGCCGAACTCGGCGCTGTCGGGGCCGCCTTCTCCCTCAGCACCGAATCGGGCGAGGTTGTGGTCGTCACCCATGAGGTGAACCCCACCGTCCGGCCCGAGCAGGGTCCCGAGCTGGTGACCGCCCTGCGTGCGACGCTCGCGCGGGAGTTCGGCCTCGCCCCGGCCGGGGTGGTGCTGGTGCGCCGCGGCCGCATCCCGCGCACCAGCAGCGGCAAGGTGCAACGCCGCCTGACCGCCCGGCTGTTCAGCACGGGGGAACTCGCCCAGGTCCATGCCGACCCCGGCGCCCACCGCCTCCTGGCGGAACTCAGGGAGGCGCACGACCGTGGAGGTGCATTCCCGCCTCCCAGCCCTCCCGCATGATAA

[0179]

[0180] 서열번호 3: RthH-FAAL 유전자 서열

[0181]

[0182] CGACTGCCCTGGAGAACCGTGAGTTCCGTCCCGCGACTGGCACGCAGCCGAGCCGTACCCTCGTCGGCTGCGGCTCGCCGACTGGGTCCGACGTGCTGATCGTGGACCCGGATACCGGTCGGGCTCTGCCCGAGGGTCGTGTTGGCGAGATCTGGCTCAGCGGACCCTGCGTGACCGCAGGCTACTGGAAGAACGGTCCCGTCACCGATGCGACGTTCCGCGCACACACGGACGATGGACGTGGTCCGTTCCTGCGCACCGGTGACCTCGGAGCCCTGCTCGACGACGATCTCTACATCACGGGTCGCAGCAAGGACGTTCTGGTCCTGCACGGTCGCAACCTGCACCCGAGCGACATCGAGTGCGAACTGCGCTCCCAGCACGAGGAGCTCGAAGGCCTCCACGGTGCCGTCTTCATGGTCGGCGATGACGGTGGAGCGGACGTCACCCCGGCTGTGGTCGTAGTCCACGAGATCCGTGCGCACTGGGGTGCCGAGCGGCTGGGCAGCATCGCGGTGGACATGAAGCAGACCGTCGTCCGCGAGTTCGGCGTACCGGTTGCAGCGGTCGCGCTGGTGCGTCCCGGTGGCGTACGACGCACGACCAGCGGCAAGGTCCAGCGTGCGGCCATGCGCGCACTCCACCTGGCCGGTGAGCTGGACACGCTGCACCTCCGTGAGGACCCGCTGCTGACGGATGCACTGGCTGGAGAGGACATCGCGCCCACGGACCACGCTCCACATCCGCACCCGGCGTGA

[0183]

[0184] 서열번호 4: CylA-FAAL 유전자 서열

[0185]

[0186] CCATCGTGAAGTGCCTCCAGGCACAGACCCTGAAGGAGAACATCATCGTCGACGTGACGCACCCCACGCCGTCGTCCCAGGAGGCGTCGAAGGTGCTGGTGGGCTGCGGGCACAGCTGGCTCGACTACAAGATCGTCATCGCCGACCCCGAGTCGTTCGAGCTCTGCGCAGACGGTCGCGTCGGCGAAATCTGGGTCTCGTCCGCGTCGGTCACCAAGGGCTACTGGAACCGGCCCCAGCAGACGCAGGAGACGTTCAAGGCGTACCTGAAGGACGGCCTCGGTCCCTTCCTGCGGACGGGCGACCTCGGCTTCCTGCACGACGGTGAGCTGTACGTCACGGGACGTCTCAAGGACATCATCATCATCAGGGGTCAGAACCACTACCCCCAGGACATCGAGCTCACGGTGCAGAAGTCGTACTCCGCGCTGCGTCTCAACTGCGGTGCGGCCTTCACCATCGAGGTCAAGGGCAAGGAGCAGCTGATCATCGTGCTGGAGGTCGAACGCACCTACCTCAAGAAGCTGGATGTCAACCACGTGCTGGAGATCATCACGCAGGCGGTGGCGACGGAGCACGGACTCCAGGTGTACGCCACGGTCCTCGTCAAGACCGGCTCGATCCCGAAGACGTCCAGCGGCAAGATCCAGCGTCACGCTTGCCGGACCAAGTTCCTCAACGCATCGCTGGACGTGGTCGAAGACTGGAGCGAGAACCCTCAGTACAAGTCGGGATTCATCCGGCTCCAGGATGAAGTCGAATCGGTGTTCAACACCTTCGCCAAGAAGCGCGAGGCCTTCCCGCCTCCCAGCCCTCCCGCATGATAA

[0187]

[0188] 서열번호 5: Tem18-FAAL 유전자 서열

[0189]

[0190] CGCGCGAACCGCTCGTGACCACCGTGGATGGCGATGCGCTGGCCCGTCGCGAGTTCCGCCCCGTACCGACAGCGGCTGGTGGCCGTGATCTGCCGTCCAACGGCACTGCCCACGGCTTCGACGTCGCGGTGGTCGACCCCGAGACGCACCGTCGGCTTCCCGCTGGACGCATCGGCGAGCTGTGGCTGCGCGGTCCGAACGTAGCGCAAGGCTACTGGGATGACCGGGATGCCACCGATGCGACCTTCAGGGCCACGACCGCGGATGGTGACACCGGCTACCTGCGCACGGGTGACCTGGGCACGGTCCACGATGGCGAGCTGTACGTGACGGGTCGCATCAAGGACGTGATGATCTTCCGTGGTCGCAACCTCTACCCGCAGGACATCGAGCACGAACTGCGGACCTGCCATCCCGAGCTGGCCAACGTCGGAGCCGTCTTCGCGGCACCCGTACGCCCGTCCGATCCGCGTGACCGCGAAGAGGGTCTGGTCGTCACCCACGAAGTGCGCGCAGGCCTCGGAGAACCGAGGCTCACCGCGCTGGCTGCCGCACTGCGGCAGACGGTAGCGCGTGACTTCGGCGTGGTTCCCGCTGCGGTCCTTCTGCTCCGTCGCGGTACCGTCCGGCGTACGACGAGCGGCAAGATCGAACGTGCGGCCATGCGCGAACTGTTCCTCACGGGTCGGCTGGACTCCGAGTACGCGACCGTGATCACGCCTCGTGGTGGTGCCCGATGATAA

[0191]

[0192] 서열번호 6: Lpm-FAAL 유전자 서열

[0193]

[0194] TGGCCGAGGCGACCCTCTTCATCTCCGGTTCCTTCCGCACCGAACGCCGGGTGGTCGAGGTCTCCGCGGAACTCCTGGAACGCCACGAGTTCCGCCCCGCGGTGACCGCCGCCGACGAGCCGCTGCGCGAGGTCGTCAGCTGCGGCCCGCCGCTCGGCGCCGAGGTGCGGGTCGTCGCCCCCGACACCCTGCGGGTGCTGCCGGACGGGAGCGTCGGGGAGATCTGGGTACGCGGCGACATCGTCGGCAAGGGCTACTTCAACCGCGAGGCCACCAACGAGGCCGAGTTCCGCGCCACGACGGCCGACGGCGACTCCGGATATCTGCGCACGGGCGACCTCGGGGCCCTGCACGACGGCGAGCTCTACATCACCGGCCGCATCAAGGACGTACTGAATCTGCGCGGCCGCAACCTCTACCCCCAGGACATCGAGCACGAACTGCGCGCCGACCGGCCCGAGTTGGGCAATCTCGTCGGCGCGTGCTTCGCGGTGCCGGGGGAGGGGCCGCAGGGCGACGACGTGCTGGTGGTCACCCACGAGGTGCGCGGCATCAAGGAGGAGGAGCGGCTGCGCGAGCTGGCCGCCGAGATGCGGCTCACCGTGGCCCGCGAATTCGGCGCACCCGTCGGGGCCGTACTGCTGCTGCGGCCCGGCGGGGTGCGGCGCACCACCAGCGGCAAGATCCAGCGCTCCGCGATGCGGGAGCTGTTCAAGGCGGGCGAACTGGAGCCCACGTACGCGGACTACCAGCCCAGCCTGCTGCGGCGCCCGGCGCCCCGGACCGCCGAGGCCACCGCATGA

[0195]

[0196] 서열번호 7: MvFAS-Ia 유전자 염기서열

[0197]

[0198] CCGGAGAAGACGCAGGAGGCGGCGATGTTGCTGGATCCGGCGTCGCGGCTCGGCGAGAACGGCGTGTACCGGCGTTGA

[0199]

[0200] Sequence No. 8: MvFAS-Ib gene sequence

[0201]

[0202] CCGGAGAAGACGCAGGAGGCGGCGATGTTGCTGGATCCGGCGTCGCGGCTCGGCGAGAACGGCGTGTACCGGCGTTGA

[0203]

[0204] Sequence No. 9: CylA&DptF-FAAL&ACP gene sequence

[0205]

[0206] CGAGTTCGTCCAGGCACTGATGCCCCAGTTGGCCGACCGCACCTGA

[0207]

[0208] Sequence No. 10: HmqF&DptF-FAAL&ACP gene sequence

[0209]

[0210] CGTCCCCACACTCAACGAGTTCGTCCAGGCACTGATGCCCCAGTTGGCCGACCGCACCTGA

[0211]

[0212] Sequence No. 11: CpTEII

[0213]

[0214]

[0215] 서열번호 12: EcFadM

[0216]

[0217] ATGCAGACGCAGATCAAGGTCCGTGGATACCATCTCGACGTCTACCAGCACGTCAACAACGCCCGCTACCTTGAGTTCCTCGAAGAGGCCCGCTGGGACGGCTTGGAGAACAGCGACAGCTTCCAGTGGATGACGGCCCACAACATCGCCTTCGTCGTGGTCAACATCAACATCAACTACCGTCGCCCAGCGGTCCTCTCGGACCTGCTGACCATCACCTCCCAGCTCCAGCAGCTGAACGGTAAGAGCGGCATCCTGAGCCAGGTCATCACGCTGGAGCCGGAGGGTCAGGTGGTAGCGGACGCGCTCATCACGTTCGTGTGCATCGATCTGAAGACGCAGAAGGCGCTGGCTCTGGAGGGCGAACTCCGCGAGAAGCTGGAGCAGATGGTCAAGTAG

[0218]

[0219] 서열번호 13: EcYigI

[0220]

[0221] ATGTCGGCCGTCCTGACCGCGGAACAGGCCCTGAAGCTCGTCGGTGAGATGTTCGTCTACCACATGCCGTTCAACCGCGCGCTGGGGATGGAACTGGAGCGCTACGAGAAGGAGTTCGCACAGCTGGCCTTCAAGAACCAGCCGATGATGGTGGGCAACTGGGCGCAGAGCATCCTGCACGGTGGGGTCATCGCGTCGGCGCTGGATGTCGCTGCCGGTCTGGTGTGCGTCGGCAGCACGCTGACCCGTCACGAGACCATCTCCGAAGACGAGCTGCGCCAGCGGCTGTCGCGGATGGGGACCATCGACCTGCGCGTGGACTACCTGCGTCCCGGTCGCGGCGAGCGGTTCACGGCGACCTCGTCCCTGCTGCGTGCGGGCAACAAGGTCGCCGTAGCCCGCGTGGAACTGCACAACGAGGAGCAGCTCTACATCGCCAGCGCCACGGCCACCTACATGGTGGGCTGA

[0222]

[0223]

[0224] 서열번호 14: B24 합성프로모터

[0225]

[0226] ATCGCTTGCAGGCGAGGTCTGGTCGGGTTCGTGTCGCGGAGAGCCGTGGTGGTAAGGGTCGGGGTGCCGGCTGTCTGGTGTGGGGGTGGCGCGTTCGCACCGTAGTCGTTGCGACCGTCGAAGCGTGCCTGTGCCTCCCTGTTCTCGTGCACAGCCCGGTGTCGGGGTCGCAGTCGGACTCGGTCCGAGCTCCATCCACAAGCGAATACTTGCCGCCCCTTCCGTCTGGATGTTAAGTTAATCTCAGACAAACACTCAGGAGGAAGACT

[0227]

[0228] 서열번호 15: B45 합성프로모터

[0229]

[0230] ACTGGTGAATGATGGGCACTGGTCCGGATCGGTGCAGGCGGTGCACTCGTGGAGTGGGTGGGGGTGACGGCTGACTGGTCTGCGGGTGGTGAGCTCGCCACGTAGTCGGTGTCGAGTCTGCCCAGACGCTGTGCCTCACTGATCCCGTGCGACGCACGGTGTCGCGGTCGGACGCTCCGGACGTAGCTCCGTCTCGTTCAAACAGCCCATTGACACGGTTCACTGCGCGCTTTTATGATGTACAGCCCTCCAACCAAAGGAGGCAGTGT

[0231]

[0232] 서열번호 16: A07 합성프로모터

[0233]

[0234] GTAGGTGAGCCTTGCTGAGCGAGTGCCATCGGACGGACTAGCCAGAGGTAGAGCGACGATTGCGACCGTGGTCGATGAGCTGGTTCGGAGCCGACGAGCCGTCGCGTGACTACGCTGACGGCGTGACCACGAGCGAGCGTGATGGCGACTGTGCACCGCAGAGTGCCGCACCGGGCTACATACGACGACACGCGTCTGGAGAATCTAAGTTGACGGGACGGTACGGTGTGCGGTAACGTCTCCCCGGTGCCGGAATCAGGAGGACTTCC

[0235]

[0236] 서열번호 17: R01 합성프로모터

[0237]

[0238] TACCACGCGTACAGCTACGACGGCTCGGCCAACGTCCGCCGTCTCCTCCGTCACGTCGCTGCTCACGCGGTACTGGCTCAGCTGCGCCAGCTGGACTCGGCTCAGTCGGTCCCACGGATGAGATGCGTAACCAGAGTGCAGTGCGTGCCAGCATGGCAGATGCCTCCGCGAGGCTGTTCTCCGATACGGCACGAACAGGCTACCTCCGCTTGACTAGCGTCCTGTAGACGCGCTAGCATTACGGTCCTTCCCCGACAAGGAGGCAAAGT

[0239]

[0240] 서열번호 18: AcpS

[0241] GTGGGCATCGTCGGGATAGGCATCGATCTCGTCTCCATTCCGGAGTTCGCCGAGCAGGTGGACCGGCCCGGGACGGTGTTCGCGGAGACGTTCACCCCGGGCGAGCGGCGCGACGCCGCCGACAAGAGTTCGTCGGCGGCGCGCCACCTCGCCGCGAGGTGGGCGGCCAAGGAGGCGGTGATCAAGGCCTGGTCCGGATCGCGCTTCGCCAAGCGGCCGGTGCTGCCCGAAGCGATCCACCGCGACATCGAGGTCATCACCGACATGTGGGGGCGTCCCCGGGTGCGCCTGTCCGGGGCCGTGGCCGAGCACCTCAAAGAGGTGACGATCCACCTGTCGCTGACCCATGAGGCCGACACCGCGGCGGCGGTCGCCGTCCTCGAGGAGCGCTAG

[0242]

[0243] [이 발명을 지원한 국가연구개발사업]

[0244] [과제고유번호] 2710011400

[0245] [과제번호] 2022R1A2C4001258

[0246] [부처명] 과학기술정보통신부

[0247] [Name of Project Management (Specialized) Agency] National Research Foundation of Korea

[0248] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)

[0249] [Research Project Title] Research on the Discovery of Novel Bioactive Substances Derived from Microorganisms and the Enhancement of Effective Substances through Genomic Big Data Mining

[0250] [Name of Project Performing Organization] Konkuk University

[0251] [Research Period] 2024.03.01 ~ 2025.02.28

Claims

1. A recombinant expression vector for daptomycin production comprising one or more foreign FAAL (fatty acyl AMP ligase) genes selected from the group consisting of HmqF (Burkholone), LptE (A54145), RthH (Rotihibin), CylA (Cylindrocyclophanes), Tem 18 (Telomycin 18), and Lpm (Laspartomycin).

2. A recombinant expression vector for producing daptomycin according to claim 1, wherein the HmqF gene comprises the sequence of SEQ ID NO. 1, the LptE gene comprises the sequence of SEQ ID NO. 2, the RthH gene comprises the sequence of SEQ ID NO. 3, the CylA gene comprises the sequence of SEQ ID NO. 4, the Tem 18 gene comprises the sequence of SEQ ID NO. 5, and the Lpm gene comprises the sequence of SEQ ID NO.

6.

3. A recombinant expression vector for daptomycin production according to claim 1, wherein the foreign FAAL gene is combined with dptF.

4. The recombinant expression vector for producing daptomycin according to claim 1, wherein the recombinant expression vector for producing daptomycin further comprises one or more fatty acid synthase (FAS) genes selected from the group consisting of MvFAS-Ia (Mycobacterium vaccae fatty acid synthase Ia) and MvFAS-Ib (Mycobacterium vaccae fatty acid synthase Ib).

5. A recombinant expression vector for producing daptomycin according to claim 4, wherein the MvFAS-Ia gene comprises the nucleotide sequence of SEQ ID NO. 7 and the MvFAS-Ib gene comprises the nucleotide sequence of SEQ ID NO.

8.

6. In paragraph 4, the recombinant expression vector for producing daptomycin further comprises an AcpS (Acyl Carrier Protein Synthase) gene.

7. The recombinant expression vector for producing daptomycin according to claim 4, wherein the recombinant expression vector for producing daptomycin further comprises one or more thioesterase (TE) genes selected from the group consisting of CpTEII (Cryptosporidium parvum Thioesterase II), EcFadM (E. coli-ketoacyl-CoA thioesterase), and EcYigI (Escherichia coli medium- to long-chain acyl-CoA thioesterase).

8. A recombinant expression vector for producing daptomycin according to claim 7, wherein the CpTEII gene comprises the nucleotide sequence of SEQ ID NO. 11, the EcFadM gene comprises the nucleotide sequence of SEQ ID NO. 12, and the EcYigI gene comprises the nucleotide sequence of SEQ ID NO.

13.

9. A recombinant expression vector for producing daptomycin, wherein the recombinant expression vector is one or more selected from the group consisting of a plasmid vector, a cosmid vector, a bacterial artificial chromosome (BAC) vector, and a yeast artificial chromosome (YAC).

10. A strain into which a recombinant expression vector according to any one of claims 1 to 9 has been introduced.

11. In paragraph 10, the strain is Streptomyces roseosporus.

12. A composition for producing daptomycin comprising the strain of claim 10, its dried product, its culture, its lysed product, or its extract as an active ingredient.

13. A method for producing daptomycin comprising the step of culturing the strain of claim 10 in a medium.

14. A method for producing daptomycin according to claim 13, wherein the medium comprises one or more selected from the group consisting of dextrin, peptone, sugarcane molasses, and ammonium sulfate ((NH4)2SO4).

15. A method for producing daptomycin according to claim 13, wherein the method further comprises the step of supplying a fatty acid mixture composed of decanoic acid and oleic acid in a weight ratio of 2:1 to 1:

2.

16. A method for producing daptomycin according to claim 13, wherein the method further comprises the step of recovering daptomycin from one or more selected from the group consisting of the cultured strain, the dried product of the strain, the culture medium of the strain, the lysate of the strain, and the extract of the strain.

Images