Transposome complex attachment to flow cell surfaces

By attaching transposome complexes to flow cell surfaces, the efficiency of DNA sample processing is enhanced, addressing the inefficiencies and costs of traditional methods through improved DNA capture and tagmentation.

WO2026096180A1PCT designated stage Publication Date: 2026-05-07ILLUMINA INC
View PDF 24 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/050474
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-31
Filing Date
2025-10-10
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing methods for DNA fragmentation and tagging generate excessive waste, require expensive instruments, and are time-consuming, limiting the efficiency of DNA sample processing for sequencing.

Method used

Binding transposome complexes to interstitial regions or primers on flow cell surfaces using covalent and non-covalent attachment mechanisms to improve DNA sample capture and tagmentation.

Benefits of technology

Enhances DNA sample processing efficiency by simplifying surface chemistry and improving DNA capture, reducing waste and costs associated with traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025050474_07052026_PF_FP_ABST
    Figure US2025050474_07052026_PF_FP_ABST
Patent Text Reader

Abstract

An example flow cell includes a substrate, which includes depressions separated by interstitial regions; a transposome capture mechanism attached over at least the interstitial regions, wherein the transposome capture mechanism i) is to bind to a transposome complex or ii) includes a free end group that is to bind to the transposome complex or iii) includes a protein that is to bind to the transposome complex; and a primer set attached over the depressions.
Need to check novelty before this filing date? Find Prior Art

Description

TRANSPOSOME COMPLEX ATTACHMENT TO FLOW CELL SURFACESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of: U.S. Provisional Application Serial Number 63 / 713,804 filed October 30, 2024, U.S. Provisional Application Serial Number 63 / 715,922 filed November 4, 2024, U.S. Provisional Application Serial Number 63 / 716,122 filed November 4, 2024, U.S. Provisional Application Serial Number 63 / 736,419 filed December 19, 2024, and U.S. Provisional Application Serial Number 63 / 752,277 filed January 31 , 2025, each of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The Sequence Listing submitted herewith is hereby incorporated by reference in its entirety. The name of the file ILI292BPCTJP-2904- PCT_Sequence_Listing.xml, the size of the file is 16,058 bytes, and the date of creation of the file is October 8, 2025.BACKGROUND

[0003] Double-stranded DNA (dsDNA) target molecules can be fragmented and tagged to generate a library of smaller, double-stranded DNA molecules, which can undergo additional processing to generate single-stranded DNA molecules (ssDNA). These smaller, single-stranded DNA molecules may be used as templates in DNA sequencing reactions. The templates may enable short read lengths to be obtained, and then during data analysis, overlapping short sequence reads can be aligned to reconstruct the longer nucleic acid sequences. Some methods for fragmentation and tagging of double-stranded DNA generate excessive waste, involve expensive instruments for fragmentation, and are time-consuming.SUMMARY

[0004] In some of the examples set forth herein, transposome complexes are bound at least to interstitial regions of the flow cell surface. The placement of the transposome complexes in these examples may improve DNA sample capture and tagmentation. Various covalent and non-covalent attachment mechanisms are described.

[0005] In other examples set forth herein, the transposome complexes are bound to primers that are present on the flow cell surface. The primers may be the same primers used during amplification, or may be primers that are designed specifically for capture of the transposome complexes. These examples may simplify the surface chemistry of the flow cell.BRIEF DESCRIPTION OF THE DRAWINGS

[0006] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

[0007] Fig. 1 A through Fig. 1 K depict different examples of transposome complexes;

[0008] Fig. 2A is a top view of a flow cell;

[0009] Fig. 2B is an enlarged, perspective, and cut-away view of one architecture of the flow cell of Fig. 2A, where transposome complexes are at least attached to interstitial regions of the flow cell;

[0010] Fig. 2C is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 2A, where transposome complexes are attached to primers in depressions of the flow cell;

[0011] Fig. 2D is an enlarged, perspective, and cut-away view of yet architecture of the flow cell of Fig. 2A, where transposome complexes are attached to primers in a lane of the flow cell;

[0012] Fig. 2E is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 2A, where a single transposome complex dimer is immobilized in each of the depressions of the flow cell;

[0013] Fig. 3 illustrates another example of the flow cell architecture of Fig. 2B;

[0014] Fig. 4 is a schematic flow diagram illustrating an example method for obtaining SiO2 at the interstitial regions of a substrate;

[0015] Fig. 5 is a schematic flow diagram illustrating one example method using the transposome complexes of Fig. 1 D and Fig. 1 E;

[0016] Fig. 6 is a schematic flow diagram illustrating one example method using the transposome complexes of Fig. 1 F and Fig. 1 G;

[0017] Fig. 7 is a schematic illustration of a flow cell including a complementary metal-oxide semiconductor (CMOS) imaging device that is coupled to a substrate of the flow cell, where a single transposome complex dimer is immobilized in each of the depressions defined in a lid of the flow cell;

[0018] Fig. 8A, Fig. 8B, and Fig. 8C together schematically depict an example of tagmentation and extension utilizing homodimers of the transposome complexes of Fig. 1A and Fig. 11;

[0019] Fig. 9A, Fig. 9B, and Fig. 9C together schematically depict another example of tagmentation utilizing homodimers of the transposome complex of Fig. 1 J;

[0020] Fig. 10A, Fig. 10B, and 10C together schematically depict yet another example of tagmentation utilizing homodimers of the transposome complex of Fig. 11;

[0021] Fig. 10D through Fig. 101 together schematically depict another example of tagmentation and initiation of amplification utilizing different homodimers of the transposome complex of Fig. 11;

[0022] Fig. 11 A through Fig. 11 D depict an example of ligation and amplification that can be used in different examples of the methods and kits disclosed herein; and

[0023] Fig. 12A and Fig. 12B depict a portion of a method utilizing homodimers of the transposome complex of Fig. 1 K.

[0024] Definitions

[0025] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.

[0026] As used herein, the singular forms “a,” “an,” and “the” refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0027] Reference throughout the specification to “one example,” “another example,” “an example,” and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0028] The terms “substantially” and “about” used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to ±5% from a stated value, such as less than or equal to ±2% from a stated value, such as less than or equal to ±1 % from a stated value, such as less than or equal to ±0.5% from a stated value, such as less than or equal to ±0.2% from a stated value, such as less than or equal to ±0.1 % from a stated value, such as less than or equal to ±0.05% from a stated value.

[0029] Adapter. An oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths may range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. The adapter may include any combination of nucleotides and / or nucleic acids. In some examples, the adapter can include an amplification domain, e.g.,having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, the adapter can include a sequence that is complementary to at least a portion of a flow cell surface bound primer (which includes the universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to the complementary flow cell surface bound primer during amplification and cluster generation. In some examples, the adapter can also include a sequencing primer sequence (i.e. , sequencing binding site) or a sequencing sample index (i.e., a barcode sequence). Combinations of different adapters may be incorporated into the nucleic acid molecule, such as the DNA fragments, generated via tagmentation.

[0030] Amplification'. Some examples further comprise amplifying and / or replicating one or more nucleic acid templates, including fragments thereof. The amplifying and / or replicating comprises use of one or more of a bridge amplification reaction, an isothermal bridge amplification reaction, a rolling circle amplification (RCA) reaction, a modified rolling circle multiple displacement amplification, a helicase-dependent amplification reaction, a recombinase-dependent amplification reaction, a singlestranded DNA binding (SSB) protein mediated Isothermal amplification, a PCR reaction, a strand-displacement reaction, a ligase chain reaction, a transcription- mediated reaction, a loop-mediated amplification reaction, other suitable reactions, and combinations thereof.

[0031] Amplification Domain’. A portion of an adapter having a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, that can serve as a starting point for template amplification and cluster generation.

[0032] Clusters: Moreover, as used herein, the term “cluster of oligonucleotides” (or “cluster” or “oligonucleotide cluster” or “colony”) refers to a localized group or collection of DNA or RNA on a nucleotide-sample support, such as a flow cell, particle, polymer scaffold, or other solid surface. In particular, a cluster includes tens, hundreds, thousands, or more copies of a cloned or the same DNA or RNA segment. For example, in one or more examples, a cluster includes a grouping of oligonucleotides immobilized in a section of a flow cell or other nucleotide-sampleslide. In some examples, the cluster can comprise one or more concatemers, such as, for example, a polony or a nanoball. In some examples, clusters are evenly spaced or organized in a systematic structure within a patterned flow cell. By contrast, in some cases, clusters are randomly organized within a non-patterned flow cell. In typical examples, a cluster is the product of an amplification reaction. A cluster of oligonucleotides can be imaged utilizing one or more light signals, changes in pH, changes in conductance, and other signals. For instance, an oligonucleotide-cluster image may be captured by a camera during a sequencing cycle of light emitted by irradiated fluorescent labeled nucleotides incorporated into oligonucleotides, fluorescent labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescent labeled complexes associated with incorporated or bound nucleotides from one or more clusters on a flow cell. Examples of other sequencing procedures are set forth herein. In some examples, a cluster can be monoclonal or polyclonal.

[0033] Corresponds with: When one primer “corresponds with” an amplification domain, the primer and amplification domain may have the same sequence, so that a copy of the amplification domain generates a sequence complementary to the primer.

[0034] Depositing: Any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.

[0035] Depression: A discrete concave or recessed feature in a substrate or a layer of a substrate (e.g., a patterned resin) having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate or the layer. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surfacecan be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have more complex architectures, such as ridges, step features, etc.

[0036] DNA Sample: Multiple pieces of a polymeric form of nucleotides of any length that includes deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from an RNA (ribonucleic acid) sample. The DNA sample is double stranded. The DNA sample may include naturally occurring DNA, which includes a nitrogen containing heterocyclic base (a nucleobase such as adenine, thymine, cytosine and / or guanine), a sugar (specifically deoxyribose, i.e. , a sugar lacking a hydroxyl group that is present at the 2’ position in ribose), and a backbone containing phosphodiester bonds. An analog structure can have an alternate backbone linkage including any of a variety known in the art.

[0037] The DNA sample may be genomic DNA (gDNA) that can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva) or tissues. gDNA can be prepared by lysing a cell that contains the DNA. The cell may be lysed under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis may be used to lyse a cell. In another particular example, exposure of a cell to alkaline pH can be used to lyse a cell while causing relatively little damage to gDNA. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, relatively undamaged gDNA can be obtained from a cell lysed by an enzyme that degrades the cell wall. Cells lacking a cell wall either naturally or due to enzymatic removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption, sonication heat, pressure differential such as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in a cell lysate or isolated gDNA sample including, for example, nuclease inhibitors, chelating agents, salts, buffers and the like. A crude cell lysate containing gDNA may be used without further isolation of the gDNA. In one example, a whole blood sample may be lysed using an inorganic salt free lysis buffer (containing a chaotropic detergent), and the crude lysate may be exposed to specific processing steps to generate a complexedcrude lysate (e.g., as described in International Pub. No. WO 2023 / 122755, incorporated herein by reference in its entirety). This complexed crude lysate can also be used as the DNA sample without further isolation or purification.

[0038] A DNA sample is one example of a nucleic acid sample. A nucleic acid sample is a sample, containing DNA and / or RNA, derived from any organism, including, for example, animals, plants, fungi, and microbes. Such samples may be derived from one or more biological fluids, cells, tissues, organs, or organisms, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence. Such samples may include, but are not limited to, sputum / oral fluid, amniotic fluid, blood, a blood fraction, or fine needle biopsy samples (such as surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (such as a patient), the sample may be from any mammal, including, but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, the sample may be microbial such as bacteria, viral, or fungal. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (such as namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein. A “nucleic acid sample” may also include nucleic acid sequence information stored in a memory, and which was originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.

[0039] Each'. When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0040] Flow Cell'. A vessel having an enclosed flow channel where a reaction can be carried out, or a vessel having a channel that is open to a surrounding environment and in which a reaction can be carried out. The vessel with an open flow channel may be referred to herein as an open wafer flow cell. Any example of the flow cell may include an inlet for delivering reagent(s) to the channel, and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.

[0041] Flow channel'. An area that is defined between two bonded or otherwise attached components or that is defined within a lane so that it is open to the surrounding environment. The flow channel can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned sequencing surfaces or a patterned sequencing surface and a lid, and thus may be in fluid communication with one or more components of the sequencing surface(s).

[0042] Fragment'. A portion or piece of DNA generated from the DNA sample. A “partially adapted fragment” is a portion or piece of the DNA that has been tagmented, and thus includes an adapter ligated to the 5’ end of the DNA fragment. A “fully adapted fragment” is a portion or piece of the DNA sample that has adapters incorporated at both the 3’ and 5’ ends of the DNA fragment.

[0043] Fragmentation'. The breaking, e.g., shearing or fragmenting, of nucleic acid into shorter lengths. Fragmentation methods include enzymatic, physical (including sonication, nebulization, needle shearing, microwave, etc.), and chemical (including depurination, hydrolysis, oxidation, etc.). The terms “fragmenting enzymes” or “enzyme-based fragmentation” or “enzyme fragmentation” as used herein refers to enzymes that fragment nucleic acid. The enzymes can be a single enzyme or two ormore enzymes that work together to fragment the nucleic acid. Some enzymes work on single stranded nucleic acid whereas others work on double stranded nucleic acid and yet others work on one strand of a double stranded nucleic acid. Fragmenting enzymes can cut randomly or specifically. Examples of fragmenting enzymes include transposase, restriction enzymes, Argonaute, CRISP R-associated nuclease (Cas), endonucleases, exonuclease, topoisomerase, FRAGMENTASE™ (New England Biolabs, Ipswich, MA). Preferred fragmentation examples include methods that fragment while retaining proximity information of the fragments.

[0044] Immobilization'. The term “immobilized”, “affixed” and “attached” are used interchangeably herein and both terms are intended to encompass direct or indirect, covalent or non-covalent attachment unless indicated otherwise, either explicitly or by context.

[0045] Covalent attachment includes, for example, those that result from the use of click chemistry techniques. Exemplary non-covalent attachment includes, but are not limited to, non-specific interactions (e.g. hydrogen bonding, ionic bonding, van der Waals interactions etc.) or specific interactions (e.g. affinity interactions, receptorligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary attachments are set forth in U.S. Pat. Nos. 6,737,236 B1 ; 7,259,258 B2; 7,375,234 B2and 7,427,678 B2; and U.S. Pat. Pub. 2011 / 0059865 A1 , each of which is incorporated herein by reference in its entirety.

[0046] In certain examples, the molecules (e.g. nucleic acids, enzymes) remain immobilized or attached to a solid support under the conditions in which it is intended to use the solid support, for example in applications requiring nucleic acid amplification and / or sequencing. In other examples, the molecules are reversibly immobilized and can be removed from the solid support through the use of cleavable sites, linkers, and the like.

[0047] Nanoballs: A concatemer comprising multiple copies of a target nucleic acid molecule. These nucleic acid copies may be arranged one after another in a continuous linear strand of nucleotides. These nucleic acid copies may result in ananoball folding configuration. The multiple copies of a target nucleic acid molecule in a nucleic acid nanoball may each contain an adaptor sequence of known sequence to facilitate amplification or sequencing. The adaptor sequence of each target nucleic acid molecule may be the same or different. The nucleic acid nanoball can be loaded on the surface of solid support. The nanoball can be attached to the surface of solid support by any suitable method. Examples of such methods include nucleic acid hybridization, biotin streptavidin binding, thiol binding, photoactive binding, covalent binding, antibody-antigen, physical constraints via hydrogels or other porous polymers, etc., or combinations thereof. In some cases, the nanoball can be digested with an enzyme (nuclease, etc.) to produce a smaller nanoball or a fragment from the nanoball.

[0048] Patterned / Random'. In some examples, the solid support comprises a patterned surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in an ordered pattern. A “patterned surface” refers to an arrangement of different regions in or on an exposed layer of a solid support. The features can be separated by interstitial regions that contribute to the pattern. In some examples, the interstitial regions can be a different height, creating wells or raised platform patterns. In other examples, the interstitial regions can have different surface charges. In yet other examples, the interstitial regions can have different attachment moieties. In some examples, the pattern can be any suitable pattern, such as a grid patterns, radial patterns, and combinations thereof. In some examples, a patterned surface can contain pre-determined locations of features but the features are not arrayed in a repetitive pattern. Examples of grid patterns include rectangular patterns, hexagonal patterns, triangular, and other suitable grid patterns. The regions for immobilization of molecules may be depressed regions, elevated regions, or planar regions relative to the interstitial regions. The regions may be fabricated as is generally known in the art using a variety of techniques, including, but not limited to, photolithography, stamping techniques, molding techniques, microetching techniques, and combinations thereof. As will be appreciated by those in the art, the technique used will depend on the composition and shape of the regions. For example, theregions for immobilization of molecules of a patterned surface may be wells, pits, channels, posts, pillars, ridges, stripes, swirls, lines, and other suitable topographies. For example, the wells may have any opening in any shape, such as circular, oval, polygonal (e.g., hexagonal, octagonal, square, rectangular, elliptical, etc.). Exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Pat. No. 8,778,849 B2, which is incorporated herein by reference in its entirety.

[0049] In some examples, the solid support comprises a surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in a random distribution over the solid support. Exemplary random distribution over a solid support is described in U.S. Pat. No. 8,241 ,573 B2, which is incorporated herein by reference in its entirety.

[0050] Polonies: Some examples further comprise rolling circle amplification / replication used to form polonies. The term “polony” or “polonies” used herein refers to a nucleic acid library molecule clonally amplified in-solution or on- support to generate an amplicon that can serve as a template molecule for sequencing. In some aspects, a linear library molecule can be circularized to generate a circularized library molecule, and the circularized library molecule can be clonally amplified in-solution or on-support to generate a concatemer. In some aspects, the concatemer can serve as a nucleic acid template molecule which can be sequenced. The concatemer is sometimes referred to as a polony. In some aspects, a polony includes nucleotide strands.

[0051] Primer. A single stranded nucleic acid molecule that can hybridize to a complementary sequence, such as a portion of an adapter. As one example, a flow cell surface bound primer can serve as a starting point for fragment amplification and cluster generation. As another example, a flow cell surface bound primer can serve as a capture primer for a transposome complex. As still another example, a primer (e.g., a sequencing primer) may be introduced that can hybridize to fragments or fragment amplicons in order to prime synthesis of a new strand that is complementary to the fragments or fragment amplicons. Any primer can include any combination ofnucleotides or analogs thereof. In some examples, the primer is a single-stranded oligonucleotide or polynucleotide. The primer length can be any number of bases long. In an example, each of the flow cell surface bound primer and the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.

[0052] Sequencing Procedures / Sequencing Operations: The term “read” or “sequence read” (or sequencing reads) refers to a sequence obtained from a portion of a nucleic acid sample. A read may be represented by a string of nucleotides sequenced from any part or all of a nucleic acid molecule. Typically, though not necessarily, a read represents a short sequence of contiguous base pairs in the sample. The read may be represented symbolically by the base pair sequence (in A, T, C, or G) of the sample portion. It may be stored in a memory device and processed as appropriate to determine whether it matches a reference sequence or meets other criteria. A read may be obtained directly from a sequencing apparatus or indirectly from stored sequence information concerning the sample. In some cases, a read is a DNA sequence of sufficient length (such as at least about 25 bp) that can be used to identify a larger sequence or region, for example, that can be aligned and specifically assigned to a chromosome or genomic region or gene. For example, a sequence read may be a short string of nucleotides (such as 20-150 bases) sequenced from a nucleic acid fragment, a short string of nucleotides at one or both ends of a nucleic acid fragment, or the sequencing of the entire nucleic acid fragment that exists in the biological sample. Sequence reads may be obtained by any method known in the art. For example, a sequence read may be obtained in a variety of ways, such as using sequencing techniques or using probes, such as in hybridization arrays or capture probes, or amplification techniques.

[0053] Examples described herein can be used with any suitable sequencing chemistry, such as sequencing by synthesis (SBS), sequencing by binding, sequencing by ligation, or nanopore sequencing.

[0054] SBS can be with or without the use of reversible terminators. For example, SBS can be initiated by contacting the target nucleic acids with one or more nucleotides (e.g., labelled, synthetic, modified, or a combination thereof), DNApolymerase, etc. Those features where a primer is extended using the target nucleic acid as template will incorporate a labeled nucleotide that can be detected. The incorporation time used in a sequencing run can be significantly reduced using the altered polymerases described herein. Optionally, the labeled nucleotides can further include a reversible termination property that terminates further primer extension once a nucleotide has been added to a primer. For example, a nucleotide analog having a reversible terminator moiety can be added to a primer such that subsequent extension cannot occur until a deblocking agent is delivered to remove the moiety. Thus, for examples that use reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washes can be carried out between the various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with an array produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; WO 91 / 06678; WO 07 / 123744; U.S. Pat. Nos. 7,057,026 B2, 7,329,492 B2, 7,211 ,414 B2, 7,315,019 B2, 7,405,281 B2, and 8,343,746 B2. Sequence reads can be generated using sequencing instruments from Illumina, Inc. (San Diego, CA).

[0055] One example of SBS is termed sequencing by binding. One implementation of sequencing by binding includes cycles of initiating sequencing of a template with a reversible blocker on the 3’ end to prevent additional bases from incorporating, interrogating the template by flooding the flow cell with fluorescently tagged bases that do not include a blocker and measuring an emitted signal of bound bases, activating the 3’ end via removal of the reversible blocker, and incorporating the complementary base from unlabeled, blocked nucleotides. Reads using sequencing by binding can be generated from using instruments such as ONSO™ sequencing instruments from Pacific Biosciences of California, Inc. (Menlo Park, CA). Another implementation of sequencing by binding could be sequencing by avidity. In sequencing by avidity, fluorescent dye labeled cores termed avidites are used. One potential cycle of sequencing by avidity includes providing a reagent of polymeraseand reversibly terminated nucleotides to templates immobilized on a solid surface, deblocking the incorporated nucleotides, flowing a set of four types of avidites, washing away unbound avidites, detecting the incorporated bases / nucleotides, and removing the bound avidites. The steps in the cycle of sequencing by avidity may be performed in other orders. Sequencing by avidity is described in Arslan, S., Garcia, F.J., Guo, M. et al. Sequencing by avidity enables high accuracy with low reagent consumption. Nat Biotechnol 42, 132-138 (2024). https: / / doi.org / 10.1038 / s41587-023-01750-7, which is incorporated by reference in its entirety. Reads using sequencing by avidity can be generated using instruments such as AVITI™ sequencing instruments from Element Biosciences (San Diego).

[0056] One example of SBS using an open flow cell and without using reversible terminators is disclosed in Almogy, G. (2022) “Cost-efficient whole genomesequencing using novel mostly natural sequencing-by-synthesis chemistry and open fluidics platform” https: / / doi.org / 10.1101 / 2022.05.29.493900, which is incorporation by reference in its entirety. Sequence reads using an open flow cell can be generated using instruments such as UG 100TM Sequencer from Ultima Genomics, Inc.(Fremont, CA).

[0057] Some SBS examples include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are described in U.S. Pat. Nos. 8,262,900 B2, 7,948,015 B2, 8,349,167 B2, and U.S. Pat. Pub. 2010 / 0137143 A1 , which are incorporated by reference in their entireties.

[0058] Sequence reads can be generated using instruments such as DNBSEQTM sequencing instruments from MGI Tech Co., Ltd. (Shenzhen, China) and as SURFSeq™, FASTASeq™, and GenoLab™ sequencing instruments from GeneMind Biosciences Co., Ltd. (Shenzhen, China).

[0059] Some examples can use methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between afluorophore-bearing polymerase and y-phosphate-labeled nucleotides, or with zeromode waveguides. Techniques and reagents for FRET-based sequencing are described, for example, in Levene, et al. Science 299, 682-686 (2003); Lundquist, et al. Opt. Lett. 33, 1026-1028 (2008); and Korlach, et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), which are incorporated by reference in their entireties. Techniques sequencing using zeromode waveguides is described in U.S. Pat. No. 6,917,726 B2, which is incorporated by reference in its entirety.

[0060] Solid Support'. The terms “solid support,” “solid surface,” and other grammatical equivalents herein refer to any substrate that is appropriate for or can be modified to be appropriate for the attachment of enzymes, nucleic acids, and complexes thereof. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include, but are not limited to, glass and modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TEFLON, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, optical fiber bundles, quartz, metal oxides, inorganic oxides, other suitable transparent materials, other suitable non-transparent materials, other suitable translucent materials, and combinations thereof. The composition and geometry of the solid support can vary with its use.

[0061] In some examples, the solid support or solid surface is a planar structure, such as a flowcell, slide, chip, microchip, array, microarray, wafer, panel, charge pad, and / or web. The planar structure can be a single surface structure having a single surface of sample / reaction sites. The planar structure can be a dual surface structure. One example of a dual surface structure includes a top substrate having a top surface of sample / reactions sites, a bottom substrate having a bottom surface of sample / reactions sites, and a spacer layer separating the top substrate and the bottom substrate. The solid support or solid surface can be open to direct application of a fluid. One example of an open solid support or open solid surface is an open flow cell having a single surface structure without an inlet port. In some examples, the solidsupport is not necessarily planar, such as, for example, the surface of a well, tube, or other vessel. Examples include the surface of a microcentrifuge tube, a well of a multiwell plate, and the like.

[0062] In some examples, the solid support comprises one or more surfaces of a flowcell or flow cell. The term “flowcell” or “flow cell” as used herein refers to a solid surface across which one or more fluid reagents can be flowed. Examples of flowcells and related fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497; U.S. 7,057,026 B2; WO 91 / 06678; WO 07 / 123744; U.S. 7,329,492 B2; U.S. 7,211 ,414 B2; U.S. 7,315,019 B2; U.S. 7,405,281 B2, and U.S. Pat. Pub. 2008 / 0108082 A1 , each of which is incorporated herein by reference in its entirety. In some examples, the flowcells can be one or more flow lanes. For flow cells having a plurality of flow lanes, each of the flow lanes can be independently accessed or two or more flow lanes can be accessed as a group.

[0063] In some examples, the solid support or solid surface is a non-planar structure, such beads, microspheres, and / or inner and / or outer surface of a tube or vessel. The terms “beads”, “microspheres,” or “particles” or grammatical equivalents herein refer to small discrete particles. Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphite, titanium dioxide, latex, polysaccharide (e.g., DEXTRAN™ , SEPHAROSE™, cellulose, nylon, cross-linked micelles, TEFLON™, as well as any other materials outlined herein for solid supports may all be used. “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind. is a helpful guide. In certain examples, the microspheres are magnetic microspheres or beads. The beads need not be spherical; irregular particles may be used. Alternatively or additionally, the beads may be porous. The bead sizes range from nanometers, i.e. 100 nm, to millimeters, i.e. 1 mm, with beads from about 0.2 micron to about 200 microns being preferred, and from about 0.5 to about 5 micron being particularly preferred, although in some examples smaller or larger beads may be used.

[0064] Tag mentation'. A process in which the DNA sample is cleaved / fragmented and tagged (e.g., with the adapters) for analysis. Tagmentation is an in vitro transposition reaction.

[0065] Transferred and Non-Transferred Strands. The term “transferred strand” refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term “non-transferred strand” refers to a sequence that includes the nontransferred portion of a transposon end. The 3’-end of a transferred strand is joined or transferred to a double-stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to the double-stranded fragment during tagmentation. In an example, the transferred and non-transferred strands include at least partially complementary portions that are covalently bound together.

[0066] Transposase or Transposase Enzyme'. An enzyme that is capable of forming a functional complex with a transposon end-containing composition (e.g., transposons, transposon ends, transposon end compositions) and catalyzing insertion or transposition of the transposon end-containing composition into the double-stranded cDNA sample with which it is incubated, for example, in the in vitro transposition reaction (i.e. , tagmentation). A transposase as presented herein can also include integrases from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposase that is capable of inserting a transposon end with sufficient efficiency to 5’-tag and fragment the cDNA sample for its intended purpose can be used.

[0067] Transposome / Transposome Complex'. An entity formed between a transposase enzyme and a nucleic acid. Typically, the nucleic acid is a double stranded nucleic acid including a transposase integration recognition site. In some examples set forth herein, the adapter includes a complementary portion (i.e., its hairpin portion), which functions as the transposase integration recognition site. As an example, the transposome complex can be the product of incubating a transposase enzyme with one of the adapters disclosed herein under conditions that support non- covalent complex formation. The complementary portion of the adapter includesdouble-stranded transposon DNA, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions or other double-stranded DNAs capable of interacting with a transposase, such as the hyperactive Tn5 transposase. Transposome complexes can form dimers. In some instances, the 5’ end or the 3’ end of each transferred strand of each complex in the dimer is attached to a flow cell surface. In other instances, the complexes in the dimers are configured for asymmetric attachment to the flow cell surface. By “asymmetric attachment” or “asymmetrically attached,” is it meant that one transposome complex in the dimer is attached to the surface through its transferred strand 5’ end and the other transposome complex in the dimer is attached to the surface through its non-transferred stand 3’ end.

[0068] Transposon End'. A double-stranded nucleic acid strand that exhibits only the nucleotide sequences (the “transposon end sequences”) that are necessary to form the complex with the transposase that is functional in tagmentation. The doublestranded nucleic acid strand of the transposon end can include any nucleic acid or nucleic acid analogue suitable for forming the functional complex with the transposase. For example, the transposon end can include natural DNA or DNA analogs (with modified bases and / or backbones), and can include nicks in one or both strands.

[0069] Transposases, transposomes and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Pat. App.Pub. 2010 / 0120098, which is incorporated herein by reference in its entirety. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposition system that is capable of inserting a transposon element with sufficient efficiency to tag a target nucleic acid can be used. In particular examples, a transposition system is capable of inserting the transposon element in a random or in an almost random manner to tag the target nucleic acid.

[0070] Transposome Complexes

[0071] Fig. 1 A through Fig. 1 K illustrate monomers of different examples of the transposome complexes 10A through 10K that may be used in the flow cells, methods, and kits disclosed herein. It is to be understood that during transposome complexes 10A through 10K assembly, dimers are capable of forming. The type of dimer that is formed can be controlled by controlling the type of annealed transposons (with transposon ends 14A, 14B, etc.) added to the solution with the transposase enzyme 12A, 12B, etc. during transposon complex 10A, 10B, etc. assembly. When a plurality of transposons that form one type of the transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, 10H, 10I, 10J, or 10K is incorporated into a liquid carrier with the transposase enzyme 12A, 12B, etc., the one type of transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, 10H, 101, 10J, or 10K will form and these transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, 10H, 101, 10J, or 10K are capable of forming homodimers. These homodimers may then be introduced into any of the flow cells 32 (see Fig. 2A) disclosed herein. If two different types of transposons - that form two different complexes, e.g., 10A and 10B - are included in solution with the transposase enzyme 12A, 12B, etc., homodimers and heterodimers will form. In any of the solutions, some transposome complexes 10A through 10J may not dimerize, and these individual transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, 10H, 101, 10J, or 10K can attach to the flow cell surface. The monomeric transposome complex(es) 10A, 10B, 10C, 10D, 10E, 10F, 10G, 10H, 101, 10J, or 10K will not participate in tagmentation. During some of the methods set forth herein, two types of transposome complex(es) 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G, or 10A and 101, or 10J and 10J’, or 101 and 101’ are used together. It is to be understood that homodimers of these complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G, or 10A and 10I, or 10J and 10J ’ , or 10I and 1 Of may be formed separately in solution and then added to the flow cell 32 for attachment thereto. During others of the methods set forth herein, one type of transposome complex 10H or 10K is used. It is to be understood that homodimers of the complex 10H may be formed either in solution prior to introduction into the flow cell 32 or insolution as they are being attached in the flow cell 32. It is to be understood that homodimers of the complex 10K may be formed either in solution prior to introduction into the flow cell 32”’ (Fig. 12A) or in solution as they are being attached in the flow cell 32’”.

[0072] Referring specifically to Fig. 1 A and Fig. 1 B, each of the transposome complexes 10A, 10B includes a transposase enzyme 12A, 12B non-covalently bound to a transposon end 14A, 14B. Each transposon end 14A, 14B is a double-stranded nucleic acid strand, one strand MEA or MEB of which is part of a transferred strand 16A, 16B and the other strand ME’ or ME’B of which is the non-transferred strand 18A, 18B. In other words, the transposon end 14A, 14B includes a portion of the respective transferred strand 16A, 16B that is hybridized to the non-transferred strand 18A, 18B.

[0073] The transferred strand 16A includes a 5’ end attachment group 20A, a first amplification domain 26, and a sequencing primer sequence 28A that is attached to the strand MEA of the transposon end 14A. The strand MEA of the transposon end 14A is positioned at the 3’ end of the transferred strand 16A. While not shown, the transferred strand 16A may further include an index sequence positioned between the first amplification domain 26 and the sequencing primer sequence 28A.

[0074] Similar to the transferred strand 16A, the transferred strand 16B includes a 5’ end attachment group 20B, a second amplification domain 38, and a sequencing primer sequence 28B that is attached to the strand ME’B of the transposon end 14B. The strand ME’B of the transposon end 14B is positioned at the 3’ end of the transferred strand 16B. Also while not shown, the transferred strand 16B may further include an index sequence positioned between the second amplification domain 38 and the sequencing primer sequence 28B.

[0075] In some examples, the 5’ end attachment groups 20A, 20B are capable of attaching to a transposome capture mechanism 57 that is attached over at least the interstitial regions 56 of the flow cell 32. In other examples, the 5’ end attachment groups 20A, 20B are capable of attaching directly to the substrate 50 or 52 that forms the interstitial regions 56 of the flow cell 32. Table 1 A provides examples of thetransposome capture mechanism 57 and corresponding 5’ end attachment groups 20A, 20B that can covalently or non-covalently attach to the transposome capture mechanism. Non-covalent attachments may include electrostatic interaction, hydrophobic interaction, Van der Waals interaction, or hydrogen bonding. Table 1 B provides examples of the substrate surface groups and corresponding 5’ end attachment groups 20A, 20B that can covalently or non-covalently attach to the substrate surface groups.

[0076] In any of the examples at forth in Table 1 A and Table 1 B, the linker can be poly(ethylene glycol) (PEG), amino PEG, poly(N-isopropylacrylamide), polyacrylate, polyacrylamide, polyethylene oxide, poly-glycine, alkyl chains, or the like.

[0077] The interactions between the transposome capture mechanism 57 or the substrate surface groups and the 5’ end attachment groups 20A, 20B (or 3’ attachment group 42, see Fig. 1 C) are described in more detail in reference to Fig. 2B.

[0078] The first and second amplification domains 26, 38 have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 attached to the polymeric hydrogel 22 (e.g., in the flow cell 32). The first and second primers 34, 36 are amplification primers of a primer set. The first amplification domain 26, its complement, and the primer 34, together with the second amplification domain 38, its complement, and the primer 36 enable the amplification of the DNA sample fragments generated during tagmentation.

[0079] Examples of suitable sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 include P5 and P7 primer sequences; P15 and P7 primer sequences; or any combination of the PA primer sequences, the PB primer sequences, the PC primer sequences, and the PD primer sequences set forth herein.

[0080] The P5 amplification domain / primer sequence is one of:P5 #1 : 5’ — 3’AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO. 1);P5 #2: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 2) where “n” is inosine in SEQ. ID. NO. 2; orP5 #3: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 3)where “n” is alkene-thymidine (i.e., alkene-dT) in SEQ. ID. NO. 3.The P7 amplification domain / primer sequence may be any of the following:P7 #1 : 5’ — ► 3’CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO. 4)P7 #2: 5’ 3’CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO. 5)P7 #3: 5’ 3’CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO. 6) where “n” is 8-oxoguanine in each of SEQ. ID. NOS. 4-6.

[0081] In the examples of P5 and P7, the uracil, inosine, or “n” is a cleavage site 40A, 40B. The cleavage sites 40A, 40B of transposome complexes 10A, 10B that are used together are orthogonal (i.e., not susceptible to the same cleaving agent), so that after fully adapted fragments are generated and amplified, forward or reverse strands can be removed, for example, from a flow cell surface, while the other of the reverse or forward strands remain attached for exposure to sequencing.

[0082] It is to be understood that other sequences may be used for the amplification domains 26, 38 and for the primers 34, 36, as long as the combination enables the desired amplification. As other examples, a P15, PA, PB, PC, or PD primer may be used.

[0083] The P15 amplification domain / primer sequence is:P15: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 7)where “n” is allyl-T (i.e. , a thymine nucleotide analog having an allyl functionality).

[0084] The other amplification domain / primer sequences (PA-PD) mentioned above include: PA 5’ 3’GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO. 8)PB 5’ - 3’CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO. 9)PC 5’ 3’ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO. 10)PD 5’ 3’GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 11 )

[0085] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site 40A, 40B, such as uracil, 8-oxoguanine, allyl-T, diols, etc. at any point in the strand. As previously mentioned, the sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not susceptible to the cleaving agent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.

[0086] Referring briefly to the primers 34, 36 that are immobilized within the flow cell 32, each of the primers 34, 36 may also include a polyT sequence at the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.

[0087] Referring back to Fig. 1 A, the sequencing primer sequences 28A, 28B of the transposome complexes 10A, 10B that are used together have differentsequences from each other that respectively bind to sequencing primers that are introduced, e.g., to a flow cell surface after amplification have been performed. As examples, the sequencing primer sequences 28A may bind a sequencing primer that primes synthesis of a new strand that is complementary, e.g., to forward strand fragments / fragment amplicons and the sequencing primer sequence 28B may bind a sequencing primer that primes synthesis of a new strand that is complementary, e.g., to reverse strand fragments / fragment amplicons.

[0088] The transposon ends 14A, 14B of each transposome complex 10A, 10B include the strands MEA, MEB respectively hybridized to the strands ME’A, ME’B. AS such, the strands MEA, ME’A are complementary and the strands MEB, ME’B are complementary. The double-stranded transposon ends 14A, 14B are respectively capable of complexing with the transposases 12A, 12B. As examples, the strands MEA, ME’A and MEB, ME’B of the transposon ends 14A, 14B may be the related but non-identical 19-base pair (bp) outer end (e.g., strands MEA, ME’A) and inner end (e.g., strands MEB, ME’B) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands MEA, ME’A) and the R2 end (strands MEB, ME’B) recognized by the MuA transposase.

[0089] When included, the index sequences of the transposome complexes 10A, 10B are the same, and include a particular nucleic acid sequence that function as a barcode for the DNA sample tagmented with the transposome complexes 10A, 10B. The unique indexes can be used for sample identification. Index sequences may range from 7 bases to 15 bases long.

[0090] In the example shown in Fig. 1A, the non-transferred strands 18A, 18B are respectively made up of the strands ME’A, ME’B.

[0091] The transposome complex 10A of Fig. 1 A may also be used with the transposome complex 10C shown in Fig. 1 C. These transposome complexes 10A, 10C are capable of asymmetric attachment to the flow cell surface.

[0092] The transposome complex 10A may be any of the examples described in reference to Fig. 1A, which include the transferred strand 16A having the 5’ endattachment group 20A that is capable of attaching to the transposome capture mechanism 57 at least at the interstitial regions 56 of the flow cell 32. In contrast to the transposome complex 10A, the transferred strand 16C of the transposome complex 10C does not include the 5’ end attachment group for surface attachment. Rather, the non-transferred strand 18C includes a 3’ end attachment group 42 for attachment to the transposome capture mechanism 57.

[0093] As shown in Fig. 1 C, the transposome complex 10C includes a transposase enzyme 12C non-covalently bound to the transposon end 14C. The transposon end 14C is a double-stranded nucleic acid strand, one strand (e.g., MEc) of which is part of the transferred strand 16C and the other strand (e.g., ME’c) of which is a part of the non-transferred strand 18C. Any of the example strands for the transposon end 14A, 14B (e.g., MEA and ME’A or MEB and ME’B) described herein may be used for the transposon end 14C.

[0094] In the transposome complex 10C, the transferred strand 16C includes a second amplification domain 38 and a sequencing primer sequence 28C that is attached to one strand MEc of the transposon end 14C. In some examples, the transferred strand 10C includes an index sequence (not shown) between the second amplification domain 38 and the sequencing primer sequence 28C. The strand MEc of the transposon end 14C is positioned at the 3’ end of the transferred strand 16C.

[0095] Similar to the transposome complexes 10A, 10B, the first and second amplification domains 26, 38 of the transposome complexes 10A, 10C have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 described herein.

[0096] Similar to the sequencing primer sequences 28A, 28B, the sequencing primer sequences 28A, 28C have different sequences from each other that respectively bind to sequencing primers introduced during sequencing.

[0097] As mentioned, the transposome complexes 10A, 10C are configured for asymmetric attachment to the transposome capture mechanism 57. As such, one of the complexes, i.e. , complex 10C, includes a 3’ end attachment group 42 for attachment to the transposome capture mechanism 57 or the substrate surfacegroups, and the other of the complexes, e.g., complex 10A, includes the 5’ end attachment group 20A for attachment to the transposome capture mechanism 57 or the substrate surface groups. The 3’ end attachment group 42 and the 5’ end attachment group 20A may be any groups that are capable of covalently or non- covalently attaching, directly or indirectly, to the transposome capture mechanism 57 or to the substrate surface groups. Any of the attachment groups set forth in Table 1A and Table 1 B may be used for the 3’ end attachment group 42.

[0098] In still other examples, the transposome complexes 10A, 10B, 10C may not include the 5’ end functional groups 20A and 20B or the 3’ end functional group 42. Rather, the amino acid chain(s) of the transposase enzyme may be used to covalently or non-covalently bind the transposome complexes to the transposome capture mechanism 57 or the substrate surface groups. Examples of such transposome complexes 101 and 10J are shown, respectively, in Fig. 11 and Fig. 1 J.

[0099] As mentioned, Fig. 11 depicts the transposome complex 101. The transposome complex 101 may be used with the transposome complex 10A (see Fig.8A through Fig. 8C) or with a different example of the complex 101 (e.g., 101’ shown in Fig. 10A) to generate fully adapted fragments that have adapters at opposed ends and that can be amplified using exclusion amplification or another amplification technique that uses surface bound amplification primers 34, 36 (Fig. 10A). Thus, the transferred strand 161 of the transposome complex 101 includes, from the 3’ end to the 5’ end, the strand MEi, a sequencing primer sequence 281, and an amplification domain 26 or 38. The transposome complex 101 does not include the 5’ end functional group 20A, 20B, and thus this example of the transferred strand 161 does not attach to the transposome capture mechanism 57 or the substrate surface groups.

[0100] The transposome complex 10I attaches to the transposome capture mechanism 57 or the substrate surface groups via the transposase enzyme 121. More specifically, an amino acid (peptide) chain 126 that is present in the backbone of the transposase enzyme 121 or is a side chain of the backbone can covalently or non- covalently bind the transposome complex 101 to the transposome capture mechanism 57 or the substrate surface groups. For example, the amine groups in the lysine of theTn5 transposase enzyme can covalently react to activated carboxylic acid groups of the mechanism 57 or substrate surface. For other examples, lysine, aspartic acid, and / or histidine present in the transposase enzyme 121 may non-covalently bind (e.g., via electrostatic attraction) to streptavidin when it is used as the transposome capture mechanism 57. For still other examples, carboxylic acid groups of the mechanism 57 or substrate surface may act as a hydrogen bond donor and acceptor for the amino acid chain(s) 126 in the transposase enzyme 121.

[0101] In addition to the amino acid chain 126, the transposome complex 10I may also include an anchoring point 128 at the 3’ end of the non-transferred strand 181. This anchoring point 128 is buried within the transposase enzyme 121 when the transposome complex 101 is intact, and thus does not attach the transposome complex 101 to the transposome capture mechanism 57 or the substrate surface groups. As will be described in reference to the figure 10 series, the anchoring point 128 is capable of attaching to a capture moiety 130 that is present at the surface of the substrate 50 or 52 after the transposase enzyme 121 is removed. Examples of the anchoring point 128 and the capture moiety 130 are biotin and streptavidin, complementary oligonucleotide probes, aptamers or antibodies and corresponding DNA binding proteins.

[0102] Fig. 1 J depicts the transposome complex 10J. Two different transposome complexes 10J, 10J’ (see Fig. 9A) may be used together to generate fully adapted fragments that have adapters at opposed ends and that can be amplified using exclusion amplification or another amplification technique that uses surface bound amplification primers 34, 36. Thus, the transferred strand 16J of the transposome complex 10J includes, from the 3’ end to the 5’ end, the strand MEj, a sequencing primer sequence 28J, and an amplification domain 26 or 38. The transposome complex 10J does not include the 5’ end functional group 20A, 20B, and thus this example of the transferred strand 16J does not attach to the transposome capture mechanism 57 or the substrate surface groups.

[0103] The transposome complex 10J attaches to the transposome capture mechanism 57 or the substrate surface groups via the 3’ end of the non-transferredstrand 18J and the amino acid chain(s) 126. The non-transferred strand 18J is linked (as shown at reference numeral 132) to the amino acid chain(s) 126. The 3’ end of the non-transferred strand 18J may be attached to a lysine, aspartic acid, histidine, and / or other amino acids of the transposase enzyme 12J, which is capable of attaching to the transposome capture mechanism 57 or the substrate surface groups as described in reference to Fig. 11.

[0104] The transposome complexes 101 and 10J, shown respectively, in Fig. 11 and Fig. 1 J, are generically described as including an amplification domain 26 or 38 and a sequencing primer sequence 28I or 28J. When one of these complexes 101 or 10J is used with the transposome complex 10A, it is to be understood that the amplification domain of the complex 101 or 10J is the domain 38, which is different from the amplification domain 26 of the transposome complex 10A. When two of the same type of complexes, e.g., 101 and 101’ or 10J and 10J’ are used together for tagmentation, it is to be understood that the respective amplification domains of the transposome complexes 101 and 101’ or 10J and 10J’ that are used together have different sequences from each other (e.g., P7 and P5), but have the same sequence, respectively, as first and second primers 34, 36 attached to the polymeric hydrogel 22 or other layer. As will be described in detail with respect to the methods of the figure 8 series, the figure 9 series, and the figure 10 series, the respective amplification domains 26, 38 and the surface bound primers 34, 36 enable amplification. Any two of the sequences (or complements thereof) set forth herein may be used for the amplification domains 26, 38 and the surface bound primers 34, 36 as long as they able sequential paired end sequencing. For example, any P5 sequence may be used for one amplification domain 26 and primer 34, any P7 sequence may be used for another primer 36, and the complement of the P7 sequence may be used for the other amplification domain 38. The respective amplification domains 26, 38 also include orthogonal (different) cleavage sites, such that the cleavage site of one amplification domain 26 is not susceptible to the cleaving agent used for the cleavage site of the other amplification domain 38. Examples of suitable cleavage sites include uracil, 8- oxoguanine, allyl-T, diols, etc. at any point in the amplification domain strands.Moreover, when two of these complexes, e.g., 10A and 101, or 101 and 101’, or 10J and 10J’, are used together, it is to be understood that the sequencing primer sequences 28A, 28I, 28J have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell 32 after tagmentation and amplification. As examples, the sequencing primer sequence 28A, 28I, 28J of the respective complexes 10A, 101, 10J may bind a particular sequencing primer that primes synthesis of a new strand.

[0105] Referring back to Fig. 1 D and Fig. 1 E, these figures respectively depict two other transposome complexes 10D, 10E that can be used together in the flow cell architecture of Fig. 2B or Fig. 2C, and in the method shown in Fig. 5.

[0106] In the transposome complexes 10D, 10E, the transposon ends 14D, 14E respectively include the transferred strands 16D, MED and 16E, MEE hybridized to a portion ME’D, ME’E of the non-transferred strand 18D, 18E. The transposon ends 14D, 14E are double-stranded nucleic acid strands, one strand (e.g., MED) of which is the transferred strand 16D and the other strand (e.g., ME’D) of which is a part of the nontransferred strand 18D. As examples, the transferred strands 16D, MED and 16E, MEE and the portion ME’D, ME’F may be the related but non-identical 19-base pair (bp) outer end (e.g., strands MEA, ME’A) and inner end (e.g., strands MEB, ME’B) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands MEA, ME’A) and the R2 end (strands MEB, ME’B) recognized by the MuA transposase. In each of these examples, the transferred strands 16D, MED and 16E, MEE do not include any additional sequences.

[0107] The transposase enzymes 12D, 12E are non-covalently bound to the transposon ends 14D, 14E. Any of the transposase enzymes disclosed herein may be used.

[0108] In these example complexes 10D, 10E, each of the non-transferred strands 18D, 18E includes additional sequences attached to the 3’ end of the portion ME’D, ME’E. In the transposome complex 10D, the non-transferred strand 18D includes a first sequencing primer sequence 28D attached to the 3’ end of the portionME’D and a complement 26’ of the first amplification domain sequence 26 attached to the 3’ end of the first sequencing primer sequence 28D. Similarly, in the transposome complex 10E, the non-transferred strand 18E includes a second sequencing primer sequence 28E attached to the 3’ end of the portion ME’E and a complement 38’ of the second amplification domain sequence 38 attached to the 3’ end of the second sequencing primer sequence 28E.

[0109] The sequencing primer sequences 28E, 28F have different sequences from each other, but have the same sequence as the respective sequencing primers 34, 36 to be used during sequencing. The sequencing primer sequences 28E, 28F are used as respective templates to form the complementary sections (e.g., 28Dc, 28Ec) in the fully adapted fragments generated in the method of Fig. 5. These complementary sections can hybridize to the respective sequencing primers

[0110] The amplification domain sequence complements 26’, 38’ are respectively complementary to the primers 34, 36 in the depression 48 (Fig. 2C) or lane 54 (Fig. 2D) of the flow cell 32. This complementarity enables at least one of the transposome complexes 10D, 10E in homodimers thereof to respectively hybridize to the primers 34, 36 in the method of Fig. 5. Because the amplification domain sequence complements 26’, 38’ are present, these transposome complexes 10D, 10E do not include the 3’ end attachment groups.

[0111] While not shown in Fig. 1 D and Fig. 1 E, other complexes similar to complexes 10D, 10E include an additional sequence attached to the 5’ end of the strands MED, MEE. These additional sequences are sequencing primer complements which can bind to the sequencing primers used in sequencing. The 5’ end of these sequencing primer complements can be ligated to the surface bound primers 34, 36. The presence of the sequencing primer complements can reduce the amount of gapfill ligation that takes place in the method of Fig. 5.

[0112] Fig. 1 F and Fig. 1 G also depict two other transposome complexes 10F, 10G that can be used together in the flow cell architecture of Fig. 2B or Fig. 2C, and in the method shown in Fig. 6.

[0113] The transposome complexes 10F, 10G are similar to the transposome complexes 10A, 10B, respectively, except that they do not include the 5’ end attachment groups 20A, 20B. Rather, the transferred strands 16F, 16G include capture sequence complements 29, 31.

[0114] More specifically, each of the transposome complexes 10F, 10G includes a transposase enzyme 12F, 12G non-covalently bound to a transposon end 1 F, 14G. Each transposon end 14F, 14G is a double-stranded nucleic acid strand, one strand MEF or MEG of which is part of a transferred strand 16F, 16G and the other strand ME’F or ME’G of which is the non-transferred strand 18F, 18G. These strands MEF, ME’F and MEG, ME’G may be any of the examples set forth herein for MEA, ME’A and MEB, ME’B.

[0115] The transferred strand 16F includes a sequencing primer sequence 28F attached to the strand MEF of the transposon end 14F, a first amplification domain 26 attached to the sequencing primer sequence 28F, and a first capture sequence complement 29. Similarly, the transferred strand 16G includes a sequencing primer sequence 28G attached to the strand MEG of the transposon end 14G, a second amplification domain 38 attached to the sequencing primer sequence 28G, and a second capture sequence complement 31 .

[0116] Similar to the sequencing primer sequences 28A, 28B, the sequencing primer sequences 28F, 28G have different sequences from each other that respectively bind to sequencing primers introduced during sequencing.

[0117] Also similar to the transposome complexes 10A, 10B, the first and second amplification domains 26, 38 of the transposome complexes 10F, 10G have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 described herein.

[0118] The capture sequence complements 29, 31 are respectively complementary to the capture primers 33, 35 in the depression 48 (Fig. 2C) or lane 54 (Fig. 2D) of the flow cell 32. This complementarity enables at least one of the transposome complexes 10F, 10G in homodimers thereof to respectively hybridize to the capture primers 33, 35 in the method of Fig. 6. Because the capture sequencecomplements 29, 31 are present, these transposome complexes 10F, 10G do not include the 5’ end attachment groups 20A, 20B. The capture primers 33, 35 have different sequences than the primers 34, 36, so that they do not participate in amplification.

[0119] One example of the capture sequence complements 29 or 31 is PX’, as shown:PX’ 5’ 3’CCTCCTCCTCCTCCTCCTCCTCCT (SEQ. ID. NO. 12).PY’ can be used for the other capture sequence complements 31 or 29, so that it can hybridize to the complementary primer 35, 33, without hybridizing to the primer 33, 35 or to the primers 34, 36. The capture primers 33, 35 are complementary, respectively, to the PX’ and PY’ sequences.

[0120] As shown in Fig. 1 F and Fig. 1 G, each of the transposome complexes 10F, 10G may also include a blocker base 41 incorporated into the transferred strands 16F, 16G between the amplification domains 26, 38 and the capture sequence complements 29, 31 . The blocker base 41 may be uracil or another nucleotide that prevents the extension reaction.

[0121] Referring now to Fig. 1 H, still another example of the transposome complex 10H is shown. This transposome complex 10H is a forked transposome complex.

[0122] The transferred strand 16H of the transposome complex 10H is similar to the transferred strand 16A, and includes a 5’ end functional group 20H, the first amplification domain 26, and a sequencing primer sequence 28H that is attached to the strand MEH of the transposon end 14H. The strand MEH of the transposon end 14H is positioned at the 3’ end of the transferred strand 16H. In some examples, the transferred strand 16H further includes an index sequence (not shown) positioned between the first amplification domain 26 and the sequencing primer sequence 28H. The 5’ end functional group 20H and the sequencing primer sequence 28H may beany of the examples set forth herein, respectively, for the 5’ end functional group 20A and the sequencing primer sequence 28A.

[0123] The non-transferred strands 18H of the transposome complexes 10H are made up of the strands ME’H and adapter segments 37 that create a forked adapter when hybridized to the transferred strands 16H. When the non-transferred strand 18H includes the adapter segments 37 and creates the forked adapter, it is to be understood that homodimers of this one type of transposome complex 10H are grafted to the polymeric hydrogel 22, without homodimers of another type of transposome complex 10A through 10G, 101, 10J, or 10K. This is because the individual complex 10H includes the first amplification domain 26 and the complement 38’ of the second amplification domain 38 to create fully adapted DNA fragments, and thus the second complexes, e.g., 10B, 10C, with the second amplification domain 38 are not needed. As one example, the transposome complex 10H includes the transferred strand 16H as described herein with the first amplification domain 26 and the non-transferred strand 18H includes the strand ME’H, a complement of the sequencing primer sequence 28I, and the complement 38’ of the second amplification domain 38.

[0124] Fig. 1 K depicts still another example of the transposome complex 10K. Each transposome complex 10K includes a transposase enzyme 12K non-covalently bound to a transposon end 14K. Each transposon end 14K is a double-stranded nucleic acid strand, one strand MEK of which is part of a transferred strand 16K and the other strand ME’K is the non-transferred strand 18K. In other words, the transposon end 14K includes a portion of the respective transferred strand 16K that is hybridized to the non-transferred strand 18K.

[0125] The transferred strand 16K includes, from the 5’ end to the 3’ end, a 5’ phosphate (5’P), an index sequence 152, a sequencing primer sequence 28K, and the strand MEK of the transposon end 14K.

[0126] The non-transferred strand 18K is made up of a strand ME’K that is complementary to the strand MEK. Any examples of the strands MEA, ME’ and MEB, ME’B may be used for the strands MEK, ME’K.

[0127] As the transposome complex 10K does not include the amplification domains 26, 38, but does include an index sequence 152, homodimers of the complex 10K can be used to tagment a single DNA sample, as described in reference to Fig. 12A and Fig. 12B.

[0128] Flow Cells

[0129] The transposome complexes 10A-10K may be used in different examples of the flow cell 32 disclosed herein.

[0130] Fig. 2A depicts an example of the flow cell 32 from a top view, and different structures 44A, 44B, 44C that may be included within individual flow channels 46 of the flow cell 32 are respectively shown in Fig. 2B, Fig. 2C, and Fig. 2D.

[0131] The structures 44A, 44B shown in Fig. 2A and Fig. 2B are patterned with depressions 48, while the structure 44C in Fig. 2C is patterned with a lane 54. While not shown, it is to be understood that a lid or a second structure may be attached to the structures 44A, 44B, 44C (e.g., at regions 58). Alternatively, the structures 44A, 44B, 44C are not bonded to another component, but rather, are open to the surrounding environment.

[0132] Each of the structures 44A, 44B, 44C may include a single-layer substrate 50 or a multi-layer substrate 52.

[0133] Examples of suitable materials for the single-layer substrate 50 include epoxy siloxane, glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceram ics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2Os) or other tantalum oxide(s) (TaOx), hafnium oxide (HK ), carbon, metals, or the like.

[0134] When the single-layer substrate 50 is used, the plurality of depressions 48 (Fig. 2B and Fig. 2C) or the single lane 54 (Fig. 2D) is defined at a surface of the single-layer substrate 50. Interstitial regions 56 surround each depression 48, and a perimeter region 58 surrounds the lane 54. The patterned structures 44A, 44B may also include a perimeter region 58. In these examples, the surface of the single-layer substrate 50 defines the interstitial regions 56 and / or the perimeter region 58.

[0135] Examples of the multi-layer substrate 52 include a base support 60 and a patterned material 62 positioned over the base support 60. The base support 60 may be any of the examples set forth herein for the single-layer substrate 50. The patterned material 62 may be any material that is capable of being patterned with the depressions 48 or the lane 54.

[0136] In an example, the patterned material 62 may be an inorganic oxide that is selectively applied to the base support 60, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta20s), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., Fifth), etc. In another example, the patterned material 62 may be a resin matrix material that is applied to the base support 60 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a polyethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.

[0137] In an example, the substrate 50 or 52 may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular, having its largestdimension up to about 10 feet (~ 3 meters). In an example, the substrate 50 or 52 may be formed from a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form the individual substrate 50 or 52. In another example, the substrate 50 or 52 is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 50 or 52 with any suitable dimensions may be used. For another example, a rectangular panel may be used, which has a greater surface area than a 300 mm round wafer. These panels may subsequently be diced to form individual substrates 50 or 52.

[0138] Each flow cell 32 also includes a flow channel 46 (Fig. 2A). The flow channel 46 may be an enclosed channel that is defined between the structures 44A, 44B, 44C and a lid. In an alternate example, the flow channel 46 may be defined between two structures 44A, 44B, 44C that are bonded together. In enclosed versions of the flow cell 32, a separate material (not shown, similar to the spacer layer 114 in Fig. 7) may attach the perimeter regions 58 of the structures 44A, 44B, 44C to the lid or other structure so that the separate material defines at least a portion of the walls of the flow channel 46.

[0139] When the structures 44A, 44B, 44C are open to the surrounding environment, the flow channel 46 may be defined by a lane in which the depressions 48 are formed, or by the lane 54.

[0140] The flow cell 32 shown in Fig. 2A includes eight flow channels 46. It is to be understood, however, that any example of the flow cell 32 may include any number of flow channels 46 (e.g., one channel, four channels, etc.). With multiple channels 46, it is to be understood that each flow channel 46 may be isolated from each other flow channel 46 so that fluid introduced into any particular flow channel 46 does not flow into any adjacent flow channel 46. Separation may be obtained through the separate material, which can be applied at the perimeter of each flow channel 46 and at the perimeter of the entire flow cell 32.

[0141] The length and width of the flow channel 46 may be smaller, respectively, than the length and width of the structures 44A, 44B, 44C so that a portion of thestructure surface surrounds the flow channel 46 and is available for attachment to another structure 44A, 44B, 44C or to the lid, or is available to define the perimeter of the open flow channel 46. In some instances, the width of each flow channel 46 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 46 can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 46 can be greater than, less than or between the values specified above. In another example, the flow channel 46 is square (e.g., 10 mm x 10 mm).

[0142] The depth / height of each flow channel 46 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material that partially defines the flow channel walls. In other examples, the depth / height of each flow channel 46 can be about 1 pm, about 10 pm, about 50 pm, about 100 pm, or more. In an example, the depth / height may range from about 10 pm to about 100 pm. In another example, the depth / height is about 5 pm or less. It is to be understood that the depth / height of each flow channel 46 can also be greater than, less than or between the values specified above. The depth / height of the flow channel 46 may also vary along the length and width of the flow cell 32, e.g., because of the depressions 48.

[0143] Referring now to Fig. 2A and Fig. 2B, the structures 44A, 44B include the depressions 48, which are defined in the single-layer substrate 50 or in the patterned material 62 of the multi-layer substrate 52, and that are separated by interstitial regions 56. Many different layouts of the depressions 48 may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 48 are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 48 and the interstitial regions 56.

[0014] The layout or pattern may be characterized with respect to the density (number) of the depressions 48 in a defined area. For example, the depressions 48 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1 ,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high-density array may be characterized as having depressions 48 separated by less than about 100 nm, a medium-density array may be characterized as having the depressions 48 separated by about 400 nm to about 1 pm, and a low- density array may be characterized as having the depressions 48 separated by greater than about 1 pm.

[0145] The layout or pattern of the depressions 48 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 48 to the center of an adjacent depression 48 (center-to-center spacing) or from the right edge of one depression 48 to the left edge of an adjacent depression 48 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 48 have a pitch (center-to-center spacing) of about 1 .5 pm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.

[0146] The size of each depression 48 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume can range from about 1 x10"3pm3to about 100 pm3, e.g., about 1 *10“2pm3, about 0.1m3, about 1 pm3, about 10 pm3, or more, or less. For another example, the opening area can range from about 1 xw3pm2to about 100 pm2, e.g., about 1 xw2pm2, about 0.1 pm2, about 1 pm2, at least about 10 pm2, or more, or less. For still another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. For yet another example, the diameter or each of the length and width can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.

[0147] In the structures 44A, 44B, the polymeric hydrogel 22 is positioned within each of the depressions 48. The polymeric hydrogel 22 is selected so that it can at least bind with a 5’ end of each of the primers 34, 36. In some examples, the polymeric hydrogel 22 is also selected so that it can also bind with a 5’ end of each of the capture primers 33, 35.

[0148] The polymeric hydrogel 22 may be a copolymer including a first recurring unit of formula (I):. wherein:R1is selected from the group consisting of -H, a halogen, an alkyl, an alkoxy, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof;R2is selected from the group consisting of an azide, an amino, an alkenyl, an alkyne, a halogen, a hydrazone, a hydrazine, a carboxyl, a hydroxy, a tetrazole, a tetrazine, a nitrile oxide, a nitrone, a sulfate, and a thiol; each (CH2)Pcan be optionally substituted; and p is an integer from 1 to 50;

[0149] and a second recurring unit of formula (II):, wherein: each of R3, R3, R4, R4’ is independently selected from the group consisting of -H, R5, - OR5, -C(O)OR5, -C(O)R5, -OC(O)R5, -C(O)NR6R7, and -NR6R7; R5is selected from the group consisting of -H, -OH, an alkyl, a cycloalkyl, a hydroxyalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof; and each of R6and R7is independently selected from the group consisting of -H and an alkyl.

[0150] The polymeric hydrogel 22 may be introduced over the entire substrate 50 or 52 and then removed from the interstitial regions 56 (e g., via polishing). In the example shown in Fig. 2B, this exposes the substrate surface groups at the interstitial regions 56 for subsequent attachment of the transposome capture mechanism 57. In the example shown in Fig. 2C, this isolates the primers 34, 36 or the primers 34, 36, 33, 35 within each of the depressions 48.

[0151] In some examples, the polymeric hydrogel 22 may be replaced with another layer, such as streptavidin, that enables the primers 34, 36 and / or the transposome complexes 10A-10J to be anchored thereto.

[0152] The structure 44A, 44B also includes the primers 34, 36 attached to the polymeric hydrogel 22 within each of the depressions 48. The primers 34, 36 respectively have the same sequence as the first and second amplification domains 26, 38. Any of the sequences set forth herein for the amplification domains 26, 38 may be used for the primers 34, 36. The primers 34, 36 may be grafted to the polymeric hydrogel 22 either before or after it is introduced into the depressions 48.

[0153] In the example shown in Fig. 2C, the primers 34, 36 alone can be attached within the depressions 48. This example will be used in the method described in reference to Fig. 5. Alternatively in the example shown in Fig. 2C, the primers 34, 36 and the capture primers 33, 35 can be attached within the depressions48. This example will be used in the method described in reference to Fig. 6. In the examples described in reference to the figure 8 series through the figure 11 series, the primers 34, 36 may be attached within the depressions 48 and / or to the interstitial regions 56 as described herein.

[0154] Referring specifically to Fig. 2A, the flow cell 32 includes, in addition to the substrate 50 or 52 and the depressions 48 defined therein, a transposome capture mechanism 57 attached over at least the interstitial regions 56, wherein the transposome capture mechanism 57 i) is to bind to a transposome complex 10A and 10B or 10C, or ii) includes a free end group that is to bind to the transposome complex 10A and 10B or 10C, or iii) includes a protein that is to bind to the transposome complex 10A and 10B or 10C; and a primer set (including primers 34, 36) attached over the depressions 48.

[0155] The transposome capture mechanism 57 is covalently or non-covalently attached to at least the interstitial regions 56 and is capable of covalently or non- covalently binding to the 5’ end attachment groups 20A, 20B of the transposome complexes 10A, 10B or to the 3’ end attachment groups 20C of the transposome complexes 10C.

[0156] In some examples, the transposome capture mechanism 57 includes a plurality of probes, each of which, at one end, is capable of attaching to the surface groups at the interstitial regions 56 and, at the opposed end, includes a free end group that can attach to the attachment groups 20A and 20B or 20C of the complexes 10A and 10B or 10C. Depending upon when the probes are introduced (e.g., before or after the polymeric hydrogel 22 and primers 34, 36 are introduced into the depressions 48), the probes may also attach to the substrate 50 or 52 through exposed surface groups within the depressions 48.

[0157] The end of the probe that can covalently attach to the surface groups at the interstitial regions 56 may be a silane (reacts with silanol surface groups), an amine group (reacts with epoxide surface groups), an alkyne (reacts with azide surface groups), or bicyclononyne (reacts with tetrazine surface groups). This end group may be a linker that is attached to the free end group or may be attached to anadditional linker that is also attached to the free end group. Examples of suitable linkers include PEG or amino PEG. The free end group of the probe is biotin or streptavidin (the latter of which can be attached to the probe through biotin).

[0158] The following are some specific examples of probes that may be exclusively attached over the interstitial regions 56, e.g., when the polymeric hydrogel 22 and primers 34, 36 are introduced into the depressions 48 before probe attachment.

[0159] In one example, the interstitial regions 56 include surface silanol groups; and the probes include the linker and the free end group, where the linker is amino- poly(ethylene glycol), the free end group is selected from the group consisting of biotin and streptavidin. In this particular example, the end of the probe that can covalently attach to the surface groups at the interstitial regions 56 is a silane, which is attached to the linker. The following structure is one example of this probe:In another example, streptavidin is attached to the biotin of this structure, and thus the streptavidin is the free end group of this particular probe.

[0160] In another example, the interstitial regions 56 include methyl tetrazine surface groups, and the probes include the linker and the free end group, where the linker is bicyclononyne, and the free end group is selected from the group consisting of biotin and streptavidin. In this example, methyl tetrazine surface groups may be introduced to the interstitial regions 56 through the reaction of methyl tetrazine-amino PEG with epoxide groups at the surface of the substrate 50 or 52.

[0161] In still another example, the interstitial regions 56 include carboxylic acid groups (resulting from a leveling agent used in the substrate 50 or 52), and the probes include the linker and the free end group, where the linker is capable of amide formation (include an amine end group), esterification (include an alcohol end group),or thioesterification (includes a thiol end group). In these examples the free end group is selected from the group consisting of biotin and streptavidin.

[0162] Probes including biotin as the free end group can attach to transposome complexes 10A, 10B, 10C with biotin 5’ or 3’ end groups 20A, 20B, 20C when additional streptavidin is added, or to -biotin-streptavidin 5’ or 3’ end groups 20A, 20B, 20C.

[0163] In other examples, the transposome capture mechanism 57 includes a hydrogel layer with any example of the probes disclosed herein attached thereto. An example is shown in Fig. 3. As depicted, the polymeric hydrogel 22 with the primers 34, 36 is applied within the depressions 48. An additional hydrogel layer 64 is applied over the entire substrate 50 or 52, so that the interstitial regions 56 and the polymeric hydrogel 22 and primers 34, 36 are covered. The additional hydrogel layer 64 may be any of the examples set forth herein for the polymeric hydrogel 22, and the R2functional groups are selected to bind to end groups of the probes. Examples of suitable R2functional groups and probe end group pairs include tetrazine and BCN or azide and alkyne.

[0164] In still another example, the transposome capture mechanism 57 is a hydrophobic layer that is applied to the interstitial regions 56. Examples of suitable hydrophobic materials include silicon-based coatings, polyurethane coatings, other hydrophobic carbon-based polymer coatings, fluoropolymer coatings (e.g., polytetrafluoroethylene), self-assembled monolayers, wax coatings, nano-silica coatings, or graphene and carbon-based coatings. The hydrophobic coating may be selectively applied to the interstitial regions 56. The hydrophobic, non-polar regions of streptavidin will anchor to the surface via hydrophobic interactions. These interactions may be promoted and stabilized in the presence of a high salt concentration used in tagmentation. In these examples, the streptavidin may be attached as part of the transposome capture mechanism 57, or may be part of the -biotin-streptavidin 5’ or 3’ end groups 20A, 20B, 20C.

[0165] In yet another example, the transposome capture mechanism 57 includes an amino acid, such as lysine, arginine, or histidine attached to the interstitialregions 56, and streptavidin attached to the amino acid. In these examples, streptavidin can be replaced with another suitable protein that can attach to the amino acid and can attach to the 5’ or 3’ end groups 20A, 20B, 20C. Lysine and / or arginine can be coupled to carboxylic acid moieties at the interstitial regions 56 via a peptide coupling. For example, carboxylic acid moieties at the interstitial regions 56 can be activated with a coupling reagent (e.g., ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (EDC), O-(Benzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HBTU), ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (TBTU), 1 -hydroxybenzotriazole (HOBt))for amide bond formation, this is followed by a substitution of the primary amine of the amino acid. For histidine, a Ni-His tag reaction can be used, where the carboxylic acid moieties at the interstitial regions 56 are functionalized with nitriloacetic acid (NTA) using a coupling reagent (e.g., a carbodiimide). A solution containing streptavidin and having a pH above the isoelectronic point (pl) of streptavidin can be introduced to the interstitial regions 56. At these conditions, the streptavidin carries a net negative charge, leading to electrostatic attraction between the positively charged amino acids and repulsion from the negatively charged depressions 48 (where primers 34, 36 are attached). In these examples, the 5’ or 3’ end groups 20A, 20B, 20C are biotin.

[0166] Alternatively, the transposome capture mechanism 57 may include the amino acid, such as lysine, arginine, or histidine, attached at the interstitial regions 56, and the transposome complexes 10A and 10B or 10C can include -biotin-streptavidin attachment groups 20A and 20B or 20C.

[0167] In still another example, the transposome capture mechanism 57 includes the previously described methyl tetrazine groups attached to the interstitial regions 56. In this example, the probes are not used. Rather, the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include biotin-BCN. The BCN can react with the tetrazine.

[0168] In still a further example, the transposome capture mechanism 57 is silicon dioxide (SiC ) that is specifically generated at the interstitial regions 56. Anexample of a method to generate the SiChat the interstitial regions 56 is shown in Fig. 4.

[0169] In this method, an aluminum / silicon dioxide film 66 is deposited over the substrate 50 or an example of the material 62 of the substrate 52. A photoresist 68 is deposited over the aluminum / silicon dioxide film 66. Any suitable negative photoresist may be used when it is desirable for the UV light to pattern insoluble regions and any suitable positive photoresist may be used when it is desirable for the UV light to pattern soluble regions. Once the desired regions are patterned, a suitable developer for the photoresist may be used to remove insoluble regions. In the example shown in Fig. 4, a positive photoresist is used and a photomask is used to selectively block the UV light. In this example, the UV light is blocked from reaching the portions of the photoresist 68 that overlie those portions of the aluminum / silicon dioxide film 66 that will form the SiO? at the interstitial regions 56. The UV light exposed portions of the photoresist remain soluble and are removed with a developer. The remaining insoluble photoresist 68’ can act as an etching mask when the exposed portions of the aluminum / silicon dioxide film 66 are etched away. Timed dry etching may be used to remove the exposed portions of the aluminum / silicon dioxide film 66 and expose the underlying substrate 50 or material 62. The insoluble photoresist 68’ can then be removed in a suitable solvent. The underlying substrate 50 or material 62 can be etched to form the depressions 48 with the SiO? (as the transposome capture mechanism 57) present at the interstitial regions 56.

[0170] With the SiO2 present at the interstitial regions 56, the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C may include the -biotin-linker-silane described herein. In these examples, the SiChcan react with the silane to attach homodimers of the transposome complexes 10A and 10B or 10C to the flow cell 32. Alternatively, the SiO2 and -silane-linker-biotin or -silane-linker- biotin-streptavidin probes may be used together as the transposome capture mechanism 57.

[0171] In one example, the surface functional groups present at the interstitial regions 56 are selected from the group consisting of carboxylic acid groups, silanolgroups, amide groups, alcohol groups, amine groups, and combinations thereof, and the transposome capture mechanism 57 is streptavidin. Any of these groups can be used as hydrogen-bond donors and acceptors for the peptidic chain at the surface of the streptavidin. In these examples, the 5’ or 3’ attachment groups 20A, 20B, 20C are biotin. In these examples, the streptavidin can be replaced with another protein that can hydrogen bond to the surface functional groups and can attach to the 5’ or 3’ attachment groups 20A, 20B, 20C.

[0172] When streptavidin is used as the transposome capture mechanism 57, it is to be understood that some of the streptavidin may also become physically entangled in the polymeric hydrogel 22 in the depressions 48. Alternatively, a layer of streptavidin may replace the polymeric hydrogel 22 in the depressions 48.

[0173] In other examples shown in Fig. 2A, the surface groups of the substrate 50 or 52 are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C are able to attach to the surface groups. In these examples, the additional transposome capture mechanism 57 is not utilized.

[0174] In one example, epoxide groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include -biotin-bicyclononyne-methyl tetrazine-amino PEG-. The terminal amino of the attachment groups 20A and 20B or 20C can react with the surface bound epoxide groups.

[0175] In another example, azide groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include -biotin. The biotin can react with the surface bound azide groups.

[0176] In another example, carboxylic groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C are selected from the group consisting of -biotinstreptavidin (resulting in hydrogen bonding), -amine (resulting in amide formation or hydrogen bonding), -alcohol (resulting in esterification or hydrogen bonding), -thiol (resulting in thioesterification), or -amide (resulting in hydrogen bonding).

[0177] In yet another example, silanol groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C are selected from the group consisting of -biotinstreptavidin (resulting in hydrogen bonding), -alcohol (resulting in esterification or hydrogen bonding), or -amide (resulting in hydrogen bonding).

[0178] It is to be understood that if the 5’ or 3’ end groups 20A, 20B, 20C of the transposome complexes 10A, 10B, 10C are capable of covalently or non-covalently attaching to the polymeric hydrogel 22 in the depressions 48, at least some of the homodimers of the transposome complexes 10A and 10B or 10C may also become bound within the depressions 48.

[0179] In still other examples shown in Fig. 2A, the surface groups of the substrate 50 or 52 are exposed at the interstitial regions 56, and the amino acid chain(s) 126 of the transposome complexes 101, 10J are able to attach to the surface groups. In these examples, the additional transposome capture mechanism 57 is not utilized.

[0180] Referring now to Fig. 2C and Fig. 2D, these examples of the flow cells 32 do not include the transposome capture mechanism 57 and do not specifically utilize the surface groups at interstitial region 56 to bound the transposome complexes 10A and 10B or 10C.

[0181] The flow cell architecture in Fig. 2C is similar to that shown in Fig. 2B in terms of the substrate 50 or 52, the depressions 48, and the polymeric hydrogel 22 and primers 34, 36 in the depressions 28. The flow cell architecture in Fig. 2C does not include the transposome capture mechanism 57. Rather, in one example, the flow cell architecture of Fig. 2C utilizes the primers 34, 36 to bind the transposome complexes 10D and 10E (Fig. 1 D and Fig. 1 E) and for amplification of fully adapted DNA fragments generated via the method shown in Fig. 5; and, in another example, the flow cell architecture of Fig. 2C utilizes the capture primers 33, 35 to bind the transposome complexes 10F and 10G (Fig. 1 F and Fig. 1 G) and the primers 34, 36 for amplification of fully adapted DNA fragments generated via the method shown in Fig.6.

[0182] The flow cell architecture in Fig. 2D includes the structure 44C, which includes the lane 54 defined in the single-layer substrate 50 or in the patterned material 62 of the multi-layer substrate 52, and surrounded by the perimeter regions 58. The depth of lane 54 is large enough to house at least the polymeric hydrogel 22. In one example, the lane 54 may be filled with the polymeric hydrogel 22. In an example, the depth may be at least about 0.1 pm, at least about 0.5 pm, at least about 1 pm, at least about 10 pm, at least about 100 pm, or more. Alternatively or additionally, the depth can be at most about 1 x103pm, at most about 100 pm, at most about 10 pm, or less. In some examples, the depth is about 0.4 pm. The depth of the lane 54 can be greater than, less than or between the values specified above.

[0183] In one example, the flow cell architecture of Fig. 2D includes the primers 34, 36 attached to the polymeric hydrogel 22. In this example, some primers 34, 36 bind the transposome complexes 10D and 10E (Fig. 1 D and Fig. 1 E) and other primers 34, 36 are used for amplification of fully adapted DNA fragments generated via the method shown in Fig. 5. In another example, the flow cell architecture of Fig. 2D includes the primers 34, 36 and the capture primers 33, 35 attached to the polymeric hydrogel 22. In this example, the capture primers 33, 35 bind the transposome complexes 10F and 10G (Fig. 1 F and Fig. 1 G) and the primers 34, 36 are used for amplification of fully adapted DNA fragments generated via the method shown in Fig.6.

[0184] Referring now to Fig. 2E, still another flow cell architecture is shown. This flow cell architecture is similar to that shown in Fig. 2B in terms of the substrate 50 or 52 having depressions 48’ defined therein. Unlike the depressions 48 described in reference to Fig. 2B, however, these depressions 48’ have an average pitch (center- to-center spacing) ranging from about 30 nm to about 50 nm, and an average depression diameter of 20 nm or less. This pitch size and diameter help to ensure that a single transposome complex dimer is immobilized in a single depression 48’. This is due to size exclusion and steric hindrance. As such, tagmentation taking place within this flow cell architecture happens between two depressions 48’ and not within a single depression 48’.

[0185] As shown in Fig. 2E, each depression 48’ includes the polymeric hydrogel 22 and two transposome complexes 10H (in dimer form) immobilized to the polymeric hydrogel 22. The attachment of the transposome complexes 10H to the polymeric hydrogel 22 may be via any of the covalent or non-covalent binding mechanisms set forth herein. In one example, the polymer hydrogel 22 is a biotinylated hydrogel, the transposome complexes 10H include a biotin end group, and streptavidin links the biotin groups. In another example, the polymer hydrogel 22 is replaced with a streptavidin layer, the transposome complexes 10H include a biotin end group.

[0186] The transposome complexes 10H may be desirable with this architecture because it eliminates the formation of fully adapted fragments with the same amplification domain 26 or 38 at opposed ends. It is to be understood, however, that the other transposome complexes 10A, 10B, or 10A, 10C, or 10A, 10I, or 10I, 10I’, or 10J, 10J’ may be used in this example architecture.

[0187] As will be described below, the flow cell architecture shown in Fig. 2E is used for tagmentation and preparation of the fully adapted fragments. Another flow cell architecture that includes the primers 34, 36 in the depressions 48 without any other primers 33, 35 and without transposome complexes 10A through 10J may be used for amplification of those fully adapted fragments.

[0188] In any of the examples set forth herein, the transposome complexes 10A, 10B, or 10A, 10C, or 10D, 10E, or 10F, 10G, 10H, or 10A, 101, or 101, 101’, or 10J, 10J’ may be included as part of the flow cell 32 or may be added and attached within the flow cell 32 at the outset of the method. The attachment mechanisms for the transposome complexes 10A, 10B, or 10A, 10C, or 10H, or 10A, 101, or 101, 101’, or 10J, 10J’ will depend upon the transposome attachment mechanism 57 or the surface groups at the interstitial regions 56 as described herein.

[0189] Another example of the flow cell 32’ is shown in Fig. 7. This flow cell 32’ includes the substrate 50 or 52, which includes a plurality of first depressions 48 defined therein and first interstitial regions 56 separating each of the plurality of first depressions 48 from one another; a primer set (primers 34, 36) attached over each ofthe depressions 48; a complementary metal oxide semiconductor (CMOS) imaging device 94 coupled to the substrate 50 or 52 such that an optical detector 98 of the CMOS imaging device 94 is respectively aligned with each of the plurality of first depressions 48; and a lid 108 attached to the substrate 50 or 52, the lid 108 including a plurality of second depressions 48’ defined therein and second interstitial regions 56’ separating each of the plurality of second depressions 48’ from one another; and a single transposome complex dimer 102 immobilized in each of the plurality of second depressions 48’, each of the single transposome complex dimers 102 including two forked transposome complexes 10H.

[0190] The flow cell 32’ incorporates the tagmentation chemistry in the lid 108. The flow cell architecture described in reference to Fig. 2E is incorporated into the lid 108 of the flow cell 32’. It is to be understood that when integrated into the lid 108 of the flow cell 32, the diameter of the depressions 48 is 20 nm or less, but the pitch may be any of the examples described herein for the depressions 48 or 48’. This will enable insert sizes (described in reference to Fig. 2E) or tuneable long inserts with narrow size distribution (no short insert bias) to be obtained. Long inserts may be achieved when the pitch ranges from about 350 nm to about 1 kB.

[0191] The lid 108 may be any material that is transparent to the excitation light 104 that is directed toward the depressions 48. As examples, the lid 108 may include glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D 263®, available from Schott North America Inc. Commercially available examples of suitable plastic materials, namely cyclo olefin polymers, are the ZEONOR® products available from Zeon Chemicals L.P.

[0192] The depressions 48’ may be imprinted or otherwise formed (e.g., etched) in the lid 108.

[0193] The polymeric hydrogel 22 (or streptavidin) may be introduced into the depressions 48’ via blanket deposition and polished from the interstitial regions 56’.

[0194] The forked transposome complexes 10H may be incorporated into a solution to form the dimers 102, and then the dimers 102 may be grafted to thepolymeric hydrogel 22 (or streptavidin) via the 5’ end group 20H. The pitch and size of the depressions 48’ help to ensure a single dimer 102 attaches in a single depression 48’.

[0195] The flow cell 32’ incorporates the amplification chemistry in the substrate 50 or 52. The flow cell architecture described in reference to Fig. 2C is used, except that the additional primers 33, 35 and the transposome complexes 10H are not included. Thus, this example of the substrate 50 includes the depressions 48 separated by the interstitial regions 56, the polymeric hydrogel 22 positioned within the depressions 56, and the primers 34, 36 attached to the polymeric hydrogel 22. For ease of illustration, the single layer substrate 50 is shown in Fig. 7. It is to be understood, however, that the multi-layer substrate 52 (including the base support 60 having the layer 62 thereon) may alternatively be used.

[0196] After the desired chemistry is introduced to the lid 108 and the substrate 50, the lid 108 may be physically connected to the substrate 50 through a spacer layer 114. In the example shown in Fig. 7, the spacer layer(s) 114 is / are coupled to a portion the surface of the substrate 50 (e.g., at bonding regions 58). The spacer layer 114 also extends between the surface of the substrate 50 and an interior surface of the lid 108. The spacer layer 114 and the lid 108 may be separate components that are coupled to each other. For example, the spacer layer 114 may include a curable adhesive layer that bonds the lid 108 to the substrate 60 (at a portion of its surface).

[0197] The lid 108 may include inlet and outlet ports 122, 124 that are configured to fluidical ly engage other ports (not shown) for directing fluid(s) into the flow channel 46’ (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 46’ (e.g., to a waste removal system).

[0198] The flow cell 32’ also includes a complementary metal oxide semiconductor (CMOS) chip 94 coupled to a bottom of the substrate 50. In examples using the substrate 52, the CMOS chip 94 may be coupled to the bottom of the base support 60.

[0199] The substrate 50 of the flow cell 32’ may be affixed directly to, and thus be in physical contact with, the CMOS chip 94 through one or more securingmechanisms (e.g., adhesive, bond, fasteners, and the like). It is to be understood that the substrate 50 may be removably coupled to the CMOS chip 94.

[0200] The CMOS chip 94 includes a plurality of stacked layers 96 including, for example, silicon layer(s), dielectric layer(s), metal-dielectric layer(s), metal layer(s), etc.). The stacked layers 96 make up the device circuitry, which includes detection circuitry.

[0201] The CMOS chip 94 includes optical components, such as optical sensor(s) 98 and optical waveguide(s) 100. The optical components may be arranged such that each optical sensor 98 at least substantially aligns with, and thus is operatively associated with, a single optical waveguide 100 and a single depression 48 of the flow cell 32’. However, in other examples, a single optical sensor 98 may receive photons through more than one optical waveguide 100 and / or from more than one depression 48. In these other examples, the single optical sensor 98 is operatively associated with more than one optical waveguide 100 and / or more than one depression 48.

[0202] As used herein, a single optical sensor 98 may be a light sensor that includes one pixel or more than one pixel. As an example, each optical sensor 98 may have a detection area that is less than about 50 pm2. As another example, the detection area may be less than about 10 pm2. As still another example, the detection area may be less than about 2 pm2. In the latter example, the optical sensor 98 may constitute a single pixel. An average read noise of each pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor(s) 98 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels, or greater than about 10 Mpixels.

[0203] Also as used herein, a single optical waveguide 100 may be a light guide including a cured filter material that i) filters the excitation light 104 (propagating from an exterior of the flow cell 32’ into the flow channel 46’), and ii) permits the light emissions resulting from reactions at the depressions 48 to propagate therethrough toward corresponding optical sensor(s) 98. In an example, the optical waveguide 100may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 104 of about 532 nm wavelength and permit light emissions of about 570 nm or more wavelengths. The optical waveguide 100 may be formed by first forming a guide cavity in a dielectric layer 106, and then filling the guide cavity with a suitable filter material.

[0204] The optical waveguide 100 may be configured relative to the dielectric material 106 in order to form a light-guiding structure. For example, the optical waveguide 100 may have a refractive index of about 2.0 so that the light emissions are substantially reflected at an interface between the optical waveguide 100 and the surrounding dielectric material 106. In certain examples, the optical waveguide 100 is selected such that the optical density (OD) or absorbance of the excitation light 104 is at least about 4 OD. More specifically, the filter material may be selected and the optical waveguide 100 may be dimensioned to achieve at least 4 OD. In other examples, the optical waveguide 100 may be configured to achieve at least about 5 OD or at least about 6 OD.

[0205] The substrate 50 functions as a passivation layer for the flow cell 32’. At least a portion of the substrate 50 is in contact with a first embedded metal layer 112 of the CMOS chip 94 and also with an input region 110 of the optical waveguide 100. The contact between the substrate 50 and the first embedded metal layer 112 may be direct contact or may be indirect contact through a shield layer 114. Thus, the substrate 50 may provide one level of corrosion protection for the embedded metal layer 112 of the CMOS chip 94 that is closest in proximity to the substrate 50. In this example, the substrate 50 may include a passivation material that is transparent to the light emissions resulting from reactions within the depressions 48 (e.g., visible light), and that is at least initially resistant to the fluidic environment and moisture that may be introduced into or present in the flow channel 46’. An at least initially resistant material acts as an etch barrier to high pH reagents (e.g., pH ranging from 8 to 14) and as a moisture barrier. Examples of suitable materials for the substrate 50 of the flow cell 32’ include silicon nitride (SisN4), silicon oxide (SiO2), tantalum pentoxide (Ta2Os), hafnium oxide (HfCh), boron doped p+ silicon, or the like. The thickness of thesubstrate 14 may vary depending, in part upon the sensor dimensions. In an example, the thickness of the substrate 14 ranges from about 100 nm to about 500 nm.

[0206] The flow channel 46’ may be sized and shaped to direct a fluid along the depressions 48’ and 48. The height of the flow channel 46’ and other dimensions of the flow channel 46’ may be configured to maintain a substantially even flow of the fluid over the depressions 48’ during tagmentation and depressions 48 during amplification. The dimensions of the flow channel 46’ may also be configured to control bubble formation. In an example, the height of the flow channel 46’ may range from about 50 pm to about 400 pm. In another example, the height of the flow channel 46’ may range from about 80 pm to about 200 pm.

[0207] Each depression 48 is a localized region in the substrate 60 of the flow cell 32’ where a designated reaction may occur. In an example, each depression 48 is at least substantially aligned with the input region 110 of a single optical waveguide 100. As such, light emissions at the depressions 48 may be directed into the input region 110, through the waveguide 100, and to an associated optical sensor 98. In other examples, one depression 48 may be aligned with several input regions 110 of several optical waveguides 100. In still other examples, several depressions 48 may be aligned with one input region 110 of one optical waveguide 100.

[0208] As described, at least a portion of the substrate 50 is in contact with a first embedded metal layer 112 of the CMOS chip 94 and also with an input region 110 of the optical waveguide 100. The embedded metal layer 112 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AICI), tungsten (W), nickel (Ni), or copper (Cu). In an example, the embedded metal layer 112 may be a functioning part of the CMOS AVdd line, and through the stacked layers 96, is also electrically connected to the optical sensor 98. Thus, the embedded metal layer 112 participates in the detection / sensing operation.

[0209] It is to be understood that the other optical sensors 98 and associated components may be configured in an identical or similar manner. It is also to be understood, however, that the CMOS chip 94 may not be manufactured identically or uniformly throughout. Instead, one or more optical sensor 98 and / or associatedcomponents may be manufactured differently or have different relationships with respect to one another.

[0210] The stacked layer 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that can conduct electrical current. The circuitry may be configured for selectively transmitting data signals that are based on detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected light emissions and generate data signals for communicating detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing in the CMOS chip 94.

[0211] The CMOS chip 94 may be manufactured using integrated circuit manufacturing processes. The CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base may include the optical sensor 98. When the CMOS chip 94 is fully formed, the optical sensor 98 may be electrically coupled to the rest of the circuitry in the stack layer 96 through gate(s), transistor(s), etc.

[0212] As used in reference to Fig. 7, the term “layer” is not limited to a single continuous body of material unless otherwise noted. For example, the sensor base / layer may include multiple sub-layers that are different materials and / or may include coatings, adhesives, and the like. Furthermore, one or more of the layers (or sub-layers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.

[0213] The stacked layer 96 also includes a plurality of metal-dielectric layers. Each of these layers includes metallic elements (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and dielectric material 106 (e.g., SiO?). Various metallic elements M1-M5 and dielectric materials 106 may be used, such as those suitable for integrated circuit manufacturing.

[0214] In the example shown in Fig. 7, each of the plurality of metal-dielectric layers L1-L6 includes both metallic elements M1 , M2, M3, M4, M5 and dielectricmaterial 106. In each of the layers L1 -L6, the metallic elements M1 , M2, M3, M4, M5 are interconnected and are embedded within dielectric material 106. In some of the metal-dielectric layers L1 -L6, additional metallic elements may also be included.Some of these additional metallic elements may be used to address individual pixels through a row and column selector. The voltages at these elements may vary and switch between about -1 .4 V and about 4.4 V depending upon which pixel the device is reading out.

[0215] The configuration of the metallic elements M1 , M2, M3, M4, M5 and dielectric layer 106 in Fig. 7 is illustrative of the circuitry, and it is to be understood that other examples may include fewer or additional layers and / or may have different configurations of the metallic elements M1-M5.

[0216] In the example shown in Fig. 7, the shield layer 114 is in contact with at least a portion of the substrate 50. The shield layer 114 has an aperture at least partially adjacent to the input region 110 of the optical waveguide 100. This aperture enables the depressions 48 (and at least some of the light emissions therefrom) to be optically connected to the waveguide 100. It is to be understood that the shield layer 114 may have an aperture at least partially adjacent to the input region 110 of each optical waveguide 100. The shield layer 114 may extend continuously between adjacent apertures.

[0217] The shield layer 114 may include any material that can block, reflect, and / or significantly attenuate the light signals that are propagating through the flow channel 46’. The light signals may be the excitation light 104 and / or the light emissions from the depressions 48. As an example, the shield layer 114 may be tungsten (W).

[0218] It is to be understood that the flow cell 32’ may be used for optical detection, or the optical signals may be converted into electrical signals, which are then detected.

[0219] Method using Transposome Complexes 10A, 10B or 10A, 10C and the Flow Cell Architecture of Fig. 2B

[0220] When the flow cell of Fig. 2B having the transposome complexes 10A, 10B, or 10A, 10C attached at least to the interstitial regions 56 is used, the method includes introducing a DNA sample to the flow cell 32, introducing a tagmentation buffer into the flow cell 32, bringing the flow cell 32 to a tagmentation temperature, thereby generating partially adapted DNA fragments, generating fully adapted DNA fragments from the partially adapted DNA fragments, amplifying the fully adapted DNA sample fragments, and performing a sequencing operation.

[0221] At the outset of this example method, the DNA sample is introduced into the flow cell 32. It is to be understood that the DNA sample includes several pieces of longer DNA or complementary DNA (cDNA) generated from RNA.The DNA sample is added with a tagmentation buffer. The tagmentation buffer may include water, an optional co-solvent (e.g., dimethylformamide), a metal co-factor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate salt, pH 7.6). In an example, the optional co-solvent may be present in an amount up to about 11 %, the metal co-factor may be present in a concentration ranging from about 3 mM to about 10 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 12 mM. In another example, the optional co-solvent may be present in an amount up to about 10%, the metal co-factor may be present in a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 10 mM.

[0222] At least at the interstitial regions 56 and at the outset of tagmentation, the DNA sample is tagmented by the transposome complexes 10A, 10B, or 10A, 10C. In particular, the strands of the longer DNA or cDNA in the DNA sample are fragmented. The 5’ ends of both strands of the fragments of the duplex sample are attached to respective 3’ ends of the transferred strands 16A, 16B or 16A, 16C of at least some of the transposome complexes 10A, 10B, or 10A, 10C. The 3’ ends of both strands of the fragments of the duplex sample are not attached to the 5’ ends of the nontransferred strands 18A, 18B or 18A, 18C. As such, a gap exists between the 3’ end of each strand of the DNA fragment strands and the 5’ end of the corresponding non-transferred strand 18A, 18B or 18A, 18C. In one example, each gap is nine (9) base pairs long.

[0223] Tagmentation generates partially adapted DNA fragments. The tagmentation may occur randomly across the different strands in the DNA sample. The number of tagmentation events that take place on a single piece of DNA or cDNA within the DNA sample will depend upon the length of the piece and the distance between neighboring transposome complex dimers. At a minimum, the transposome complexes 10A, 10B, or 10A, 10C can tagment the pieces within the DNA sample at least every 30 base pairs.

[0224] Tagmentation (including fragmentation and attachment) may take place at a temperature at or above 30°C. In one example, the temperature may range from 30°C to about 55°C. In another example, the temperature may range from 35°C to about 45°C.

[0225] The method then involves washing untagmented DNA fragments (not shown) from the flow cell 32. An example of the washing solution is an aqueous solution including a buffer agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbates), and / or a chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA)). In one example, the washing solution includes water, the salt at a concentration ranging from about 25 mM to about 50 mM, the surfactant in an amount ranging from about 0.01 wt% to about 0.1 wt%, and optionally the chelating agent. The washing solution may have a relatively high pH, e.g., ranging from about 7 to about 10.

[0226] To generate the fully adapted fragments, the transposase enzymes 12A, 12B or 12A, 12C are removed from the transposome complexes 10A, 10B, or 10A, 10C, and an extension reaction is initiated.

[0227] Transposase enzyme removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 32 to about 60°C. When heat is used, some example methods involve introducing the washing solution into the flow cell 32; and heating the flow cell 32, containing the washing solution, to about 60°C.

[0228] When SDS or another chaotropic detergent has been used for transposase removal, the washing solution may be flushed through the flow channel 46 prior to initiating the extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0229] To initiate the extension reaction, an extension mix or an extension amplification mix is introduced into the flow cell 32. An example of the extension mix includes nucleotides, a polymerase, and accessory proteins. The extension mix may be used when it is desirable to initiate amplification separately from extension. An example of the extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension amplification mix may be used when it is desirable to initiate amplification along with extension. The extension or extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and / or a cosolvent (e.g., glycerol, dimethylformamide, etc.). The ExAMP reagents available from Illumina Inc. are examples of suitable extension amplification mixes.

[0230] The flow cell 32 may be up to 60°C (e.g., at about 38°C) when the extension mix or the extension amplification mix is introduced.

[0231] At the outset of the extension reaction, the non-transferred strands 18A, 18B or 18A, 18C are dehybridized. Additional sequences (adapters) are added to the 3’ ends of the newly tagmented strands by an extension reaction using the extension or extension amplification mix. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the partially adapted DNA fragments using the respective transferred strands 16A, 16B or 16A, 16C as the template. The sequences resulting from the extension reaction render the partially adapted (tagmented) fragments fully adapted. At least some of the fully adapted fragments (not shown) that are generated along the transposome complex 10A include the first amplification domain 26 at one end and a complement 38’ of the second amplification domain 38 at the other end. At least some of the fully adapted fragments that are generated along the transposome complex 10B or 10C include the secondamplification domain 38 at one end and a complement 26’ of the first amplification domain 26 at the other end.

[0232] The fully adapted fragments are amplified using the primers 34, 36 and then sequenced. When the extension amplification mix is used, amplification takes place immediately when the fully adapted fragments are generated. When the extension mix is used, amplification does not occur immediately, but after an additional polymerase and nucleotides are added to the flow cell 32. In one example of cluster generation, the fully adapted fragments are denatured from one another, and loop over to hybridize to an adjacent, complementary primer 34, 36, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers 34, 36, and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double stranded bridges is denatured. In an example, the reverse strands are removed by a cleaving agent suitable for the cleavage site of the primers 36 to which the reverse strands are attached (e.g., specific base cleavage), leaving forward template strands / amplicons. In another example, the forward strands are removed by a cleaving agent suitable for the cleavage site of the primers 34 to which the forward strands are attached (e.g., specific base cleavage), leaving reverse template strands / amplicons. Clustering results in the formation of several fragments immobilized in the depressions 48.

[0233] Sequencing may then be performed. In one example, sequencing by synthesis (SBS) is performed by introducing sequencing primers (which bind to the sequencing primer sequence 28A, 28B or 28C) followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0234] Method using Transposome Complexes 10D, 10E and the Flow Cell Architecture of Fig. 2C or Fig. 2D

[0235] When the flow cell 32 of Fig. 2C or Fig. 2D is used with the primers 34, 36 attached but without the transposome complexes 10D, 10E attached at the outset of the method, two transposome complex fluids are used.

[0236] The first transposome complex fluid includes a first liquid carrier and the transposome complexes 10D. In this fluid, the transposome complexes 10D form the homodimers. The second transposome complex fluid includes a second liquid carrier and the transposome complexes 10E. In this fluid, the transposome complexes 10E form the homodimers. The first and second liquid carriers may each be water. A buffer and / or salt may be added to the liquid carrier. The buffer has a pH ranging from 5 to 12. The transposome complex fluids respectively include the transposome complexes 10D or 10E in the carrier liquid in a concentration ranging from about 0.01 pM to about 1 pM.

[0237] With this flow cell 32, the example method includes introducing the first and second transposome complex fluids to the flow cell 32, whereby the complements 26’, 38’ of the first amplification domain sequence 26 (and the primer 34) and the second amplification domain sequence (and the primer 36) respectively hybridize to the complementary primers 34, 36; introducing a DNA sample into the flow cell 32 at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating gap-fill ligation to generate fully adapted fragments from each of the partially adapted fragments.

[0238] In other examples, the flow cell 32 of Fig. 2C or Fig. 2D is used with the primers 34, 36 and the transposome complexes 10D, 10E attached at the outset. When this flow cell 32 is used, the method includes introducing a DNA sample into the flow cell 32 at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating gap-fill ligation to generate fully adapted fragments from each of the partially adapted fragments.

[0239] Both of these methods also include amplifying the fully adapted DNA sample fragments, and performing a sequencing operation.

[0240] These example methods are shown in Fig. 5.

[0241] In the first example method, the transposome complex fluids are introduced into the flow cell 32 using any suitable technique. The flow cell 32 is at or is brought to a hybridization temperature, e.g., from about 40°C to about 65°C. As shown in Fig. 5, at A., at least one of the transposome complexes 10E, 10D in the dimers hybridizes to a respectively complementary primer 34, 36.

[0242] Whether the transposome complexes 10E, 10D are pre-hybridized in the flow cell 32 or are introduced by a user of the flow cell 32, the method then includes introducing the DNA sample and initiating tagmentation. DNA sample introduction and tagmentation may be performed as described herein. As shown at B. in Fig. 5, partially adapted DNA fragments 70A, 70B are generated as a result of tagmentation. The 5’ ends of the tagmented DNA are attached to the transferred strands 16D, 16E and gaps exist between the 3’ ends of tagmented DNA and the non-transferred strands 18D, 18E. Gaps Gi , G2 are also present between the surface bound primers 34, 36 and the respective transferred strands 16E, 16D. These gaps may be about 14 base pairs (bp) or 15 bp.

[0243] The transposase enzymes 12D, 12E are then removed as described herein. This is shown in Fig. 5, at C.

[0244] A gap-fill ligation reaction is then initiated to attach the 3’ ends of tagmented DNA to the non-transferred strands 18D, 18E, and to fill the gaps G1 , G2 between the surface bound primers 34, 36 and the respective transferred strands 16E, 16D. The gap-fill ligation may be performed using a mixture of a non-strand displacing polymerase, a ligase, and nucleotides. A commercially available kit for gap-fill ligation may be used, such as Illumina Inc.’s DNA PCR free kit. Examples of non-strand displacing polymerases include T4 and T7 DNA polymerases, which are active at temperatures ranging from about 20°C to about 37°C. Examples of the DNA ligase include E.coli DNA ligase, T4 DNA ligase, etc. The gap-fill ligation mix also includes any of the nucleotides described herein. The gap-fill ligation forms the fully adapted DNA strands 72A, 72B, as shown in Fig. 5 at D. The fully adapted DNA strands 72A, 72B are attached to the flow cell surface through the primers 34, 36.

[0245] Amplification and sequencing can then be performed as described herein.

[0246] In another example, the transposome complexes 10D, 10E include the sequencing primer sequences as part of the transferred strands 16D, 16E, which would simplify the gap-fill ligation.

[0247] Method using Transposome Complexes 10F, 10G and the Flow Cell Architecture of Fig. 2C or Fig. 2D

[0248] When the flow cell 32 of Fig. 2C or Fig. 2D is used with the primers 34, 36 and the capture primers 33, 35 attached but without the transposome complexes 10F, 10G attached at the outset of the method, two transposome complex fluids are used.

[0249] The first transposome complex fluid includes a first liquid carrier and the transposome complexes 10F. In this fluid, the transposome complexes 10F form the homodimers. The second transposome complex fluid includes a second liquid carrier and the transposome complexes 10G. In this fluid, the transposome complexes 10G form the homodimers. The first and second liquid carriers may be any of the examples disclosed herein.

[0250] With this flow cell 32, the example method includes introducing the first and second transposome complex fluids to the flow cell 32, whereby the capture sequence complements 29, 31 respectively hybridize to the capture primers 33, 35; introducing a DNA sample into the flow cell 32 at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating an extension reaction to generate fully adapted fragments from each of the partially adapted fragments.

[0251] In other examples, the flow cell 32 of Fig. 2C or Fig. 2D is used with the primers 34, 36, the capture primers 33, 35, and the transposome complexes 10F, 10G attached at the outset. When this flow cell 32 is used, the method includes introducing a DNA sample into the flow cell 32 at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating anextension reaction to generate fully adapted fragments from each of the partially adapted fragments.

[0252] Both of these methods also include amplifying the fully adapted DNA sample fragments, and performing a sequencing operation.

[0253] These example methods are shown in Fig. 6.

[0254] In the first example method, the transposome complex fluids are introduced into the flow cell 32 using any suitable technique. The flow cell 32 is at or is brought to a hybridization temperature, e.g., from about 55°C to about 65°C. As shown in Fig. 6, at A. and B., at least one of the transposome complexes 10F, 10G in the dimers hybridizes to the respectively complementary capture primer 33, 35. Alternatively, both of the transposome complexes 10F, 10G in the dimers respectively hybridize to the complementary capture primers 33, 35.

[0255] Whether the transposome complexes 10F, 10G are pre-hybridized in the flow cell 32 or are introduced by a user of the flow cell 32, the method then includes introducing the DNA sample and initiating tagmentation. DNA sample introduction and tagmentation may be performed as described herein. As shown at C. in Fig. 6, partially adapted DNA fragments 70C, 70D are generated as a result of tagmentation. The 5’ ends of the tagmented DNA are attached to the transferred strands 16F, 16G and gaps exist between the 3’ ends of tagmented DNA and the non-transferred strands 18F, 18G.

[0256] The transposase enzymes 12F, 12G are then removed as described herein.

[0257] An extension reaction is initiated as described herein using the extension mix or the extension amplification mix. During the extension reaction, the sequences may be extended down to the ends of the transferred strands 16F, 16G, thus displacing the capture primer 33, 35 and copying the complement 29, 31 sequence. Alternatively, when the blocker base 41 is included between the amplification domain 26, 38 and the capture sequence complements 29, 31 , the extension reaction is prevented from copying the complement 29, 31 sequence. The extension reactiongenerates the fully adapted DNA fragments (not shown in Fig. 6). Amplification and sequencing can then be performed as described herein.

[0258] In order to improve the binding of the transposome complexes 10F, 10G throughout the workflow, base modifications may be made to the capture primers 33, 35. For example, locked nucleic acids (LNC) may be included to improve the melting temperature of the capture primers 33, 35.

[0259] Method using Transposome Complexes 10A, 10B or 10A, 10C, or 10H and the Flow Cell Architecture of Fig. 2E

[0260] The flow cell architecture of Fig. 2E (with depressions 48’ and single transposome complex dimers in each depression 48’) may be used for tagmentation. This architecture may be present in one flow channel 46 of a flow cell 32, and another flow channel 46 of the same flow cell 32 may include the amplification chemistry (i.e. , primers 34, 36 attached within depressions 48 or a lane 54).

[0261] The flow cell architecture of Fig. 2E is particularly desirable for generating small inserts (i.e., from about 40 bp to about 160 bp) of a DNA sample or crude plasma that contains cell-free DNA (cfDNA), which may be human or microbial.

[0262] This method generally includes introducing a crude plasma sample or a processed plasma sample containing cell-free DNA (cfDNA) into the flow cell with a tagmentation buffer, thereby tagmenting at least some of the cfDNA and forming partially adapted cfDNA fragments; and initiating an extension reaction to generate fully adapted cfDNA fragments from the partially adapted cfDNA fragments.

[0263] Sample (e.g., blood) collection may take place in a stabilizing medium that contains apoptosis inhibitors so that only cfDNA (microbial and / or human) is present. The sample may be exposed to plasma isolation for cfDNA extraction. The plasma may be separated (or isolated) from the blood by centrifugation. For the extraction, a commercially available kit can be used (e.g., silica-column, magnetic bead-based, microfluidic circuits, etc.).

[0264] After plasma isolation, the crude plasma may be used as is, or may be exposed to an automated microfluidic process that maximizes the cfDNA extraction yield. The latter is referred to herein as the processed plasma sample.

[0265] The crude plasma sample or a processed plasma sample is introduced into the flow cell channel including the architecture of Fig. 2E. The sample is introduced with the tagmentation buffer described herein, and is brought to a suitable tagmentation temperature. Tagmentation of the cfDNA takes place as described herein to form partially adapted cfDNA fragments.

[0266] The transposase enzymes 12A, 12B, or 12A, 12C, or 12H may then be removed using any of the techniques described herein.

[0267] When the transposome complexes 10A, 10B, or 10A, 10C are used, the method then includes initiating an extension reaction using the extension mix described herein. This generates fully adapted cfDNA fragments. The fully adapted fragments can be dehybridized from one another.

[0268] Because the flow cell architecture of Fig. 2E does not include the primers 34, 36, a cleaving agent for one of the two types of fully adapted cfDNA fragments that are generated may be introduced into the flow channel 46. The cleaving agent that is used will depend upon the cleavage site 40A, 40B or 40A, 40C of the transposome complexes 10A, 10B, or 10A, 10C and the desired fully adapted cfDNA fragments that are to be cleaved. As examples, uracil can be cleaved by Uracil-DNA glycosylase (UDG), inosine can be cleaved by Endonuclease IV (Endo IV) or Endonuclease V (Endo V), 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent.

[0269] The cleaved fully adapted cfDNA fragments can then be transported to another flow channel 46 that includes the amplification chemistry. Amplification of the cleaved and transported fully adapted cfDNA fragments can take place using the primers 34, 36 as described herein. Amplification can be followed by sequencing.

[0270] When the transposome complexes 10H are used, the method then includes initiating gap-fill ligation to attach the partially adapted cfDNA fragments to the non-transferred strands 18H. Gap-fill ligation may be performed with any suitable gap-fill ligation enzyme (e.g., tTaq608 polymerase, T7 exo minus polymerase, etc.) and any suitable ligase (e.g., E.coli DNA ligase, T4 DNA ligase, etc.), in combination with a solution of nucleotides. Gap-fill ligation may take place at a temperature ranging from about 37°C to about 50°C for about 5 minutes. The resulting fully adapted cfDNA fragments are attached across the depression 48’.

[0271] The fully adapted cfDNA fragments are first dehybridized from one another, and then a cleaving agent for fully adapted cfDNA fragments may be introduced into the flow channel 46. The cleaving agent that is used will depend upon the cleavage site 40H of the transposome complexes 10H. The cleaved fully adapted cfDNA fragments can then be transported to another flow channel 46 that includes the amplification chemistry (e.g., primers 34, 36). Amplification of the cleaved and transported fully adapted cfDNA fragments can take place using the primers 34, 36 as described herein. Amplification can be followed by sequencing.

[0272] Method using Transposome Complexes Dimers 102 and the Flow Cell Architecture of Fig. 7

[0273] A method for using the flow cell 32’ shown in Fig. 7 includes introducing a DNA sample into the flow cell 32’ with a tagmentation buffer, thereby tagmenting the DNA sample and forming partially adapted DNA fragments; initiating gap-fill ligation to generate fully adapted DNA fragments from the partially adapted DNA fragments; releasing the fully adapted DNA fragments from the lid 108; initiating hybridization of the fully adapted DNA fragments to the primer set 34, 36; and initiating amplification of the fully adapted DNA fragments.

[0274] The DNA sample is introduced into the flow cell 32’, where it will be tagmented by the transposome complexes 10H in the depressions 48’. The sample is introduced with the tagmentation buffer described herein, and is brought to a suitable tagmentation temperature. Tagmentation of the DNA sample takes place as described herein to form partially adapted DNA fragments.

[0275] The transposase enzymes 12H may then be removed using any of the techniques described herein. Gap-fill ligation is

[0276] then performed as described herein to generate the fully adapted DNA fragments attached within and / or across the depression 48’.

[0277] The fully adapted DNA fragments are dehybridized from one another and a cleaving agent is introduced into the flow channel 46’. The cleaving agent that is used will depend upon the cleavage site 40H of the transposome complexes 10H.The fully adapted DNA fragments can be transported into an empty flow channel of the flow cell 32’, where they can be washed.

[0278] The fully adapted DNA fragments are then reflowed into the flow channel 46’, where they can hybridize to the primers 34, 36 in the depressions 48, and be exposed to amplification and sequencing as described herein.

[0279] In this example, detection of the optical signals during sequencing may be performed optically or electronically.

[0280] Method using Transposome Complexes 10A and 101

[0281] The transposome complexes 10A, 101 may be included in a composition. The composition includes the first transposome complex 10A, which includes the first transferred strand 16A having a first amplification domain 26, a first non-transferred strand 18A, and a first transposase enzyme 12A non-covalently bound to the first transfer strand 16A and the first non-transferred strand 18A wherein the first transposome complex 10A is attached to a solid surface 116 via a 5’ end (e.g., 20A) of the first transferred strand 16A; and a second transposome complex 101 including a second transferred strand 161 having a second amplification domain 38, a second nontransferred strand 181, and a second transposase enzyme 121 non-covalently bound to the second transferred strand 161 and second non-transferred strand 181, wherein the second transposome complex 101 is attached to a solid surface 116’ via an amino acid chain 126 present in a backbone of the second transposase enzyme 121.

[0282] Within the composition, the transposome complexes 10A, 101 may be attached to the same solid surface (116 = 116’) or to two different solid surfaces 116, 116’ (see Fig. 8A through Fig. 8C). When the same, the solid surface 116, 116’ may be a bead, a particle, or the same area of the substrate 50, 52 of the flow cell 32 (e.g.,interstitial regions 56). When different, the solid surfaces 116, 116’ may be different areas of the substrate 50, 52, e.g., interstitial regions 56 and depressions 48. While the transposome complexes 10A, 101 in Fig. 8A through Fig. 8C are shown attached to the solid surface 116, 116’, it is to be understood that the actual attachment of the transposome complexes 10A, 101 (through 20A and 126, respectively) may be to the transposome capture mechanism 57, to surface groups of the substrate 50, 52, and / or to the polymeric hydrogel 22 in accordance with examples described herein for the respective complexes 10A, 101.

[0283] The composition can also be part of a kit that includes amplification reagents, sequencing reagents, or both. In one specific example, the kit includes sequencing reagents for sequencing by synthesis.

[0284] An example of a method using the transposome complexes 10A, 101 is shown Fig. 8A through Fig. 80. This method generally includes obtaining the previously described composition, applying a lysed sample containing nucleic acid to the composition, tagmenting the nucleic acid (and forming partially adapted DNA fragments 120, 121 ), removing the transposase enzymes 12A, 121 from each of the transposome complexes 10A, 101, and performing an extension reaction to generate fully adapted DNA fragments 120’, 12T. The fully adapted DNA fragments 120’, 12T can then be amplified using surface bound amplification primers 34, 36.

[0285] The sample containing the nucleic acid (referred to as the “DNA sample”) is introduced into composition with any example of the tagmentation buffer set forth herein. Tagmentation, including fragmentation and attachment, as described herein, may take place at a temperature at or above 30°C. In one example, the tagmentation temperature may range from 30°C to about 55°C. In another example, the tagmentation temperature may range from 35°C to about 45°C.

[0286] With the introduction of the tagmentation buffer and the temperature brought to the tagmentation temperature, the DNA sample is fragmented and the 5’ ends of both strands 120, 121 of the duplex fragment are attached to respective 3’ ends of the transferred strands 16A, 161 of the transposome complexes 10A, 101. The 3’ ends of the strands 120, 121 are not attached to the 5’ ends of the non-transferredstrands 18A, 181. As such, a gap exists between the 3’ end of each the DNA fragment strands 120, 121 and the 5’ end of the non-transferred strand 181, 18A of the respective complexes 101, 10A. In one example, each gap is nine (9) base pairs long.

[0287] Fig. 8A depicts the bridge product of the tagmentation process.

[0288] Transposase enzyme 12A, 121 removal may be accomplished, for example, using sodium dodecyl sulfate (SDS), guanidine hydrochloride, or proteinase, or by heating the flow cell to about 60°C. When heat is used, some example methods involve introducing a washing solution to the composition (e.g., into the flow cell 32 including the immobilized complexes 10A, 101); and heating the composition, containing the washing solution, to about 60°C. Fig. 8B depicts the tagmentation products after the transposase enzyme 12A, 121 have been removed.

[0289] When SDS or another chaotropic detergent has been used for transposase enzyme 12A, 121 removal, the washing solution may be flushed through composition (e.g., through flow channel 46 of the flow cell 32) prior to initiating the extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0290] To initiate the extension reaction, an extension amplification mix is introduced to the composition (e.g., into the flow cell 32). An example of the extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and / or a co-solvent (e.g., glycerol, dimethylformamide, etc.). The ExAMP reagents available from Illumina Inc. are examples of suitable extension amplification mixes.

[0291] The composition may be at about 38°C when the extension amplification mix is introduced.

[0292] At the outset of the extension reaction, the non-transferred strands 18A, 181 are dehybridized. Additional sequences (adapters) are added to the 3’ ends of the partially adapted fragments 120, 121 by an extension reaction using the extension amplification mix. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the DNA fragments using therespective transferred strands 161, 16A as the template. As such, one DNA fragment 120 is extended along the transferred strand 161 of the transposome complex 101 to generate complementary sections of the sequencing primer sequence 281 and the amplification domain 38 attached to the DNA fragment 120; and the other DNA fragment 121 is extended along the transferred strand 16A of the transposome complex 10A to generate complementary sections of the sequences 28A, 26 attached to the other DNA fragment 121 . The sequences resulting from the extension reaction render the partially adapted fragments 120, 121 (i.e. , the tagmented fragments that have not been ligated, extended, etc.) fully adapted (with two orthogonal amplification domains, such as P5, P7’ or P5’, P7, and ready for further amplification and cluster generation. As shown in Fig. 8C, one of the fully adapted DNA strands 120’ is attached to the solid surface 116, 116’, and the other 12T is only attached via hybridization.

[0293] With the extension amplification mix, amplification takes place immediately upon the generation of the fully adapted fragments 120’, 12T. The fully adapted DNA sample strands 120’, 121 ’ are dehybridized from each other. Because the fully adapted strands 12T are not attached to the solid surface 116, 116’, they can be washed away. The complement ends of the fully adapted DNA strands 120’ (which are attached to the solid surface 116, 116’) hybridize to the respective complementary surface bound amplification primers 34, 36. The fully adapted DNA strands 120’ are copied from the hybridized primers 34, 36 by 3’ extension using a high-fidelity DNA polymerase. The original sample fragments 120’ are denatured, leaving the copies immobilized to the solid surface 116, 116’. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. For example, the copied templates loop over to hybridize to an adjacent, complementary primer 34, 36 and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers 34, 36 and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create denseclonal clusters of amplicons across the solid surface 116, 116’. Each cluster of double stranded bridges is denatured. This example of clustering is similar to kinetic exclusion amplification, and is one example of the amplification that may be performed. It is to be understood that other amplification techniques may be used.

[0294] Fig. 8C depicts the fully adapted DNA sample strands 120’, 12T of the central bridge (of Fig. 8B) after strand extension from the 3’ ends of the tagmented products 120, 121.

[0295] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0296] Method using Two Different Transposome Complexes 10J and 10J’

[0297] The transposome complexes 10J, 10J’ may be included in a composition, an example of which is shown in Fig. 9A. The composition includes a first transposome complex 10J including a first transferred strand 16J having a first amplification domain 26, a first non-transferred strand 18J, and a first transposase enzyme 12J non-covalently bound to the first transferred strand 16J and first nontransferred strand 18J and including a first amino acid chain 126J that is linked to a 3’ end of the first non-transferred strand 18J, wherein the first transposome complex 10J is attached to a solid surface 116 via a first amino acid chain 126J present in a backbone of the first transposase enzyme 12J; a second transposome complex 10J’ including a second transferred strand 16J’ having a second amplification domain 38, a second non-transferred strand 18J’, and a second transposase enzyme 12J’ non- covalently bound to the second transferred strand 16J’ and second non-transferred strand 18J’ and including a second amino acid chain 126J’ that is linked to a 3’ end of the second non-transferred strand 18J’, wherein the second transposome complex 10J’ is attached to a solid surface 116’ via a second amino acid chain 126J’ present in a backbone of the second transposase enzyme 121.

[0298] Within this composition, the transposome complexes 10J, 10J’ may be attached to the same solid surface (116 = 116’) or to two different solid surfaces 116, 116’ (see Fig. 9A through Fig. 9C). When the same, the solid surface 116, 116’ may be a bead, a particle, or the same area of the substrate 50, 52 of the flow cell 32 (e.g., interstitial regions 56). When different, the solid surfaces 116, 116’ may be different areas of the substrate 50, 52, e.g., interstitial regions 56 and depressions 48. While the transposome complexes 10J, 10J’ in Fig. 9A through Fig. 9C are shown attached to the solid surface 116, 116’, it is to be understood that the actual attachment of the transposome complexes 10J, 10J’ (through 126J, 126J’, respectively) may be to the transposome capture mechanism 57, to surface groups of the substrate 50, 52, and / or to the polymeric hydrogel 22 in accordance with examples described herein for the complexes 10J.

[0299] The composition can also be part of a kit that includes amplification reagents, sequencing reagents, or both. In one specific example, the kit includes sequencing reagents for sequencing by synthesis.

[0300] An example of a method using the transposome complexes 10J, 10J’ is shown Fig. 9A through Fig. 9C. This method generally includes obtaining the composition, applying a lysed sample containing nucleic acid (i.e. , the DNA sample) to the composition, tagmenting the nucleic acid (and forming partially adapted DNA fragments 120, 121 respectively attached to the first and second transferred strands 16J, 16J’), removing (in this example denaturing or clipping) at least a portion of the transposase enzymes 12J, 12J’ of the transposome complexes 10J, 10J’, and initiating extension of the first and second partially adapted fragments 120, 121 to respectively attach the first and second partially adapted fragments to the second and first nontransferred strands 18J, 18J’ and to the solid surface 116, 116’.

[0301] The example method described in reference to the figure 9 series utilizes the transposome complexes 10J, 10J’. Homodimers of these complexes 10J, 10J’ are shown in Fig. 9A attached to the solid surface 116, 116’. In this example, both of the transposomes 10J, 10J’, which are used to produce a clusterable and sequence-abletemplate, are attached to the solid surface 116, 116’. Thus, the non-transferred strands 18 J , 18J’ are attached to the solid surface 116, 116’.

[0302] The DNA sample is introduced to the composition (e.g., into the flow cell 32) with the tagmentation buffer as described herein. The temperature of the composition is brought to the tagmentation temperature, and the DNA sample is tagmented as described herein. As shown in Fig. 9B, the 5’ ends of both strands 120, 121 of the duplex fragment are attached to respective 3’ ends of the transferred strands 16J’, 16J of the transposome complexes 10J’, 10J. The 3’ ends of the strands 120, 121 are not attached to the 5’ ends of the non-transferred strands 18J, 18J’. As such, a gap exists between the 3’ end of each the DNA fragment strands 120, 121 and the 5’ end of the non-transferred strand 18J, 18J’ of the respective complexes 10J, 10J’. In one example, each gap is nine (9) base pairs long. Fig. 9B depicts the bridge product of the tagmentation process.

[0303] In this example method, the transposase enzymes 12J, 12J’ are denatured or clipped (e.g., via exposure to Proteinase K) so that at least a portion, e.g., the amino acid chain(s) 126J, 126J’ and the linkage 132J, 132J’ remain, thus keeping the non-transferred strands 18J, 18J’ attached to the solid surface 116, 116’. As shown in Fig. 9C, the DNA fragment strands 120, 121 are attached to the solid surface 116, 116’ through the hybridization of the transposon ends 14J, 14J’, and the attachment of the non-transferred strands 18J, 18J’ is through the linkage 132J, 132J’ to the amino acid chain(s) 126J, 126J’.

[0304] To initiate the extension reaction, an extension amplification mix is introduced into the composition (e.g., flow cell 32). Following addition of the extension amplification mix, the 3’ ends of the DNA fragment strands 120, 121 will be initially extended to the end, displacing the surface-anchored non-transferred strand 18J, 18J’, and generating fully adapted DNA strands 120’, 12T (not shown in Fig. 9A through Fig. 9C) that will hybridize to the respective surface bound amplification primers 34, 36, and amplify as described in reference to the figure 8 series. It is to be understood that in this example, both types of fully adapted DNA strands 120’, 12T will amplify.

[0305] In order to sequence one type of strand, the forward or reverse strands (e.g., 120’ or 12T) may be cleaved, leaving the other strands (e.g., 121’ or 120’) for sequencing. The cleaving agent that is used will depend upon the cleavage site of the transposome complexes 10J, 10J’ and the desired fully adapted DNA fragments 120’ or 121 ’ that are to be cleaved. As examples, uracil can be cleaved by Uracil-DNA glycosylase (UDG), inosine can be cleaved by Endonuclease IV (Endo IV) or Endonuclease V (Endo V), 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent.

[0306] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0307] Methods using Two Different Transposome Complexes 101 and 101’ or 101 and 101”

[0308] The transposome complexes 101, 101’ (Fig. 10A) or 10l, 101” (Fig. 10D) may be included in a composition, such as a bead, particle, or flow cell. In one example, the transposome complexes 101, 101’ are included in a flow cell, which includes the substrate 50, 52; a first transposome complex 101 including a first transferred strand 161 having a first amplification domain 26, a first non-transferred strand 181 having a first anchoring point 128 at its 3’ end, and a first transposase enzyme 121 non-covalently bound to the first transfer strand 161 and the first nontransferred strand 181, wherein the first transposome complex 161 is attached to the substrate via an amino acid chain 1261 present in a backbone of the first transposase enzyme 121; and a second transposome complex 101’ including a second transferred strand 181’ having a second amplification domain 38, a second non-transferred strand 181’ having a second anchoring point 1261’ at its 3’ end and a second transposase enzyme 121’ non-covalently bound to the second transferred strand 161’ and second non-transferred strand 181’ wherein the second transposome complex 101’ is attachedto the substrate 50 or 52 via an amino acid chain 1261’ present in a backbone of the second transposase enzyme 121’; and a plurality of a capture moiety 130 attached to the substrate 50 or 52, wherein the capture moiety 130 is configured to attach to the first and second anchoring points 1281, 1281’.

[0309] It is to be understood that the actual attachment of the transposome complexes 101, 101’ (through 1261, 1261’, respectively) may be to the transposome capture mechanism 57, to surface groups of the substrate 50, 52, and / or to the polymeric hydrogel 22 in accordance with examples described herein for the complexes 101.

[0310] This example of the flow cell 32 can also be part of a kit that includes amplification reagents, sequencing reagents, or both. In one specific example, the kit includes sequencing reagents for sequencing by synthesis.

[0311] An example of a method for using the transposome complexes 101, 10I’ includes introducing a lysed sample containing nucleic acid (i.e. , the DNA sample) to the flow cell including the complexes 101, 101’ and the capture moieties 130; tagmenting the nucleic acid to form first and second partially adapted fragments 120, 121 ; removing the first and second transposase enzymes 121, 121’, whereby the first and second anchoring points 1281, 1281’ respectively attach to one of the plurality of capture moieties 130; and initiating extension of the first and second partially adapted fragments 120, 121 to respectively attach the first and second partially adapted fragments 120, 121 to the second and first non-transferred strands 181’, 181. The fully adapted DNA fragments 120’, 12T that are generated can then be amplified using surface bound amplification primers 34, 36.

[0312] Homodimers of the complexes 101, 101’ (with the anchoring points 1261, 1261’) are shown in Fig. 10A attached to the substrate 50 or 52. In this example, both of the transposomes 101, 101’, which are used to produce a clusterable and sequenceable template, are attached to the substrate 50 or 52 via the respective amino acid (peptide) chain 1261, 1261’ of the transposase enzyme 121, 121’ (which is the same in both complexes 101, 101’). Thus, the non-transferred strands 181, 181’ are not directly attached to the substrate 50 or 52.

[0313] The DNA sample is introduced into the flow cell 32 with the tagmentation buffer as described herein. The temperature of the flow cell 32 is brought to the tagmentation temperature, and the DNA sample is tagmented as described herein. As shown in Fig. 10B, the 5’ ends of both strands 120, 121 of the duplex fragment are attached to respective 3’ ends of the transferred strands 161’, 161 of the transposome complexes 101’, 101. The 3’ ends of the strands 120, 121 are not attached to the 5’ ends of the non-transferred strands 181, 181’. As such, a gap exists between the 3’ end of each the DNA fragment strands 120, 121 and the 5’ end of the non-transferred strand 181, 181’ of the respective complexes 101, 101’. In one example, each gap is nine (9) base pairs long. Fig. 10B depicts the bridge product of the tagmentation process.

[0314] Transposase 121, 121’ removal may be accomplished as described herein, following by washing. Upon removal of the transposase enzymes 121, 121’, the attachment points 1281, 1281’ of the respective non-transferred strands 181, 181’ are able to bind to the surface bound capture moieties 130, thus linking the tagmented, partially adapted DNA fragments 120, 121 to the substrate 50 or 52. This is shown in Fig. 10C.

[0315] To initiate the extension reaction, an extension amplification mix is introduced into the flow cell 32. Following addition of the extension amplification mix, the 3’ ends of the DNA fragment strands 120, 121 will be initially extended to the end, displacing the surface-anchored non-transferred strand 181, 181’, and generating fully adapted DNA strands 120’, 12T (not shown in Fig. 10A through Fig. 10C) that will hybridize to the respective surface bound amplification primers 34, 36, and amplify as described in reference to the figure 8 series. It is to be understood that in this example, both types of fully adapted DNA strands 120’, 121 ’ will amplify.

[0316] In order to sequence one type of strand, the forward or reverse strands (e.g., 120’ or 12T) may be cleaved, leaving the other strands (e g., 12T or 120’) for sequencing. The cleaving agent that is used will depend upon the cleavage site of the transposome complexes 101, 101’ and the desired fully adapted DNA fragments 120’ or 12T that are to be cleaved. As examples, uracil can be cleaved by Uracil-DNAglycosylase (UDG), inosine can be cleaved by Endonuclease IV (Endo IV) or Endonuclease V (Endo V), 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent.

[0317] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0318] The example shown in Fig. 10D through Fig. 101 depicts the transposome complexes 101, 101” as part of composition that includes the solid surface 116, 116’. The composition includes a solid surface 116, 116’; a first transposome complex 101 including a first transferred strand 161 having a first amplification domain 26, a first non-transferred strand 181, and a first transposase enzyme 121 non-covalently bound to the first transfer strand 161 and the first nontransferred strand 181, wherein the first transposome complex 101 is attached to the solid surface 116, 116’ via a first amino acid chain 1261 present in a backbone of the first transposase enzyme 121; and a second transposome complex 101” including a second transferred strand 161” having a second amplification domain 38, a second non-transferred strand 181”, a second transposase enzyme 121” non-covalently bound to the second transferred strand 161” and second non-transferred strand 181”, wherein the second transposome complex 101” is attached to the solid surface 116, 116’ via a second amino acid chain 1261” present in a backbone of the second transposase enzyme 121”, wherein the first and second amino acid chains 1261, 1261” have orthogonal removal chemistries.

[0319] Within the composition, the transposome complexes 101, 101” may be attached to the same solid surface (116 = 116’) or to two different solid surfaces 116, 116’ (see Fig. 10D through Fig. 101). When the same, the solid surface 116, 116’ may be a bead, a particle, or the same area of the substrate 50, 52 of the flow cell 32 (e.g., interstitial regions 56). When different, the solid surfaces 116, 116’ may be different areas of the substrate 50, 52, e.g., interstitial regions 56 and depressions 48. Whilethe transposome complexes 101, 101” in Fig. 10D through Fig. 101 are shown attached to the solid surface 116, 116’, it is to be understood that the actual attachment of the transposome complexes 101, 101” (through 1261 and 1261”, respectively) may be to the transposome capture mechanism 57, to surface groups of the substrate 50, 52, and / or to the polymeric hydrogel 22 in accordance with examples described herein for the respective complexes 101, 101”.

[0320] The composition can also be part of a kit that includes amplification reagents, sequencing reagents, or both. In one specific example, the kit includes sequencing reagents for sequencing by synthesis.

[0321] An example of a method for using the transposome complexes 101, 10I” includes introducing a lysed sample containing nucleic acid (i.e. , the DNA sample) to this example of the composition; tagmenting the nucleic acid to form first and second partially adapted fragments 121 , 120; removing the second transposase enzymes 121”, whereby the first and second partially adapted fragments 121 , 120 are free at their 3’ and 5’ ends, respectively; initiating extension of the first partially adapted fragments 121 to generate first fully adapted fragments 121 ’; and initiating a strand invasion reaction to anchor the first fully adapted fragments 12T to respective surface bound primers 34, 36. This example method further includes removing the first transposase enzymes 121, whereby the first fully adapted fragments 12T and the second partially adapted fragments 120 are free at their 5’ and 3’ ends, respectively; initiating extension of the second partially adapted fragments 120 to generate second fully adapted fragments 120’; and initiating a second strand invasion reaction to anchor the second fully adapted fragments 120’ to respective surface bound primers 36, 34. The fully adapted DNA fragments 120’, 12T can then be amplified using surface bound amplification primers 34, 36.

[0322] Homodimers of the complexes 101, 101” (without the anchoring point 1261, 1261”) are shown in Fig. 10D attached to the solid surface 116, 116’. In this example, the transposase enzymes 121, 121” are selected so that they are different, and so that one (e.g., enzyme 121”) can be preferentially removed while the other enzyme (e.g., enzyme 121) remains intact and attached. While the amino acid(peptide) chains 1261, 1261” of the respective enzymes 121, 121” attach the transposome complexes 101, 101” to the solid surface 116, 116’, the difference in the enzymes 121, 121” enables selective removal. An example of such a difference includes different peptide backbones that require exposure to different removal chemistries. For example, one peptide backbone may contain sequences or modifications that enable it to be cleaved by a peptidase that does not act on the other peptide backbone.

[0323] The DNA sample is introduced into the flow cell 32 with the tagmentation buffer as described herein. The temperature of the flow cell 32 is brought to the tagmentation temperature, and the DNA sample is tagmented as described herein. As shown in Fig. 10E, the 5’ ends of both strands 120, 121 of the duplex fragment are attached to respective 3’ ends of the transferred strands 161”, 161 of the transposome complexes 101”, 101. The 3’ ends of the strands 120, 121 are not attached to the 5’ ends of the non-transferred strands 181, 181”. As such, a gap exists between the 3’ end of each the DNA fragment strands 120, 121 and the 5’ end of the non-transferred strand 181, 181” of the respective complexes 101, 101”. In one example, each gap is nine (9) base pairs long. Fig. 10E depicts the bridge product of the tagmentation process.

[0324] The removal of one of the transposases 121” may be accomplished by introducing an agent to which the transposases 121” are susceptible, but that will not remove the transposases 12. This exposure is followed by washing to remove the transposases 121”. Fig. 10F depicts the outcome of the selective removal of one of the transposomes 121” following the tagmentation reaction.

[0325] The extension mix may then be introduced to extend the free 3’ end of the tagmented DNA fragment (i.e. , the 3’ end of the fragment 121 ) to form one fully adapted DNA fragment 12T of the duplex DNA fragment. The 3’ end of the fragment 120 is still complexed with the transposome 121, and thus is not extended. This is shown in Fig. 10G.

[0326] A strand invasion reaction is then initiated. In one example, this reaction involves a locked nucleic acid (LNA) surface primer 123, which initiates the strandinvasion reaction of the fully adapted DNA fragment 121 ’ (which includes a complementary sequence of the LNA primer 123). The LNA surface primer 123 may have a higher melting temperature, which limits the reaction to strand invasion (i.e. , extension and amplification are not performed). This invasion effectively captures the free end of the bridge from solution and anchors it to the surface. This is shown in Fig.IOH. Alternatively, the strand invasion reaction may be protein mediated.

[0327] The removal of the other of the transposases 121 may be accomplished by introducing another agent to which the transposases 121 are susceptible or by exposure to heat. This exposure is followed by washing to remove the transposases 121. Removal is then followed by the introduction of the extension amplification mix to initiate a second extension reaction to flush out the now free 3’ end of the tagmented product (i.e., the 3’ end of the fragment 120) to its end. Fig. 10H and Fig. 101 depict the outcome of the transposase enzyme 121 removal, and the extension to form the fully adapted DNA fragment 120’.

[0328] During the second extension and amplification reaction, as shown in Fig.IOI, the surface amplification primer 36 initiates a strand invasion reaction of the fully adapted DNA fragment 120’ (which includes a complementary sequence of the primer 36). This invasion effectively captures the free end of the bridge from solution and copies its strand. Amplification continues over the surface of the flow cell 32 so that one or both of the fully adapted DNA fragments 120’, 12T is / are amplified.

[0329] In order to sequence one type of strand, the forward or reverse strands (e.g., 120’ or 12T) may be cleaved, leaving the other strands (e.g., 12T or 120’) for sequencing. The cleaving agent that is used will depend upon the cleavage site of the transposome complexes 101, 101” and the desired fully adapted DNA fragments 120’ or 121 ’ that are to be cleaved. As examples, uracil can be cleaved by Uracil-DNA glycosylase (UDG), inosine can be cleaved by Endonuclease IV (Endo IV) or Endonuclease V (Endo V), 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent.

[0330] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0331] Methods Using an Alternate Flow Cell

[0332] Some examples disclosed herein generate clusterable and sequenceable templates using ligation-based biochemistry on a surface of the solid support. An example is shown and described in reference to Fig. 11 A through Fig. 11 D.

[0333] This example uses yet another example of the flow cell 32”. This flow cell 32” includes a substrate 50 or 52; a polymeric hydrogel 22 over a portion of the substrate 50 or 52; double stranded endonuclease enzymes 134 attached to the polymeric hydrogel 22; and a non-sequence specific capture moiety 136 attached to the polymeric hydrogel 22.

[0334] A method for using this example flow cell 32” includes introducing a lysed sample containing nucleic acid (DNA sample 138 shown in Fig. 11A) to the flow cell 32”, thereby capturing the nucleic acid 138 via the non-sequence specific capture moiety 136 and fragmenting the nucleic acid 138 via the double stranded endonuclease enzymes 134 into a plurality of immobilized fragments 140; adding adapters 142, 144 to each of the plurality of immobilized fragments 140; and amplifying the plurality of immobilized fragments 140.

[0335] In one example, the surface chemistry of the flow cell 32” of Fig. 11 A includes the polymeric hydrogel 22, double stranded endonuclease enzymes 134 that are capable of cutting dsDNA 138, and a non-sequence specific capture moiety 136 for the dsDNA 138. Both the double stranded endonuclease enzymes 134 and the non-sequence specific capture moiety 136 are immobilized (covalently or via another attachment chemistry) to the polymeric hydrogel 22 within the depressions 48 of a patterned substrate (as shown) or in a lane of a non-patterned substrate (not shown). In another example, the surface chemistry of the flow cell 32” includes the polymeric hydrogel 22 and a non-sequence specific capture moiety 136 for the dsDNA 138. Thedouble stranded endonuclease enzymes 134 that are capable of cutting dsDNA 138 are introduced separately in solution.

[0336] Examples of suitable endonucleases enzymes 134 include restriction enzymes or any of the fragmenting enzymes set forth herein. An example of a capture moiety 136 could be a catalytically inactive transposome.

[0337] Fig. 11 B depicts the addition of the non-fragmented intact DNA 138 to the flow cell 32” containing both the endonucleases enzymes 134 and the nonsequence specific capture moieties 136 immobilized at the surface. Contiguous sections of the DNA fragments will span nearby depressions 48. The DNA fragments attach to the surface of the flow cell 32” via the dsDNA capture moieties 136 and respectively interact with nearby endonucleases 134.

[0338] Alternatively, the non-fragmented intact DNA 138 may be added the flow cell 32” containing the non-sequence specific capture moieties 136 immobilized to the surface, without the immobilized endonucleases 134. Contiguous sections of the DNA fragments will become attached and span nearby depressions 48, but will not be cut until the endonucleases 134 are added to the flow cell 32” in solution. Once added and allowed to react for a predetermined time period, the endonucleases 134 in solution may be removed, and the fragmented DNA will remain attached to the flow cell surface via the dsDNA capture moieties 136.

[0339] Fig. 11 C depicts the outcome of the cleavage of the DNA 138 by the endonucleases 134 that are immobilized within the flow cell 32”. In these examples, the surface bound endonucleases 134 are inactivated or removed. Inactivation may be performed by removing a co-factor of the endonucleases 134 from the flow cell 32”. Removal of the surface bound endonucleases 134 may involve cleaving an anchor or denaturing a cleavage protein of the anchor that immobilizes the endonuclease 134 to the flow cell surface. Proteinase K may be used if the anchor does not include the target of the proteinase K.

[0340] Whether surface-immobilized or solution-based endonucleases 134 are used, the DNA 138 is cleaved into fragments 140 that remain attached to the polymeric hydrogel 22 in the flow cell depressions 48 via the non-sequence specificcapture moieties 136. It will be appreciated that nearby depressions 48 will likely contain fragments 140 that have originated from the same initial intact dsDNA molecule 138. In other words, there is a proximity correlation between depressions 48 and the genomic location of the clusters that arise from within nearby depressions 48.

[0341] Fig. 11 D depicts one example of a process to append adaptors 142, 144 (e.g., including sequences similar to the amplification domains 26, 38 described herein, such as P5 and P7) to the ends of the dsDNA fragments 140 within a depression 48. This process is similar to methods used to generate sequencing libraries via ligation chemistries in solution-based library preparation protocols, such as end-repair, A-tailing, or ligation. The adapter-containing templates may then be amplified to form clusters using clustering methods described herein (e.g., as described in reference to the figure 8 series).

[0342] Method using Surface Bound Splint Adapters

[0343] Still another example of the flow cell 32”’ is shown in Fig. 12A and is used in the method that is partially depicted in Fig. 12A and Fig. 12B. This example method uses homodimers of the transposome complex 10K shown in Fig. 1 K.

[0344] The flow cell 32”’ may be patterned with depressions 48 (as shown), or may include a lane 54. The polymeric hydrogel 22 is positioned within the depressions 48 or the lane 54, and splint adapters 146, 148 are immobilized to the polymeric hydrogel 22 or to the interstitial regions 56 in accordance with the attachment mechanisms described herein. The splint adapters 146, 148 respectively include a portion 150, 152 that is immobilized to the polymeric hydrogel 22 and a splint portion 154, 156 that is hybridized to the 3’ end of the portion 150, 152. The portions 150, 152 may be any of the sequences sets forth herein for the primers 34, 36. These portions 150, 152 will be ligated to the tagmented sample, and thus will add the adapters to the DNA fragments. The splint portion 154, 156 is the reverse complement to the 5’ end of the transferred strands 16K. Thus, the splint portion 154, 156 creates an overhang than can hybridize to the 5’ end of the transferred strands 16K for splint ligation. The splint adapters 146, 148 can be attached to the polymeric hydrogel 22 or the surfacegroups of the substrate 50 or 52 using any of the attachment mechanisms set forth herein.

[0345] A method utilizing the flow cell 32”’ and the transposome complex 10K includes performing solution-based tagmentation of a DNA sample with indexed transposome complexes 10K to generate a bound complex 158, wherein the transposome complexes 10K include a 5’ phosphorylated transferred strand 16K; inactivating transposase enzymes 12K of the bound complex 158; introducing the bound complex 158 with the inactivated transposase enzymes to a flow cell 32’” including a plurality of splint adapters 1 6, 148 attached thereto at a condition to initiate splint adapter ligation, whereby a first of the plurality of splint adapters 146 anneals to ligate a first amplification domain (portion 150) to some of the 5’ phosphorylated transferred strands 16K and a second of the plurality of splint adapters 148 anneals to ligate a second amplification domain (portion 152) to some other of the 5’ phosphorylated transferred strands 16K, thereby forming partially adapted strands; removing the inactive transposase enzymes of the indexed transposome complexes 10K; and initiating an extension reaction to form fully adapted strands from the partially adapted strands.

[0346] The solution-based tagmentation is performed by mixing a DNA sample with a transposome complex solution including homodimers of the transposome complex 10K. The transposome complex solution includes the transposome 10K in a liquid carrier in a concentration ranging from about 0.1 pM to about 1 pM. The liquid carrier may be water. A buffer and / or salt may be added to the liquid carrier. The buffer has a pH ranging from 5 to 12. To this mixture, the tagmentation buffer is added, and the temperature of the solution is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tagmentation time may range from about 2 minutes to about 15 minutes.

[0347] Post tagmentation, the transposase enzymes 12K are not removed so the DNA sample fragments remain connected together by the transposome complexes 10K that are still in place along the double stranded DNA sample strand. The bound complex 158 is shown in Fig. 12B.

[0348] The solution-based tagmentation of several different DNA samples may be performed separately as long as the index sequences 152 of the transposome complexes 10K used for each sample are different. The different index sequences 152 enable the different DNA samples to be identified during sequencing.

[0349] Once all of the bound complexes 158, etc. are formed, they may be pooled together. After pooling, the transposase enzymes 12K may be deactivated. Deactivation may involve complexing the metal co-factor for the transposase (e.g., magnesium acetate) or careful temperature control. The introduction of EDTA can complex, and thus deactivate, the transposase enzymes 12K. Reducing the temperature can reduce the activity of the transposase enzymes 12K, thus at least partially deactivating the transposase enzymes 12K. Deactivation helps to ensure that surface bound splint adapters 146, 148 are not tagmented.

[0350] The pooled bound complexes 158, etc. can then be introduced into the flow cell 32”’. The bound complexes 158, etc. are allowed to incubate within the flow cell 32”’ at a hybridization / ligation temperature so that splint adapter ligation takes place between the splint adapters 146, 148 and respective transferred strands 16K, as shown in Fig. 12B. Splint adapter ligation forms partially adapted fragments because one amplification domain sequence (i.e., portion 150 or 152) is added to each transferred strands 16K.

[0351] One bound complex 158 attached within some of the depressions 48 of the flow cell 32’” is depicted in Fig. 12B. Because the DNA sample is held together post-tagmentation and the bound complex 158 is attached to depressions 48 that are close together, the spatial link between the fragments from the same DNA sample is maintained on the flow cell surface.

[0352] Once the bound complexes 158, etc. are attached, a wash may be performed with an example of the washing solution described herein in order to remove any unbound material. Then, the transposase enzymes 12K may be removed using one of the methods disclosed herein. The tagmented (partially adapted) DNA sample fragments (from the different samples) remain attached to the flow cell 32” through the ligated portions 150, 152.

[0353] An extension reaction may be initiated followed by amplification. To initiate the extension reaction, an extension amplification mix is introduced into the flow cell 32”’. Following addition of the extension amplification mix, the 3’ ends of the DNA fragment strands will be initially extended to the end, which displaces the nontransferred strands 18K, and fully adapted DNA strands will be generated through the extension process as described herein, that the fully adapted DNA strands will hybridize to the respective surface bound amplification primers 34, 36, and amplify as described in reference to the figure 8 series. It is to be understood that in this example, both types of fully adapted DNA strands will amplify.

[0354] Additional Notes

[0355] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.

[0356] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0357] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

What is claimed is:

1. A flow cell, comprising: a substrate including depressions separated by interstitial regions; a transposome capture mechanism attached over at least the interstitial regions, wherein the transposome capture mechanism i) is to bind to a transposome complex or ii) includes a free end group that is to bind to the transposome complex or iii) includes a protein that is to bind to the transposome complex; and a primer set attached in the depressions.

2. The flow cell as defined in claim 1 , further comprising: a first polymeric hydrogel positioned within the depressions, wherein the primer set is attached to the first polymeric hydrogel; and a second polymeric hydrogel deposited over the first polymeric hydrogel and the interstitial regions, and wherein: the transposome capture mechanism includes a plurality of probes, each of which includes the free end group; and each of the plurality of probes is covalently attached to the second polymeric hydrogel over the interstitial regions, over the depressions, or both over the interstitial regions and the depressions.

3. The flow cell as defined in claim 2, wherein the free end group is selected from the group consisting of biotin and streptavidin.

4. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism includes a plurality of probes, each of which includes an end group, a linker, and the free end group; and the plurality of probes is exclusively attached over the interstitial regions; the interstitial regions include surface silanol groups; the end group is silane; the linker is amino-poly(ethylene glycol); andthe free end group is selected from the group consisting of biotin and streptavidin.

5. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism includes a plurality of probes, each of which includes a linker and the free end group; the plurality of probes is exclusively attached over the interstitial regions; the interstitial regions include methyl tetrazine surface groups; and the linker is bicyclononyne; and the free end group is selected from the group consisting of biotin and streptavidin.

6. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism includes a plurality of probes, each of which includes a linker and the free end group; the plurality of probes is exclusively attached over the interstitial regions; the interstitial regions include surface carboxylic acid groups; and the linker is capable of amide formation, esterification, or thioesterification.

7. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism is streptavidin; the transposome capture mechanism is exclusively attached over the interstitial regions; and the interstitial regions include surface functional groups selected from the group consisting of carboxylic acid groups, silanol groups, amide groups, alcohol groups, amine groups, and combinations thereof.

8. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism includes an amino acid attached to the interstitial regions and streptavidin attached to the amino acid; andthe transposome capture mechanism is exclusively attached over the interstitial regions.

9. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism is a hydrophobic layer having a protein bound thereto; and the transposome capture mechanism is exclusively attached over the interstitial regions.

10. The flow cell as defined in claim 1 , wherein: the transposome capture mechanism includes a plurality of a protein; some of the plurality of the protein is non-covalently attached over the interstitial regions; the flow cell further comprises a polymeric hydrogel positioned within the depressions, wherein the primer set is attached to the polymeric hydrogel; and some other of the plurality of the protein is intermingled in the polymeric hydrogel.11 . The flow cell as defined in claim 1 , further comprising a transposome complex attached to the transposome capture mechanism through an amino acid side chain of its transposase enzyme.

12. A transposome complex, comprising: a transposon end including a portion of a transferred strand hybridized to a nontransferred strand; a first transposase enzyme non-covalently bound to the first transposon end; and an end group attached to a 5’ end of the transferred strand or a 3’ end of the non-transferred strand, wherein the end group is biotin-streptavidin or biotin attachedto a linker attached to a flow cell attachment group that is selected from the group consisting of silane, bicyclononyne, tetrazine, an amine, an alcohol, and a thiol.

13. A kit, comprising: a flow cell including: a substrate; and a primer set attached to at least a portion of the substrate, the primer set including a first primer having a first amplification domain sequence and a second primer having a second amplification domain sequence; a first transposome complex fluid including a plurality of first transposome complexes in a first liquid carrier, each of the first transposome complex including: a first transposon end including a first transferred strand hybridized to a portion of a first non-transferred strand, the first nontransferred strand including a first sequencing primer sequence attached to the portion and a complement of the first amplification domain sequence attached to the first sequencing primer sequence; and a first transposase enzyme non-covalently bound to the first transposon end; and a second transposome complex fluid including a plurality of second transposome complexes in a second liquid carrier, each second transposome complex including: a second transposon end including a second transferred strand hybridized to a portion of a second non-transferred strand, the second non-transferred strand including a second sequencing primer sequence attached to the portion and a complement of the second amplification domain sequence attached to the second sequencing primer sequence; and a second transposase enzyme non-covalently bound to the second transposon end.

14. The kit as defined in claim 13, wherein: the first transferred strand includes a first transposon end portion and a first sequencing primer sequence attached to the first transposon end portion; and the second transferred strand includes a second transposon end portion and a second sequencing primer sequence attached to the second transposon end portion.

15. A method for using the kit of claim 13, the method comprising: introducing the first and second transposome complex fluids to the flow cell, whereby the complements of the first amplification domain sequence and the second amplification domain sequence respectively hybridize to the first and second primers; introducing a DNA sample into the flow cell at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating gap-fill ligation to generate fully adapted fragments from each of the partially adapted fragments.

16. A kit, comprising: a flow cell including: a substrate; an amplification primer set attached to at least a portion of the substrate, the amplification primer set including a first primer having a first amplification domain sequence and a second primer having a second amplification domain sequence; and a capture primer set attached to at least a portion of the substrate, the capture primer set including a third primer having a first capture sequence and a fourth primer having a second capture sequence; a first transposome complex fluid including a plurality of first transposome complexes in a first liquid carrier, each of the plurality of first transposome complexes including:a first transposon end including a portion of a first transferred strand hybridized to a first non-transferred strand, the first transferred strand including a first sequencing primer sequence attached to the portion, a first amplification domain sequence attached to the first sequencing primer sequence, and a first capture sequence complement attached to the first amplification domain sequence; and a first transposase enzyme non-covalently bound to the first transposon end; and a second transposome complex fluid including a plurality of second transposome complexes in a second liquid carrier, each of the second transposome complexes including: a second transposon end including a portion of a second transferred strand hybridized to a second non-transferred strand, the second transferred strand including a second sequencing primer sequence attached to the portion, a second amplification domain sequence attached to the second sequencing primer sequence, and a second capture sequence complement attached to the second amplification domain sequence; and a second transposase enzyme non-covalently bound to the second transposon end.

17. A method for using the kit of claim 16, the method comprising: introducing the transposome complex fluid to the flow cell, whereby the first and second capture sequence complements respectively hybridize to the first and second capture sequences; introducing a DNA sample into the flow cell at a condition that initiates tagmentation of the DNA sample, thereby generating partially adapted DNA fragments; and initiating an extension reaction to generate fully adapted fragments from each of the partially adapted fragments.

18. A flow cell, comprising: a substrate including: a plurality of first depressions defined therein; and first interstitial regions separating each of the plurality of first depressions from one another; a primer set attached over each of the depressions; a complementary metal oxide semiconductor (CMOS) imaging device coupled to the substrate such that an optical detector of the CMOS imaging device is respectively aligned with each of the plurality of first depressions; and a lid attached to the substrate, the lid including: a plurality of second depressions defined therein; and second interstitial regions separating each of the plurality of second depressions from one another; a single transposome complex dimer immobilized in each of the plurality of second depressions, each of the single transposome complex dimers including two forked transposome complexes.

19. A method of using the flow cell of claim 18, comprising: introducing a DNA sample into the flow cell with a tagmentation buffer, thereby tagmenting the DNA sample and forming partially adapted DNA fragments; initiating gap-fill ligation to generate fully adapted DNA fragments from the partially adapted DNA fragments; releasing the fully adapted DNA fragments from the lid; initiating hybridization of the fully adapted DNA fragments to the primer set; initiating amplification of the fully adapted DNA fragments.

20. A flow cell, comprising: a substrate including: a plurality of depressions defined therein, each of the plurality of depressions being separated by a pitch ranging from about 30 nm to about 50 nm; and interstitial regions separating each of the plurality of depressions from one another; and a single transposome complex dimer immobilized in each of the plurality of depressions, each of the single transposome complex dimers including two forked transposome complexes.21 . A method of using the flow cell of claim 20, comprising: introducing a crude plasma sample or a processed plasma sample containing cell-free DNA (cfDNA) into the flow cell with a tagmentation buffer, thereby tagmenting at least some of the cfDNA and forming partially adapted cfDNA fragments; and initiating an extension reaction to generate fully adapted cfDNA fragments from the partially adapted cfDNA fragments.

22. A composition, comprising: a first transposome complex including: a first transferred strand having a first amplification domain; a first non-transferred strand; and a first transposase enzyme non-covalently bound to the first transfer strand and the first non-transferred strand; wherein the first transposome complex is attached to a solid surface via a 5’ end of the first transferred strand; and a second transposome complex including: a second transferred strand having a second amplification domain: a second non-transferred strand; anda second transposase enzyme non-covalently bound to the second transferred strand and second non-transferred strand; wherein the second transposome complex is attached to a solid surface via an amino acid chain present in a backbone of the second transposase enzyme.

23. The composition as defined in claim 22, wherein the solid surface is a bead, a particle, or a substrate of a flow cell.

24. The composition as defined in claim 23, wherein the flow cell is a patterned flow cell, or a non-patterned flow cell.

25. The composition as defined in any of claims 22 through 24, wherein the first transposome complex and second transposome complex are dimers.

26. The composition as defined in claim 25, wherein the dimers are homodimers.

27. The composition as defined in claim 25, wherein the dimers are heterodimers.

28. A kit comprising the composition of any of claims 22 through 27 and amplification reagents.

29. The kit as defined in claim 28, further comprising sequencing reagents.

30. The kit as defined in claim 29, wherein the sequencing reagents are for sequence by synthesis.31 . A method for preparing a nucleic acid for sequencing, comprising: obtaining the composition of claim 22; applying a lysed sample containing nucleic acid to the composition; tagmenting the nucleic acid; removing the first and second transposase enzymes; and amplifying the tagmented nucleic acid that is attached to the solid surface.

32. A composition, comprising: a first transposome complex including: a first transferred strand having a first amplification domain; a first non-transferred strand; and a first transposase enzyme non-covalently bound to the first transfer strand and the first non-transferred strand, and including a first amino acid chain that is linked to a 3’ end of the first non-transferred strand; wherein the first transposome complex is attached to a solid surface via the first amino acid chain; and a second transposome complex including: a second transferred strand having a second amplification domain: a second non-transferred strand; and a second transposase enzyme non-covalently bound to the second transferred strand and second non-transferred strand, and including a second amino acid chain that is linked to a 3’ end of the second non-transferred strand.

33. The composition as defined in claim 32, wherein the solid surface is a bead, a particle, or a substrate of a flow cell.

34. The composition as defined in claim 33, wherein the flow cell is a patterned flow cell, or a non-patterned flow cell.

35. The composition as defined in any of claims 32 through 34, wherein the first transposome complex and second transposome complex are dimers.

36. The composition as defined in claim 35, wherein the dimers are homodimers.

37. The composition as defined in claim 35, wherein the dimers are heterodimers.

38. A kit comprising the composition of any of claims 32 through 37 and amplification reagents.

39. The kit as defined in claim 38, further comprising sequencing reagents.

40. The kit as defined in claim 39, wherein the sequencing reagents are for sequence by synthesis.41 . A method for preparing a nucleic acid for sequencing, comprising: obtaining the composition of claim 32; applying a lysed sample containing nucleic acid to the composition; tagmenting the nucleic acid to generate first and second partially adapted fragments respectively attached to the first and second transferred strands; removing the first and second transposase enzymes used in the tagmenting; and initiating extension of the first and second partially adapted fragments to respectively attach the first and second partially adapted fragments to the second and first non-transferred strands and to the solid surface.

42. A flow cell, comprising: a substrate;a first transposome complex including: a first transferred strand having a first amplification domain; a first non-transferred strand having a first anchoring point at its 3’ end; and a first transposase enzyme non-covalently bound to the first transfer strand and the first non-transferred strand; wherein the first transposome complex is attached to the substrate via an amino acid chain present in a backbone of the first transposase enzyme; and a second transposome complex including: a second transferred strand having a second amplification domain; a second non-transferred strand having a second anchoring point at its 3’ end; and a second transposase enzyme non-covalently bound to the second transferred strand and second non-transferred strand; wherein the second transposome complex is attached to the substrate via an amino acid chain present in a backbone of the second transposase enzyme; and a plurality of a capture moiety attached to the substrate, wherein the capture moiety is configured to attach to the first and second anchoring points.

43. The flow cell as defined in claim 42, wherein the substrate includes depressions separated by interstitial regions.

44. The flow cell as defined in claim 42, wherein the substrate includes a lane.

45. The flow cell as defined in any of claims 42 through 44, wherein the first transposome complex and second transposome complex are dimers.

46. A kit comprising the flow cell of any of claims 42 through 45 and amplification reagents.

47. The kit as defined in claim 46, further comprising sequencing reagents.

48. The kit as defined in claim 47, wherein the sequencing reagents are for sequence by synthesis.

49. A method for preparing a nucleic acid for sequencing, comprising: introducing a lysed sample containing nucleic acid to the flow cell of claim 42; tagmenting the nucleic acid to form first and second partially adapted fragments; removing the first and second transposase enzymes, whereby the first and second anchoring points respectively attach to one of the plurality of capture moieties; and initiating extension of the first and second partially adapted fragments to respectively attach the first and second partially adapted fragments to the second and first non-transferred strands.

50. A composition, comprising: a solid surface; a first transposome complex including: a first transferred strand having a first amplification domain; a first non-transferred strand; and a first transposase enzyme non-covalently bound to the first transfer strand and the first non-transferred strand; wherein the first transposome complex is attached to the solid surface via a first amino acid chain present in a backbone of the first transposase enzyme; and a second transposome complex including: a second transferred strand having a second amplification domain; a second non-transferred strand; anda second transposase enzyme non-covalently bound to the second transferred strand and second non-transferred strand; wherein the second transposome complex is attached to the solid surface via a second amino acid chain present in a backbone of the second transposase enzyme, wherein the first and second amino acid chains have orthogonal removal chemistries.

51. The composition as defined in claim 50, wherein the solid surface is a substrate including depressions separated by interstitial regions.

52. The composition as defined in claim 50, wherein the solid surface is a substrate including a lane.

53. The composition as defined in any of claims 50 through 52, wherein the first transposome complex and second transposome complex are dimers.

54. A kit comprising the composition of any of claims 50 through 53 and amplification reagents.

55. The kit as defined in claim 54, further comprising sequencing reagents.

56. The kit as defined in claim 55, wherein the sequencing reagents are for sequence by synthesis.

57. A method for preparing a nucleic acid for sequencing, comprising: introducing a lysed sample containing nucleic acid to the composition of claim50; tagmenting the nucleic acid to form first and second partially adapted fragments;removing the second transposase enzymes, whereby the first and second partially adapted fragments are free at their 3’ and 5’ ends, respectively; initiating extension of the first partially adapted fragments to generate first fully adapted fragments; and initiating a strand invasion reaction to anchor the first fully adapted fragments to respective surface bound primers.

58. The method as defined in claim 57, further comprising: removing the first transposase enzymes, whereby the first fully adapted fragments and the second partially adapted fragments are free at their 5’ and 3’ ends, respectively; initiating extension of the second partially adapted fragments to generate second fully adapted fragments; and initiating a second strand invasion reaction to anchor the second fully adapted fragments to respective surface bound primers.

59. A flow cell, comprising: a substrate; a polymeric hydrogel over a portion of the substrate; double stranded endonuclease enzymes attached to the polymeric hydrogel; and a non-sequence specific capture moiety attached to the polymeric hydrogel.

60. A method for preparing a nucleic acid for sequencing, comprising: introducing a lysed sample containing nucleic acid to the flow cell of claim 59, thereby capturing the nucleic acid via the non-sequence specific capture moiety and fragmenting the nucleic acid via the double stranded endonuclease enzymes into a plurality of immobilized fragments; adding adapters to each of the plurality of immobilized fragments; and amplifying the plurality of immobilized fragments.61 . A method for preparing a nucleic acid for sequencing, comprising: performing solution-based tagmentation of a DNA sample with indexed transposome complexes to generate a first bound complex, wherein the indexed transposome complexes include a 5’ phosphorylated transferred strand; inactivating transposase enzymes of the bound complex; introducing the bound complex with the inactivated transposase enzymes to a flow cell including a plurality of splint adapters attached thereto at a condition to initiate splint adapter ligation, whereby a first of the plurality of splint adapters anneals to ligate a first amplification domain to some of the 5’ phosphorylated transferred strands and a second of the plurality of splint adapters anneals to ligate a second amplification domain to some other of the 5’ phosphorylated transferred strands, thereby forming partially adapted strands; removing the inactive transposase enzymes of the indexed transposome complexes; and initiating an extension reaction to form fully adapted strands from the partially adapted strands.

Citation Information

Patent Citations

  • Polymerase enzymes and reagents for enhanced nucleic acid sequencing

    US20080108082A1

  • Transposon end compositions and methods for modifying nucleic acids

    US20100120098A1

  • Methods and apparatus for measuring analytes

    US20100137143A1

  • Modified Molecular Arrays

    US20110059865A1

  • Bioconjugation of macromolecules

    US6737236B1