Yeast cell wall extract for reducing / inhibiting the formation of dental biofilm
A β-glucan-rich yeast product from Saccharomyces cerevisiae cell walls inhibits pathogenic bacteria to prevent dental biofilm formation, addressing the need for maintaining oral health and preventing infectious diseases.
Patent Information
- Application Number
- PCT/EP2025/081795
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-08
- Filing Date
- 2025-11-04
- Publication Date
- 2026-05-15
AI Technical Summary
There is a need for a product that reduces and/or prevents the formation of dental biofilm caused by the growth of pathogenic bacteria, particularly in humans and pets, to maintain or restore the balance of oral microbiota and prevent infectious diseases such as dental caries and periodontal diseases.
A yeast product extracted from Saccharomyces cerevisiae yeast cell walls, rich in β-glucans, is used to reduce and/or prevent dental biofilm formation by inhibiting the growth of pathogenic bacteria like Leptotrichia, Tannerella forsythia, Porphyromonas gingivalis, and Peptostreptococcus canis.
The yeast product effectively reduces the macromolecular and bacterial density of dental biofilm, maintaining oral hygiene and health in humans and animals by inhibiting the growth of pathogenic bacteria involved in biofilm formation.
Abstract
Description
[0001] Yeast product used as a postbiotic in the field of oral hygiene and health
[0002] technical field
[0003] The present invention relates to the field of oral hygiene and health. The present invention relates to a product extracted from the cell walls of Saccharomyces cerevisiae yeast rich in p-glucans, or a composition comprising it, for use in reducing and / or preventing the formation of dental biofilm.
[0004] Technical background
[0005] In mammals, the oral cavity is a complex ecosystem, both open to the outside and the inside, inhabited by numerous microorganisms.
[0006] In humans, the oral cavity is home to more than 700 detected bacterial species (see, for example, the articles: Marsh et al., Penodontology 2000, 2011, 55, 16-35; Paster et al., Penodontology 2000, 2006, 42, 80-87; Aas et al., J. Clin. Microbiol., 2005, 43, 5721-5732; Dewhirst et al., J. Bacteriol., 2010, 192, 5002-5017). For example, in a single individual, the number of resident bacterial species varies from 150 to 250. Most of these species are commensal and necessary to maintain the balance of this ecosystem. However, in certain situations (for example, dietary habits, high carbohydrate intake, smoking, physiological changes such as aging, puberty, pregnancy), a disruption of this balance occurs and can lead to the development of infectious diseases of the oral cavity.
[0007] The main infectious diseases of the oral cavity in humans are dental caries and periodontal diseases.
[0008] Dental caries are polybacterial diseases characterized by the demineralization of the tooth's hard tissues. This demineralization is due to the production of acids by fermentative bacteria present within the dental biofilm. Streptococcus mutans and Lactobacillus are considered the main cariogenic bacteria. The World Health Organization (WHO) report on oral health highlights the high prevalence of caries, particularly among young people. Compared to the rest of the world, the risk of childhood caries is much higher in developed countries (North America, Australia, Europe, Japan) due to diets very high in sugar. Periodontal diseases are a group of pathologies affecting the periodontium, that is, the supporting tissues of the tooth—bone and gum tissue. These diseases are divided into two main categories: gingivitis and periodontitis.Gingivitis refers to any inflammation limited to the superficial periodontium. Periodontitis is an advanced infectious lesion of the periodontium and often follows gingivitis. The presence of certain bacteria and an intense immune response lead to the destruction of the periodontium. The transition from a healthy state to periodontal disease is accompanied by a gradual shift towards a flora richer in anaerobic and Gram-negative bacteria. This phenomenon is called anaerobic drift. Among the bacterial species most frequently implicated in periodontal diseases in humans are the red complex, composed of bacteria of the species Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. Also of note are bacteria of the species Fusobacterium nucleatum, whose co-aggregation with bacteria of the species Porphyromonas gingivalis appears to improve their survival and pathogenicity (see...).for example the articles: Diaz et al., Microbiology, 2002, 148, 467-472; Saito et al., FEMS Immunol. Med. Microbiol., 2008, 54, 349-355; Polak et al., J. Clin. Periodonto., 2009, 36, 406-410).
[0009] To prevent or treat infectious diseases of the oral cavity, it is helpful to maintain or restore the balance between non-pathogenic and pathogenic microorganism populations within the human oral microbiota. This balance allows for the control of dental biofilm formation, development, and composition. Many pathogenic bacteria can be present in the oral microbiota and can stimulate the formation, development, and composition of dental biofilm, potentially contributing to the development of infectious diseases of the human oral cavity.
[0010] For example, bacteria of the genus Leptotrichia promote the formation of dental biofilm and increase its density, which is undesirable. Leptotrichia bacteria are generally found in the filament-rich annular zone of dental biofilms, particularly in association with Fusobacterium and Capnocytophaga bacteria. Leptotrichia bacteria are therefore involved in the structuring of maturing dental biofilms. Colonization of the oral microbiota by Leptotrichia bacteria, and their growth within the dental biofilm, is thus likely to contribute to the onset and development of infectious diseases of the human oral cavity.
[0011] For example, bacteria of the species Tannerella forsythia, one of the three species of the red complex in humans, express numerous virulence factors that allow them to colonize the subgingival space, disrupt the host's defense system, invade and destroy periodontal tissues, and promote the host's destructive immunosuppressive response. Colonization of the oral microbiota by Tannerella forsythia bacteria and their growth in dental biofilm contribute to the emergence and development of infectious diseases of the human oral cavity.
[0012] For example, bacteria of the species Porphyromonas gingivalis, one of the three species of the red complex in humans, cause severe lesions in oral tissues and gums, leading to the destruction of the structure that supports the teeth. These lesions are caused by a cocktail of toxic proteins secreted by Porphyromonas gingivalis bacteria called gingipains. Gingipains have adhesin-like or protease-like activities that allow the bacteria to adhere to oral tissues and promote the invasion of gingival tissues by degrading the protective protein matrix. Colonization of the oral microbiota by Porphyromonas gingivalis bacteria, and their growth in the dental biofilm, contributes to the onset and development of infectious diseases of the human oral cavity.
[0013] In companion animals, particularly dogs and cats, the oral cavities are also complex ecosystems inhabited by numerous microorganisms (see, for example, the article: Holcombe et al., PlosOne, 2014, 9, 12, e113744). Most of these microorganisms are commensal and necessary to maintain the balance of this ecosystem. However, a disruption of this balance can occur and lead to the development of infectious diseases of the oral cavity.
[0014] The main infectious diseases of the oral cavity are periodontal diseases. Indeed, dental caries are very rare in dogs and cats. Among the bacterial species most frequently implicated in periodontal diseases in pets are Porphyromonas cangingivalis, Porphyromonas gulae, and Tannerella forsythia.
[0015] To prevent or treat infectious diseases of the oral cavity, it is helpful to maintain or restore the balance between non-pathogenic and pathogenic microorganism populations within the oral microbiota. This allows for the control of dental biofilm formation, development, and composition. Many pathogenic bacteria can be present in the canine or feline oral microbiota and can stimulate the formation, development, and composition of dental biofilm, potentially contributing to the development of infectious diseases of the oral cavity.
[0016] For example, bacteria of the species Peptostreptococcus canis express virulence factors that allow them to colonize the subgingival space. Colonization of the oral microbiota by Peptostreptococcus canis bacteria and their growth in dental biofilm contribute to the onset and development of infectious diseases of the oral cavity in companion animals.
[0017] For example, bacteria of the genus Porphyromonas express numerous virulence factors that allow them to colonize the subgingival space, disrupt the host's defense system, invade and destroy periodontal tissues, or promote the host's destructive immunosuppressive response. Colonization of the oral microbiota by Porphyromonas bacteria and their growth in dental biofilm contribute to the onset and development of infectious diseases of the oral cavity in companion animals.
[0018] Therefore, there is a real need, both in humans and in pets, particularly dogs and cats, for a product that reduces and / or prevents the formation of dental biofilm, avoiding the drawbacks mentioned above. There is also a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria. There is also a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Tannerella forsythia bacteria, and thus reduces or inhibits the growth of these bacteria, particularly in humans. Finally, there is a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Leptotrichia bacteria, and thus reduces or inhibits the growth of these bacteria, particularly in humans.There is also a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Porphyromonas gingivalis bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in humans. There is also a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Peptostreptococcus canis bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in pets. There is also a need for a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Porphyromonas bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in pets.
[0019] Summary of the invention
[0020] The invention relates to the non-therapeutic use of a yeast product, or a composition comprising it, in the reduction and / or prevention of the formation of dental biofilm; preferably the reduction and / or prevention of the formation of dental biofilm by growth of periodontogenic and / or cariogenic bacteria; said yeast product being an extract of cell walls of Saccharomyces cerevisiae yeast rich in p-glucans.
[0021] The invention also relates to a yeast product, or a composition comprising it, for therapeutic use in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria, said yeast product being a p-glucan-rich extract of Saccharomyces cerevisiae yeast cell walls.
[0022] In embodiments, the yeast product comprises at least 20% p-glucans, by weight per total weight of the product.
[0023] In some embodiments, the yeast product, or a composition comprising it, includes, by weight per total weight of the product:
[0024] - at least 20%, preferably between 20 and 30%, of p-glucans;
[0025] - at least 20%, preferably 20 to 30%, of mannans;
[0026] - 25% or less, preferably 10 to 25%, of protein; and
[0027] - 10% or less of glycogen.
[0028] In some embodiments, the yeast product, or a composition comprising it, includes, by weight per total weight of the product:
[0029] - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of p-glucans;
[0030] - 5% or less, preferably between 1 and 5%, of mannans;
[0031] - 10% or less protein; and
[0032] - 10% or less of glycogen.
[0033] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the species Tannerella forsythia.
[0034] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the genus Leptotrichia.
[0035] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the genus Porphyromonas, preferably bacteria of the species Porphyromonas gingivalis. In other embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the species Peptostreptococcus canis.
[0036] In some embodiments, the product is administered to a subject; preferably to a mammal; very preferably to a human, a dog or a cat.
[0037] In some embodiments (non-therapeutic use), the product is administered to a healthy subject.
[0038] In some embodiments, the product is administered to a subject orally.
[0039] In some embodiments (therapeutic use), the product is administered to a subject with a disease of the oral cavity, or at risk of having one.
[0040] In embodiments, the composition comprising the yeast product is selected from a food supplement, a parapharmaceutical composition or a pharmaceutical composition.
[0041] Surprisingly, the inventors found that using a yeast product extracted from the cell walls of Saccharomyces cerevisiae yeast, rich in p-glucans, has beneficial effects on oral hygiene and health, particularly in humans, cats, and / or dogs. Specifically, the inventors demonstrated that the yeast product reduces the macromolecular and bacterial density of dental biofilm. In addition, the yeast product has a beneficial effect on pathogenic bacteria colonizing the oral microbiota and involved in the formation and development of dental biofilm, in particular bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g. bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (e.g. bacteria of the species Porphyromonas gingivalis) and bacteria of the genus Peptostreptococcus (e.g. bacteria of the species Peptostreptococcus canis).The yeast product, or the composition comprising it, is particularly interesting in that it can be used in healthy subjects (non-therapeutic use) or in subjects with a disease of the oral cavity, or at risk of having one (therapeutic use), these two populations of subjects being distinct.
[0042] A more detailed description of the invention is given below.
[0043] Detailed description The invention is now described in more detail and in a non-limiting manner in the following description.
[0044] Definitions
[0045] By “Saccharomyces cerevisiae yeast strain”, we mean a relatively homogeneous population of Saccharomyces cerevisiae yeast cells obtained by culturing (or multiplying) the starting strain.
[0046] The term "oral microbiota" refers to all the microorganisms, particularly bacteria, present in the oral cavity. The terms "oral microbiota," "buccal microbiota," "human oral microbiota," "dog and cat oral microbiota," "oral cavity microbiota," "oral flora," and "oral flora" can be used interchangeably. The microorganisms present in the oral microbiota can be non-pathogenic or pathogenic. The balance between non-pathogenic and pathogenic microorganism populations therefore determines, from a clinical and biological perspective, whether the oral microbiota is healthy or not.Des microorganismes présent peuvent être, par exemple, les baccteria appartant au genre Actinomyces, Actinomycetemcomitans, Aggregatibacter, Alloprevotella, Alloscardovia, Anaeroglobus, Atopobium, Bacteroides Bifidobacterium, Capnocytophaga, Catonella, Corynebacterium, Dialister, Eggerthia, Eubacteria, Fusobacterium, Haemophilus, Lachnoanaerobaculum, Leptotrichia, Mogibacterium, Moryella, Neisseriaceae, Olsenella, Oribacterium, Parvimonas, Peptoniphilus, Peptostreptococcus, Propionibacterium, Porphyromonas, Prevotella, Rikenellaceae, Ruminococcaceae, Selenomonas, Shuttleworthia, Slackia, Solobacterium, Stomatobaculum, Streptococcus, Tannerella, Treponema ou Veillonella. Pathogenic microorganisms are for example: Tannerella forsythia (T. forsythia), Porphyromonas gingivalis (P. gingivalis), Treponema denticola (T. denticola), Porphyromonas cangingivalis (P. cangingivalis), Porphyromonas gulae (P. gulae), Porphyromonas endodontalis {P. endodontalis), Prevotella intermedia {P.intermedia), Streptococcus mutans (S. mutans) and Streptococcus sobrinus (S. sobrinus). Non-pathogenic microorganisms include, for example: Streptococcus oralis (S. oralis), and Streptococcus mitis (S. mitis).
[0047] The term "biofilm" refers to the film formed on the surface of teeth and oral mucosa, such as the mucosa of the tongue, gums, palate, and cheeks, by the oral microbiota. The terms "biofilm," "dental biofilm," "dental plaque," "polymicrobial biofilm," and "polymicrobial film" can be used interchangeably. The term "periodontium" refers to all the tissues supporting the teeth: the gums, bone, cementum, and periodontal ligament.
[0048] An "infectious disease of the oral cavity" is a medical condition located in the oral cavity (mouth) that results from infection by a pathogenic microorganism. Infectious diseases of the oral cavity include, but are not limited to, dental caries and periodontal disease.
[0049] By "dental caries" or "cavity", we mean an infectious disease of the tooth, which causes damage to the enamel, dentin and / or cementum (pulp).
[0050] By "periodontal health" we mean the absence of inflammation or the presence of a low level of inflammation in an intact or reduced but stable periodontium.
[0051] Periodontal disease refers to inflammation of the tissues supporting the teeth, namely the bone and gums. These infections are caused by the accumulation of pathogenic bacteria and their toxins on the gum line surrounding the teeth. It initially manifests as gingivitis and then, if left untreated, progresses to periodontitis. The terms "periodontal disease" and "periodontal disease" can be used interchangeably.
[0052] Gingivitis refers to inflammation of the gums, stage 1 of periodontal disease. The terms gingivitis, gum disease, and gum inflammation can be used interchangeably.
[0053] By "periodontitis" we mean the inflammation of the deep tissues of the periodontium, stage 2 of periodontal disease.
[0054] By "postbiotic" we mean a preparation of inanimate microorganisms and / or their components that confer a health benefit to the host.
[0055] The term "treatment" means a method intended to: (1) delay or prevent the onset of a disease or clinical condition; (2) slow or stop the progression, worsening, or deterioration of disease symptoms; (3) improve disease symptoms; and / or (4) cure the disease. A treatment may be administered before the onset of the disease, for prophylactic action (referred to as "prevention"), or it may be administered after the disease has begun, for therapeutic action. In the context of the invention, the term "treatment" generically refers to the reduction and / or prevention of dental biofilm formation, particularly through the growth of periodontogenic and / or cariogenic bacteria.
[0056] A "physiologically acceptable excipient" is defined as any medium or additive that does not interfere with the efficacy of the biological activity of the active ingredient and is not excessively toxic to the subject at the concentrations at which it is administered. A "pharmaceutical active ingredient" is defined as any compound or substance whose administration has a therapeutic effect or whose administration has a beneficial effect on the health or general condition of a subject to whom it is administered. Unless otherwise indicated, all percentages for stated quantities are mass percentages. For p-glucan percentages, these are expressed as an equivalent mass of glucose. For mannan percentages, these are expressed as an equivalent mass of mannose.
[0057] Yeast product
[0058] The yeast product is an extract of p-glucan-rich cell walls of Saccharomyces cerevisiae yeasts, preferentially rich in p-1,3 / p-1,6-glucans (p-1,3 / p-1,6-glucans).
[0059] By "rich in p-glucans" is meant a product comprising at least 20% p-glucans by weight of the total product weight. The yeast product may comprise from 20 to less than 30%, alternatively from 30 to less than 40%, alternatively from 40 to less than 50%, alternatively from 50 to less than 60%, alternatively from 60 to less than 70%, alternatively from 70 to less than 80%, alternatively from 80 to less than 90%, alternatively at least 90%, of p-glucans, by weight of the total product weight.
[0060] Yeast, as a living microorganism, comprises cytoplasm surrounded by a cytoplasmic membrane (also called the inner membrane or cell membrane). The cytoplasm contains intracellular compartments, including the nucleus, mitochondria, and Golgi apparatus. The cytoplasmic membrane is surrounded by a cell wall or cortex (the terms "yeast cell walls" and "yeast cortex" are used interchangeably and refer to the insoluble portion of yeast cells, i.e., the cell wall and the plasma membrane of yeast) composed primarily of p-glucans and mannans. The area between the cell membrane and the cell wall forms the periplasm (also called the periplasmic space).
[0061] Yeast products are obtained from the yeast Saccharomyces cerevisiae, and more specifically from a strain of Saccharomyces cerevisiae. Saccharomyces cerevisiae is also known as brewer's yeast or baker's yeast. Many strains of Saccharomyces cerevisiae are known to the art. They are widely used in the food industry for their role in the production of various foods, including breads and fermented beverages. A yeast strain can be obtained from a clone, a clone being a population of yeast cells derived from a single yeast cell. Culturing a strain of Saccharomyces cerevisiae can be carried out using any suitable method. Yeast culture methods are known in the prior art, and those skilled in the art know how to optimize the culture conditions for each strain according to its specific characteristics.Thus, a Saccharomyces cerevisiae yeast can be obtained by multiplying a strain in an appropriate culture medium, for example, as described in the reference work "Yeast Technology", 2. ème edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.
[0062] The p-glucans originating from the yeast cell wall are called "ft-cell wall glucans". These p-glucans are essentially glucose polymers in which the glucose units of the main chain are linked by p-1,3 bonds and whose branches are linked by p-1,6 bonds. p-glucans are insoluble and have low viscosity.
[0063] Mannans from yeast cell walls are called "cell wall mannans." These mannans are polysaccharides composed mainly of mannose, more precisely of copolymers of neutral or acidic sugars (with 5 or 6 carbon atoms), linked together by glycosidic bonds and associated with proteins. In Saccharomyces cerevisiae cell wall mannans, mannose is present as a skeleton of 50 or more mannose residues linked by α-(1,6) chains, branched by short chains of mannose linked by α-(1,2) and α-(1,3) chains.
[0064] In one embodiment, the yeast product may comprise, by weight per total weight of the product:
[0065] - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of p-glucans;
[0066] - 5% or less, preferably between 1 and 5%, of mannans;
[0067] - 10% or less protein; and
[0068] - 10% or less of glycogen.
[0069] This yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the product.
[0070] p-glucans and mannans can be present in a (weight / weight) ratio of 12 to 40, preferentially 15 to 30, very preferentially 18 to 22.
[0071] For example, a product of this type is disclosed in application WO 2023194609 A1 published on October 12, 2023.
[0072] In one embodiment, the yeast product may comprise, by weight per total weight of the product:
[0073] - at least 20%, preferably between 20 and 30%, of p-glucans; - at least 20%, preferably between 20 and 30%, of mannans;
[0074] - 25% or less, preferably 10 to 25%, of protein; and
[0075] - 10% or less of glycogen.
[0076] This yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the product.
[0077] For example, a product of this type is disclosed in international application WO 2020152229 A1 published on July 30, 2020.
[0078] The yeast product can be obtained from any process that yields a product rich in p-glucans.
[0079] Yeast product refers to the insoluble fraction of yeast. This insoluble fraction can be obtained using conventional methods. The method can be biochemical and / or mechanical. For example, mechanical methods can be implemented using glass beads, a high-pressure homogenizer, ultrasound, or microwaves. Biochemical methods, for instance, can be implemented through autolysis, thermal plasmolysis, enzymatic hydrolysis, osmotic shock, or repeated freeze-thaw cycles. Specifically, the process may include the following steps: autolysis or enzymatic hydrolysis of the whole yeast; separation of the insoluble fraction and removal of the soluble fraction; and optionally, drying of the soluble fraction.The soluble fraction is conventionally called "yeast extract" and comprises the majority of amino acids, including glutamic acid, peptides, and minerals. The insoluble fraction comprises yeast cell walls, polymers, polysaccharides, nucleotides, and thermocoagulated proteins. Conventional extraction methods are disclosed in the reference work "Yeast Technology," 2. ème edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.
[0080] Additional yeast products
[0081] The yeast product according to the invention can be used in combination with an additional yeast product.
[0082] The additional yeast product may be a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight per total weight of the additional yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash, 3% or less sodium chloride.
[0083] The additional yeast product may be a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight per total weight of the additional yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash, and 2% or less sodium chloride. Alternatively, the additional yeast product may be a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight per total weight of the additional yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash, and 1% or less sodium chloride.
[0084] The protein content was measured using the Kjedhl method (6.25 times the total nitrogen). The sodium chloride content was measured using the sodium chloride method. The pH was measured at room temperature (18°C) in a solution containing 8.33% dry matter.
[0085] The additional yeast product may be in powder form.
[0086] The additional yeast product may comprise at least 94%, preferably at least 96%, by weight of dry matter per total weight of yeast product. The yeast product may comprise 100% or less, preferably 99% or less, by weight of dry matter per total weight of additional yeast product. Alternatively, the additional yeast product may comprise 40% to 60% by weight of dry matter per total weight of additional yeast product. For example, the dry matter proportion may be measured by a drying method carried out for 5 hours at 105 °C.
[0087] The additional yeast product may be soluble. By "soluble" is meant a yeast product which can be homogeneously dissolved in water at a concentration of 50 g / L, under stirring and at a temperature of 50°C, the solution comprising less than 500 mg of solid residues i.e. undissolved.
[0088] The additional yeast product can be obtained by implementing a preparation process comprising the following steps:
[0089] - obtaining a yeast cream by fermentation followed by concentration by centrifugation;
[0090] - washing of the yeast cream obtained by adding water and centrifugal concentration;
[0091] - heating the washed yeast cream to a temperature between 60 and 95°C, preferably between 75 and 90°C;
[0092] - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours;
[0093] - separation of yeast extract and yeast cell walls by centrifugation;
[0094] - concentration of the yeast extract by evaporation and / or reverse osmosis; and
[0095] - Optionally, drying of the concentrated yeast extract. The additional yeast product is available under the trade name Springer® 4101 / 0-PW-L from Biospringer by Lesaffre (Lesaffre Group).
[0096] The Springer® 4101 / 0-PW-L yeast supplement is in powder form, has a pH between 6.3 and 6.7 (8.33% solution), comprises at least 94% by weight dry matter and includes less than 1% by weight sodium chloride, 7.5 to 9.0% by weight total nitrogen, 46.9 to 56.3% by weight protein (nitrogen x 6.25), and 18 to 22% by weight ash (excluding sodium chloride) by total product weight.
[0097] Uses
[0098] The present invention relates to the use of a yeast product as a postbiotic in the field of oral hygiene and health. The yeast product used is obtained from yeast, but is not a living microorganism, unlike probiotics.
[0099] The yeast product is used in the reduction and / or prevention of dental biofilm formation; preferentially the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria; very preferentially the reduction and / or prevention of dental biofilm formation by growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g. bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (e.g. bacteria of the species Porphyromonas gingivalis) and / or bacteria of the genus Peptostreptococcus (e.g. bacteria of the species Peptostreptococcus canis).As a corollary, the product is used for the maintenance and / or restoration of periodontal health; for the prevention and / or treatment of periodontal disease; and / or for the prevention and / or treatment of gingivitis, preferentially for the prevention and / or treatment of gingivitis induced by dental biofilm; and / or for the prevention and / or treatment of periodontitis, preferentially for the prevention and / or treatment of periodontitis induced by dental biofilm.
[0100] The use of the yeast product, including its therapeutic or non-therapeutic use, depends on the subject to whom it is administered.
[0101] If the individual is in good health, the yeast product may be administered to maintain their well-being, including maintaining satisfactory oral hygiene. This is a non-therapeutic use of the yeast product. The yeast product may be formulated as a food supplement, a parapharmaceutical composition, or any other suitable non-therapeutic form. If the individual has an infectious disease of the oral cavity, or is at risk of developing one, the yeast product may be administered to prevent, limit, or treat the disease. This is a therapeutic use of the yeast product. The yeast product may be formulated as a pharmaceutical composition or any other suitable therapeutic form.
[0102] The method according to the invention can be used to treat a first episode of infectious disease of the oral cavity, in particular gingivitis or periodontitis, or a recurrence.
[0103] The yeast product can be administered alone. Alternatively, the product can be administered with an additional yeast product as defined above. Alternatively, the yeast product can be administered with another therapy, for example, an antibiotic and / or an antiseptic. Alternatively, the yeast product can be administered with another prebiotic, probiotic, and / or postbiotic product. Alternatively, the yeast product can be administered in combination with a mechanical or surgical procedure, including scaling, root planing, curettage, filling, restoration, or root canal treatment.
[0104] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Leptotrichia in the oral microbiota.
[0105] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Tannerella, in particular bacteria of the species Tannerella forsythia, in the oral microbiota.
[0106] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Porphyromonas, in particular bacteria of the species Porphyromonas gingivalis, in the oral microbiota.
[0107] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the species Peptostreptococcus canis.
[0108] Topics
[0109] The yeast product may be administered to a subject. The subject may already have an infectious disease of the oral cavity, or be at risk of developing one. When the subject has such a disease, the term "patient" may be used interchangeably.
[0110] The yeast product can be administered to a human. This can be a human of any age, including newborns, children, adolescents, adults, and the elderly.
[0111] The yeast product can be administered to an animal, preferably a dog or cat. Effective quantity
[0112] Use in reducing and / or preventing dental biofilm formation (and the corresponding treatment and / or prevention method) involves administering an effective amount of the yeast product to the animal. The effective amount, which may be administered in one or more doses, can be determined by the physician, dentist, veterinarian, breeder, or any other appropriate person. The exact amount to be administered may vary from one animal to another, depending on the species, age, weight, general condition of the animal, the presence or absence of an infectious disease of the oral cavity, and if so, its nature, severity, and / or extent. The effective amount may also vary depending on the desired therapeutic effect (reduction and / or prevention of dental biofilm formation).
[0113] Form of administration
[0114] The yeast product can be administered as such or in the form of a preparation or composition.
[0115] The yeast product can be administered as a food supplement, for use in the reduction and / or prevention of dental biofilm formation; preferentially the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria; very preferentially the reduction and / or prevention of dental biofilm formation by growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (for example, bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (for example, bacteria of the species Porphyromonas gingivalis) and / or bacteria of the genus Peptostreptococcus (for example, bacteria of the species Peptostreptococcus canis).The food supplement may be in the form of a lozenge, a candy, a chewing gum, an orodispersible powder, a powder to be diluted in water in the form of a stick or sachet, a lozenge or chewable tablet, a chewing gum, a capsule, a tablet, a biscuit, a treat, a kibble, drops, a vial with a dosing cap or may be incorporated directly into food during its manufacture, especially pet food such as kibble.
[0116] The yeast product can be administered as a parapharmaceutical composition for use in reducing and / or preventing the formation of dental biofilm; preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria; most preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., Porphyromonas gingivalis), and bacteria of the genus Peptostreptococcus (e.g., Peptostreptococcus canis). The parapharmaceutical composition may be in the form of sachets, powders, capsules, softgels, dental pastes, gummies, or gels.
[0117] The yeast product can be administered as a pharmaceutical composition for use in reducing and / or preventing the formation of dental biofilm; preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria; most preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., Porphyromonas gingivalis), and / or bacteria of the genus Peptostreptococcus (e.g., Peptostreptococcus canis). The pharmaceutical composition may be available by prescription or over the counter.The pharmaceutical composition can be administered using any combination of dosage and route of administration effective in achieving the desired therapeutic or prophylactic effect. The effective amount to be administered may vary from one individual to another, depending on the species, age, weight, general condition of the individual, the presence or absence of an infectious disease of the oral cavity, and, if applicable, its nature, severity, and / or extent, etc.
[0118] The pharmaceutical composition may be intended for topical administration or oral administration.
[0119] The pharmaceutical composition may include a physiologically acceptable excipient. A physiologically acceptable excipient may be one suitable for administration to mammals, particularly humans.
[0120] The pharmaceutical composition may include at least one additional active pharmaceutical ingredient having soothing, anti-irritant, analgesic, pain-relieving, anti-inflammatory, healing, antibiotic, antipyretic or antifungal activity.
[0121] The pharmaceutical composition may include at least one additive, for example, an additive selected from the group consisting of preservatives, sweeteners, flavorings, thickening agents, colorings, humectants, disintegrating agents, absorption accelerators, lubricants, and mixtures thereof. The pharmaceutical composition may be in any form suitable for administration to a subject, preferably a mammal, most preferably a human, a dog, or a cat.
[0122] The pharmaceutical composition may be in the form of tablets, pills, dragees, capsules, pearls, syrups, emulsions, ointments, pastes, gels, powders, sachets or injectable solutions.
[0123] The yeast product, optionally in combination with an additional yeast product or the composition comprising it(s), can be administered by incorporation into a dental medical device, for use in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria; most preferably the reduction and / or prevention of dental biofilm formation by growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g. bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (e.g. bacteria of the species Porphyromonas gingivalis) and / or bacteria of the genus Peptostreptococcus (e.g. bacteria of the species Peptostreptococcus canis).A dental appliance can be a dental implant, a dental crown, a dental bridge, a dental onlay, or a dental prosthesis.
[0124] Examples
[0125] The following examples illustrate the invention without limiting it.
[0126] Example 1
[0127] Products tested
[0128] Product 1: product comprising 20 to 30% p-glucans, 20 to 30% mannans, 10 to 25% protein and 10% or less glycogen, by weight per total weight of product (Lynside® Prebiotic product, Gnosis by Lesaffre, Lesaffre group).
[0129] Product 2: product comprising 50 to 60% p-glucans, 1 and 5% mannans, 10% or less protein and 10% or less glycogen, by weight per total weight of product (Safglucan® product, Phileo by Lesaffre, Lesaffre group).
[0130] Study model
[0131] This in vitro model of a multi-species human biofilm involves collecting dental plaque from a healthy subject, culturing the sample under anaerobic conditions, and obtaining and maturing the biofilm on a solid substrate. This model allows for the evaluation of the dental biofilm's appearance, macromolecular density, bacterial density, composition, and short-chain fatty acid production.
[0132] Methodology
[0133] The tests are performed in triplicate. Dental plaque is collected from ten healthy subjects by brushing their teeth, followed by rinsing the mouth. The collected samples are immediately placed in an anaerobic environment. Culture media forming artificial saliva (modified McBain medium) are prepared extemporaneously and conditioned anaerobically. The culture media are supplemented with 7.5 g / L of product 1 or 2 (tests). These culture media are compared to an unsupplemented medium (negative control) and a medium supplemented with 1% sucrose (sucrose control). The supplemented media are cultured on twelve-well cell culture plates placed on a rotating platform under anaerobic conditions and at a temperature of 37°C. A glass coverslip is placed in each well to support the dental biofilm. The culture medium is replaced every three days.The final culture medium and the slides are harvested after nine days for analysis.
[0134] Analysis of dental biofilm density
[0135] Biofilms were quantified by crystal violet staining. After harvesting, the biofilms were fixed in 96% ethanol and stained with Crystal Violet (Pro-lab Diagnostics). The bound Crystal Violet was solubilized in 33% acetic acid. Optical density was measured at 580 nm on the BioTek Synergy Neo2 plate reader.
[0136] Results concerning the macromolecular density of dental biofilm
[0137] Exposure to products 1 and 2 showed a decrease in the optical density reading of the violet crystal.
[0138] Product 1 reduces the macromolecular density of dental biofilm by approximately 70% (7.5 g / L) compared to the negative control.
[0139] Product 2 reduces the macromolecular density of dental biofilm by approximately 60% (7.5 g / L) compared to the negative control.
[0140] Analysis of bacterial density in dental biofilm
[0141] Bacterial density was determined using a quantitative PCR method using the primers 5'-3' CGA AAG CGT GGG GAG CAA A, GTT CGT ACT CCC CAG GCG G and ATT AGA TAC CCT GGT AGT CCA (RT PCR master mix, Applied Biosystems 7500 RT PCR system, 45 cycles with a denaturation step at 95°C for 15 sec and an elongation step at 60°C for 1 min).
[0142] Results concerning the bacterial density of dental biofilm
[0143] Product 1 reduces the bacterial density of dental biofilm by approximately 45% (7.5 g / L) compared to the negative control. Product 2 reduces the bacterial density of dental biofilm by approximately 80% (7.5 g / L) compared to the negative control.
[0144] Analysis of the bacterial composition of the species Tannerella forsythia and results obtained
[0145] The Tannerella forsythia population was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method with 5'-3' primers:
[0146] - GACTGTCAGTTGCTAACAGGTAAAGCT (p192)
[0147] - CCAACCTTCCTCACAGCTACG (p193)
[0148] - ACTCTGGCGGGACTG (p194)
[0149] - (RT PCR master mix, Applied Biosystems 7500 RT PCR system, 45 cycles with a denaturation step at 95°C for 15 sec and a hybridization / elongation step at 60°C for 1 min).
[0150] Product 1 reduces the amount of Tannerella forsythia bacteria by approximately 2.2 Log (7.5 g / L) compared to the negative control.
[0151] Product 2 reduces the amount of Tannerella forsythia bacteria by approximately 1.7 Log % (7.5 g / L) compared to the negative control.
[0152] Analysis of the composition of bacteria of the genus Leptotrichia and results obtained
[0153] The composition of the biofilm was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method.
[0154] Product 1 reduces the relative abundance of Leptotrichia genus bacteria by approximately 70% (7.5 g / L) compared to the negative control.
[0155] Product 2 reduces the relative abundance of Leptotrichia genus bacteria by approximately 90% (7.5 g / L) compared to the negative control.
[0156] Analysis of the composition of bacteria of the genus Porphyromonas and results obtained
[0157] The composition of the biofilm was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method.
[0158] Product 1 reduces the relative abundance of Porphyromonas genus bacteria by approximately 100% (7.5 g / L) compared to the negative control.
[0159] Product 2 reduces the relative abundance of Porphyromonas genus bacteria by approximately 100% (7.5 g / L) compared to the negative control.
[0160] Conclusions
[0161] Products 1 and 2 tested significantly reduced the density of dental biofilm. Products 1 and 2 significantly reduced the growth of bacteria of the genus Leptotrichia, bacteria of the species Tannerella forsythia, and bacteria of the genus Porphyromonas.
[0162] Example 2
[0163] Products tested
[0164] Product 3: product comprising 20 to 30% p-glucans, 20 to 30% mannans, 10 to 25% protein and 10% or less glycogen, by weight per total weight of the product (Safmannan® product, Phileo by Lesaffre, Lesaffre group).
[0165] Product 4: product comprising 50 to 60% p-glucans, 1 and 5% mannans, 10% or less protein and 10% or less glycogen, by weight per total weight of product (Safglucan® product, Phileo by Lesaffre, Lesaffre group).
[0166] Study model
[0167] In vitro model of a polymicrobial biofilm comprising five different bacterial species mimicking a canine dental biofilm, namely Neisseria zoodegmatis CCUG 52598T, Corynebacterium canis CCUG 58627T, Porphyromonas cangingivalis DSMZ VPB 4874, Peptostreptococcus canis CCUG 57081 and an isolate of Enterococcus faecalis.
[0168] Analysis
[0169] The tests were performed in triplicate. A dental plaque biofilm was artificially created from five microorganisms described in the literature as being involved in periodontal disease: early colonizers of dental plaque such as Neisseria zoodegmatis and Corynebacterium canis, other anaerobic bacteria such as Peptostreptococcus canis and Porphyromonas cangingivalis, and Enterococcus faecalis, a species involved in the development of periodontal disease in dogs. A bacterial suspension of each strain was deposited into the wells of a 96-well microplate placed on a Calgary device. A lid with pegs, previously incubated for two hours in artificial canine saliva, was then added to the microplate. After incubation for 48 hours at 37°C under microaerophilic conditions, the biofilm formed on the surface of the pegs.After incubation, the pegs were washed three times in 0.9% NaCl and transferred to a new microplate supplemented with each product to be tested, at a concentration of 10 per product. The plate was then incubated for 24 h at 37 °C under microaerophilic conditions, after which the percentage of biofilm inhibition was determined by Crystal Violet staining (by determining optical density).
[0170] Results concerning the determination of biofilm density
[0171] Exposure to products 3 and 4 showed a concentration-dependent decrease in the optical density reading of crystal violet. Product 3 exhibited approximately 19.5% biofilm-inhibiting activity (125 g / L) compared to the negative control.
[0172] Product 4 exhibits approximately 13% (50 g / L) biofilm inhibitory activity compared to the negative control. Conclusions
[0173] Products 3 and 4 show potential for inhibiting canine biofilm.
Claims
DEMANDS 1. Non-therapeutic use of a yeast product, or a composition comprising it, in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria, said yeast product being a p-glucan-rich extract of Saccharomyces cerevisiae yeast cell walls.
2. Non-therapeutic use according to claim 1, the product comprising at least 20% p-glucans, by weight per total weight of the product.
3. Non-therapeutic use according to any one of the preceding claims, the product comprising, by weight per total weight of the product: - at least 20%, preferably between 20 and 30%, of p-glucans; - at least 20%, preferably 20 to 30%, of mannans; - 25% or less, preferably 10 to 25%, of protein; and - 10% or less of glycogen.
4. Non-therapeutic use according to any one of the preceding claims, the product comprising, by weight per total weight of the product: - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of p-glucans; - 5% or less, preferably between 1 and 5%, of mannans; - 10% or less protein; - and 10% or less of glycogen.
5. Non-therapeutic use according to any of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the species Tannerella forsythia.
6. Non-therapeutic use according to any of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the genus Leptotrichia.
7. Non-therapeutic use according to any of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the genus Porphyromonas, preferably bacteria of the species Porphyromonas gingivalis.
8. Non-therapeutic use according to any of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the species Peptostreptococcus canis.
9. Non-therapeutic use according to any of the preceding claims, the product being administered to a subject; preferably to a mammal; very preferably to a human, a dog or a cat.
10. Non-therapeutic use according to any of the preceding claims, the product being administered to a healthy subject.
11. Non-therapeutic use according to any of the preceding claims, the product being administered to a subject orally.
12. Non-therapeutic use according to any of the preceding claims, the composition comprising the yeast product being selected from a food supplement or a parapharmaceutical composition.
13. Yeast product, or a composition comprising it, for therapeutic use in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria, said yeast product being a p-glucan-rich extract of Saccharomyces cerevisiae yeast cell walls.
14. The yeast product, or a composition comprising it, for use according to claim 13, the product being administered to a subject having a disease of the oral cavity, or at risk of having one.
15. The composition comprising the yeast product, for use according to one of claims 13 or 14, the composition being a pharmaceutical composition.