Peptide having Anti-obesity and Anti-diabetes activities and uses thereof

Abstract

The present invention relates to a peptide having anti-obesity and anti-diabetes activities and uses thereof. The peptide of the present invention increases the expression of insulin genes and genes of PDX1 and GLP1R involved in insulin secretion, increases the secretion of insulin itself, and increases the expression levels of phospho-CREB and POMC factors associated with satiety signaling. In addition, the peptide of the present invention exhibits anti-obesity activity. Therefore, the peptide of the present invention can be used for treating, preventing, and alleviating obesity or diabetes, and can be advantageously used for lowering blood glucose levels of a person in need of blood glucose control.

Description

Peptides having anti-obesity and anti-diabetic activity and their uses

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority based on Korean Patent Application No. 10-2024-0165022 filed on November 19, 2024, and all contents disclosed in said Korean Patent Application are incorporated herein as part of this specification.

[0003] The present invention relates to a peptide having anti-obesity and anti-diabetic activity and the use thereof.

[0004]

[0005] Obesity refers to a condition in which there is an excessive presence of adipose tissue in the body, resulting from the accumulation of excess energy as body fat when the energy consumed through food is not balanced with its expenditure. According to the World Health Organization (WHO), over one billion adults worldwide are overweight, and at least 3 million of them are clinically obese; this trend is increasing significantly in the United States and Europe. Overweight and obesity raise blood pressure and cholesterol levels, acting as causes for various diseases such as heart disease, diabetes, and arthritis, and increasing the incidence of various adult diseases. Furthermore, overweight and obesity are contributing factors to the increased incidence of various adult diseases, such as arteriosclerosis, hypertension, hyperlipidemia, and heart disease, not only in adults but also in children and adolescents.

[0006] Currently, the representative obesity treatment drugs approved by the U.S. FDA and widely prescribed include a group of drugs that act on the central nervous system to function as appetite suppressants, and orlistat (Xenical), an inhibitor of lipase, a digestive enzyme secreted by the pancreas. Among central nervous system-acting drugs, approvals for many drugs, such as sibutramine, have been revoked due to cardiovascular and psychiatric side effects, and orlistat has limitations in that its efficacy varies depending on fat intake, along with various side effects. Meanwhile, as an endocrine peptide-targeted drug, liraglutide, a glucagon-like peptide-1 (GLP-1) receptor agonist, has been approved and is in use, but the risk of thyroid cancer is emerging.

[0007] Diabetes is a type of metabolic disease characterized by insufficient insulin secretion or impaired normal insulin function. It is distinguished by hyperglycemia, a rise in blood glucose levels, which leads to various symptoms and signs and the excretion of glucose in the urine. Recently, the incidence of diabetes has been increasing explosively due to the rise in obesity rates, particularly abdominal obesity. Diabetes can be broadly classified into Type 1 diabetes, which is insulin-dependent, and Type 2 diabetes, which is insulin-independent. Type 2 diabetes is characterized by hyperglycemia, insulin resistance, and relative insulin secretion impairment.

[0008] When food is consumed, glucose is absorbed from the food in the digestive tract, stimulating the secretion of insulin from the beta cells of the pancreas, and the secreted insulin promotes the absorption of glucose into the muscles. In addition, while insulin is partially involved in glucose absorption by the liver, it primarily inhibits glucose production in the liver. Insulin lowers blood glucose levels by inhibiting glucose production in the liver and promoting glucose absorption into peripheral tissues, including muscles.

[0009] Currently, methods used to control blood sugar include lifestyle modifications (dietary therapy, exercise therapy) and drug therapy. However, strict management and implementation of dietary therapy and exercise therapy are difficult, and their effectiveness is limited. Therefore, most diabetic patients rely on medications such as insulin, insulin secretagogues, insulin sensitivity enhancers, and hypoglycemic agents to control blood sugar, in addition to lifestyle modifications.

[0010]

[0011] The inventors of the present invention have made research efforts to find an active substance with improved efficacy and ensured safety for the treatment of obesity and diabetes. As a result, the present invention was completed by experimentally proving that a peptide having a novel amino acid sequence satisfies the above requirements and activity conditions.

[0012] Accordingly, the objective of the present invention is to provide a novel peptide having anti-obesity or anti-diabetic activity.

[0013] Another objective of the present invention is to provide a pharmaceutical composition or a food composition comprising a peptide having the activity described above.

[0014] Another objective of the present invention is to provide an anti-obesity or anti-diabetic composition comprising a peptide having the activity described above as an active ingredient.

[0015] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of obesity or diabetes comprising a peptide having the activity described above as an active ingredient.

[0016] Another objective of the present invention is to provide a functional food composition for the prevention or improvement of obesity or diabetes comprising a peptide having the activity described above as an active ingredient.

[0017]

[0018] In order to achieve the above purpose,

[0019] One aspect of the present invention provides a peptide comprising the amino acid sequence of SEQ ID NO. 1.

[0020] Another aspect of the present invention provides an anti-obesity or anti-diabetic composition comprising the peptide as an active ingredient.

[0021] Another aspect of the present invention provides a pharmaceutical composition comprising the peptide as an active ingredient.

[0022] Another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of obesity or diabetes comprising the peptide as an active ingredient.

[0023] Another aspect of the present invention provides a functional food composition comprising the peptide as an active ingredient.

[0024] Another aspect of the present invention provides a functional food composition for the prevention or improvement of obesity or diabetes comprising the peptide as an active ingredient.

[0025]

[0026] The present invention will be described in detail below.

[0027]

[0028] 1. Peptides and their activity

[0029] According to one aspect of the present invention, a peptide comprising the amino acid sequence disclosed in SEQ ID NO. 1 is provided.

[0030] [Sequence No. 1] : QHYRKTWIG

[0031] The term "peptide" in this specification refers to a linear molecule formed by amino acid residues being joined together by peptide bonds.

[0032] The peptide containing the amino acid sequence of SEQ ID NO. 1 of the present invention may be used without modification, but variants or fragments of amino acids having different sequences may be used by deletion, insertion, substitution, or a combination thereof of amino acid residues within a range that does not affect the original activity of the peptide, such as anti-obesity and anti-diabetic activity.

[0033] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0034] The peptide of the present invention comprises a peptide having a substantially identical amino acid sequence to the peptide having the amino acid sequence of SEQ ID NO. 1, a variant thereof, or an active fragment thereof. The substantially identical amino acid sequence means an amino acid sequence having at least 75%, e.g., at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% sequence identity with the amino acid sequence of SEQ ID NO. 1. Additionally, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence prepared for a specific purpose to increase half-life or peptide stability.

[0035] The peptide of the present invention may have N-terminal and / or C-terminal modifications induced to select a portion of the amino acid sequence and increase its activity. Through such N-terminal and / or C-terminal modifications, the stability of the peptide of the present invention can be significantly improved, for example, by increasing the half-life of the peptide upon in vivo administration. The term "stability" includes not only stability in vivo, which protects the peptide of the present invention from attack by protein-cleaving enzymes in vivo, but also storage stability (e.g., room temperature storage stability).

[0036] The above N-terminal modification may be a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) attached to the N-terminus of the peptide. The above C-terminal modification may be a protecting group such as a hydroxyl group (-OH), an amino group (-NH2), or a hydrazino group (-NHNH2) attached to the C-terminus of the peptide, but is not limited thereto.

[0037] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention belongs. For example, the peptide of the present invention can be prepared according to chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0038] The peptide of the present invention has anti-obesity activity.

[0039] The peptide of the present invention has the activity of increasing the level of mRNA expression of proteins involved in satiety signals or the secretion of proteins involved in satiety signals.

[0040] The above satiety signal may be a signal that suppresses appetite.

[0041] Specifically, the peptide of the present invention can increase the secretion of phospho-CREB (phosphorylated-Cyclic AMP Response Element-Binding Protein), which is involved in satiety signals, or the mRNA expression of POMC (pro-opiomelanocortin), which is involved in satiety signals.

[0042] The above phospho-CREB may be an activated CREB in which the Ser133 position of CREB is phosphorylated by protein kinase A (PKA) within the cell. The above phospho-CREB stimulates satiety neurons through the melanocortin 4 receptor (MC4R) of satiety neurons located in various parts of the central nervous system.

[0043] The above POMC neurons produce α-melanocyte-stimulating hormone (α-MSH), a neuropeptide that reduces appetite. The above α-MSH stimulates satiety neurons through melanocortin 4 receptors (MC4R) of satiety neurons located in various parts of the central nervous system, including the paraventricular nucleus (PVN).

[0044] The peptide of the present invention described above has such activity as described above, and thus can exhibit excellent efficacy in the treatment, prevention, or improvement of obesity.

[0045] The peptide of the present invention has antidiabetic activity.

[0046] The peptide of the present invention has activity that promotes the secretion of insulin or the expression of the insulin gene.

[0047] The peptide of the present invention has the activity of increasing the expression of genes involved in insulin secretion.

[0048] Specifically, the peptide of the present invention can increase the mRNA expression level of genes involved in promoting insulin secretion in pancreatic cells, such as Pancreatic duodenal homeobox 1 (Pdx1) or GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

[0049] The above-mentioned Pdx1 is expressed at high levels in β cells of the pancreatic islets and is a major transcription factor involved in the regulation of insulin gene expression.

[0050] The aforementioned GLP1R is found in pancreatic beta cells and brain neurons and is a factor involved in blood sugar regulation by promoting insulin secretion.

[0051] The peptide of the present invention has activity that binds to the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R). Therefore, the peptide of the present invention may be a GLP-1R agonist.

[0052] The peptide of the present invention acts as a GLP-1R agonist and can be used for the treatment, prevention, and improvement of diabetes and obesity.

[0053]

[0054] 2. Applications of the peptide of the present invention

[0055] According to another aspect of the present invention, an anti-obesity or anti-diabetic composition is provided that comprises a peptide having the amino acid sequence of SEQ ID NO. 1 as an active ingredient.

[0056] According to another aspect of the present invention, a pharmaceutical composition comprising a peptide having the amino acid sequence of SEQ ID NO. 1 is provided.

[0057] According to another aspect of the present invention, a pharmaceutical composition for the prevention or treatment of obesity or diabetes is provided, comprising a peptide having the amino acid sequence of SEQ ID NO. 1 as an active ingredient.

[0058] The peptide of the present invention has anti-obesity or anti-diabetic activity as described above.

[0059] In the present invention, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, it may be type 2 diabetes.

[0060] In the above pharmaceutical composition for the prevention or treatment of obesity or diabetes, the peptide may increase the secretion level of insulin or the expression level of the insulin gene.

[0061] In the above pharmaceutical composition for the prevention or treatment of obesity or diabetes, the peptide can increase the mRNA expression level of at least one gene involved in promoting insulin secretion in pancreatic cells, selected from the group consisting of Pdx1 (pancreatic and duodenal homeobox 1) and GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

[0062] In the above pharmaceutical composition for the prevention or treatment of obesity or diabetes, the peptide may increase the level of mRNA expression of the gene or the secretion of at least one protein involved in satiety signaling, selected from the group consisting of phospho-CREB (phospho-cAMP Response Element-Binding Protein) and POMC (pro-opiomelanocortin).

[0063] In the above pharmaceutical composition for the prevention or treatment of obesity, the peptide can bind to the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

[0064] The term "prevention" above refers to anything that suppresses obesity or diabetes or delays its onset through the treatment or administration of the subject, and the term "treatment" above refers to anything that improves or beneficially alters the symptoms of obesity or diabetes through the treatment or administration of the subject.

[0065] The pharmaceutical composition of the present invention may comprise a therapeutically effective amount of the peptide described above and a pharmaceutically acceptable carrier.

[0066] The above term "therapeutic effective amount" means an amount sufficient for a peptide, which is an active ingredient of the pharmaceutical composition of the present invention, to achieve its activity or efficacy, and, for example, an amount sufficient to achieve efficacy in treating or preventing diabetes or obesity.

[0067] The above pharmaceutically acceptable carriers are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0068] The pharmaceutical composition of the present invention may additionally include, in addition to the above components, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0069] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy (19th ed., 1995, Williams & Wilkins).

[0070] The pharmaceutical composition of the present invention may be administered by any suitable route for treating diabetes or obesity, for example, orally or parenterally, and in the case of parenteral administration, may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, local administration, transdermal administration, etc.

[0071] The dosage of the above pharmaceutical composition may be 0.0001 μg to 100 mg, 0.001 μg to 100 mg, 0.01 μg to 100 mg, 0.1 μg to 100 mg, or 1.0 μg to 1000 mg per day, but is not limited thereto, and may be prescribed in various ways depending on factors such as the method of formulation, mode of administration, age, body weight, sex, pathological condition of the patient, food, time of administration, route of administration, excretion rate and response responsiveness.

[0072] The pharmaceutical composition of the present invention may be prepared in a unit volume form or contained in a multi-dose container by formulation using pharmaceutically acceptable carriers and / or excipients according to a method that can be easily carried out by a person skilled in the art to which the invention belongs. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer.

[0073]

[0074] According to another aspect of the present invention, a functional food composition is provided that comprises a peptide having the amino acid sequence of SEQ ID NO. 1 as an active ingredient.

[0075] In one embodiment, the functional food composition may be used for improving obesity or diabetes.

[0076] In one embodiment, the functional food composition may be used for controlling blood sugar levels.

[0077] In one embodiment, the functional food composition can regulate blood sugar, and the regulation of the blood sugar level may be the regulation of the blood sugar level of a diabetic patient or a high-risk patient with prediabetes.

[0078] In one embodiment, the diabetes may be type 1 diabetes or type 2 diabetes, and specifically, it may be type 2 diabetes.

[0079] In one embodiment, the control of the blood glucose level may be a decrease in the blood glucose level.

[0080] In one embodiment, in the functional food composition, the peptide can increase the secretion level of insulin or the expression level of the insulin gene.

[0081] In the above functional food composition, the peptide can increase the mRNA expression level of at least one gene involved in promoting insulin secretion in pancreatic cells, selected from the group consisting of Pdx1 (pancreatic and duodenal homeobox 1) and GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

[0082] In the above functional food composition, the peptide can increase the level of mRNA expression of the gene or the secretion of at least one protein involved in satiety signaling, selected from the group consisting of phospho-CREB (phospho-cAMP Response Element-Binding Protein) and POMC (pro-opiomelanocortin).

[0083] In the above functional food composition, the peptide can bind to the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

[0084] In the functional food composition of the present invention, the peptide may be included in an appropriate amount selected within the range of 0.0001% to 10% by weight with respect to the total weight of the composition.

[0085] In one embodiment, the functional food composition of the present invention may comprise a food-effective amount of the peptide and a food-acceptable carrier.

[0086] The food composition of the present invention includes not only peptides as the active ingredients but also ingredients that are typically added during food manufacturing, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates described above include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as conventional sugars like dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents, natural flavoring agents, taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) may be used. The proportion of the carbohydrates may generally be about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the food composition of the present invention, but is not limited thereto.

[0087] In addition to the ingredients described above, the functional food composition of the present invention may contain various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, it may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. For example, when the functional food composition of the present invention is manufactured as a drink, in addition to the peptide which is the active ingredient of the present invention, it may additionally include citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc.

[0088] The above functional food composition may be prepared into a food science-acceptable formulation according to a method that can be easily carried out by a person skilled in the art to which the invention belongs, for example, into a powder, granule, pill, tablet, capsule, candy, syrup, or beverage formulation.

[0089] In one embodiment, the functional food composition may be a health functional food in powder form.

[0090] In another aspect of the present invention, a peptide comprising the amino acid sequence of SEQ ID NO. 1 described above, used as a drug, or a pharmaceutical composition comprising the same is provided.

[0091] In another aspect of the present invention, a peptide comprising the amino acid sequence of SEQ ID NO. 1 described above or a pharmaceutical composition comprising the same is provided for use in treating or preventing obesity or diabetes.

[0092] In another aspect of the present invention, a method for treating, preventing, or improving diabetes is provided, comprising the step of administering a therapeutically effective amount of a peptide containing the amino acid sequence of SEQ ID NO. 1 described above to a subject requiring treatment for diabetes.

[0093] In another aspect of the present invention, a blood glucose control method is provided comprising the step of administering a therapeutically effective amount of a peptide containing the amino acid sequence of SEQ ID NO. 1 described above to a subject requiring blood glucose control.

[0094] In another aspect of the present invention, a method for treating, improving, or preventing obesity is provided, comprising the step of administering a therapeutically effective amount of a peptide containing the amino acid sequence of SEQ ID NO. 1 described above to a subject requiring treatment for obesity.

[0095]

[0096] The peptide of the present invention increases the expression of insulin genes and genes of Pdx1 and GLP1R involved in insulin secretion, increases the secretion of insulin itself, and increases the expression levels of phospho-CREB and POMC factors related to satiety signals. In addition, the peptide of the present invention exhibits anti-obesity activity in vivo. Therefore, the peptide of the present invention can be used for the treatment, prevention, or improvement of obesity or diabetes, and can be usefully used for lowering blood sugar in people who require blood sugar control.

[0097] However, the effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the description below.

[0098]

[0099] Figure 1 is a figure showing the binding force between the peptide of the present invention and the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R) through surface plasmon resonance analysis (SPR analysis).

[0100] Figure 2a is a UV-irradiated agarose gel image confirming that the peptide of the present invention increases the expression of Pdx1 (pancreatic and duodenal homeobox 1) and GLP1R genes, which are involved in the expression of insulin genes and insulin secretion, in rat insulinoma cell lines (INS-1 cells).

[0101] Figure 2b is a figure confirming the result of measuring the band intensity in the gel of Figure 2a through image J.

[0102] Figure 3 is a figure confirming, through ELISA, the activity of the peptide of the present invention in increasing insulin secretion in INS-1 cells.

[0103] Figure 4 is a figure confirming the activity of the peptide of the present invention in increasing the secretion of phospho-CREB (phospho-cAMP Response Element-Binding Protein) protein involved in satiety signaling in human neuroblastoma cell lines.

[0104] Figure 5 is a figure confirming the activity of the peptide of the present invention in increasing the expression of the POMC (pro-opiomelanocortin) gene involved in satiety signals in cells derived from the anterior pituitary gland.

[0105] Figures 6 and 7 show the in vivo anti-obesity activity of the peptide of the present invention confirmed through mouse animal model experiments.

[0106]

[0107] The present invention will be described in detail below by way of examples. However, the following examples are intended to specifically illustrate the present invention, and the scope of the present invention is not limited by the following examples.

[0108]

[0109] Examples

[0110]

[0111] Preparation Example 1: Preparation of a peptide

[0112] Peptides having the amino acid sequence of SEQ ID NO. 1 listed in Table 1 below were synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA), and these synthesized peptides were purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). An ACQUITY UPLC BEH300 C18 column (2.1 mm x 100 mm, 1.7 µm, Waters Co, USA) was used.

[0113] Sequence number of peptide amino acid sequence 1QHYRKTWIG

[0114]

[0115] Next, the efficacy of the peptide of sequence number 1 prepared above was evaluated.

[0116]

[0117] Experimental Example 1: Confirmation of binding affinity between a peptide and the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R)

[0118] To confirm the binding affinity between the peptide prepared in Preparation Example 1 and the GLP-1 receptor (GLP1R), Surface Plasmon Resonance (SPR) analysis was performed using a Biacore T200 system (Cytiva, US). Specifically, human recombinant GLP1R-His (hμMan recombinant GLP1R-His, R&D systems, US) protein was immobilized on a CM5 sensor chip (Cytiva, US) at a value of 900 RU using an EDC / NHS amine coupling kit (EDC / NHS amine coupling kit, Cytiva, US). Subsequently, peptides of Preparation Example 1 at various concentrations (31.25 μM, 62.5 μM, 125 μM, 250 μM, and 500 μM) diluted in HBS-EP buffer were flowed into a flow cell immobilized with GLP1R at a flow rate of 30 μL / min at 25 ℃. Then, sensorgram patterns were analyzed using Biacore T200 evaluation software ver. 3.1 (Cytiva, US).

[0119] As a result, as shown in Fig. 1, it was confirmed that the surface plasmon resonance reaction increased significantly as the concentration of the peptide of Preparation Example 1 increased. Accordingly, it was confirmed that the peptide of Preparation Example 1 has a high binding affinity to the GLP-1 receptor.

[0120]

[0121] Experimental Example 2: Analysis of expression of insulin and genes involved in insulin secretion in INS-1 cells

[0122] In rat insulinoma cell lines (INS-1 cells), the effect of the peptide of Preparation Example 1 on the expression of the insulin gene, the Pdx1 (pancreatic and duodenal homeobox 1) gene involved in insulin gene expression, and the GLP1R gene involved in promoting insulin secretion was analyzed through RT-PCR (Reverse transcription polymerase chain reaction). Specifically, INS-1 cells were obtained from the Laboratory of Molecular and Cellular Biology at Sungkyunkwan University (Suwon, South Korea) and used. The INS-1 cells were cultured at 37°C under 5% CO2 conditions in RPMI 1640 (Gibco, 11875-085) medium containing 10% FBS, 1% P / S, 10 mM HEPES (Welgene, BB001-01), 1 mM sodium pyruvate (Gibco, 11360-070), and 50 μM 2-mercaptoethanol (Gibco, 21985-02). The cultured INS-1 cells were placed in a 10×10 4The cells were seeded into wells at a concentration of cells / well, and after 72 hours, the INS-1 cells were starved with w / o glucose KRB Buffer (bio solution, BK005). After 2 hours, 16.7 mM glucose (biosolution, BK005) and 50 μM and 100 μM of the peptide of Preparation Example 1 were added together, respectively, and the cells were cultured for 1 hour. At this time, 100 nM of liraglutide (selleckchem, s8256) was used as a positive control. Then, RNA was isolated from the treatment group INS-1 cells using TRIzol (Invitrogen, 15596018), cDNA was synthesized using RT DryMIX (Enzynomics, RT200), and RT-PCR was performed using PCR premix (Enzynomics, P581T) and the primers listed in Table 2 below. The product was then subjected to electrophoresis on an agarose gel, stained with ethidium bromide, and the bands were observed under UV light and measured using Image J.

[0123] Gene-derived primer sequence (5'->3') Sequence number Insulin rat ForwardACA CCC AAG TCC CGT CGT GA2ReverseTGA TCC ACA ATG CCA CGC TT3Pdx1 rat ForwardCCC GAG CTT CTG AAA ACT TTG4ReverseCTT TTC ATT GTC CTC AGT TGG G5GLP1R rat ForwardGGA GTG TGA AGA GTC TAA GC6ReverseGCA GTA CTG CAT GAG CAG GA7GAPDH rat ForwardGTG ATG GCA TGG ACT GTG GT8ReverseGGA GCC AAA AGG GTC ATC AT9

[0124]

[0125] As a result, as shown in Figure 2, it was confirmed that when the INS-1 cells were treated with the peptide of Preparation Example 1, the expression of the genes for insulin, Pdx1, and GLP1R increased compared to the untreated group.

[0126]

[0127] Experimental Example 3: Analysis of Insulin Secretion in INS-1 Cells

[0128] The effect of the peptide of Preparation Example 1 on insulin secretion in INS-1 cells was analyzed using an enzyme-linked immunosorbent assay (ELISA). Specifically, INS-1 cells were cultured in RPMI 1640 (Gibco, 11875-085) medium containing 10% FBS, 1% P / S, 10 mM HEPES (Welgene, BB001-01), 1 mM sodium pyruvate (Gibco, 11360-070), and 50 μM 2-mercaptoethanol (Gibco, 21985-02) at 37°C and 5% CO2. The cultured INS-1 cells were placed in 10×10 4The cells were seeded into wells, and after 72 hours, the INS-1 cells were starved with w / o glucose KRB Buffer (bio solution, BK005). After 2 hours, 16.7 mM glucose (biosolution, BK005) was added along with 5 μM, 50 μM, and 100 μM of the peptides from Preparation Example 1, respectively, and the cells were cultured for 1 hour. At this time, 100 nM of liraglutide (selleckchem, s8256) was used as a positive control. The culture medium was collected and centrifuged at 2000 g for 10 minutes. Subsequently, the supernatant was collected, and the insulin secretion level of the INS-1 cells was analyzed using a Rat insulin ELISA kit (Abclonal, RK09278).

[0129] As a result, as shown in Figure 3, when the INS-1 cells were treated with the peptide of Preparation Example 1 at 50 μM and 100 μM, insulin secretion increased compared to the untreated group, and in the case of treatment at 100 μM, it was confirmed that insulin secretion increased to a level similar to that of the positive control liraglutide.

[0130]

[0131] Experimental Example 4: Analysis of Factors Related to Satiety Signals

[0132] Changes in the secretion of satiety signal proteins and the expression of satiety signal-related genes following treatment with the peptide of Preparation Example 1 were analyzed in various cell lines using Western blotting and RT-PCR.

[0133] First, the amounts of phospho-CREB (phospho-cAMP Response Element-Binding Protein) and Total CREB protein were analyzed by Western blot: Human neuroblastoma SH-SY5Y cells (American Type Cell Culture, VA, USA) were cultured in a cell incubator (37°C, 5% CO2) using DMEM / F12 (1:1) medium containing 10% FBS and 1% penicillin-streptomycin. The cultured SH-SY5Y cells were placed in 6-well cell culture medium at a concentration of 1 × 10⁶ 6 The cells were seeded at cell / well ratios, and after 18 hours, the medium was replaced with serum-free DMEM / F12 and cultured for 6 hours to starve the SH-SY5Y cells. Subsequently, 100 μM and 200 μM of the peptide of Preparation Example 1 were added to the SH-SY5Y cells, respectively, and cultured for 15 minutes. At this time, 0.1 μM and 1 μM of liraglutide (selleckchem, s8256) were used as positive controls. Afterward, the cells were washed with PBS (phosphate-buffered saline), and 120 μL of protein lysis buffer was added to each well to lyse the cells. The cells were centrifuged at 13,000 rpm for 15 minutes, and the protein-containing lysate was extracted. The protein concentration of the extracted lysate was quantified (20 μg), and a Western blot was performed. The primary antibodies used for the above Western blot were anti-phospho-CREB antibody (Cell signaling, #9198), anti-Total CREB antibody (Cell signaling, #9197), and anti-α-Tubulin antibody (Santa Cruz / #sc-69969).

[0134] As a result, as shown in Figure 4, it was confirmed that when the SH-SY5Y cells were treated with the peptide of Preparation Example 1, the amount of phospho-CREB (phospho-cAMP Response Element-Binding Protein) protein increased compared to the untreated group.

[0135] In addition, the expression of the POMC (pro-opiomelanocortin) gene was analyzed via RT-PCR: First, mouse anterior pituitary GH3 cells (American Type Cell Culture, VA, USA) were cultured in a cell incubator (37°C, 5% CO2) using F-12K medium containing 10% FBS and 1% penicillin-streptomycin. The cultured GH3 cells were placed in a 12-well plate at a density of 2.0 × 10⁶ 5 1 mL of the solution was dispensed into each well. The GH3 cells were cultured at 37°C, then replaced with serum-free F-12K medium and cultured for 6 hours to induce starvation in the GH3 cells. Subsequently, 100 μM and 200 μM of the peptide of Preparation Example 1 were added to the GH3 cells, respectively, and cultured for 12 hours. At this time, 0.1 μM and 1 μM of liraglutide (selleckchem, s8256) were used as positive controls. Then, after removing the medium (media suction), the cells were collected, RNA was isolated from the cells using TRIzol (Invitrogen, 15596018), cDNA was synthesized using RT DryMIX (Enzynomics, RT200), and RT-PCR was performed using PCR premix (Enzynomics, P581T) and the primers listed in Table 3 below.

[0136] Gene Primer Sequence (5'->3') Sequence Number POMCForwardCTCACCACGGAAAGCAACCT10ReverseCACGTTCTTGATGATGGCGTTC11GAPDHForwardACCACAGTCCATGCCATCAC12ReverseTCCACCACCCTGTTGCTGTA13

[0137]

[0138] As a result, as shown in Figure 5, it was confirmed that when the GH3 cells were treated with the peptide of Preparation Example 1, the expression of the POMC gene increased compared to the untreated group.

[0139] From the experimental results of Experimental Example 4, it was found that the peptide of Preparation Example 1 increased the satiety signal.

[0140]

[0141] Experimental Example 5: Analysis of In vivo Anti-obesity Activity of Peptides

[0142] The anti-obesity activity of the peptide of Preparation Example 1 was confirmed through in vivo animal experiments. Specifically, C57BL / 6 mice (7-ws, female) were purchased and acclimatized for one week. The mice were divided into three groups (n=5), each consisting of 5 mice: 1) a group treated with the peptide of Preparation Example 1, 2) a group not treated with the peptide, and 3) a positive control group, and the weight of each group was measured. The mice in the three groups were subjected to an administration period of 7 days and a recovery period of 7 days. Specifically, the peptide-treated group was orally administered to mice daily for 7 days by dissolving the peptide of Preparation Example 1 in PBS at a concentration of 10 mg / 200 μL, the peptide-untreated group was orally administered to mice daily for 7 days by dissolving 200 μL of PBS, and the positive control group was intraperitoneally injected into mice daily by dissolving the liraglutide in PBS at a concentration of 0.3 μg / 50 μL. Then, on day 7, the body weight (g) of each mouse in the three groups was measured, and the mice were photographed after being anesthetized by inhalation using isoflurane. After the 7-day administration, the mice were allowed a 7-day recovery period. After the recovery period, on day 14, the body weight of each mouse in the three groups was measured, and the mice were photographed after being anesthetized by inhalation using isoflurane.

[0143] As a result, as shown in FIGS. 6 and 7, after the 7-day administration period, it was confirmed that the peptide-treated group had a lower degree of body weight increase and a lower body weight compared to the peptide-untreated group. Accordingly, it was found that the peptide of Preparation Example 1 exhibits anti-obesity activity in vivo.

[0144]

[0145] Preparation Example 2: Preparation of a pharmaceutical composition

[0146] 2-1. Preparation of Powders

[0147] 2 g of the peptide from Preparation Example 1

[0148] 1 g lactose

[0149] The above ingredients were mixed and filled into an airtight bag to manufacture a powder.

[0150]

[0151] 2-2. Preparation of Tablets

[0152] 100 mg of the peptide of Preparation Example 1

[0153] 100 mg corn starch

[0154] 100 mg lactose

[0155] Magnesium stearate 2 mg

[0156] After mixing the above ingredients, tablets were manufactured by compressing them according to the conventional method of manufacturing tablets.

[0157]

[0158] 2-3. Manufacture of Capsules

[0159] 100 mg of the peptide of Preparation Example 1

[0160] 100 mg corn starch

[0161] 100 mg lactose

[0162] Magnesium stearate 2 mg

[0163] After mixing the above ingredients, a capsule was manufactured by filling it into a gelatin capsule according to a conventional method for manufacturing capsules.

[0164]

[0165] 2-4. Preparation of Pills

[0166] 1 g of the peptide of Preparation Example 1

[0167] 1.5 g lactose

[0168] 1 g glycerin

[0169] 0.5 g xylitol

[0170] After mixing the above ingredients, the product was prepared according to a conventional method so that each pill weighed 4g.

[0171]

[0172] 2-5. Preparation of Granules

[0173] 150 mg of the peptide of Preparation Example 1

[0174] Soybean extract 50 mg

[0175] 200 mg of glucose

[0176] 600 mg of starch

[0177] After mixing the above ingredients, 100 mg of 30% ethanol was added and dried at 60°C to form granules, which were then filled into a bag.

[0178]

[0179] Preparation Example 3: Preparation of a functional food composition

[0180] 3-1. Manufacture of Health Food Granules

[0181] 500 μg of the peptide of Preparation Example 1

[0182] Appropriate amount of vitamin mixture

[0183] Vitamin A Acetate 70 mg

[0184] Vitamin E 1.0 mg

[0185] Vitamin D 0.13mg

[0186] Vitamin B2 0.15mg

[0187] Vitamin B6 0.5mg

[0188] Vitamin B12 0.2mg

[0189] Vitamin C 10mg

[0190] Biotin 10mg

[0191] Nicotinamide 1.7 mg

[0192] 50mg of folic acid

[0193] Calcium pantothenate 0.5mg

[0194] Appropriate amount of mineral mixture

[0195] Ferrous sulfate 1.75 mg

[0196] 0.82 mg of zinc oxide

[0197] Magnesium carbonate 25.3mg

[0198] 15 mg of dipotassium phosphate

[0199] 55 mg dicalcium phosphate

[0200] Potassium citrate 90mg

[0201] 100mg of calcium carbonate

[0202] Magnesium chloride 24.8 mg

[0203] The composition ratio of the above vitamin and mineral mixture is composed of ingredients that are relatively suitable for health food as a preferred example, but the mixing ratio may be modified at will. The above ingredients may be mixed according to a conventional method of manufacturing health food, then powder or granules may be prepared and used to manufacture a health food composition according to a conventional method.

[0204]

[0205] 3-2. Preparation of Health Food Powder

[0206] 500 μg of the peptide of Preparation Example 1

[0207] Appropriate amount of vitamin mixture

[0208] Vitamin A Acetate 70 mg

[0209] Vitamin E 1.0 mg

[0210] Vitamin D 0.13mg

[0211] Vitamin B2 0.15mg

[0212] Vitamin B6 0.5mg

[0213] Vitamin B12 0.2mg

[0214] Vitamin C 10mg

[0215] Biotin 10mg

[0216] Nicotinamide 1.7 mg

[0217] 50mg of folic acid

[0218] Calcium pantothenate 0.5mg

[0219] Appropriate amount of mineral mixture

[0220] Ferrous sulfate 1.75 mg

[0221] 0.82 mg of zinc oxide

[0222] Magnesium carbonate 25.3mg

[0223] 15 mg of dipotassium phosphate

[0224] 55 mg dicalcium phosphate

[0225] Potassium citrate 90mg

[0226] 100mg of calcium carbonate

[0227] Magnesium chloride 24.8 mg

[0228] Although the composition ratio of the above vitamin and mineral mixture is composed of ingredients relatively suitable for health food in a preferred embodiment, the mixing ratio may be modified at will. The above ingredients or their powders are mixed according to a conventional method for manufacturing health food, and the powder of the mixture is prepared and used to manufacture a health food composition according to a conventional method.

[0229]

[0230] 3-3. Preparation of Health Drinks

[0231] 500 μg of the peptide of Preparation Example 1

[0232] 1000mg citric acid

[0233] 100g oligosaccharide

[0234] 2g of plum concentrate

[0235] 1g of taurine

[0236] Add purified water to make a total of 900ml

[0237] The above ingredients were mixed according to a conventional method for manufacturing health beverages, stirred and heated at 85°C for about 1 hour, and then the resulting solution was filtered, placed in a sterile container, sealed and sterilized, and stored in a refrigerator before being used to manufacture a health beverage composition. Although the above composition ratio was composed of ingredients suitable for a relatively palatable beverage as a preferred example, the mixing ratio can be arbitrarily modified according to regional and ethnic preferences, such as consumer groups, countries of demand, and intended uses.

[0238]

[0239] Although representative embodiments of the present application have been described above by way of example, the scope of the present application is not limited to such specific embodiments, and those skilled in the art will be able to make appropriate modifications within the scope described in the claims of the present application.

Claims

1. A peptide comprising the amino acid sequence of Sequence No.

1.

2. In Claim 1, The above peptide is a peptide having anti-obesity activity or anti-diabetic activity.

3. An anti-obesity or anti-diabetic composition comprising the peptide of Claim 1 as an active ingredient.

4. A pharmaceutical composition for the prevention or treatment of obesity or diabetes comprising the peptide of Claim 1 as an active ingredient.

5. In Claim 4, A pharmaceutical composition for the prevention or treatment of obesity or diabetes, wherein the above peptide has one or more of the following activities: (i) Activating the secretion level of insulin or the expression level of the insulin gene; (ii) activity that increases the mRNA expression level of at least one gene involved in promoting insulin secretion in pancreatic cells, selected from the group consisting of Pdx1 (pancreatic and duodenal homeobox 1) and GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R); (iii) an activity that increases the level of secretion or mRNA expression of a protein involved in satiety signaling, selected from the group consisting of phospho-CREB (phospho-cAMP Response Element-Binding Protein) and POMC (pro-opiomelanocortin); and (iv) Activity binding to the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

6. A functional food composition comprising the peptide of Claim 1 as an active ingredient.

7. In Claim 6, The above composition is a functional food composition intended for the prevention or improvement of obesity or diabetes.

8. In Claim 6, A functional food composition wherein the above peptide has one or more of the following activities: (i) Activating the secretion level of insulin or the expression level of the insulin gene; (ii) activity that increases the mRNA expression level of at least one gene involved in promoting insulin secretion in pancreatic cells, selected from the group consisting of Pdx1 (pancreatic and duodenal homeobox 1) and GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R); (iii) an activity that increases the level of secretion or mRNA expression of a protein involved in satiety signaling, selected from the group consisting of phospho-CREB (phospho-cAMP Response Element-Binding Protein) and POMC (pro-opiomelanocortin); and (iv) Activity binding to the GLP-1 receptor (glucagon-like peptide-1 receptor, GLP1R).

Images