Primer-probe combination for multiplex fluorescent PCR, and kit therefor

By designing primer-probe combinations for multiplex fluorescent PCR, the problems of primer interaction and cross-reaction in multiplex PCR technology have been solved, enabling simultaneous detection of syphilis and herpes simplex virus, improving diagnostic efficiency and accuracy, and making it suitable for screening high-risk populations and epidemiological studies.

WO2026108007A1PCT designated stage Publication Date: 2026-05-28SHANGHAI BEION MEDICAL TECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHANGHAI BEION MEDICAL TECH CO LTD
Filing Date
2025-02-27
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

Existing single-pathogen nucleic acid detection methods require independent swab collection, which leads to delays in the diagnosis of syphilis and herpes simplex virus. Furthermore, multiplex PCR technology suffers from primer interactions and cross-reactions, affecting the accuracy and efficiency of the test results.

Method used

A primer-probe combination for multiplex fluorescent PCR was designed, including specific primers and probe sequences, which can simultaneously detect Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2. Interactions are avoided by optimizing primer design, and the specificity and sensitivity of the detection are ensured by using fluorescent reporter and quencher groups.

Benefits of technology

It enables the simultaneous detection of multiple pathogens in a single experiment, improving diagnostic accuracy and efficiency, reducing sample requirements, lowering the false positive rate, and making it suitable for screening and rapid diagnosis of high-risk populations, while supporting epidemiological research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025079621_28052026_PF_FP_ABST
    Figure CN2025079621_28052026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are primers and probes for single-tube multiplex fluorescent PCR detection of Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2, a fluorescent PCR kit, and the use thereof. The primers comprise specific sequences for Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2, respectively, which sequences have no cross-reaction. The specific sequences of the primers and probes are as shown in SEQ ID NO:1 to SEQ ID NO:9. A plurality of sexually transmitted pathogens such as Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2 can be detected simultaneously.
Need to check novelty before this filing date? Find Prior Art

Description

A primer-probe combination and kit for multiplex fluorescent PCR Technical Field

[0001] This invention belongs to the field of molecular biological detection technology, specifically relating to a PCR-based single-tube multiplex rapid detection kit for herpes simplex virus 1, herpes simplex virus 2 and Treponema pallidum in samples and its uses. Background Technology

[0002] More than 340 million new cases of sexually transmitted diseases (STIs) are diagnosed globally each year. Treponema pallidum (TP), herpes simplex virus 1 (HSV-1), and herpes simplex virus 2 (HSV-2) are the main pathogens causing ulcers in the genital, perianal, and oropharyngeal regions. These genital ulcers not only directly impact the health of patients but also significantly increase the risk of human immunodeficiency virus (HIV) transmission. Therefore, accurately identifying the pathogens of these ulcers is crucial for reducing the risk of HIV infection. The diagnosis of syphilis mainly relies on clinical manifestations and serological testing methods, but their effectiveness is limited by factors such as the antibody response window period and reinfection. While traditional cell culture and serological testing are used for the diagnosis of herpes simplex virus, the development of polymerase chain reaction (PCR) technology in recent years has significantly improved the speed and sensitivity of pathogen diagnosis, making it possible to simultaneously detect multiple pathogens in a single sample.

[0003] Although PCR technology has been widely used in the diagnosis of HSV-2, the application of nucleic acid detection methods for syphilis in clinical practice remains relatively limited. Current single-pathogen nucleic acid detection typically requires separate swabs, and syphilis swab collection must be performed only in cases of high clinical suspicion, leading to delays in diagnosis and treatment. There is a need to develop a multiplex fluorescent PCR detection kit designed to simultaneously diagnose TP, HSV-1, and HSV-2 in different types of skin lesions, thereby overcoming many bottlenecks in the current diagnostic process and improving the accuracy and efficiency of clinical diagnosis.

[0004] While multiplex PCR technology can incorporate multiple target DNA / RNA sequences into a single PCR reaction system and simultaneously amplify multiple target genes in a single experiment, allowing for the detection of multiple pathogens and significantly reducing detection time and sample requirements, it places high demands on primer design. While ensuring amplification specificity, it is crucial to avoid interactions between multiple specific primers and the formation of primer dimers, which could negatively impact pathogen amplification and specific detection results. Summary of the Invention

[0005] In view of this, one objective of the present invention is to provide a primer-probe combination for multiplex fluorescent PCR. A second objective is to provide the application of this primer-probe combination in the preparation of reagents or kits for the simultaneous detection of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2. A third objective is to provide reagents or kits containing this primer-probe combination.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] 1. A primer-probe combination for multiplex fluorescent PCR, comprising: primers or combinations thereof; and / or probes or combinations thereof; (1) said primers or combinations thereof having any one of the following nucleotide sequences:

[0008] I. Possessing any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6;

[0009] Or II, a nucleotide sequence having the same function as the nucleotide sequences shown in any of SEQ ID No: 1 to SEQ ID No: 6, obtained by modification, substitution, deletion or addition of one or more bases;

[0010] Or III, a nucleotide sequence having at least 90% homology with any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6 and having the same function as any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6;

[0011] Or IV, complementary sequences to sequences shown in I, II, or III;

[0012] (2) The probe or combination thereof has any one of the following nucleotide sequences:

[0013] V. Having any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9;

[0014] Or VI. A nucleotide sequence having the same function as the nucleotide sequence having been modified, substituted, deleted or added to one or more bases by modifying, substituting, deleting or adding any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9;

[0015] Or VII, a nucleotide sequence having at least 90% homology with any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9 and having the same function as any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9;

[0016] Or complementary sequences of sequences such as VIII, V, VI, or VII.

[0017] Furthermore, in the probe or combination thereof, a fluorescent reporter group is attached to the 5' end of the probe sequence, and a fluorescent quencher group is attached to the 3' end.

[0018] Furthermore, the fluorescent reporter group is selected from FAM, VIC, Cy5, HEX, JOE, ROX, Texas Red, TAMRA, and Cy3.

[0019] Furthermore, the fluorescence quenching group includes those selected from BHQ-1, BHQ-2, BHQ-3, and MGB.

[0020] Furthermore, the primer-probe combination for the multiplex fluorescent PCR also includes specific primers and probes for human internal control genes.

[0021] Furthermore, the human internal standard gene is selected from G3PDH gene, Actin gene, GAPDH gene, β2 microglobulin gene, and Globin gene.

[0022] Furthermore, the human internal control gene is the G3PDH gene.

[0023] Furthermore, the forward primer sequence of the G3PDH gene is shown in SEQ ID NO:10, and the reverse primer sequence is shown in SEQ ID NO:11; the sequence of the G3PDH gene detection probe is shown in SEQ ID NO:12.

[0024] Technical solution two specifically refers to the application of the primer and probe combination of any of the above-mentioned multiplex fluorescent PCR in the preparation of reagents or kits for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

[0025] Technical solution three specifically refers to reagents or kits for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2, including primer-probe combinations as described in any of the above and acceptable auxiliaries.

[0026] In further reagents or kits, the concentration of each primer or probe is 0.1–1.0 μM.

[0027] Further reagents or kits may also include PCR reaction solution comprising: 5–15 U DNA polymerase, 0.1–5 U UDG enzyme, 0.1–0.3 mM dATP, 0.1–0.3 mM dGTP, 0.1–0.3 mM dCTP, 0.2–0.6 mM dUTP, 0.05%–2% v / v Tween 20, 1%–2% v / v glycerol, 10–100 mM tris(hydroxymethyl)methylglycine, and 1–8 mM magnesium chloride.

[0028] Furthermore, it also includes a nucleic acid releasing agent, which comprises 10–100 mM sodium hydroxide, 0.01%–2% w / v sodium dodecyl sulfonate, and 1%–8% v / v Tween 20.

[0029] Furthermore, it also includes positive and / or negative control samples; the positive control sample is a mixture of clonal plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2; the negative control sample is a reagent that does not contain clonal plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

[0030] The beneficial effects of this invention are as follows: By designing multiple specific primers for experimental verification, this invention ultimately provides a set of primer and probe sequences that can simultaneously detect multiple pathogens, including Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2, in a single experiment, achieving multiplex PCR in one step. This primer set avoids interactions and primer dimer formation, improving sensitivity and specificity, and is expected to play an important role in clinical practice, especially in the initial screening of high-risk populations and the rapid diagnosis of patients with related symptoms, thereby effectively reducing complications and the risk of transmission. When detecting Treponema pallidum and HSV, this primer and probe sequence set shows no cross-reactivity with common clinical pathogens such as Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, human cytomegalovirus, human papillomavirus 16, and human papillomavirus 18, and will not cause false positives.

[0031] Furthermore, this kit can be used in epidemiological studies to help public health departments understand the spread of syphilis and herpes and develop more effective prevention and control strategies. The small sample size required for testing improves the accuracy and efficiency of clinical diagnosis, enhances the overall health of patients, and has a profound impact on public health. Attached Figure Description

[0032] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0033] Figure 1 shows the amplification curve of the reference material for detecting Treponema pallidum using the kit of the present invention.

[0034] Figure 2 shows the amplification curve of the HSV-1 detection limit reference sample detected by the kit of the present invention.

[0035] Figure 3 shows the amplification curve of the HSV-2 detection limit reference sample detected by the kit of the present invention.

[0036] Figure 4 shows the Treponema pallidum amplification curve of the kit of the present invention in a specific experiment.

[0037] Figure 5 shows the HSV-1 amplification curve of the kit specificity experiment of the present invention.

[0038] Figure 6 shows the HSV-2 amplification curve of the kit specificity experiment of the present invention. Detailed Implementation

[0039] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings of the embodiments of the invention. Preferred embodiments of the invention are shown in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items. Experimental methods not specifically described in the embodiments are generally performed under conventional conditions or as recommended by the manufacturer.

[0041] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0042] Example 1

[0043] This invention provides primers and probes for multiplex detection of Treponema pallidum, herpes simplex virus 1 (HSV-1), and herpes simplex virus 2 (HSV-2). The primers include Treponema pallidum amplification primer pair 1 and corresponding detection probe 1, HSV-1 amplification primer pair 2 and corresponding detection probe 2, and HSV-2 amplification primer pair 3 and corresponding detection probe 3. Compared to other patents, such as the target described in CN 110157838A, which uses the UL27 gene and compares it using the EMBOSS Needle's Pairwise Sequence Alignment (PSA) system, the similarity between HSV-1 and HSV-2 reaches 89%. Therefore, during multiplex amplification, HSV-1 and HSV-2 may exhibit cross-reactivity, leading to false results. After multiple experiments, the target sequence of this invention was ultimately determined to be the UL42 gene, where the similarity between HSV-1 and HSV-2 sequences is only 75%, making it more suitable for HSV-1 and HSV-2 genotyping. Further comparison using the BLAST system provided by the National Center for Biotechnology Information (NCBI) showed that no other closely related species had sequences completely identical to those of each primer and probe designed in this invention. This result also demonstrates the high specificity of the primers and probes of this invention, and that the corresponding primer pairs and probes can only be used to amplify and detect the UL42 gene of HSV1 or HSV2. The sequences of the two primers for Treponema pallidum amplification primer pair 1 are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and the sequence of the corresponding detection probe 1 is shown in SEQ ID NO:7. The sequences of the two primers for Herpes simplex virus 1 amplification primer pair 2 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively, and the sequence of the corresponding detection probe 2 is shown in SEQ ID NO:8. The sequences of the two primers for Herpes simplex virus 2 amplification primer pair 3 are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively, and the sequence of the corresponding detection probe 3 is shown in SEQ ID NO:9. Each of the above detection probes is labeled with a fluorescent reporter group and a fluorescent quencher group at both ends, and the fluorescent reporter groups of different detection probes are different.

[0044] The fluorescent reporter groups include, but are not limited to: FAM, VIC, Cy5, HEX, JOE, ROX, Texas Red, TAMRA, Cy3, Cy5.5, and TET. The fluorescent quencher groups include, but are not limited to: BHQ-1, BHQ-2, BHQ-3, MGB, Eclipse, and Dabcyl.

[0045] Forward primer for Treponema pallidum, SEQ ID No: 1: CCTTTGCGCACGTCCCTTAT;

[0046] Reverse primer for Treponema pallidum, SEQ ID No: 2: GGTGCATGACAGCTTGGACA;

[0047] Treponema pallidum detection probe 1, SEQ ID No: 7: TCTGCTGTGCAGGATCCGGCA;

[0048] Herpes simplex virus 1 forward primer, SEQ ID No: 3: GAACCGCCGGGAACCAAG;

[0049] Herpes simplex virus 1 reverse primer, SEQ ID No: 4: TCTGGAGGTCGCGAAAGTAG;

[0050] Herpes simplex virus 1 detection probe 2, SEQ ID No: 8: CCGCCGCCTCGGGTCCGTAT;

[0051] Herpes simplex virus 2 forward primer, SEQ ID No: 5: GACCGACAGCCAGGACTC;

[0052] Herpes simplex virus 2 reverse primer, SEQ ID No: 6: TCGAGGCCTTCTTCTTCTGG,

[0053] Herpes simplex virus 2 detection probe 3, SEQ ID No: 9: CTCCTCCGAGCCGGACGCGG.

[0054] It is understood that in other embodiments, the fluorescent reporter groups labeled on each detection probe are not limited to those described above, as long as the fluorescent groups labeled at both ends can undergo fluorescence energy resonance transfer, and the fluorescent reporter groups labeled on the detection probes corresponding to different pathogens are different from each other.

[0055] Preferably, the concentrations of the forward and reverse primers for multi-target nucleotide amplification are 0.1–1.0 μM; and the concentration of the detection probe is 0.1–1.0 μM.

[0056] Example 2

[0057] The present invention also provides a kit for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2, which includes the primers and probes used for the above detection.

[0058] In one embodiment, the kit further includes a specific primer pair for amplifying a human internal control gene and a detection probe as a positive control. The sequences of the two primers in the positive control amplification primer pair are shown in SEQ ID No: 10 and SEQ ID No: 11, respectively, and the sequence of the corresponding detection probe is shown in SEQ ID No: 12. The detection probe for the positive control is also labeled with a fluorescent reporter group and a fluorescent quencher group at both ends, and the fluorescent reporter group is different from the fluorescent reporter group labeled on detection probes for other pathogens. The human internal control gene can be selected from: glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene, Actin gene, GAPDH gene, β2-microglobulin gene, Globin gene, etc. Selecting an internal control can monitor sample collection factors and avoid false negatives.

[0059] SEQ ID No: 10: CAGGGGGGAGCCAAAAGGGTC;

[0060] SEQ ID No: 11: CAGGAGGCATTGCTGA;

[0061] SEQ ID No: 12: CATGGGTGTGAACCATGAGA.

[0062] Preferably, the concentration of the primers used for amplifying the internal standard fragment is 0.1–1 μM; and the concentration of the detection probe for the internal standard is 0.1–1.0 μM.

[0063] Furthermore, in one embodiment, the kit includes positive controls: a plasmid containing a target fragment of Treponema pallidum, a plasmid containing a target fragment of herpes simplex virus 1, and a plasmid containing a target fragment of herpes simplex virus 2.

[0064] Preferably, the clonal plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2 can be mixed together in a specific concentration ratio to form a positive control.

[0065] Preferably, Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2 clone plasmids are mixed, and the concentration of each component is 1.00 to 5.00E+05 copies / ml.

[0066] Furthermore, the kit also includes a negative control, which can be, but is not limited to, substances such as sterile water.

[0067] Preferably, the negative control is sterile TE buffer.

[0068] The fluorescent PCR kit of the present invention further includes at least one of a nucleic acid release agent and a PCR reaction solution.

[0069] Preferably, the PCR reaction solution contains the following components at the following concentrations: 5–15 U DNA polymerase, 0.1–5 U UDG enzyme, 0.1–0.3 mM dATP, 0.1–0.3 mM dGTP, 0.1–0.3 mM dCTP, 0.2–0.6 mM dUTP, 0.05%–2% v / v Tween 20, 1%–2% v / v glycerol, 10–100 mM tris(hydroxymethyl)methylglycine (pH 8.3), and 1–8 mM magnesium chloride;

[0070] 0.1–1.0 μM Treponema pallidum forward primers and 0.1–1.0 μM Treponema pallidum reverse primers;

[0071] 0.1–1.0 μM herpes simplex virus 1 forward primer, 0.1–1.0 μM herpes simplex virus 1 reverse primer;

[0072] 0.1–1.0 μM herpes simplex virus 2 forward primer, 0.1–1.0 μM herpes simplex virus 2 reverse primer;

[0073] 0.1–1.0 μM human G3PDH gene forward primer, 0.1–1.0 μM human G3PDH gene reverse primer;

[0074] 0.1–1.0 μM Treponema pallidum probe, 0.1–1.0 μM Herpes simplex virus 1 probe, 0.1–1.0 μM Herpes simplex virus 2 probe, 0.1–1.0 μM Human G3PDH gene probe.

[0075] Preferably, the DNA polymerase is a hot-start Taq polymerase.

[0076] Example 3

[0077] This embodiment describes a method for detecting Treponema pallidum, herpes simplex virus type 1, or herpes simplex virus type 2 DNA nucleic acid in genital herpes fluid swab samples using the above-mentioned kit.

[0078] I. Reagent Preparation

[0079] Based on the number of samples to be tested, negative controls, and positive controls, take the corresponding amount of PCR reaction solution, aliquot it into reaction tubes, and centrifuge briefly before use.

[0080] II. Nucleic Acid Extraction from Samples

[0081] This step extracts DNA from Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2, as well as human G3PDH gene DNA from the sample, which is a genital herpes fluid swab sample. DNA extraction can be performed using a commercially available DNA extraction and purification kit. This invention also provides a nucleic acid release agent, which eliminates the need for DNA extraction; the sample can be directly added after simple treatment with the nucleic acid release agent.

[0082] After high-speed centrifugation and concentration, the sample is added with a nucleic acid release agent (the nucleic acid release agent includes 10-100mM sodium hydroxide, 0.01%-2% w / v sodium dodecyl sulfonate, and 1%-8% v / v Tween20).

[0083] The specific procedure is as follows: take 200-500 μl of the sample to be tested, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, add 100-200 μl of nucleic acid release agent, vortex to mix, let stand for 10 minutes, and then set aside.

[0084] III. Fluorescent PCR

[0085] 1. Take the PCR reaction tubes aliquoted in step 1, add 25 μL each of the extracted test sample and the negative / positive quality control nucleic acid product, cap the tubes (after removing air bubbles), and centrifuge for 10 seconds.

[0086] 2. PCR reaction system for centrifuged samples

[0087] Table 1

[0088]

[0089] The concentrations of the components in the PCR reaction solution are as follows: 10 U hot-start Taq enzyme, 1 U UDG enzyme, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dCTP, 0.4 mM dUTP, 0.05% Tween 20, 1% glycerol, 50 mM tris(hydroxymethyl)methylglycine (pH 8.3), and 4 mM magnesium chloride;

[0090] 0.3 μM Treponema pallidum forward primer, 0.3 μM Treponema pallidum reverse primer;

[0091] 0.5 μM herpes simplex virus 1 forward primer, 0.5 μM herpes simplex virus 1 reverse primer;

[0092] 0.5 μM herpes simplex virus 2 forward primer, 0.5 μM herpes simplex virus 2 reverse primer;

[0093] 0.3 μM human G3PDH gene forward primer, 0.3 μM human G3PDH gene reverse primer;

[0094] 0.15μM Treponema pallidum probe, 0.25μM Herpes simplex virus 1 probe, 0.25μM Herpes simplex virus 2 probe,

[0095] 0.15μM human G3PDH gene probe.

[0096] Place the PCR reaction tubes into the sample slots of the amplification instrument, and set the names of the samples to be tested and the concentrations of the positive reference standard in the corresponding order.

[0097] The fluorescent reporter group labeled on the detection probe 1 for Treponema pallidum is FAM, and the fluorescent quencher group is BHQ1; the fluorescent reporter group labeled on the detection probe 2 for herpes simplex virus 1 is VIC, and the fluorescent quencher group is BHQ1; the fluorescent reporter group labeled on the detection probe 3 for herpes simplex virus 2 is CY5, and the fluorescent quencher group is BHQ2.

[0098] The detection probe for the internal standard positive control is also labeled with a fluorescent reporter group of Texas Red and a fluorescent quencher group of BHQ2 at both ends.

[0099] 3. Fluorescence detection channel selection: Select the FAM channel to detect TP, select the VIC channel to detect HSV-1 target; select the CY5 channel to detect HSV-2 target; select the Texas Red channel to detect internal standard;

[0100] 4. The reaction conditions for fluorescent PCR are shown in Table 2:

[0101] Table 2: Fluorescent PCR reaction conditions:

[0102]

[0103] IV. Results Analysis

[0104] After the reaction, the instrument automatically saves the results, which can be automatically analyzed using the instrument's built-in software (or manually adjusted for baseline start, end, and threshold values). The Ct values ​​of each sample are then recorded. The intersection of the amplification curve and the threshold line is called the Ct value (cycle threshold, the number of cycles required for the fluorescence signal in the PCR reaction tube to reach the set threshold). The instrument software determines the detection results based on the Ct values ​​of each sample. Samples with a Ct value ≤ 38.00 are reported as positive; samples with a Ct value > 38 and a positive internal standard test (Ct value ≤ 40) are reported as below the detection limit; samples with no Ct value but a positive internal standard test (Ct value ≤ 40) are reported as negative. If the internal standard Ct value is > 40 or not displayed, the test result for that sample is invalid; the cause should be identified and eliminated, and the sample should be retested.

[0105] Example 4: Performance Study of the Reagent Kit of the Present Invention

[0106] 1. Sensitivity Experiment

[0107] Using the detection kit of this invention, the detection limit reference (the enterprise detection limit reference is a single reference, including 300 copies / ml of Treponema pallidum, 300 copies / ml of herpes simplex virus 1, and 300 copies / ml of herpes simplex virus 2 clone plasmid. This verifies that there is no cross-reaction between the three systems and also verifies the stability of the detection limit of the detection kit) was tested. The detection rate of the detection limit reference (300 copies / mL) was >95%. This kit detected 8 samples each of the enterprise working reference for TP, HSV-1, and HSV-2. Figure 1 shows the amplification curve of the detection limit reference for Treponema pallidum detected by the kit of this invention; Figure 2 shows the amplification curve of the detection limit reference for HSV-1 detected by the kit of this invention; Figure 3 shows the amplification curve of the detection limit reference for HSV-2 detected by the kit of this invention.

[0108] Conclusion: According to the test results, the kit of this invention can detect 8 cases each of the enterprise detection limits working reference samples of TP, HSV-1 and HSV-2. The amplification curves of all samples are standard "S"-shaped curves. Among them, all 8 cases of Treponema pallidum were detected within the detection limit, with a detection rate of 100%. Specifically, all 8 cases of HSV-1 were detected within the detection limit, with a detection rate of 100%; and all 8 cases of HSV-2 were detected within the detection limit, with a detection rate of 100%.

[0109] 2. Specificity test

[0110] Specificity experiments were conducted using the detection kit of this invention to detect Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), Human cytomegalovirus (HCMV), and Human papillomaviruses 16 and 18 (HPV-16 and HPV-18). Quality control samples were purchased from Guangzhou Bondsheng Biotechnology Co., Ltd. Amplification was performed using 10000 cps / mL of the above-mentioned pathogen quality control samples. The results showed that there was no cross-reactivity with Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), Human cytomegalovirus (HCMV), and Human papillomaviruses 16 and 18 (HPV-16 and HPV-18), and all detection results were negative.

[0111] The results are shown in Figures 4-6. Figure 4 shows the amplification curve of Treponema pallidum in the specific experiment of the kit of the present invention; Figure 5 shows the amplification curve of HSV-1 in the specific experiment of the kit of the present invention; and Figure 6 shows the amplification curve of HSV-2 in the specific experiment of the kit of the present invention.

[0112] Conclusion: The test results showed that common clinical pathogens such as Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), Human cytomegalovirus (HCMV), and Human papillomavirus 16 and 18 (HPV-16 and HPV-18) did not cross-react with Treponema pallidum and HSV, proving that this kit has high specificity.

[0113] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered as the scope of protection defined by the claims.

Claims

1. A primer probe combination for multiplex fluorescent PCR, characterized by, include: Primers or combinations thereof; and / or probes or combinations thereof; (1) the primers or combinations thereof have any one of the following nucleotide sequences: I. Possessing any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6; Or II, a nucleotide sequence having the same function as the nucleotide sequences shown in any of SEQ ID No: 1 to SEQ ID No: 6, obtained by modification, substitution, deletion or addition of one or more bases; Or III, a nucleotide sequence having at least 90% homology with any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6 and having the same function as any of the nucleotide sequences shown in SEQ ID No: 1 to SEQ ID No: 6; Or IV, complementary sequences to sequences shown in I, II, or III; (2) The probe or combination thereof has any one of the following nucleotide sequences: V. Having any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9; Or VI. A nucleotide sequence having the same function as the nucleotide sequence having been modified, substituted, deleted or added to one or more bases by modifying, substituting, deleting or adding any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9; Or VII, a nucleotide sequence having at least 90% homology with any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9 and having the same function as any of the nucleotide sequences shown in SEQ ID No: 7 to SEQ ID No: 9; Or complementary sequences of sequences such as VIII, V, VI, or VII.

2. The primer probe combination for multiplex fluorescent PCR according to claim 1, wherein, In the probe or combination thereof, a fluorescent reporter group is attached to the 5' end of the probe sequence, and a fluorescent quencher group is attached to the 3' end.

3. The primer probe combination for multiplex fluorescent PCR according to claim 1, wherein, It also includes specific primers and probes for human internal standard genes.

4. The primer probe combination for multiplex fluorescent PCR according to claim 1, wherein, The human internal standard gene is the G3PDH gene.

5. The use of the primer-probe combination of any one of claims 1-4 in the preparation of reagents or kits for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

6. A reagent or kit for detecting Treponema pallidum, Herpes simplex virus 1, Herpes simplex virus 2, characterized in that, Includes the primer-probe combination as described in any one of claims 1-4 and acceptable auxiliaries.

7. The reagent or kit according to claim 6, wherein The concentration of each primer or probe is 0.1–1.0 μM.

8. The reagent or kit according to claim 6, wherein It also includes a PCR reaction solution, which comprises: 5–15 U DNA polymerase, 0.1–5 U UDG enzyme, 0.1–0.3 mM dATP, 0.1–0.3 mM dGTP, 0.1–0.3 mM dCTP, 0.2–0.6 mM dUTP, 0.05%–2% Tween 20, 1%–2% glycerol, 10–100 mM tris(hydroxymethyl)methylglycine, and 1–8 mM magnesium chloride.

9. The reagent or kit of claim 6, wherein Also included are nucleic acid release agents comprising 10-100 mM sodium hydroxide, 0.01-2% w / v sodium dodecylsulfonate, 1-8% v / v Tween 20.

10. The reagent or kit of claim 6, wherein Also included are positive controls or / and negative controls; the positive control is a mixture of cloned plasmids of Treponema pallidum, Herpes simplex virus 1, Herpes simplex virus 2; the negative control is a reagent without cloned plasmids of Treponema pallidum, Herpes simplex virus 1, Herpes simplex virus 2.

Citation Information

Patent Citations

  • Detection marker, primer probe pair, kit and detection method for herpesvirus hominis I type and II type

    CN109487013A

  • Multiplex PCR primer group, kit and method for detecting sexually transmitted pathogens based on high-throughput sequencing

    CN112458195A

  • Kit for multiple nucleic acid detection of sexual transmission infection

    CN114250319A

  • Reaction system, method and kit for pathogenic microorganism detection

    CN114540522A

  • Nucleic acid detection kit for integrally and rapidly detecting pathogens of infectious diseases of central nervous system

    CN116855634A