Method for preparing recombinant human collagen

By constructing engineered strains co-expressing human and viral proline hydroxylases in Pichia pastoris and combining them with a three-stage fermentation process, large-scale, high-purity, immunogenic, and virus-free recombinant human collagen was successfully prepared. This solved the problems of difficulty in preparing full-length triple helix structures and inconsistent proline hydroxylation levels in existing technologies, enabling the application of recombinant human collagen in medical and tissue engineering fields.

WO2026114227A1PCT designated stage Publication Date: 2026-06-04JHM BIOPHARMACEUTICAL (HANGZHOU) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
JHM BIOPHARMACEUTICAL (HANGZHOU) CO LTD
Filing Date
2025-11-25
Publication Date
2026-06-04

Smart Images

  • Figure PCTCN2025137551-FTAPPB-I100001
    Figure PCTCN2025137551-FTAPPB-I100001
  • Figure PCTCN2025137551-FTAPPB-I100002
    Figure PCTCN2025137551-FTAPPB-I100002
  • Figure PCTCN2025137551-FTAPPB-I100003
    Figure PCTCN2025137551-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a method for preparing a recombinant human collagen. The method comprises: constructing a genetically engineered bacterium which expresses a prolyl hydroxylase and a recombinant human collagen; culturing the genetically engineered bacterium and performing digestion treatment by means of pepsin to obtain a recombinant human collagen type I or type III. The prolyl hydroxylase comprises P4Ha2, P4Hb and vP4H, and by means of controlling the ratio of the copy numbers of the genes thereof, the recombinant human collagen and a natural human collagen are consistent in hydroxylation modification. Also provided is a large-scale production method for the recombinant human collagen. The prepared recombinant human collagen has completely the same sequence composition and length and substantially the same hydroxyproline content as the natural human collagen, and also has a stable full-length triple helix structure and biological activity without immunogenicity and potential risk of viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Methods for preparing recombinant human collagen Technical Field

[0001] This application relates to the field of biomedical materials, specifically to a method for preparing recombinant human collagen, particularly a method for preparing recombinant type I human collagen and recombinant type III human collagen, and more specifically, to a recombinant protein, recombinant human collagen, a composition, a method for large-scale preparation of recombinant human collagen, and their uses. Background Technology

[0002] Collagen is the most abundant protein in the human body. Due to its unique physicochemical properties and mechanical strength, it is widely used in tissue engineering and medical devices. Type I collagen accounts for the largest proportion of collagen in the human body, making up 80% to 90% of the total collagen, and is mainly distributed in tissues such as skin and tendons; Type III collagen is commonly found in elastic tissues such as skin and blood vessels, and plays an important role in tissue repair.

[0003] The synthesis process of collagen in animal tissues: First, procollagen polypeptide chains are synthesized intracellularly, including N-terminal telopeptides, triple helix regions, and C-terminal telopeptides. These three polypeptide chains intertwine to form procollagen. Under the action of N-terminal and C-terminal proteases, the N-terminal and C-terminal telopeptides of procollagen are cleaved, respectively, to form procollagen molecules. Simultaneously, under the action of proline hydroxylase (P4H), proline (Pro) on the procollagen polypeptide chains is catalyzed to hydroxyproline (HyP). Procollagen molecules self-assemble to form collagen microfibrils, which further polymerize into collagen fibers and collagen bundles. Collagen has a unique triple helix structure, and its stability depends on the intra- and inter-chain hydrogen bonds formed by the hydroxyl groups on the hydroxyproline residues.

[0004] Currently, the method for preparing collagen with a full-length triple helix structure involves extraction from animal tissues, typically derived from animal skin or tendons. While animal-derived collagen possesses a full-length triple helix structure and complete biological activity, it suffers from limitations in source, low purity, high immunogenicity, and risks associated with animal diseases and viral transmission. Furthermore, obtaining a single type of collagen is difficult. In addition, existing recombinant collagen preparation methods, such as recombinant humanized collagen or recombinant collagen-like proteins, consist of fragment sequences or combinations of fragment sequences, lacking a complete full-length structure, proline hydroxylation modification, and a triple helix structure. These methods cannot achieve all the biological functions of natural human collagen, severely limiting their application in tissue engineering products. Only recombinant human collagen, besides being 100% homologous to natural human collagen, also possesses characteristics such as essentially identical proline hydroxylation modification, a full-length triple helix structure, and all the biological functions of natural human collagen. Therefore, recombinant human collagen is an ideal alternative to animal-derived collagen and recombinant humanized collagen in both medical aesthetics and tissue engineering fields.

[0005] However, the large-scale preparation of recombinant human collagen, such as fermentation volumes exceeding 5000 liters, has remained a significant challenge for the industry. During process scale-up, especially at fermentation volumes greater than 5000 liters, unforeseen technical difficulties arise, including variations in expression levels, consistency between large-scale production and small-scale production (e.g., fermentation volumes less than 100 liters), such as consistent proline hydroxylation levels and the presence of a full-length triple helix structure. To date, large-scale preparation and application of recombinant human collagen with a full-length triple helix structure in medical aesthetics and tissue engineering products have not been observed domestically or internationally.

[0006] Therefore, there is an urgent need in the field to provide a recombinant human collagen with a hydroxylation degree consistent with that of natural human collagen and a full-length triple helix structure, as well as a method for its preparation, especially one that can be prepared on a large scale, in order to solve the bottleneck problem in the scale-up preparation process and overcome the shortcomings of existing sources and technologies. Summary of the Invention

[0007] This application aims to address at least one problem existing in the prior art by providing a method for preparing recombinant human collagen. The recombinant human collagen (including type I and type III) prepared by this method has a proline hydroxylation level and a full-length triple helix structure that are essentially identical to those of natural human collagen. Its sequence composition is completely identical to that of natural human collagen, and it has no immunogenicity or viral risks, and can be prepared on a large scale.

[0008] This application is based on the inventor's following discoveries:

[0009] First, most recombinant collagen currently on the market is recombinant humanized collagen or recombinant collagen-like protein, composed of collagen fragments, and lacks the triple helix structure and complete biological activity of collagen. Because the full-length collagen gene sequence is quite long (approximately 4000 bp), with a large number of repetitive amino acid sequences (Gly-XY)n, and requires a large amount of hydroxyproline (HyP) to maintain the triple helix structure and functional properties, and because human proline hydroxylase (P4H) is a tetrameric structure (α2β2), it must possess a complete tetrameric structure to perform its proline hydroxylation function, although different methods have been attempted to prepare collagen, none have been able to achieve the stable preparation of full-length collagen with a complete triple helix structure. In particular, due to several unforeseen technical bottlenecks during scale-up, large-scale preparation (stable expression and purification) of full-length collagen with a complete triple helix structure is not possible.

[0010] Currently available methods for preparing recombinant humanized collagen or recombinant collagen-like proteins all involve fragments or repetitive sequences, lacking the full-length human collagen sequence and structure. Furthermore, they lack the insertion of proline hydroxylase, preventing the conversion of proline to hydroxyproline. Alternatively, collagen can be obtained from bovine and porcine hides. While these methods yield full-length sequences and triple helical structures, their sourcing requirements are extremely stringent, limiting production scale. They also pose risks of high immunogenicity and potential for animal-borne diseases and viral transmission.

[0011] Secondly, to overcome the inherent defects of animal-derived collagen and the bottleneck of existing recombinant technologies in the large-scale stable production of full-length triple-helix collagen, this invention develops a large-scale preparation method based on Pichia pastoris. By constructing engineered bacteria co-expressing human and viral proline hydroxylases and combining this with a three-stage fermentation process with a final volume ≥9000 liters, the industrial production of recombinant human collagen has been successfully achieved. The product obtained by this method has a complete triple-helix structure, high purity, low immunogenicity, and stable and controllable quality, making it suitable for medical, cosmetic, and tissue engineering fields.

[0012] Ideal recombinant human collagen preparation should have the following characteristics: (1) possessing the full-length sequence of human collagen, (2) having a triple helix structure, complete biological activity, strong stability, (3) being able to be prepared on a large scale, with high purity, and (4) being non-immunogenic.

[0013] Based on this, in a first aspect of this application, a method for preparing recombinant human collagen is proposed. According to an embodiment of this application, the method includes: constructing a genetically engineered bacterium expressing proline hydroxylase and recombinant human collagen; culturing the genetically engineered bacterium; and performing enzymatic digestion of the culture product using pepsin to obtain the recombinant human collagen; wherein the recombinant human collagen is recombinant type I human collagen or recombinant type III human collagen; when the recombinant human collagen is recombinant type I human collagen:

[0014] The recombinant type I human collagen includes full-length COL1A1 protein and full-length COL1A2 protein;

[0015] The amino acid sequence of the full-length COL1A1 is shown in SEQ ID NO:1 or 2, and the amino acid sequence of the full-length COL1A2 is shown in SEQ ID NO:3 or 4.

[0016] The proline hydroxylase includes P4Ha2, P4Hb, and vP4H;

[0017] The copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1, and full-length COL1A2 is (1.80–2.20): (1.80–2.20): (0.80–1.50): (1.80–2.20): 1; when the recombinant human collagen is recombinant type III human collagen: the amino acid sequence of the full-length recombinant type III human collagen is as shown in SEQ ID NO: 11; the proline hydroxylase includes P4Ha2, P4Hb, and vP4H; the copy number ratio of P4Ha2, P4Hb, vP4H, and full-length recombinant type III human collagen is (1.80–2.20): (1.80–2.20): (0.80–1.60): 1.

[0018] The preparation method described in this application allows for large-scale production with high purity, while significantly reducing production costs. Furthermore, the recombinant type I human collagen prepared by this method has a sequence completely identical to the full-length sequence of natural type I human collagen, a hydroxyproline content essentially the same as natural type I human collagen, and possesses a triple helix structure, exhibiting the complete biological activity of natural type I human collagen. Because it is entirely a human-derived sequence, it has no immunogenicity and poses no viral risk. Similarly, the recombinant type III human collagen prepared by this method has a sequence completely identical to the full-length sequence of natural type III human collagen, a hydroxyproline content essentially the same as natural type III human collagen, and possesses a triple helix structure, exhibiting the complete biological activity of natural type III human collagen. Because it is entirely a human-derived sequence, it has no immunogenicity and poses no viral risk.

[0019] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1 and full-length COL1A2 is (1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):1.

[0020] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90-2.10):(1.90-2.10):(0.90-1.10):1.

[0021] In some aspects of this application, the amount of pepsin added to the culture product is 100-500 U / L.

[0022] In some aspects of this application, the temperature of the enzymatic digestion treatment is 2–10°C.

[0023] In some aspects of this application, the enzyme digestion treatment time is 16 to 30 hours.

[0024] In some aspects of this application, the amino acid sequence of P4Ha2 is shown in SEQ ID NO:6.

[0025] In some aspects of this application, the amino acid sequence of the P4Hb is shown in SEQ ID NO:7.

[0026] In some aspects of this application, the amino acid sequence of the vP4H is shown in SEQ ID NO:8.

[0027] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the amino acid sequence of the enzyme-digested COL1A1 is shown in SEQ ID NO:9, and the amino acid sequence of the enzyme-digested COL1A2 is shown in SEQ ID NO:10.

[0028] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the amino acid sequence of the enzyme-digested COL3A1 is shown in SEQ ID NO:5.

[0029] In some aspects of this application, the genetically engineered bacteria are selected from Pichia pastoris strains.

[0030] In some aspects of this application, the method further includes purifying the enzyme digestion product.

[0031] In some aspects of this application, the purification process is performed sequentially as microfiltration, salting out, chromatography, and ultrafiltration.

[0032] In some aspects of this application, the microfiltration process is performed using a filter membrane with a pore size of 0.22 μm or larger.

[0033] In some aspects of this application, the salting-out treatment is carried out using a 0.5–3 mol / L sodium chloride solution.

[0034] In some aspects of this application, the salting-out treatment takes 16 to 30 hours.

[0035] In some aspects of this application, the chromatography process is performed using ion exchange chromatography.

[0036] In some aspects of this application, the ultrafiltration process is performed using a filter membrane with a molecular weight of 50 kD or higher.

[0037] In some aspects of this application, the purity of the recombinant human collagen is greater than 95%.

[0038] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the hydroxyproline content in the recombinant type I human collagen is greater than 10.5%.

[0039] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the hydroxyproline content in the recombinant type I human collagen is 10.5% to 11.5%.

[0040] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the hydroxyproline content in the recombinant type III human collagen is greater than 16.5%.

[0041] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the hydroxyproline content in the recombinant type III human collagen is 16.6% to 17.5%.

[0042] In some aspects of this application, the recombinant human collagen has a complete triple helix structure.

[0043] In some aspects of this application, in the circular dichroism spectrum, the recombinant human collagen has a negative absorption peak at a wavelength of 190–200 nm and a positive absorption peak at a wavelength of 210–230 nm.

[0044] In some aspects of this application, the recombinant human collagen has a negative absorption peak at a wavelength of 195–200 nm.

[0045] In some aspects of this application, the recombinant human collagen has a positive absorption peak at a wavelength of 215–225 nm.

[0046] In a second aspect, this application provides a recombinant protein. According to embodiments of this application, the amino acid sequence of the recombinant protein is as shown in SEQ ID NO:2 or 4 (corresponding to the modified sequence of type I collagen). This application modifies the C-terminal telopeptide sequences in the original full-length COL1A1 and COL1A2 sequences into helper folding sequences, as shown in SEQ ID NO:2 or 4. Therefore, using the above-mentioned recombinant protein to prepare recombinant type I human collagen can increase the expression level of recombinant type I human collagen.

[0047] In a third aspect, this application discloses the use of the recombinant protein described in the second aspect in the preparation of recombinant type I human collagen. This application transforms the C-terminal telopeptide sequences in the original full-length COL1A1 and COL1A2 sequences into helper folding sequences, thereby increasing the expression level of recombinant type I human collagen when using the aforementioned recombinant protein to prepare it.

[0048] In a fourth aspect, this application discloses a recombinant human collagen. According to an embodiment of this application, the recombinant human collagen is prepared using the method described in the first aspect. Therefore, the recombinant human collagen sequence of this application is completely identical to that of natural human collagen, its hydroxyproline content is substantially the same as that of natural human collagen, and it possesses a triple helix structure. It possesses all the biological activities of natural human collagen, and because it is entirely a human-derived sequence, it has no immunogenicity and poses no viral risk.

[0049] In a fifth aspect of this application, a composition is provided. According to embodiments of this application, the composition comprises recombinant human collagen prepared by the method described in the first aspect. The composition may further comprise excipients, such as at least one selected from recombinant human collagen hydrogel, repair fluid, solution or dressing, recombinant human collagen cross-linked or non-cross-linked facial filler, recombinant human collagen artificial dermis, recombinant human collagen sponge, and recombinant human collagen bone repair material. Therefore, the composition of this application is non-immunogenic and poses no viral risk.

[0050] In a sixth aspect of this application, a method for large-scale preparation of recombinant human collagen is proposed. According to an embodiment of this application, the method includes: fermenting engineered bacteria to express pre-collagen; purifying the fermentation product to obtain recombinant human collagen; wherein the fermentation is a three-stage fermentation, and the final fermentation volume of the three-stage fermentation is not less than 9000 liters; the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen; when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(1.80~2.20):(1.80~2.20). 0~2.20):1; or P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2=(1.80~2.20):(1.80~2.20):(0.80~1.50):(1.80~2.20):1; When the recombinant human collagen is recombinant type III human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL3A1=(1.80~2.20):(1.80~2.20):1, or P4Ha2:P4Hb:vP4H:full-length COL3A1=(1.80~2.20):(1.80~2.20):(0.80~1.60):1. The method according to the embodiments of this application can be used to prepare recombinant human collagen with a complete triple helix structure, no immunogenicity, no viral risk, and high purity on a large scale.

[0051] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):1.

[0052] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90-2.10):(1.90-2.10):(0.90-1.10):1.

[0053] In some aspects of this application, the engineered bacteria include at least one of Pichia pastoris and Saccharomyces cerevisiae.

[0054] In some aspects of this application, the procollagen includes an N-terminal telopeptide, a triple helix region, and a C-terminal telopeptide, wherein the C-terminus of the N-terminal telopeptide is connected to the N-terminus of the triple helix region, and the C-terminus of the triple helix region is connected to the N-terminus of the C-terminal telopeptide.

[0055] In some aspects of this application, the engineered bacteria co-express proline hydroxylase.

[0056] In some aspects of this application, the proline hydroxylase includes at least one of human proline hydroxylase and viral proline hydroxylase.

[0057] In some aspects of this application, the procollagen includes type I procollagen or type III procollagen.

[0058] In some aspects of this application, the recombinant type I human collagen is a recombinant protein with a sequence identical to that of natural type I human collagen.

[0059] In some aspects of this application, the recombinant type III human collagen is a recombinant protein with a sequence identical to that of natural type III human collagen.

[0060] In some aspects of this application, the structure of the recombinant type I human collagen includes two α1 chains and one α2 chain.

[0061] In some aspects of this application, the structure of the recombinant type III human collagen includes three α1 chains.

[0062] In some aspects of this application, the α1 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:9, and the α2 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:10.

[0063] In some aspects of this application, the recombinant type III human collagen has an amino acid sequence as shown in SEQ ID NO:5.

[0064] In some aspects of this application, the α1 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:1 or 2, and the α2 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:3 or 4.

[0065] In some aspects of this application, the type III procollagen has an amino acid sequence as shown in SEQ ID NO:11.

[0066] In some aspects of this application, the fermentation culture treatment includes a seed revival treatment prior to the fermentation culture treatment.

[0067] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing OD at a temperature of 25-30°C and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.0.

[0068] In some aspects of this application, when the recombinant human collagen is recombinant type III human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing OD at a temperature of 28-35°C and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.0.

[0069] In some aspects of this application, the tertiary fermentation includes: a) primary fermentation: carried out in a 10-50 L fermenter, with an inoculation ratio of 2-6%, and culturing OD... 600 b) Secondary fermentation: carried out in a 100-1000L fermenter, with an inoculation ratio of 2-6%, and culturing OD... 600 c) Tertiary fermentation: carried out in a 5000-50000 liter fermenter, with an inoculation ratio of 2-6%, and cultured to OD 45-60; 600 Up to 45-60.

[0070] In some aspects of this application, the tertiary fermentation also includes cell density (OD) 600 Feed culture and induced expression treatment after the value reaches the predetermined value.

[0071] In some aspects of this application, the fed culture treatment uses glycerol as a carbon source.

[0072] In some aspects of this application, the induced expression treatment uses methanol as an inducer.

[0073] In some aspects of this application, the fermentation culture treatment further includes subjecting the fermentation culture product to cell autolysis.

[0074] In some aspects of this application, the cell autolysis treatment is performed by incubation at 2-25°C and 2-5 mol / L NaCl for 4-10 days.

[0075] In some aspects of this application, the method further includes crushing and centrifuging the autolysis product of the bacterial cells.

[0076] In some aspects of this application, the method further includes enzymatic digestion of the products from the crushed and centrifuged process.

[0077] In some aspects of this application, the enzymatic digestion is achieved by using at least one of pepsin and trypsin.

[0078] In some aspects of this application, the purification process includes microfiltration, ultrafiltration, salting out, and chromatography.

[0079] In some aspects of this application, the chromatography includes at least one of anion chromatography and cation chromatography.

[0080] In some aspects of this application, the microfiltration includes at least one of a 0.22 μm filter membrane and a 0.44 μm filter membrane.

[0081] In some aspects of this application, the ultrafiltration includes at least one of a 50kD pore size and a 100kD pore size.

[0082] In some aspects of this application, the salting out includes treatment with a 0.5–3 mol / L sodium chloride solution.

[0083] In a seventh aspect of this application, a recombinant human collagen is provided. According to an embodiment of this application, the recombinant human collagen is prepared by the method described in the sixth aspect of this application; wherein the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen. The recombinant human collagen according to the embodiments of this application has a complete triple helix structure, is non-immunogenic, poses no viral risk, and exhibits high safety and high purity.

[0084] In some aspects of this application, the recombinant human collagen exists in the form of a recombinant human collagen stock solution.

[0085] In some aspects of this application, the stock solution contains recombinant type I human collagen at a concentration of 3.0-5.0 mg / mL, as well as pharmaceutically acceptable solvents and stabilizers.

[0086] In some aspects of this application, the stock solution contains recombinant type III human collagen at a concentration of 3.0-5.0 mg / mL, as well as pharmaceutically acceptable solvents and stabilizers.

[0087] In some aspects of this application, the solvent is selected from at least one of 10-20 mmol / L hydrochloric acid, 10-50 mmol / L phosphate buffer, and 50-100 mmol / L acetic acid.

[0088] In some aspects of this application, the stabilizer is glycerol with a final concentration of 1-2 mol / L.

[0089] In some aspects of this application, the α1 chain of the recombinant type I human collagen has an amino acid sequence as shown in SEQ ID NO:9, the α2 chain has an amino acid sequence as shown in SEQ ID NO:10, and the ratio of the two is 2:1.

[0090] In some aspects of this application, the recombinant type III human collagen has an amino acid sequence as shown in SEQ ID NO:5.

[0091] In some aspects of this application, when the recombinant human collagen is recombinant type I human collagen, the storage temperature of the recombinant type I human collagen is 0 to 30°C, preferably 2 to 25°C.

[0092] In some aspects of this application, the recombinant type I human collagen contains 9-18% hydroxyproline.

[0093] In some aspects of this application, the SEC-HPLC purity of the recombinant type I human collagen is not less than 95%.

[0094] In some aspects of this application, the recombinant type I human collagen contains no more than 0.05% residual host protein.

[0095] In some aspects of this application, the host DNA residue in the recombinant type I human collagen is no higher than 100 pg / mg.

[0096] In some aspects of this application, the endotoxin content in the recombinant type I human collagen is less than 0.1 EU / mg.

[0097] In some aspects of this application, the recombinant type III human collagen contains 9-18% hydroxyproline.

[0098] In some aspects of this application, the SEC-HPLC purity of the recombinant type III human collagen is not less than 95%.

[0099] In some aspects of this application, the recombinant type III human collagen contains no more than 0.05% host protein residue.

[0100] In some aspects of this application, the host DNA residue in the recombinant type III human collagen is no higher than 100 pg / mg.

[0101] In some aspects of this application, the endotoxin content in the recombinant type III human collagen is less than 0.1 EU / mg.

[0102] In the eighth aspect of this application, the use of the recombinant human collagen described in the seventh aspect of this application in the preparation of tissue-engineered products and medical devices is proposed. Beneficial effects:

[0103] 1. The preparation method of this application uses Pichia pastoris strain as the expression system and successfully inserts five genes: recombinant type I human collagen (COL1A1 and COL1A2), human proline hydroxylase (P4Ha2 and P4Hb), and viral proline hydroxylase (vP4H). Through screening of gene copy number and hydroxyproline content, the expressed recombinant type I human collagen sequence is completely consistent with the full-length sequence of natural type I human collagen, and the hydroxyproline content is basically consistent with that of natural type I human collagen. It also has a triple helix structure and possesses the biological activity of natural type I human collagen. Since the sequence composition and length are completely consistent with natural human collagen, it has no immunogenicity and no viral risk.

[0104] 2. The preparation method of this application uses Pichia pastoris strain as the expression system, and successfully inserts four genes: recombinant type III human collagen (COL3A1), human proline hydroxylase (P4Ha2 and P4Hb), and viral proline hydroxylase (vP4H). Through screening of gene copy number and hydroxyproline content, the expressed recombinant type III human collagen sequence is completely consistent with the full-length sequence of natural type III human collagen, and the hydroxyproline content is basically consistent with that of natural type III human collagen. It also has a triple helix structure and possesses the biological activity of natural type III human collagen. Since the sequence composition and length are completely consistent with those of natural type III human collagen, it has no immunogenicity and no viral risk.

[0105] 3. In this application, the C-terminal peptide sequence in the original human COL1A1 and COL1A2 proteins is transformed into an auxiliary folding sequence to obtain the full-length COL1A1 and full-length COL1A2 of this application, thereby increasing the protein expression level.

[0106] 4. The preparation method of this application can be mass-produced with high purity, thus greatly reducing production costs. Attached Figure Description

[0107] Figure 1 shows a plasmid diagram of the human proline hydroxylase P4Hb gene constructed in Example 1 of this application;

[0108] Figure 2 shows a plasmid diagram of the human proline hydroxylase P4Ha2 gene constructed in Example 1 of this application;

[0109] Figure 3 shows the WB detection diagram of human proline hydroxylase P4Hb and P4Ha2 expressed proteins in Example 1 of this application;

[0110] Figure 4 shows a plasmid diagram of the full-length COL1A1 and full-length COL1A2 genes constructed from the full-length recombinant type I human collagen in Example 2 of this application;

[0111] Figure 5 shows an electrophoresis diagram of full-length recombinant type I human collagen expression in Example 2 of this application;

[0112] Figure 6 shows a plasmid diagram of the full-length recombinant type III human collagen COL3A1 gene constructed in Example 2 of this application;

[0113] Figure 7 shows an electrophoresis diagram of the expression of full-length recombinant type III human collagen COL3A1 in Example 2 of this application;

[0114] Figure 8 shows a plasmid diagram of the viral proline hydroxylase vP4H gene constructed in Examples 4 and 5 of this application;

[0115] Figure 9 shows the WB detection diagram of the viral proline hydroxylase vP4H expression protein in Example 5 of this application;

[0116] Figure 10 shows the N / C-terminal sequence identification results of the enzyme-digested COL1A1 protein and the enzyme-digested COL1A2 protein using LC / MS technology in Example 7 of this application;

[0117] Figure 11 shows the sequence coverage detection results of the enzyme-digested COL1A1 protein and the enzyme-digested COL1A2 protein using LC / MS technology in Example 7 of this application;

[0118] Figure 12 shows the SDS-PAGE results of the recombinant type I human collagen after enzyme digestion in Example 7 of this application;

[0119] Figure 13 shows the purity (SEC-HPLC) results of the recombinant type I human collagen after enzymatic digestion in Example 7 of this application;

[0120] Figure 14 shows the circular dichroism (CD) spectrum of the recombinant type I human collagen after enzymatic digestion in Example 7 of this application;

[0121] Figure 15 shows the self-assembly ability of recombinant type I human collagen after enzyme digestion in Example 7 of this application.

[0122] Figure 16 shows the N / C-terminal sequence identification results of recombinant type III human collagen using LC / MS technology in Example 7 of this application;

[0123] Figure 17 shows the sequence coverage results of recombinant type III human collagen using LC / MS technology in Example 7 of this application;

[0124] Figure 18 shows the SDS-PAGE results of recombinant type III human collagen in Example 7 of this application;

[0125] Figure 19 shows the purity (SEC-HPLC) results of recombinant type III human collagen in Example 7 of this application;

[0126] Figure 20 shows the circular dichroism (CD) spectrum of recombinant type III human collagen in Example 7 of this application;

[0127] Figure 21 shows the self-assembly capability results of recombinant type III human collagen in Example 7 of this application;

[0128] Figure 22 shows a comparison electrophoresis diagram of recombinant type I human collagen expressed by the strains before and after the replacement of the auxiliary folding sequence in Example 8 of this application.

[0129] Figure 23 is an electrophoresis diagram of recombinant type I human collagen bacterial cell expression after large-scale fermentation in Example 9 of this application.

[0130] Figure 24 is an electrophoresis diagram showing the identification of α1 and α2 chains of recombinant type I human collagen after large-scale fermentation in Example 9 of this application.

[0131] Figure 25 is an electrophoresis diagram of recombinant type III human collagen bacterial cell expression after large-scale fermentation in Example 9 of this application.

[0132] Figure 26 is an electrophoresis diagram of recombinant type III human collagen cells after pepsin digestion following large-scale fermentation in Example 10 of this application.

[0133] Figure 27 is an electrophoresis diagram of the recombinant type III human collagen cells after autolysis following large-scale fermentation in Example 10 of this application.

[0134] Figure 28 is an SDS-PAGE image of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0135] Figure 29 shows the purity (SDS-PAGE) of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0136] Figure 30 is a liquid phase diagram of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0137] Figure 31 is a liquid phase diagram showing the hydroxyproline content of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0138] Figure 32 is a diagram of the recombinant type I human collagen protein stock solution peptides produced on a large scale in Test Example 1 of this application.

[0139] Figure 33 is a circular dichroic chromatogram of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0140] Figure 34 is a diagram of the self-assembly of recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0141] Figure 35 shows the thermal stability of the recombinant type I human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0142] Figure 36 is an electrophoresis diagram of the recombinant type III human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0143] Figure 37 is a liquid phase diagram of the recombinant type III human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0144] Figure 38 is a diagram of the recombinant type III human collagen protein stock solution peptides produced on a large scale in Test Example 1 of this application.

[0145] Figure 39 is a circular dichroic chromatogram of the recombinant type III human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0146] Figure 40 is a self-assembly diagram of the recombinant type III human collagen stock solution produced on a large scale in Test Example 1 of this application.

[0147] Figure 41 shows the m / z and matching molecular weight diagram of the disulfide bond analysis of the recombinant type III human collagen stock solution produced on a large scale in Test Example 1 of this application. Detailed Implementation

[0148] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0149] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0150] To facilitate understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this invention, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0151] In this invention, the terms "comprising" or "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0152] In this invention, the terms “optionally,” “optionally,” or “optionally” generally refer to events or conditions described subsequently that may but may not occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0153] In this invention, the term "recombinant human collagen" refers to collagen produced by host cells through the introduction of a gene sequence encoding human collagen into host cells using genetic engineering techniques. Its amino acid sequence is identical to or highly homologous to natural human collagen.

[0154] In this invention, the term "procollagen" refers to procollagen expressed by genetically engineered bacteria (such as Pichia pastoris), whose sequence is consistent with or partially optimized as the precursor form of natural human collagen. The expressed procollagen retains its telopeptide structure after fermentation and needs to be removed by enzymatic digestion (such as pepsin) to obtain mature recombinant human collagen with a complete triple helix structure. For example, type I procollagen includes an α1 chain (SEQ ID NO: 1 or 2) and an α2 chain (SEQ ID NO: 3 or 4); type III procollagen is shown in SEQ ID NO: 11. It should be noted that "type III procollagen" is synonymous with "full-length recombinant type III human collagen".

[0155] In this invention, the term "full-length sequence" refers to the complete amino acid sequence containing all the natural functional domains of the protein (such as N-terminal telopeptide, triple helix region, C-terminal telopeptide, etc.), that is, the full-length α1 and α2 sequences of type I procollagen, which are consistent with the sequence composition of the natural protein.

[0156] In this invention, the term "proline hydroxylase" refers to a key enzyme that catalyzes the hydroxylation of proline residues in collagen peptide chains into hydroxyproline residues. This modification is crucial for the stability and thermal stability of the collagen triple helix structure. The terms "P4Ha2" and "P4Hb" refer to human proline hydroxylases, which function as tetramers, catalyzing the conversion of proline residues on collagen into hydroxyproline residues. The term "vP4H" is a viral proline hydroxylase, co-expressed with P4Ha2 and P4Hb, which enhances the conversion of proline residues on collagen into hydroxyproline residues, promoting the formation and structural stability of the triple helix structure.

[0157] In this invention, the term "triple helix structure" refers to the unique high-order spatial structure of collagen molecules, which consists of three polypeptide chains intertwined to form a stable right-handed superhelical conformation. This structure is fundamental to maintaining the biological function and stability of collagen.

[0158] In this invention, the term "Pichia pastoris" refers to a methyltrophic yeast commonly used as a host bacterium for the expression of exogenous proteins. It possesses the protein processing capabilities of eukaryotic cells, the ability to perform post-translational modifications (such as proline hydroxylation), and can undergo high-density fermentation, making it suitable for the industrial production of recombinant proteins.

[0159] In this invention, the term "genetically engineered bacteria" refers to engineered microbial strains that have been introduced into host cells (such as Pichia pastoris) through molecular biology techniques, enabling them to be stably inherited and efficiently expressed.

[0160] In this invention, the term "three-stage fermentation" refers to a fermentation process that is scaled up step by step, including inoculating the seed culture into first-stage, second-stage, and third-stage fermenters of progressively increasing volume for cultivation, with the aim of obtaining high-biomass cells to prepare for final large-scale induced expression.

[0161] In this invention, the term "high-density fermentation" refers to achieving a high cell density (typically expressed as OD) in the fermentation broth through optimized culture conditions and feeding strategies. 600 Fermentation technologies that achieve a high level of yield (measured by value) aim to increase the yield per unit volume of the target product.

[0162] In this invention, the term "induced expression" refers to the process of initiating the transcription and translation of a target gene within a host cell during fermentation by adding a specific chemical inducer (such as methanol), thereby synthesizing a large quantity of the target protein.

[0163] In this invention, the term "host protein residue" refers to non-target protein impurities derived from host cells (such as Pichia pastoris) that remain in the purified final product. Their content is an important indicator for evaluating product purity.

[0164] In this invention, the term "host DNA residue" refers to nucleic acid impurities derived from host cells or expression vectors that remain in the purified final product. Their content is a key indicator for evaluating product safety.

[0165] In this invention, the term "hydroxyproline content" refers to the percentage of hydroxyproline residues in the total amino acid mass of collagen molecules, or the percentage of the number of moles of hydroxyproline residues in the total number of moles of proline. This value is a core characteristic indicator for identifying the authenticity of collagen and evaluating the correctness and stability of its triple helix structure.

[0166] In this invention, the term "SEC-HPLC purity" refers to the percentage of the target protein's main peak area relative to the total peak area when detected using size exclusion chromatography-high performance liquid chromatography. This value is used to quantitatively evaluate the molecular weight uniformity and purity of the product.

[0167] In this invention, the term "anion exchange chromatography" refers to a purification technique that uses the difference in surface charge between the target protein and impurities under specific pH conditions to cause different electrostatic interactions between them and positively charged chromatographic packing material, thereby achieving separation and purification.

[0168] This invention proposes a method for preparing recombinant human collagen, particularly a method for preparing recombinant type I human collagen and recombinant type III human collagen. More specifically, it relates to a recombinant protein, recombinant human collagen, a composition, a method for preparing recombinant human collagen, and their uses, which will be described in detail below.

[0169] method

[0170] In a first aspect, this application provides a method for preparing recombinant human collagen. According to an embodiment of this application, the method includes: constructing a genetically engineered bacterium expressing proline hydroxylase and recombinant human collagen; culturing the genetically engineered bacterium; and performing enzymatic digestion of the culture product with pepsin to obtain the recombinant human collagen; wherein the recombinant human collagen is recombinant type I human collagen or recombinant type III human collagen; when the recombinant human collagen is recombinant type I human collagen: the recombinant type I human collagen includes a full-length COL1A1 protein and a full-length COL1A2 protein; the amino acid sequence of the full-length COL1A1 is as shown in SEQ ID NO: 1 or 2, and the amino acid sequence of the full-length COL1A2 is as shown in SEQ ID NO: 1. As shown in NO:3 or 4; the proline hydroxylase includes P4Ha2, P4Hb, and vP4H; the copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1, and full-length COL1A2 is (1.80–2.20): (1.80–2.20): (0.80–1.50): (1.80–2.20): 1; when the recombinant human collagen is recombinant type III human collagen: the amino acid sequence of the full-length recombinant type III human collagen is shown in SEQ ID NO:11; the proline hydroxylase includes P4Ha2, P4Hb, and vP4H; the copy number ratio of P4Ha2, P4Hb, vP4H, and full-length recombinant type III human collagen is (1.80–2.20): (1.80–2.20): (0.80–1.60): 1. The preparation method described in this application allows for large-scale production with high purity, while significantly reducing production costs. Furthermore, the recombinant human collagen sequence obtained by this method is completely identical to that of natural human collagen, with a hydroxyproline content essentially the same, and possesses a triple helix structure. It exhibits all the biological activities of natural human collagen, and because it is entirely a human-derived sequence, it has no immunogenicity and poses no viral risk.

[0171] Furthermore, in the preparation method of this application, by converting the C-terminal peptide sequence in the original human COL1A1 and COL1A2 proteins into an auxiliary folding sequence, the full-length COL1A1 and full-length COL1A2 of this application are obtained, which can further improve the protein expression level.

[0172] According to embodiments of this application, the above method may further include at least one of the following technical features:

[0173] According to an embodiment of this application, the copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1 and full-length COL1A2 is (1.80~2.20):(1.80~2.20):(0.80~1.50):(1.80~2.20):1. Therefore, the copy number ratio of P4Ha2 to full-length COL1A2 is 1.80:1, 1.85:1, 1.90:1, 1.95:1, 2.00:1, 2.05:1, 2.10:1, 2.15:1, 2.20:1, or any range between two endpoints; the copy number ratio of P4Hb to full-length COL1A2 is 1.80:1, 1.85:1, 1.90:1, 1.95:1, 2.00:1, 2.05:1, 2.10:1, 2.15:1, 2.20:1, or any range between two endpoints; the copy number ratio of vP4H to full-length COL1A2 is 0. The ratio of the number of copies of full-length COL1A1 to full-length COL1A2 is 1.80:1, 1.85:1, 0.90:1, 0.95:1, 1.00:1, 1.05:1, 1.10:1, 1.15:1, 1.20:1, 1.25:1, 1.30:1, 1.35:1, 1.40:1, 1.45:1, 1.50:1, or any range between two endpoints; the ratio of the number of copies of full-length COL1A1 to full-length COL1A2 is 1.80:1, 1.85:1, 1.90:1, 1.95:1, 2.00:1, 2.05:1, 2.10:1, 2.15:1, 2.20:1, or any range between two endpoints.

[0174] It should be noted that the copy number in this application refers to the copy number among the genes encoding the above-mentioned proteins.

[0175] According to embodiments of this application, the copy number ratio of P4Ha2, P4Hb, vP4H, and full-length recombinant type III human collagen is (1.80–2.20):(1.80–2.20):(0.80–1.60):1. Therefore, the copy number ratio of P4Ha2 to full-length recombinant type III human collagen is 1.80:1, 1.85:1, 1.90:1, 1.95:1, 2.00:1, 2.05:1, 2.10:1, 2.15:1, 2.20:1, or any range between any two endpoints thereof; the copy number ratio of P4Hb to full-length recombinant type III human collagen is 1.80:1, 1.85:1, 1.90:1, 1.95:1, 2.00:1, 2.05:1, 2.10:1, 2.15:1, 2.20:1, or any range between any two endpoints thereof. 1, 2.20:1 or any range between two endpoints; the ratio of vP4H to full-length recombinant type III human collagen copy number is 0.80:1, 0.85:1, 0.90:1, 0.95:1, 1.00:1, 1.05:1, 1.10:1, 1.15:1, 1.20:1, 1.25:1, 1.30:1, 1.35:1, 1.40:1, 1.45:1, 1.50:1, 1.55:1, 1.60:1 or any range between two endpoints.

[0176] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1 and full-length COL1A2 is (1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):1.

[0177] It should be noted that "the full-length COL1A1 and full-length COL1A2 of this application are obtained by converting the C-terminal peptide sequence in the original full-length COL1A1 and COL1A2 sequences into an auxiliary folding sequence", and the amino acid sequence of the auxiliary folding sequence is shown in SEQ ID NO:12.

[0178] DIPRAPRDGQAYVEKDGEWVFLSTFLSFA (SEQ ID NO: 12).

[0179] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the ratio of the copy numbers of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90~2.10):(1.90~2.10):(0.90~1.10):1.

[0180] According to an embodiment of this application, the amount of pepsin added to the culture product is 100-500 U / L.

[0181] According to the embodiments of this application, the temperature of the enzymatic digestion treatment is 2 to 10°C.

[0182] According to the embodiments of this application, the enzyme digestion treatment time is 16 to 30 hours.

[0183] According to an embodiment of this application, the amino acid sequence of P4Ha2 is shown in SEQ ID NO:6.

[0184] According to an embodiment of this application, the amino acid sequence of P4Hb is shown in SEQ ID NO:7.

[0185] According to an embodiment of this application, the amino acid sequence of vP4H is shown in SEQ ID NO:8.

[0186] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the amino acid sequence of the enzyme-digested COL1A1 is shown in SEQ ID NO:9, and the amino acid sequence of the enzyme-digested COL1A2 is shown in SEQ ID NO:10.

[0187] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the amino acid sequence of COL3A1 after enzymatic digestion is shown in SEQ ID NO:5.

[0188] According to embodiments of this application, the genetically engineered bacteria are selected from Pichia pastoris strains. Exemplarily, Pichia pastoris strains include, but are not limited to, Pichia pastoris strain GS115, Pichia pastoris strain X33, Pichia pastoris strain GS190, and Pichia pastoris strain KM71. According to an optional embodiment of this application, the Pichia pastoris strain is selected from Pichia pastoris strain GS115.

[0189] According to an embodiment of this application, the method further includes: purifying the enzyme digestion product.

[0190] According to an embodiment of this application, the purification process consists of microfiltration, salting out, chromatography, and ultrafiltration.

[0191] According to embodiments of this application, the microfiltration process is performed using a filter membrane with a pore size of 0.22 μm or larger. This removes cellular impurities.

[0192] According to embodiments of this application, the salting-out treatment is performed using a 0.5–3 mol / L sodium chloride solution. According to embodiments of this application, the salting-out treatment time is 16–30 hours. Thus, recombinant type I and type III human collagen precipitates can be obtained.

[0193] According to an embodiment of this application, the salting-out treatment takes 16 to 30 hours.

[0194] According to an embodiment of this application, the chromatography process is performed using ion exchange chromatography.

[0195] According to embodiments of this application, the ultrafiltration process is performed using a retardant membrane with a molecular weight of 50 kD or higher. This allows for the preparation of a retardant solution, which concentrates recombinant type I and type III human collagen.

[0196] According to an embodiment of this application, the purity of the recombinant type I human collagen is greater than 95%.

[0197] According to an embodiment of this application, the purity of the recombinant type III human collagen is greater than 95%.

[0198] According to embodiments of this application, when the recombinant human collagen is recombinant type I human collagen, the hydroxyproline content in the recombinant type I human collagen is greater than 10.5%. The degree of proline hydroxylation in the recombinant type I human collagen of this application is close to that of natural type I human collagen, thereby further reducing the problem of triple helix instability.

[0199] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the hydroxyproline content in the recombinant type III human collagen is greater than 16.5%. The degree of proline hydroxylation in the recombinant type III human collagen of this application is close to that of natural type III human collagen, thereby further reducing the problem of triple helix instability.

[0200] In this article, the terms “hydroxyproline content” and “proline hydroxylation degree” are synonymous.

[0201] According to the embodiments of this application, the hydroxyproline content in the recombinant type I human collagen is 10.5% to 11.5%. The hydroxyl groups on hydroxyproline are crucial for the formation of intra- and inter-chain hydrogen bonds, maintaining the stability of the triple helix structure of collagen, and exerting biological functions in vivo. When the degree of proline hydroxylation is 10.5% to 11.5%, preferably 10.5% to 11.0%, it is beneficial for the recombinant type I human collagen to form a triple helix structure and maintain the stability of the triple helix structure.

[0202] According to the embodiments of this application, the hydroxyproline content in the recombinant type III human collagen is 16.6% to 17.5%. The hydroxyl groups on hydroxyproline are crucial for the formation of intra- and inter-chain hydrogen bonds, maintaining the stability of the triple helix structure of collagen, and exerting biological functions in vivo. When the degree of proline hydroxylation is 16.6% to 17.5%, preferably 16.6% to 16.9%, it is beneficial for the recombinant type III human collagen to form a triple helix structure and maintain the stability of the triple helix structure.

[0203] According to embodiments of this application, the recombinant type I human collagen has a complete triple helix structure. The recombinant type I human collagen in this application has a complete triple helix structure, which is similar to that of natural type I human collagen, thereby further reducing the problem of triple helix instability.

[0204] According to embodiments of this application, the recombinant type III human collagen has a complete triple helix structure. The recombinant type III human collagen in this application has a complete triple helix structure, which is similar to that of natural type III human collagen, thereby further reducing the problem of triple helix instability.

[0205] According to an embodiment of this application, in a circular dichroism spectrum, the recombinant type I human collagen has a negative absorption peak at a wavelength of 190–200 nm and a positive absorption peak at a wavelength of 210–230 nm.

[0206] It should be noted that, as is known to those skilled in the art, the presence of both a negative absorption peak near 197 nm and a positive absorption peak near 221 nm in a circular dichroism spectrum is the gold standard for collagen to have a correct and complete triple helix structure.

[0207] According to an embodiment of this application, the recombinant type I human collagen has a negative absorption peak at a wavelength of 192–198 nm.

[0208] According to an embodiment of this application, the recombinant type I human collagen has a positive absorption peak at a wavelength of 215–225 nm.

[0209] In an optional embodiment of this application, the recombinant type I human collagen of this application has the following characteristics: (1) Structural composition, which is 100% homologous to the sequence of natural type I human collagen, including complete consistency with the full-length amino acid sequence composition and collagen length of natural type I human collagen; (2) The degree of post-translational modification, i.e. the degree of proline hydroxylation, is close to or consistent with that of natural type I human collagen, which is an important basis for the formation of the triple helix structure of collagen; (3) It has a complete triple helix structure, which is a necessary basis and condition for natural collagen to exert its biological function in vivo; (4) It has biological activity compared with animal-derived collagen.

[0210] According to an embodiment of this application, in a circular dichroism spectrum, the recombinant type III human collagen has a negative absorption peak at a wavelength of 190–200 nm and a positive absorption peak at a wavelength of 210–230 nm.

[0211] It should be noted that, as is known to those skilled in the art, the presence of both a negative absorption peak near 197 nm and a positive absorption peak near 221 nm in a circular dichroism spectrum is the gold standard for collagen to have a correct and complete triple helix structure.

[0212] According to an embodiment of this application, the recombinant type III human collagen has a negative absorption peak at a wavelength of 192–198 nm.

[0213] According to an embodiment of this application, the recombinant type III human collagen has a positive absorption peak at a wavelength of 215–225 nm.

[0214] In an optional embodiment of this application, the recombinant type III human collagen that is consistent with natural type III human collagen in this application must have the following characteristics: (1) Structural composition, which is 100% homologous to the sequence of natural type III human collagen, including complete consistency with the full-length amino acid sequence composition and collagen length of natural type III human collagen; (2) Post-translational modification degree, that is, the degree of proline hydroxylation is close to or consistent with that of natural type III human collagen, which is an important basis for the formation of the triple helix structure of collagen; (3) Having a complete triple helix structure, which is a necessary basis and condition for natural collagen to exert its biological function in vivo; (4) Having biological activity compared with animal-derived collagen.

[0215] Recombinant protein

[0216] In a second aspect, this application provides a recombinant protein. According to embodiments of this application, the amino acid sequence of the recombinant protein is as shown in SEQ ID NO:2 or 4. This application transforms the C-terminal peptide sequences of the original human COL1A1 and COL1A2 proteins into helper folding sequences, thereby increasing the expression level of recombinant type I human collagen when preparing recombinant type I human collagen using the aforementioned recombinant protein.

[0217] use

[0218] In a third aspect, this application discloses the use of the recombinant protein described in the second aspect in the preparation of recombinant type I human collagen. This application transforms the C-terminal telopeptide sequences of the original human COL1A1 and COL1A2 proteins into helper folding sequences, thereby increasing the expression level of recombinant type I human collagen when using the aforementioned recombinant protein to prepare it.

[0219] Recombinant human collagen

[0220] In a fourth aspect, this application discloses a recombinant human collagen. According to an embodiment of this application, the recombinant human collagen is prepared using the method described in the first aspect. Therefore, the recombinant human collagen sequence of this application is completely identical to the full-length sequence of natural human collagen, the hydroxyproline content is substantially the same as that of natural human collagen, and it possesses a triple helix structure, exhibiting the complete biological activity of natural human collagen. Because it is entirely a human-derived sequence, it has no immunogenicity and poses no viral risk.

[0221] Composition

[0222] In a fifth aspect of this application, a composition is provided. According to embodiments of this application, the composition comprises recombinant human collagen prepared by the method described in the first aspect. Therefore, the composition of this application is non-immunogenic and poses no viral risk.

[0223] According to embodiments of this application, the composition may further include excipients, such as at least one selected from recombinant human collagen hydrogel, repair fluid, solution or dressing, recombinant human collagen cross-linked or non-cross-linked facial filler, recombinant human collagen artificial dermis, recombinant human collagen sponge and recombinant human collagen bone repair material.

[0224] According to embodiments of this application, the composition is selected from at least one of recombinant type I human collagen hydrogel, recombinant type I human collagen repair fluid, recombinant type I human collagen solution, or recombinant type I human collagen dressing, recombinant type I human collagen cross-linked or non-cross-linked facial filler, recombinant type I human collagen artificial dermis, recombinant type I human collagen sponge, and recombinant type I human collagen bone repair material.

[0225] According to embodiments of this application, the composition is selected from at least one of recombinant type III human collagen hydrogel, recombinant type III human collagen repair fluid, recombinant type III human collagen solution, or recombinant type III human collagen dressing, recombinant type III human collagen cross-linked or non-cross-linked facial filler, recombinant type III human collagen artificial dermis, recombinant type III human collagen sponge, and recombinant type III human collagen bone repair material.

[0226] method

[0227] In a sixth aspect of this application, a method for large-scale preparation of recombinant human collagen is provided. According to an embodiment of this application, the method includes: fermenting engineered bacteria to express pre-collagen; purifying the fermentation product to obtain recombinant human collagen; wherein the fermentation is a three-stage fermentation, and the final fermentation volume of the three-stage fermentation is not less than 9000 liters; the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen; when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(1.80~ 2.20):1; or P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2=(1.80~2.20):(1.80~2.20):(0.80~1.50):(1.80~2.20):1; and / or, when the recombinant human collagen is recombinant type III human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL3A1=(1.80~2.20):(1.80~2.20):1, or P4Ha2:P4Hb:vP4H:full-length COL3A1=(1.80~2.20):(1.80~2.20):(0.80~1.60):1. Those skilled in the art will understand that the final fermentation volume can be further scaled up. The method according to the embodiments of this application can prepare recombinant human collagen with a complete triple helix structure, no immunogenicity, no viral risk, and high purity.

[0228] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(1.80~2.20):1.

[0229] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):1.

[0230] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the ratio of the copy numbers of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90~2.10):(1.90~2.10):(0.90~1.10):1.

[0231] According to embodiments of this application, the engineered bacteria include at least one of Pichia pastoris and Saccharomyces cerevisiae.

[0232] According to embodiments of this application, the procollagen, from its N-terminus to its C-terminus, sequentially comprises an N-terminal telopeptide, a triple-helix region, and a C-terminal telopeptide. The C-terminus of the N-terminal telopeptide is connected to the N-terminus of the triple-helix region, and the C-terminus of the triple-helix region is connected to the N-terminus of the C-terminal telopeptide. It should be noted that "procollagen" includes "telopeptides," while "recombinant human collagen" is the product obtained by enzymatic cleavage of "procollagen" to remove the "telopeptides."

[0233] According to embodiments of this application, the engineered bacteria co-express proline hydroxylase.

[0234] According to embodiments of this application, the proline hydroxylase includes at least one of human proline hydroxylase and viral proline hydroxylase.

[0235] According to embodiments of this application, the procollagen includes type I procollagen or type III procollagen.

[0236] According to embodiments of this application, the recombinant type I human collagen is a recombinant protein whose sequence composition and length are completely identical to those of natural type I human collagen.

[0237] According to embodiments of this application, the recombinant type III human collagen is a recombinant protein whose sequence composition and length are completely identical to those of natural type III human collagen.

[0238] According to an embodiment of this application, the structure of the recombinant type I human collagen includes two α1 chains and one α2 chain.

[0239] According to an embodiment of this application, the structure of the recombinant type III human collagen includes three α1 chains.

[0240] According to an embodiment of this application, the α1 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:9, and the α2 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:10.

[0241] According to embodiments of this application, the α1 chain of the recombinant type III human collagen has the amino acid sequence shown in SEQ ID NO:5. It should be noted that the amino acid sequence of the recombinant type III human collagen in this application is the amino acid sequence of procollagen after removing the N-terminal and C-terminal telopeptides. It should also be noted that SEQ ID NO:5 is the amino acid sequence of recombinant type III human collagen (after enzymatic cleavage to remove telopeptides).

[0242] According to embodiments of this application, the α1 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:1 or 2, and the α2 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:3 or 4.

[0243] According to an embodiment of this application, the type III procollagen has an amino acid sequence as shown in SEQ ID NO:11.

[0244] According to an embodiment of this application, the fermentation culture treatment includes a seed revival treatment prior to the fermentation culture treatment.

[0245] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing OD at a temperature of 25-30°C and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.0.

[0246] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing OD at a temperature of 28-35°C and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.0.

[0247] According to an embodiment of this application, the three-stage fermentation includes: a) primary fermentation: carried out in a 10-50L fermenter, with an inoculation ratio of 2-6%, and culturing OD... 600 b) Secondary fermentation: carried out in a 100-1000L fermenter, with an inoculation ratio of 2-6%, and culturing OD... 600 c) Tertiary fermentation: carried out in a 5000-50000 liter fermenter, with an inoculation ratio of 2-6%, and cultured to OD 45-60; 600 Up to 45-60.

[0248] According to an embodiment of this application, the three-stage fermentation includes: a) Primary fermentation: 8-12L of culture medium is loaded into a 10-50L fermenter, and seed culture is inoculated at an inoculation ratio of 2-6%. OD6 is cultured under the conditions of stirring speed of 200-800rpm, temperature of 28-35℃, pH of 4-6, and dissolved oxygen of 15-35%. 00 a) Secondary fermentation: 150-300L of culture medium is added to a 100-1000L fermenter, and the primary fermentation broth is inoculated at a 2-6% inoculation ratio. The OD600 is cultured to 45-60 under the following conditions: a) Stirring speed of 200-600rpm, temperature of 28-35℃, pH of 4-6, and dissolved oxygen of 15-35%; b) Tertiary fermentation: 8000-12000L of culture medium is added to a 5000-50000L fermenter, and the secondary fermentation broth is inoculated at a 2-6% inoculation ratio. The OD600 is cultured to 45-60 under the following conditions: a) Stirring speed of 200-600rpm, temperature of 28-35℃, pH of 4-6, and dissolved oxygen of 15-35%. 600 Up to 45-60.

[0249] According to the embodiments of this application, the inoculum ratio for the primary fermentation is 3-5%, the culture temperature is 30-32℃, the pH is 5-5.5, the dissolved oxygen is 25-30%, and the culture OD... 600 Up to 50-55.

[0250] According to the embodiments of this application, the inoculation ratio of the secondary fermentation is 3-5%, the culture temperature is 30-32℃, the pH is 5-5.5, the dissolved oxygen is 25-30%, and the culture OD is 600 to 50-55.

[0251] According to the embodiments of this application, the inoculation ratio of the three-stage fermentation is 2-5%, the culture temperature is 30-32℃, the pH is 5-5.5, the dissolved oxygen is 25-30%, and the culture OD is 600 to 50-55.

[0252] According to an embodiment of this application, the three-stage fermentation further includes fed-batch culture treatment and induced expression treatment after the cell density reaches a predetermined value.

[0253] According to an embodiment of this application, the fed culture treatment uses glycerol as a carbon source.

[0254] According to an embodiment of this application, the induced expression treatment uses methanol as an inducer.

[0255] According to an embodiment of this application, the fed-batch culture treatment involves adding 40-65% glycerol at a rate of 70-140 kg / h for 20-30 hours, and culturing the OD under conditions of 120-220 rpm stirring speed, 28-35°C temperature, pH 4-6, and dissolved oxygen 0-35%. 600 When the dissolved oxygen level reaches 300-450 and continues to increase significantly, stop feeding and continue culturing for another 100-400 minutes until the glycerol is depleted.

[0256] According to an embodiment of this application, the fed-batch culture treatment is achieved by adding 45-50% glycerol at a feeding rate of 90-120 kg / h for 22-26 hours, under the conditions of a stirring speed of 150-200 rpm, a temperature of 30-32°C, a pH of 5-5.5, and a dissolved oxygen of 0-35%.

[0257] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the induction expression treatment involves adding methanol at a rate of 0.5-3 g / L·h for 24 hours, then increasing to 2-6 g / L·h after 24 hours, inducing for 100-300 hours, and culturing the OD under conditions of a stirring speed of 120-220 rpm, a temperature of 20-25°C, a pH of 5-8, and a dissolved oxygen content of 0-35%. 600 It was achieved at 300-500.

[0258] According to the embodiments of this application, when the recombinant human collagen is recombinant type III human collagen, the induction expression treatment involves adding methanol at a rate of 0.5-3 g / L·h for 24 hours, then increasing to 2-6 g / L·h after 24 hours, inducing for 60-200 hours, and culturing the OD under conditions of a stirring speed of 120-220 rpm, a temperature of 29-36°C, a pH of 5-8, and a dissolved oxygen content of 0-35%. 600 It was achieved at 300-500.

[0259] According to an embodiment of this application, when the recombinant human collagen is recombinant type I human collagen, the induction expression treatment is carried out at a methanol addition rate of 1-2 g / L·h for 24 hours, 3-5 g / L·h after 24 hours, for 80-250 hours, under the conditions of a stirring speed of 150-200 rpm, a temperature of 20-25°C, a pH of 6-7, and a dissolved oxygen content of 0-25%.

[0260] According to an embodiment of this application, when the recombinant human collagen is recombinant type III human collagen, the induction expression treatment is carried out at a methanol addition rate of 1-2 g / L·h for 24 hours, 3-5 g / L·h after 24 hours, for 70-150 hours, under the conditions of a stirring speed of 150-200 rpm, a temperature of 31-34℃, a pH of 6-7, and a dissolved oxygen of 0-25%.

[0261] According to embodiments of this application, the fermentation culture treatment further includes subjecting the fermentation culture product to cell autolysis. It should be explained that the purpose of cell autolysis is to facilitate the release of procollagen expressed within the cells during disruption, reduce disruption stress, and allow enzymes within the cells to degrade their own proteins, thereby reducing the residue of host proteins.

[0262] According to the embodiments of this application, the cell autolysis treatment is performed by incubation at 2-25°C and 2-5 mol / L NaCl for 4-10 days.

[0263] According to embodiments of this application, the method further includes centrifuging the autolysis product. It should be explained that this centrifugation step is used to remove the Pichia pastoris host DNA released after centrifugation; this step removes the host DNA released along with the breakdown of procollagen.

[0264] According to embodiments of this application, the method further includes enzymatic digestion of the crushed and centrifuged product.

[0265] According to embodiments of this application, the enzymatic digestion is achieved by using at least one of pepsin and trypsin.

[0266] According to embodiments of this application, the purification process includes microfiltration, ultrafiltration, salting out, and chromatography.

[0267] According to embodiments of this application, the chromatography includes at least one of anion chromatography and cation chromatography.

[0268] According to the embodiments of this application, the enzymatic digestion is carried out under the conditions of a final enzyme concentration of 200-800 U / L, pH of 1.8-3.0, and temperature of 2-20°C for 4-30 hours, and the pH is adjusted to 8-10 to terminate the reaction after the reaction is completed.

[0269] According to embodiments of this application, the microfiltration includes at least one of a 0.22 μm filter membrane and a 0.44 μm filter membrane.

[0270] According to embodiments of this application, the ultrafiltration includes at least one of a 50kD pore size and a 100kD pore size.

[0271] According to an embodiment of this application, the salting out includes treatment with a 0.5–3 mol / L sodium chloride solution.

[0272] According to an embodiment of this application, the salting out is achieved by incubation for 2-24 hours in sodium chloride or ammonium sulfate at a concentration of 1-3 mol / L and a temperature of 2-10°C.

[0273] According to an embodiment of this application, the anion chromatography is performed at a linear flow rate of 100-350 cm / h.

[0274] Recombinant human collagen

[0275] In a seventh aspect of this application, a recombinant human collagen is provided. According to an embodiment of this application, the recombinant human collagen is prepared by the method described in the sixth aspect of this application; wherein the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen. The recombinant human collagen according to the embodiment of this application has a complete triple helix structure, is non-immunogenic, free of viral risks, and has high purity.

[0276] According to an embodiment of this application, the recombinant human collagen exists in the form of a recombinant human collagen stock solution.

[0277] According to embodiments of this application, the stock solution contains recombinant type I human collagen at a concentration of 3.0-5.0 mg / mL, as well as pharmaceutically acceptable solvents and stabilizers.

[0278] According to embodiments of this application, the stock solution contains recombinant type III human collagen at a concentration of 3.0-5.0 mg / mL, as well as pharmaceutically acceptable solvents and stabilizers.

[0279] According to embodiments of this application, the solvent is selected from at least one of 10-20 mmol / L hydrochloric acid, 10-50 mmol / L phosphate buffer, and 50-100 mmol / L acetic acid.

[0280] According to embodiments of this application, the stabilizer is glycerol with a final concentration of 1-2 mol / L, for example, it can be 1 mol / L, 1.1 mol / L, 1.2 mol / L, 1.3 mol / L, 1.4 mol / L, 1.5 mol / L, 1.6 mol / L, 1.7 mol / L, 1.8 mol / L, 1.9 mol / L, 2.0 mol / L, or a range between the two, such as 1.1-2 mol / L or 1.2-2 mol / L.

[0281] According to an embodiment of this application, the α1 chain of the recombinant type I human collagen has an amino acid sequence as shown in SEQ ID NO:9, and the α2 chain has an amino acid sequence as shown in SEQ ID NO:10, with a ratio of 2:1.

[0282] According to embodiments of this application, the recombinant type III human collagen has an amino acid sequence as shown in SEQ ID NO:5.

[0283] According to embodiments of this application, when the recombinant human collagen is recombinant type I human collagen, the storage temperature of the recombinant type I human collagen is 0–30°C, preferably 2–25°C. According to embodiments of this application, the storage temperature of the recombinant type I human collagen is 0–30°C, for example, it can be 0°C, 2°C, 4°C, 6°C, 8°C, 10°C, 12°C, 14°C, 16°C, 18°C, 20°C, 22°C, 23°C, 24°C, 25°C, 26°C, 28°C, 30°C, or a range between the two, 2–30°C, 2–28°C, preferably 2–25°C.

[0284] According to embodiments of this application, the recombinant human collagen contains 9-18% hydroxyproline.

[0285] According to embodiments of this application, the SEC-HPLC purity of the recombinant human collagen is not less than 95%.

[0286] According to embodiments of this application, the recombinant human collagen contains no more than 0.05% residual host protein.

[0287] According to embodiments of this application, the residual host DNA in the recombinant human collagen is no higher than 100 pg / mg.

[0288] According to embodiments of this application, the endotoxin content in the recombinant human collagen is less than 0.1 EU / mg.

[0289] According to embodiments of this application, the hydroxyproline content in the recombinant type I human collagen is 9-18%, for example, it can be 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, or a range between the two, such as 13-18% or 14-18%.

[0290] According to embodiments of this application, the molar percentage of hydroxyproline in the recombinant type I human collagen is 30%-50%, for example, it can be 30%, 32%, 34%, 36%, 38%, 40%, 42%, 44%, 46%, 48%, 50%, or a range between the two, such as 32%-50% or 34%-50%.

[0291] According to embodiments of this application, the SEC-HPLC purity of the recombinant type I human collagen is not less than 95%.

[0292] According to embodiments of this application, the recombinant type I human collagen contains no more than 0.05% residual host protein.

[0293] According to embodiments of this application, the residual host DNA in the recombinant type I human collagen is no higher than 100 pg / mg.

[0294] According to an embodiment of this application, the endotoxin content in the recombinant type I human collagen is less than 0.1 EU / mg.

[0295] According to the embodiments of this application, the SEC-HPLC purity of the recombinant type III human collagen is not less than 95%.

[0296] According to embodiments of this application, the recombinant type III human collagen contains no more than 0.05% residual host protein.

[0297] According to embodiments of this application, the residual host DNA in the recombinant type III human collagen is no higher than 100 pg / mg.

[0298] According to an embodiment of this application, the endotoxin content in the recombinant type III human collagen is less than 0.1 EU / mg.

[0299] use

[0300] In the eighth aspect of this application, the use of the recombinant human collagen described in the seventh aspect of this application in the preparation of tissue-engineered products and medical devices is proposed.

[0301] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0302] Example 1: Construction of Pichia pastoris strain containing human proline hydroxylase

[0303] Synthesize the gene for P4H hydroxylase (the amino acid sequence of P4Ha2 is shown in SEQ ID NO:6, and the nucleotide sequence encoding P4Ha2 is shown in SEQ ID NO:13; the amino acid sequence of P4Hb is shown in SEQ ID NO:7, and the nucleotide sequence encoding P4Hb is shown in SEQ ID NO:14).

[0304] Construction of the GS115-P4Hb strain expressing human proline hydroxylase P4Hb protein:

[0305] The AOX1 promoter gene and α-factor secretion signal gene were synthesized upstream of the P4Hb gene and inserted together between Bgl II and Not I on pGAPZA to construct the pPIC-P4Hb plasmid, as shown in Figure 1. Using plasmid pPIC-P4Hb as a template, the fragment was amplified using primers AOX1F11: AAACGCTGTCTTGGAACCTAATATGACAAAAG (SEQ ID NO:17) and AOX1R11: AAACTGTCAGTTTTGGGCCATTTGGGGAACATG (SEQ ID NO:18). The fragment was recovered by agarose gel electrophoresis and electrotransformed into Pichia pastoris GS115. Positive colonies were screened by incubation on YPD plates containing 50 μg / ml bleomycin (Zeo) at 28°C for 2-3 days. Single clones from the YPD selection plate were cultured in BMGY medium and induced to express for 72 h. Samples were taken and Western blot (WB) was performed using anti-P4Hb antibody. The pattern is shown in Figure 3, indicating that the constructed strain GS115-P4Hb successfully expressed P4Hb protein.

[0306] Construction of the GS115-P4Hb-P4Ha2 strain expressing human proline hydroxylase P4Hb and P4Ha proteins:

[0307] A Strep tag sequence was added to the C-terminus of the P4Ha2 gene (containing its natural signal peptide at the N-terminus) and inserted into the multiple cloning site of the Glyco13 plasmid to obtain the pPIC-P4Ha2 plasmid, as shown in Figure 2. The pPIC-P4Ha2 plasmid was linearized by PmeI digestion, and the fragment was recovered by agarose gel electrophoresis. It was then electrotransformed into Pichia pastoris GS115-P4Hb and cultured on YPD plates containing 100 μg / ml noroside at 28°C for 2-3 days. Positive colonies were screened. Single colonies from the YPD selection plates were picked and cultured on BMGY medium. After induced expression for 72 h, samples were taken, and Western blotting (WB) was performed using an anti-Strep-tag antibody. The resulting pattern is shown in Figure 3, indicating that the constructed strain GS115-P4Hb-P4Ha2 successfully expressed the P4Ha2 protein.

[0308] Example 2: Construction of a Pichia pastoris strain co-expressing human proline hydroxylase and full-length recombinant human collagen

[0309] (1) Full-length recombinant type I human collagen: The amino acid sequence of full-length COL1A1 comes from UniProtKB-P02452, with a total length of 1464 amino acids, and the amino acid sequence of full-length COL1A2 comes from UniProtKB-P08123, with a total length of 1366 amino acids. After removing the N-terminal and C-terminal telopeptides that are prone to causing immunogenicity, the sequence lengths of COL1A1 and COL1A2 are 1049 and 1037 amino acids, respectively (i.e., recombinant type I human collagen). The theoretical degree of hydroxylation is 10.3%, and the higher the degree of hydroxylation, the better the stability. The amino acid sequence of the full-length COL1A1 is shown in SEQ ID NO:1, the amino acid sequence of the full-length COL1A2 is shown in SEQ ID NO:3, the amino acid sequence encoding COL1A1 with N-terminal and C-terminal telopeptides removed is shown in SEQ ID NO:9, and the amino acid sequence encoding COL1A2 with N-terminal and C-terminal telopeptides removed is shown in SEQ ID NO:10. The nucleotide sequence encoding the amino acid sequence of the full-length recombinant type I human collagen COL1A1 is shown in SEQ ID NO:15, and the nucleotide sequence encoding the amino acid sequence of the full-length recombinant type I human collagen COL1A2 is shown in SEQ ID NO:16.

[0310] Construction of pPIC-Col1A1 plasmid expressing full-length recombinant type I human collagen COL1A1: The gene sequence of full-length recombinant type I human collagen COL1A1 protein was taken and inserted between the BamHI and NotI sites of the pPIC3.5 plasmid to obtain plasmid pPIC-Col1A1, as shown in Figure 4.

[0311] Construction of pPIC-Col1A2 plasmid expressing full-length recombinant type I human collagen COL1A2: The gene sequence encoding the full-length COL1A2 protein was taken and inserted into the pPIC6A plasmid through the Xba I site to obtain the plasmid pPIC-Col1A2, as shown in Figure 4.

[0312] Construction of the GS115-COL1A1-COL1A2-P4Hb-P4Ha2 strain expressing full-length COL1A1, full-length COL1A2, human proline hydroxylase P4Hb protein, and P4Ha protein: After linearizing the plasmid pPIC-COL1A1 with SalI, the fragment was recovered and electrotransformed into Pichia pastoris GS115-P4Hb-P4Ha2. The strain was then incubated at 28°C for 2-3 days on YPD plates containing 600 μg / ml genimycin G418. Positive colonies were screened to obtain the GS115-COL1A1-P4Hb-P4Ha2 strain. After the linearized fragment of plasmid pPIC-COL1A2 was recovered by digestion with PmeI, it was electrotransformed into Pichia pastoris GS115-COL1A1-P4Hb-P4Ha2. The fragment was then incubated at 28°C for 2-3 days on YPD plates containing 50 μg / ml hygromycin. Positive colonies were screened to obtain strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2.

[0313] Single clones from the YPD selection plate were cultured in BMGY medium and induced for expression for 72 h. Samples were then taken for electrophoresis and SDS-PAGE detection. The pattern is shown in Figure 5. It can be seen that protein expression is present at a molecular weight of about 390 kD on the electrophoresis pattern. The molecular weight is significantly larger than the 130 kD of a single chain, indicating that the full-length recombinant type I human collagen formed a triple helix structure after expression in Pichia pastoris. This shows that the constructed strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2 successfully expressed the full-length recombinant type I human collagen.

[0314] (2) The amino acid sequence of the full-length recombinant type III human collagen is derived from UniProtKB-P02461, which is a natural type III human collagen with a full length of 1466 amino acids. After removing the N-terminal and C-terminal telopeptides, which are prone to causing immunogenicity, the sequence length is 1061 amino acids (i.e., recombinant type III human collagen). The theoretical degree of hydroxylation is 16.9%. The amino acid sequence of the full-length recombinant type III human collagen is shown in SEQ ID NO:11. The amino acid sequence encoding the recombinant type III human collagen with the N-terminal and C-terminal telopeptides removed is shown in SEQ ID NO:5 (i.e., the sequence length is 1061 amino acids). The nucleotide sequence encoding the amino acid sequence of the full-length recombinant type III human collagen is shown in SEQ ID NO:19.

[0315] Construction of pPIC3.5K-Col3A1 plasmid expressing full-length recombinant type III human collagen COL3A1: The gene sequence of full-length recombinant type III human collagen (nucleotide sequence as shown in SEQ ID NO:22) was taken and inserted between the BamHI and NotI sites of the pPIC3.5 plasmid to obtain the plasmid pPIC3.5K-Col3A1, as shown in Figure 6.

[0316] The GS115-COL3A1-P4Hb-P4Ha2 strain, expressing full-length recombinant type III human collagen COL3A1, human proline hydroxylase P4Hb protein, and P4Ha protein, was constructed as follows: Using plasmid pPIC3.5K-Col3A1 as a template, the fragment was amplified using primers AOXF33: TTTGGTTCGTTGAAATGCTAACGGCCAGTTGGT (SEQ ID NO:20) and AOXR33: CTTAGTTCATCTTGGATGAGATCACGCTTTTGTC (SEQ ID NO:21). The linearized pPIC3.5K-Col3A1 fragment was purified and recovered by ethanol precipitation. The strain was electrotransformed into Pichia pastoris GS115-P4Hb-P4Ha2 and cultured on YPD plates containing 600 μg / ml genimycin G418 at 28°C for 2–3 days. Positive colonies were screened. Single clones from the YPD selection plate were cultured in BMGY medium and induced for expression for 72 h. Samples were then taken for electrophoresis and SDS-PAGE detection. The pattern is shown in Figure 7. It can be seen that protein expression is present at molecular weights above 245 kD on the electrophoresis pattern. The molecular weight is significantly greater than that of a single chain of 130 kD, indicating that the full-length recombinant type III human collagen formed a triple helix structure after expression in Pichia pastoris. This shows that the constructed strain GS115-COL3A1-P4Hb-P4Ha2 successfully expressed the full-length recombinant type III human collagen.

[0317] Example 3: Screening of highly hydroxylated, full-length triple helix recombinant human collagen strains

[0318] For the Pichia pastoris strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2, which was constructed in Example 2 and co-expressed with full-length recombinant type I human collagen, the plasmid copy number was detected using relative quantitative PCR to confirm the strain with the highest degree of hydroxylation corresponding to the optimal insertion ratio of the four genes. For the Pichia pastoris strain GS115-COL3A1-P4Hb-P4Ha2, which was constructed in Example 2 and co-expressed with human proline hydroxylase and full-length recombinant type III human collagen, the plasmid copy number was detected using relative quantitative PCR to confirm the strain with the highest degree of hydroxylation corresponding to the optimal insertion ratio of the three genes.

[0319] 1. Yeast genomic DNA extraction: Yeast genomic DNA was extracted using a yeast genomic DNA extraction kit, following the instructions. The DNA concentration was determined using a Nanodrop One device.

[0320] 2. Gene copy number detection:

[0321] (1) Full-length recombinant type I human collagen: The relative quantitative PCR ΔΔCt method was used. Two sets of primers were provided for each gene PCR (see Table 1, including upstream and downstream primers). For each gene, a 25 μL PCR reaction solution was prepared as follows. In a 96-well PCR plate, 12.5 μL of TB GreenPremix Ex Taq (2X) (Tli RNaseH Plus), 1 μL of ROX plus (2×), 1 μL each of the upstream and downstream primers (10 μmol / L) for each gene, 9.5 μL of sterile water, and 1 μL of genomic DNA extracted from each strain (prepared to 10 ng / ml) were added sequentially. Double-duplicate wells were used. After adding the reagents, the plate was sealed with sealing film, and the plates were briefly centrifuged until the liquid in each tube reached the bottom of the well. The plates were then placed in a real-time PCR instrument, and the ΔΔCt method was selected for operation. PCR conditions were set to 95°C preheating for 30 seconds, followed by repeated cycles of 95°C for 5 seconds and 60°C for 30 seconds for 40 times. Finally, the melting curve program (Melt) was run. After the overall reaction was completed, the GAP gene was selected as the internal reference gene, and one strain (serial number 1) was used as the control sample for analysis. The mean Ct value of each gene group was calculated (Ct value: the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold). The first ΔCt value was calculated, which is the Ct value of the target gene minus the Ct value of the internal reference gene in each group. Then, the ΔCt value of the control group was subtracted from each ΔCt value to obtain the ΔΔCt value, and then the relative expression level (2^-ΔΔCt) was calculated. The gene copy number results of each sample are shown in Table 2.

[0322] Table 1: Primer information for quantitative PCR of each gene

[0323] Note: GAP is the Pichia pastoris housekeeper gene, P4Ha2 and P4Hb are two genes for human proline hydroxylase, COL1A1 is the full-length recombinant type I human collagen COL1A1 gene, and COL1A2 is the full-length recombinant type I human collagen COL1A2 gene.

[0324] Table 2: Results of gene copy number and hydroxyproline content detection for each strain

[0325] (2) Full-length recombinant type III human collagen: The relative quantitative PCR ΔΔCt method was used. Two sets of primers were provided for each gene PCR (see Table 3, including upstream and downstream primers). One set of primers was selected for detection. For each gene, a 25 μL PCR reaction solution was prepared as follows. In a 96-well PCR plate, 12.5 μL of TB GreenPremix Ex Taq (2X) (Tli RNaseH Plus), 1 μL of ROX plus (2×), 1 μL each of the upstream and downstream primers (10 μmol / L) for each gene, 9.5 μL of sterile water, and 1 μL of genomic DNA extracted from each strain (prepared to 10 ng / ml) were added sequentially. Double-duplicate wells were used. After adding the reagents, the plate was sealed with sealing film, and the plate was briefly centrifuged until the liquid in each tube reached the bottom of the well. The plate was then placed in a real-time PCR instrument, and the ΔΔCt method was selected for operation. The PCR conditions were set to 95℃ preheating for 30 seconds, followed by repeated cycles of 95℃ for 5 seconds and 60℃ for 30 seconds for 40 times. Finally, the melting curve program (Melt) was run. After the overall reaction was completed, the GAP gene was selected as the internal reference gene, and one strain (serial number 1) was used as the control sample for analysis. The mean Ct value of each gene group was calculated (Ct value: the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold). The first ΔCt value was calculated, which is the Ct value of the target gene minus the Ct value of the internal reference gene in each group. Then, the ΔCt value of the control group was subtracted from each ΔCt value to obtain the ΔΔCt value, and then the relative expression level (2^-ΔΔCt) was calculated. The gene copy number results of each sample are shown in Table 4.

[0326] Table 3: Primer information for quantitative PCR of each gene Note: GAP is the Pichia pastoris housekeeping gene, P4Ha2 and P4Hb are two genes for human proline hydroxylase, and COL3A is the full-length recombinant type III human collagen gene.

[0327] Table 4: Results of gene copy number and hydroxyproline content detection for each strain

[0328] 3. Hydroxyproline content detection

[0329] (1) Full-length recombinant type I human collagen: Hydroxyproline is a specific amino acid found in collagen, and its content is positively correlated with the stability of the triple helix structure formed by collagen. The sample to be tested (i.e., the full-length recombinant type I human collagen prepared in step 2 of this embodiment) was hydrolyzed into a single amino acid at 110℃ and 7 mol / L hydrochloric acid for 24 h. The amino acid was then dried, reconstituted, labeled with PITC, and analyzed by liquid chromatography. The detection method is as follows:

[0330] 3.1 Sample acid hydrolysis: Take 400 μL of sample (1 mg / mL), add 2 mL of 7 mol / L hydrochloric acid aqueous solution, purge with nitrogen for 2 min, and acid hydrolyze at 110℃ for 24 h.

[0331] 3.2 Rotary evaporation drying: Transfer the acid-hydrolyzed sample to a 10 mL volumetric flask, dilute to 10 mL with purified water, add to a rotary evaporator flask, and dry at 40 °C until all liquid is removed.

[0332] 3.3 Transfer 2.5 mL of 0.05 mol / L sodium acetate solution (pH 6.5) to the dried sample flask described above, ensuring complete reconstitution of the sample at the bottom. Transfer 25 μL to a 1.5 mL centrifuge tube. Simultaneously, transfer 25 μL of amino acid mixed standard and hydroxyproline single standard solution to centrifuge tubes, and repeat the same procedure. Add 12.5 μL of 1 mol / L triethylamine acetonitrile solution to each tube, mix well, then add 12.5 μL of 0.1 mol / L PITC acetonitrile solution, mix well, and let stand at room temperature for 1 h. Add 100 μL of n-hexane, mix for 1 min, and let stand at room temperature for 10 min. Transfer 30 μL of the lower layer solution to a 1.5 mL centrifuge tube, add 270 μL of 0.05 mol / L sodium acetate solution (pH 6.5), mix well, and analyze using a centrifuge.

[0333] 3.4 Liquid phase conditions, see Table 5 for details.

[0334] Table 5

[0335] The molar number of each amino acid in the sample was calculated by relative quantitative analysis of the molar number of each amino acid in the standard. The results of hydroxyproline content in each sample are shown in Table 1.

[0336] The gene copy number and hydroxyproline content results show that when the copy numbers of the P4Ha2 and P4Hb genes are controlled at (1.80–2.20):(1.80–2.20), and the copy numbers of the P4Ha2, P4Hb, and COL1A1 genes are all 1.80–2.20 times that of the COL1A2 gene, recombinant type I human collagen with a relatively high degree of hydroxylation can be obtained. In other words, the target strain for recombinant type I human collagen with a high degree of hydroxylation can be obtained by controlling the gene copy number ratio, but the degree of hydroxylation cannot reach 10.0% or higher.

[0337] (2) Full-length recombinant type III human collagen: Hydroxyproline is a specific amino acid found in collagen, and its content is positively correlated with the stability of the triple helix structure formed by collagen. The sample to be tested (i.e., the full-length recombinant type III human collagen prepared in step 2 of this embodiment) was hydrolyzed to hydroxyproline at 105℃ and 6 mol / L hydrochloric acid. After oxidation by chloramine T, hydroxyproline reacted with p-dimethylaminobenzaldehyde to generate a red compound, which was then measured colorimetrically at a wavelength of 560 nm. The detection method is as follows:

[0338] 3.1 Solution preparation:

[0339] Hydrochloric acid solution, c(HCl) = 6 mol / L: Mix equal volumes of analytical grade hydrochloric acid and water;

[0340] pH 6.0 buffer solution: Weigh 57g sodium acetate trihydrate, 37.5g trisodium citrate, 5.5g citric acid monohydrate, 385mL isopropanol, add 500mL water, adjust the pH to 6.0 with citric acid monohydrate, and dilute with water to 1000mL; Chloramine T solution: Weigh 3.5g chloramine T, and dilute with water to 50mL;

[0341] Oxidizing agent solution: Mix chloramine T solution and pH 6.0 buffer at a ratio of 1:4; 60% perchloric acid solution: Measure 43 mL of perchloric acid and dilute with water to 50 mL;

[0342] p-Dimethylaminobenzaldehyde solution: Weigh 10g of p-dimethylaminobenzaldehyde and dissolve it in 15mL of 60% perchloric acid solution;

[0343] Colorimetric reagent: Measure 15 mL of p-dimethylaminobenzaldehyde solution and dissolve it in 65 mL of isopropanol; Sodium hydroxide solution, c(NaOH) = 6 mol / L: Weigh 24 g of sodium hydroxide and dilute it with water to 100 mL.

[0344] Preparation of 3.2L-hydroxyproline reference solution:

[0345] L-hydroxyproline reference stock solution: Weigh the L-hydroxyproline reference standard accurately, dissolve it in water and dilute quantitatively to a solution containing 20 μg per 1 mL;

[0346] L-hydroxyproline reference standard series solutions: Accurately measure 2.5 mL, 3.75 mL, 5.0 mL, 7.5 mL, and 10.0 mL of L-hydroxyproline reference standard stock solution into 10 mL volumetric flasks, and dilute to volume with water to prepare the L-hydroxyproline reference standard series solutions.

[0347] 3.3 Preparation of test sample: Take the full-length recombinant type III human collagen obtained in step 2 of this embodiment, place it in a hydrolysis tube, weigh it accurately, add an appropriate amount of 6mol / L HCl, fill the tube with nitrogen and seal it; hydrolyze at 105℃ for 22h-24h, cool, transfer the hydrolysis product to a volumetric flask, wash the hydrolysis tube with water, combine the washings and transfer them to a volumetric flask, add 2 drops of phenolphthalein indicator, add 6mol / L NaOH until the solution turns pink, dilute to volume with water, shake well, and prepare the test solution.

[0348] 3.4 Detection: Accurately measure 0.5 mL of blank (water), hydroxyproline reference standard series solutions, and test solution, add 1 mL of isopropanol and 0.5 mL of oxidant solution respectively, mix, and let stand at room temperature for 4 min. Then add 6.5 mL of colorimetric reagent to each, mix, and place each tube in a 60℃ water bath for 15 min, then cool. Use the blank as a control, and measure the absorbance value at 560 nm. Perform linear regression on the absorbance of the hydroxyproline reference standard series concentrations to obtain the linear regression equation, and calculate the hydroxyproline content in the test solution. The hydroxyproline content results for each sample are shown in Table 3.

[0349] The gene copy number and hydroxyproline content results show that a relatively high degree of hydroxylation in recombinant type III human collagen can be obtained when the copy number ratio of P4Ha2 and P4Hb genes is controlled at 1:1, and both P4Ha2 and P4Hb gene copy numbers are twice the copy number of COL3A1 gene. In other words, a target strain for recombinant type III human collagen with a high degree of hydroxylation can be obtained by controlling the gene copy number ratio, but the degree of hydroxylation cannot reach 16.5% or higher.

[0350] Example 4: Construction of a yeast strain co-expressing viral proline hydroxylase gene and recombinant human collagen gene

[0351] The pPIC-Col1A1 plasmid expressing recombinant type I human collagen COL1A1 and the pPIC-Col1A2 plasmid expressing recombinant type I human collagen COL1A2 constructed in Example 2 were transformed into strain GS115 according to the transformation operation in Example 2 to obtain strain GS115-COL1A1-COL1A2; the pPIC3.5K-Col3A1 plasmid expressing recombinant type III human collagen COL3A1 constructed in Example 2 was transformed into strain GS115 according to the transformation operation in Example 2 to obtain strain GS115-COL3A1.

[0352] Construction of pPIC6A-vP4H plasmid: The vP4H gene sequence (amino acid sequence as shown in SEQ ID NO:8, nucleotide sequence as shown in SEQ ID NO:22) was synthesized. The N-terminus contains a His Tag for protein expression screening. The His Tag was inserted between the EcoRI and Xho I sites of the pPIC6A plasmid to obtain the plasmid pPIC6A-vP4H. The plasmid map is shown in Figure 8.

[0353] Construction of the GS115-COL1A1-COL1A2-vP4H strain: Using plasmid pPIC6A-vP4H as a template, the fragment was amplified using primers GAPFc1: ACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGC (SEQ ID NO:23) and GAPRc1: AATGCTGGGAAGAGCATTGCTGCAAGGGGGCCGTAGAA (SEQ ID NO:24), and the linearized pPIC6A-vP4H fragment was recovered. The strain was electrotransformed into Pichia pastoris GS115-COL1A1-COL1A2 and cultured at 28℃ for 2-3 days on YPD plates containing 300 μg / ml blastcinin to screen for positive GS115-COL1A1-COL1A2-vP4H strains. Single clones from YPD selection plates were cultured in BMGY medium and induced to express for 72 h. Samples were taken and Western blot (WB) was performed using anti-His-Tag antibody. The gene copy number and hydroxyproline content of the full-length recombinant type I human collagen expressed by strain GS115-COL1A1-COL1A2-vP4H were detected according to the method in Example 3.

[0354] Construction of the GS115-COL3A1-vP4H strain: Using plasmid pPIC6A-vP4H as a template, the fragment was amplified using primers GAPFc1: ACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGC (SEQ ID NO:23) and GAPRc1: AATGCTGGGAAGAGCATTGCTGCAAGGGGGCCGTAGAA (SEQ ID NO:24), and the linearized pPIC6A-vP4H fragment was recovered. The strain was electrotransformed into Pichia pastoris GS115-COL3A1 and cultured at 28℃ for 2-3 days on YPD plates containing 300 μg / mL blast fungicide to screen for positive GS115-COL3A1-vP4H strains. Single clones from YPD selection plates were cultured in BMGY medium and induced to express for 72 h. Samples were taken and Western blot (WB) was performed using anti-His-Tag antibody. The gene copy number and hydroxyproline content of the full-length recombinant type III human collagen expressed by strain GS115-COL3A1-vP4H were detected according to the method in Example 3.

[0355] The results showed that the prepared recombinant type I human collagen possessed a full-length triple helix structure. When the gene copy number ratio of COL1A1 gene:COL1A2 gene:vP4H gene was close to 2:1:1, the hydroxyproline content reached a maximum of 9.7%, which was basically consistent with the characteristics of recombinant type I human collagen expressed by strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2, but the degree of hydroxylation could not reach 10.3% or higher. The prepared recombinant type III human collagen also possessed a full-length triple helix structure. When the gene copy number ratio of COL3A1 gene:vP4H gene was close to 1:1, the hydroxyproline content reached 15.9%, which was basically consistent with the characteristics of recombinant type III human collagen expressed by strain GS115-COL3A1-P4Hb-P4Ha2, but the degree of hydroxylation could not reach 16.5% or higher.

[0356] Example 5: Further insertion of viral proline hydroxylase gene

[0357] Based on the construction and screening of the highly hydroxylated, triple-helix full-length recombinant type I human collagen strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2 (gene copy number ratio of P4Ha2 gene:P4Hb gene:COL1A1 gene:COL1A2 gene was 2.11:2.05:2.02:1, i.e., strain number 1 in Table 1) in Example 3, the vP4H gene was further inserted into the strain to enhance the recombinant type I human collagen production. The hydroxyproline content of white collagen; based on the construction and screening of the highly hydroxylated, triple-helix full-length recombinant type III human collagen strain GS115-COL3A1-P4Hb-P4Ha2 (gene copy number ratio of P4Ha2 gene:P4Hb gene:COL3A1 gene is 1.98:1.93:1, i.e. strain number 8 in Table 3) in Example 3, the vP4H gene was further inserted into the strain to increase the hydroxyproline content of recombinant type III human collagen.

[0358] Construction of pPIC6A-vP4H plasmid: See Example 4 for details. The plasmid map is shown in Figure 8.

[0359] Construction of the GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H strain: Using plasmid pPIC6A-vP4H as a template, the fragment was amplified using primers GAPFc1: ACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGC (SEQ ID NO:23) and GAPRc1: AATGCTGGGAAGAGCATTGCTGCAAGGGGGCCGTAGAA (SEQ ID NO:24), and the linearized pPIC6A-vP4H fragment was recovered. The *Pichia pastoris* GS115-COL1A1-COL1A2-P4Hb-P4Ha2 was electrotransformed and cultured on YPD plates containing 300 μg / mL blast fungicide at 28°C for 2-3 days to screen for positive GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H strains. Single clones from YPD selection plates were cultured in BMGY medium and induced to express for 72 h. Samples were taken and Western blot (WB) was performed using anti-His-Tag antibody to confirm that the constructed strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H successfully expressed the vP4H protein.

[0360] Construction of strain GS115-COL3A1-P4Hb-P4Ha2-vP4H: Using plasmid pPIC6A-vP4H as a template and primer GAPFc1: ACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGC (SEQ ID NO:23)

[0361] The amplified fragment of GAPRc1:AATGCTGGGAAGAGCATTGCTGCAAGGGGGCCGTAGAA (SEQ ID NO:24) was recovered, and the linearized pPIC6A-vP4H fragment was recovered. Pichia pastoris GS115-COL3A1-P4Hb-P4Ha2 was electrotransformed and cultured on YPD plates containing 300 μg / mL blastomycin at 28℃ for 2-3 days to screen for positive strains of GS115-COL3A1-P4Hb-P4Ha2-vP4H. Single clones from the YPD selection plates were picked and cultured on BMGY medium. After induced expression for 72 h, samples were taken, and Western blotting (WB) was performed using anti-His-Tag antibody. The blotting pattern is shown in Figure 9, indicating that the constructed strain GS115-COL3A1-P4Hb-P4Ha2-vP4H successfully expressed the vP4H protein.

[0362] Meanwhile, the gene copy number and hydroxyproline content of recombinant type I human collagen expressed by strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H were detected according to the method in Example 3. The results are shown in Table 6.

[0363] Meanwhile, the gene copy number and hydroxyproline content of recombinant type III human collagen expressed by strain GS115-COL3A1-P4Hb-P4Ha2-vP4H were detected according to the method in Example 3. The results are shown in Table 7.

[0364] Table 6: Gene copy number and hydroxyproline content of strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H

[0365] Table 7: Results of gene copy number and hydroxyproline content detection in strain GS115-COL3A1-P4Hb-P4Ha2-vP4H

[0366] The results showed that the degree of proline hydroxylation in recombinant type I human collagen was further improved, with the highest hydroxyproline content (11.1%). However, the hydroxyproline content tended to decrease with further increases in the vP4H gene copy number ratio, possibly due to overexpression of the hydroxyproline protein, which increased the strain's energy consumption and was detrimental to further post-translational modifications of recombinant type I human collagen. Similarly, the degree of proline hydroxylation in recombinant type III human collagen was further improved, with the highest hydroxyproline content (16.8%). However, the hydroxyproline content tended to decrease with further increases in the vP4H gene copy number ratio, possibly due to overexpression of the hydroxyproline protein, which increased the strain's energy consumption and was detrimental to further post-translational modifications of recombinant type III human collagen.

[0367] Example 6: Preparation of recombinant human collagen

[0368] The highly hydroxylated, triple-helix, full-length recombinant type I human collagen strain GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H (strain number 3) selected in Example 5 was cultured in 500 ml shake flasks using BMGY medium for 72 h. After confirmation by electrophoresis (protein expression is shown in Figure 5), the fermentation broth was collected and centrifuged at 5000 rpm for 15 min to obtain a bacterial precipitate containing recombinant type I human collagen. This precipitate was homogenized, centrifuged at 12000 rpm for 30 min, and the supernatant was discarded. The obtained precipitate was further reconstituted and then enzymatically digested with pepsin at a final concentration of 300 U / L at 4°C for 20 hours to remove telopeptides. The permeate was then obtained by microfiltration through a 0.44 μm membrane, followed by salting out with 1 mol / L sodium chloride solution for 16–30 hours. Non-recombinant type I human collagen impurities were removed by ion exchange chromatography, and the solution was concentrated by ultrafiltration through a 100 kD membrane to obtain a high-purity recombinant type I human collagen stock solution.

[0369] The highly hydroxylated, triple-helix, full-length recombinant type III human collagen strain GS115-COL3A1-P4Hb-P4Ha2-vP4H (strain number 3) selected in Example 5 was cultured in 500 mL shake flasks using BMGY medium for 72 h. After confirmation by electrophoresis (protein expression is shown in Figure 9), the fermentation broth was collected and centrifuged at 5000 rpm for 15 min to obtain a bacterial precipitate containing recombinant type III human collagen. This precipitate was homogenized, centrifuged at 12000 rpm for 30 min, and the supernatant was discarded. The obtained precipitate was further subjected to enzymatic digestion with pepsin at a final concentration of 400 U / L at 4°C for 20 hours to remove telopeptides. Then, it was microfiltered through a 0.44 μm filter membrane to obtain the permeate, which was then salted out with 1 mol / L sodium chloride solution for 16–30 hours. Ion exchange chromatography was used to remove non-recombinant type III human collagen impurities, and ultrafiltration through a 100 kD filter membrane was used to concentrate and obtain a high-purity recombinant type III human collagen stock solution.

[0370] Example 7: Detection of the structure and properties of recombinant human collagen

[0371] (1) To confirm the consistency between the recombinant type I human collagen prepared in Example 6 and the natural type I human collagen, the structure and characteristics of the recombinant type I human collagen obtained from strain number 3 were tested.

[0372] 1. Sequencing

[0373] The recombinant type I human collagen was sequenced, and the N / C-terminal sequence was identified by Trypsin digestion combined with LC / MS (Figure 10) and the Trypsin digestion sequence coverage (Figure 11). The results showed that the sequence composition of the recombinant type I human collagen sample was completely consistent with the amino acid sequence of natural type I human collagen after removing the N-terminal and C-terminal telopeptides.

[0374] 2. Molecular weight determination

[0375] Molecular weight was determined using non-reducing and reducing polyacrylamide gel electrophoresis. A 4% stacking gel / 7.5% separating gel was prepared. 50 μg of recombinant type I human collagen sample was added to a 1.5 mL centrifuge tube, and 0.01 mol / L hydrochloric acid was added to a total volume of 75 μL. 25 μL of loading buffer (4x) was added (for reducing the sample, 10 μL of 10× reducing agent was added), and the mixture was stirred. 6–10 μL of the prepared sample was spotted into the gel wells, and the gel was connected to the electrophoresis apparatus for electrophoresis. Step 1: 80 V, 20 min; Step 2: 160 V or 180 V, 60 min. After electrophoresis, staining and destaining were performed, and images were captured using a gel imaging system. The results are shown in Figure 12. It can be seen that the reduced electrophoresis band is around 130kD, and the non-reduced electrophoresis band is around 390kD, which is the same as the molecular weight of the triple helix structure of recombinant type I human collagen. By measuring the molecular weight of the non-reduced electrophoresis, it can be seen that the expressed recombinant type I human collagen has a triple helix structure.

[0376] 3. Purity determination

[0377] The detection was performed using size exclusion chromatography (SEC-HPLC), and the detection conditions are as follows (see Table 8 for details).

[0378] Table 8

[0379] The detection results are shown in Figure 13. The main peak at RT 8.807 min represents the location of the triple helix structure of recombinant type I human collagen. The area before the main peak at RT 8.561 min represents the location of the dimer based on the triple helix structure of recombinant type I human collagen. The area after the main peak at RT 8.623 min represents the location of the single chains (COL1A1 and COL1A2 proteins) of recombinant type I human collagen. All of these are components of recombinant type I human collagen, indicating a purity of 100% and a triple helix structure ratio of 98.92%.

[0380] 4. Triple Helix Structure Detection

[0381] Circular dichroism spectroscopy was used to analyze the structure of recombinant human type I collagen by utilizing the circular dichroism of proteins and the different absorption of circularly polarized light by asymmetric molecules.

[0382] Take a sample of recombinant type I human collagen, dilute it to 0.1 mg / mL with 20 mM PB, and then directly scan it in the far ultraviolet band. The scanning conditions are as follows, see Table 9 for details.

[0383] Table 9

[0384] The detection results are shown in Figure 14. It can be seen that the maximum absorption is near 223 nm and the minimum absorption is near 197 nm in the far-ultraviolet spectrum of the circular dichroism spectroscopy. The spectral characteristics are consistent with the far-ultraviolet spectral characteristics of collagen with a triple helix structure.

[0385] 5. Self-assembly capability test

[0386] Collagen, with its triple helix structure, can self-assemble into collagen fibers under suitable conditions. During this process, the turbidity of the collagen solution changes. By using a microplate reader to detect these changes at different times within a 313 nm wavelength range, the self-assembly performance of collagen can be observed. The self-assembly curve of collagen solution exhibits a typical S-shape, including three phases: a lag phase, a rapid growth phase, and a plateau phase. The steps are as follows:

[0387] Preparation of 10 mmol / L PBS buffer (pH 10.0): Weigh 0.27 g potassium dihydrogen phosphate, 1.14 g disodium hydrogen phosphate, 0.20 g potassium chloride, and 8.00 g sodium chloride. Dissolve in 800 mL of water. Adjust the pH to 10.0 ± 0.05 with 1 mol / L sodium hydroxide solution. Add water to 1000 mL.

[0388] Sample dilution was performed on ice. 200 μL of recombinant type I human collagen sample was added to 400 μL of 10 mmol / L PBS buffer (pH 10.0), and mixed thoroughly to achieve a final pH between 7.0 and 7.4. 200 μL of the prepared test solution was added to a 96-well plate. The detection wavelength was set to 313 nm, and the temperature was controlled at 37 °C. The OD value at 313 nm was measured using a microplate reader, with measurements taken every 30 seconds for 1.5 hours. The detection curve is shown in Figure 15, exhibiting a typical S-shaped curve, indicating that recombinant type I human collagen possesses the ability to further self-assemble on the basis of its triple helix structure.

[0389] (2) To confirm the consistency between the recombinant type III human collagen prepared in Example 6 and the natural type III human collagen, the structure and characteristics of the recombinant type III human collagen were tested.

[0390] 1. Sequencing

[0391] The recombinant type III human collagen was sequenced, and the N / C-terminal sequence results and the Trypsin and Glu-C double enzyme digestion sequence coverage results were identified by LC / MS (Figure 16). The results showed that the sequence composition of the recombinant type III human collagen sample was completely consistent with the amino acid sequence of natural human collagen after removing the N-terminal telopeptide and C-terminal telopeptide (amino acid sequence such as SEQ ID NO:5).

[0392] 2. Molecular weight determination

[0393] Molecular weight was determined using non-reducing and reducing polyacrylamide gel electrophoresis (NRGE), following the steps outlined above for determining molecular weight of recombinant type I human collagen using NRGE. A 4% stacking gel / 7.5% separating gel was prepared, and 50 μg of recombinant type III human collagen sample was used for the experiment. The results are shown in Figure 18. The reducing electrophoresis band is located around 130 kDa, and the non-reducing electrophoresis band is around 390 kDa, consistent with the triple-helix molecular weight of recombinant type III human collagen. The non-reducing electrophoresis molecular weight indicates that the expressed recombinant type III human collagen possesses a triple-helix structure.

[0394] 3. Purity determination

[0395] The detection was performed using size exclusion chromatography (SEC-HPLC), and the detection conditions are as follows (see Table 10 for details).

[0396] Table 10

[0397] The test results are shown in Figure 19. The main peak at RT 8.550 min is the location of the triple helix structure of recombinant type III human collagen, and the area before the main peak at RT 8.302 min is the location of the dimer based on the triple helix structure of recombinant type III human collagen. Both are components of recombinant type III human collagen, indicating a purity of 100%.

[0398] 4. Triple Helix Structure Detection

[0399] Circular dichroism spectroscopy was used to analyze the structure of recombinant human type III collagen by utilizing the circular dichroism of proteins and the different absorption of circularly polarized light by asymmetric molecules.

[0400] Take a sample of recombinant type III human collagen, dilute it with 20 mM PB to 0.1 mg / mL, and then directly scan it in the far ultraviolet band. The scanning conditions are as follows, see Table 11 for details.

[0401] Table 11

[0402] The detection results are shown in Figure 20. It can be seen that the far-ultraviolet spectrum of the circular dichroism spectroscopy has a maximum absorption near 223 nm and a minimum absorption near 197 nm. The spectral characteristics are consistent with the far-ultraviolet spectrum characteristics of collagen with a triple helix structure.

[0403] 5. Self-assembly capability test

[0404] For details, please refer to the steps outlined above for recombinant type I human collagen. The self-assembly curve of the collagen solution exhibits a typical S-shape, including three phases: stasis phase, rapid growth phase, and plateau phase.

[0405] Preparation of 10 mmol / L PBS buffer (pH 10.0): Refer to the steps for preparing recombinant type I human collagen described above.

[0406] The sample dilution was performed on ice. 200 μL of recombinant type III human collagen sample was taken, and the specific steps for sample dilution on ice for recombinant type I human collagen were described above. The detection spectrum is shown in Figure 21. It can be seen that a typical S-shaped curve is presented, indicating that recombinant type III human collagen has the ability to further self-assemble on the basis of the triple helix.

[0407] Example 8: Construction of a strain with increased recombinant type I human collagen expression

[0408] Following the procedures in Examples 1-4 above, the C-terminal telopeptide sequences of the full-length COL1A1 and full-length COL1A2 in Example 2 were replaced with helper folding sequences. The amino acid sequences of the helper folding sequences are shown in SEQ ID NO:12. The amino acid sequences of the replaced full-length COL1A1 are shown in SEQ ID NO:2, and the amino acid sequences of the replaced full-length COL1A2 are shown in SEQ ID NO:4. The other steps were the same. After culturing in 500 ml shake flasks in BMGY medium for 72 h, electrophoresis was performed. Compared with the full-length COL1A1 and full-length COL1A2 strains without helper folding sequence replacement, the expression levels of the full-length COL1A2 strains with helper folding sequence replacement were increased by approximately 1.5 times. The expression comparison electrophoresis diagram is shown in Figure 22 (numbers 1 and 2 are the expression electrophoresis bands of the strain without helper folding sequence replacement, and numbers 3 and 4 are the expression electrophoresis bands of the strain after the C-terminal telopeptide sequence was replaced with the helper folding sequence).

[0409] Example 9: Large-scale fermentation of recombinant human collagen

[0410] 1. Recombinant Type I human collagen:

[0411] The recombinant type I human collagen expression strain used in this embodiment was constructed by our company based on genetic engineering, molecular biology, fermentation engineering and other technologies. The host strain is Pichia pastoris GS115, which can simultaneously express type I procollagen α1 chain (as shown in SEQ ID NO: 1 or 2) and α2 chain (as shown in SEQ ID NO: 2). The human proline hydroxylase gene (P4Ha2 and P4Hb) and the viral proline hydroxylase gene (vP4H) expressed in NO:3 or 4 can be efficiently hydroxylated, and type I procollagen with a stable triple helix structure can be directly obtained after fermentation. The engineered bacteria used in this embodiment are the bacteria shown in Table 6 of Example 5 (strain numbers 1 to 5). The engineered bacteria used in this embodiment are GS115-COL1A1-COL1A2-P4Hb-P4Ha2-vP4H strain number 3 screened in Example 5, and its gene copy number ratio is P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2 = 2.02:2.06:1.04:2.02:1 (see Table 6).

[0412] (1) Seed thawing: Pichia pastoris GS115 engineered strain seeds co-expressing proline hydroxylase and / or viral proline hydroxylase and type I procollagen (SEQ ID NO: 1 or 2 and SEQ ID NO: 3 or 4) were frozen and inoculated into 500 mL of YPD medium at a dilution of 1:100 (v / v). The cultures were then incubated at 30℃ and 240 rpm for 20 h in a shaker until OD reached the target value. 600 ≈6.0.

[0413] (2) Primary fermentation: Add 10L of basal salt (BSM) medium to a 30L fermenter and sterilize at 121℃ for 20min. After cooling, inoculate the seed culture at a rate of 5% (v / v). Control the culture conditions: temperature 30℃, pH 5.2 (adjusted with ammonia), dissolved oxygen (DO) maintained at 25-30%, and stirring speed 300-500rpm. Incubate for approximately 20h until OD reaches... 600 ≈55.

[0414] (3) Secondary fermentation: Add 200L of BSM medium to a 600L fermenter and sterilize at 121℃ for 20min. After cooling, inoculate the primary fermentation broth at a rate of 5% (v / v). Control conditions are the same as for the primary fermentation. Cultivate to OD. 600 ≈55.

[0415] (4) Tertiary fermentation: Add 9000 liters of BSM medium to a 20000 liter fermenter and sterilize at 121°C for 20 min. After cooling, inoculate the secondary fermentation broth at a 2% (v / v) inoculum. Control conditions remain the same as before, and culture until OD reaches [the desired fermentation temperature]. 600 ≈55.

[0416] (5) Glycerol feeding: Initially, add 50% (w / v) glycerol at a rate of 100 kg / h. Culture parameters are: rotation speed 150–200 rpm, temperature 30℃, pH 5.2, and DO controlled at 0–25%. When OD… 600 When the DO level rises to approximately 400 and continues to rise significantly, stop feeding and continue culturing for another 200 minutes to deplete the remaining glycerol.

[0417] (6) Methanol induction: Methanol was added continuously for induction. The initial addition rate was 1 g / L·h for the first 24 hours, and then increased to 4 g / L·h. The culture parameters were: rotor speed 150–200 rpm, temperature 22℃, pH 6.5, dissolved oxygen 0–25%. After induction for approximately 120 hours, the culture was continued until the bacterial OD reached the target value. 600 When the absorbance value reaches approximately 450, the expression culture ends, and fermentation is terminated.

[0418] (7) Sampling and detection: SDS-PAGE analysis was performed on bacterial samples taken at different induction time points. The results are shown in Figures 23 and 24. It can be seen that there is a clear target band at about 300 kDa (corresponding to the triple helix structure), which deepens with the extension of induction time, indicating that the target protein is successfully expressed.

[0419] 2. Recombinant type III human collagen:

[0420] The recombinant type III human collagen expression strain used in this embodiment was constructed by our company based on genetic engineering, molecular biology, fermentation engineering and other technologies. The host strain is Pichia pastoris GS115, which can simultaneously express procollagen (amino acids as shown in SEQ ID NO: 11) and human proline hydroxylase genes (P4Ha2 and P4Hb). The expressed procollagen can be modified in the cell by the simultaneously inserted human proline hydroxylase genes. After fermentation, procollagen with a triple helix structure can be directly obtained. The engineered strain used in this embodiment is the strain shown in Table 7 of Example 5 (strain numbers 1 to 6). The engineered strain used in this embodiment is GS115-COL3A1-P4Hb-P4Ha2-vP4H strain number 3 screened in Example 5. Its gene copy number ratio is P4Ha2:P4Hb:vP4H:full-length COL3A1 = 1.99:1.93:1.04:1 (see Table 7).

[0421] (1) Seed thawing: Frozen Pichia pastoris GS115 engineered strain seeds co-expressing proline hydroxylase and procollagen (amino acid sequence as shown in SEQ ID NO:11) were inoculated into 500 mL YPD medium at a ratio of 1:100 (v / v) and cultured in a shaker at 30℃ and 240 rpm for 20 h until OD... 600 ≈6.0.

[0422] (2) Primary fermentation: For details, please refer to the steps of primary fermentation in the large-scale fermentation of recombinant type I human collagen mentioned above.

[0423] (3) Secondary fermentation: For details, please refer to the steps of secondary fermentation in the large-scale fermentation of recombinant type I human collagen.

[0424] (4) Tertiary fermentation: For details, please refer to the steps of tertiary fermentation in the large-scale fermentation of recombinant type I human collagen mentioned above.

[0425] (5) Glycerin feeding: For details, please refer to the steps of glycerin feeding in the large-scale fermentation of recombinant type I human collagen mentioned above.

[0426] (6) Methanol induction: See the steps for methanol induction in the large-scale fermentation of recombinant type I human collagen mentioned above.

[0427] (7) Sampling and detection: SDS-PAGE analysis was performed on bacterial samples taken at different induction time points. The results are shown in Figure 25. It can be seen that there is a clear target band at about 280 kDa (corresponding to the triple helix structure), which deepens with the extension of induction time, indicating that the target protein is successfully expressed.

[0428] Example 10: Large-scale purification of recombinant human collagen

[0429] 1. Recombinant Type I Human Collagen: The fermentation broth purified in this embodiment is from Example 9. This embodiment exemplarily demonstrates that the engineered bacteria used for fermentation of recombinant type I human collagen has a gene copy number ratio of P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2 = (1.80~2.20):(1.80~2.20):(0.80~1.50):(1.80~2.20):1, as specifically shown in Example 5 and Table 6.

[0430] (1) Harvesting and washing of bacterial cells: The bacterial cells in the fermentation broth prepared in Example 9 were harvested by centrifuging at 4°C using a disc centrifuge. The bacterial cells were washed twice with pre-cooled purified water. By controlling the centrifugation flow rate to 2000-5000 L / h and the sludge discharge time to 100-150 s, the final bacterial sludge solid content was kept below 20%, and the final turbidity of the supernatant was found to be below 400 NTU.

[0431] (2) Autolysis of bacterial cells: Add NaCl to the washed bacterial cells to a final concentration of 3 mol / L, suspend them evenly, and incubate them at 15°C for 6 days.

[0432] (3) Cell disruption: Totipotency nuclease with a final concentration of 25 μg / g of cells was added to the autolyzed bacterial suspension. The suspension was homogenized three times using a high-pressure homogenizer at a controlled temperature of 10℃ and a disruption pressure of 900 Bar. After disruption, the suspension was centrifuged (4℃, 10,000g, 30min), purified water was added, and the supernatant was collected by controlling the centrifugation flow rate at 1000–3000 L / h and the sludge removal time at 100–150 s.

[0433] (4) Enzymatic digestion: The pH of the supernatant was adjusted to 2.0, and pepsin was added to a final concentration of 500 U / L. Digestion was carried out at 4℃ for 20 h, and then the pH was adjusted to 9.0 with NaOH to terminate the digestion. SDS-PAGE analysis was performed on samples, and the results are shown in Figure 26. The removal of N-terminal and C-terminal telopeptide sequences was confirmed, and a significant reduction in host protein was observed in the bacterial cells. The type I procollagen expressed in the fermented cells had formed a stable triple helix structure. After pepsin digestion to remove the N-terminal and C-terminal telopeptides, recombinant type I human collagen was obtained. ≥99% of the protein components in the final product stock solution were the aforementioned triple helix structure and its assembled aggregates, without telopeptides.

[0434] (5) Preliminary purification (microfiltration and ultrafiltration): Microfiltration was performed using a 0.45 μm PES membrane at an injection flow rate of 4 L / min / m² and a transmembrane pressure of 2 bar. The flow-through was collected to remove larger Pichia pastoris cell-related impurities. Ultrafiltration was then performed using a 100 kDa membrane for concentration and buffer replacement (using low-salt buffer). Specifically, a PVDF membrane with a 100 kDa pore size was selected, and the retentate was collected at an injection flow rate of 5 L / min / m² and a transmembrane pressure of 1 bar. The buffer was replaced 3–5 times.

[0435] (6) Fine purification (salting out and chromatography): Add sodium chloride to the sample from the previous step to a final concentration of 1.5 mol / L, incubate at 4℃ for 8 h, and collect the precipitate by centrifugation. After redissolving the precipitate, purify it using an anion exchange column, eluting with 10 mmol / L Tris and 0.1 mol / L NaCl solution, and collect the target protein peak.

[0436] (7) Final formulation: The protein solution purified by chromatography was replaced with 10 mmol / L HCl (containing 1 M glycerol) by ultrafiltration to obtain recombinant type I human collagen stock solution with a protein concentration of approximately 3.8 mg / mL.

[0437] 2. Recombinant Type III Human Collagen: The fermentation broth purified in this embodiment is from Example 9. This embodiment exemplarily demonstrates that the engineered bacteria (GS115-COL3A1-P4Hb-P4Ha2-vP4H) used for fermentation of recombinant type III human collagen has a gene copy number ratio of P4Ha2:P4Hb:vP4H:full-length COL3A1 = 1.99:1.93:1.04:1, as shown in Table 7 of Example 5.

[0438] (1) Bacterial harvesting and washing: Refer to the steps for bacterial harvesting and washing in the large-scale purification of recombinant type I human collagen mentioned above.

[0439] (2) Bacterial autolysis: Specifically, refer to the steps of bacterial autolysis in recombinant type I human collagen mentioned above, take samples for testing and perform SDS-PAGE analysis. The results are shown in Figure 27. It can be seen that the host protein of the bacteria is significantly reduced after bacterial autolysis.

[0440] (3) Cell disruption: Refer to the steps for cell disruption in the large-scale purification of recombinant type I human collagen mentioned above.

[0441] (4) Enzyme digestion; Specifically refer to the enzyme digestion steps in the large-scale purification of recombinant type I human collagen mentioned above to obtain recombinant type III human collagen. The protein components in the final product stock solution are ≥99% of the above triple helix structure and its assembled polymers, without telopeptides.

[0442] (5) Preliminary purification (microfiltration and ultrafiltration): Refer to the preliminary purification (microfiltration and ultrafiltration) steps in the large-scale purification of recombinant type I human collagen mentioned above.

[0443] (6) Fine purification (salting out and chromatography): Refer to the steps above for fine purification (salting out and chromatography) of recombinant type I human collagen.

[0444] (7) Final formulation: The protein solution purified by chromatography was replaced with 10 mmol / L HCl (containing 1 M glycerol) by ultrafiltration to obtain recombinant type III human collagen stock solution with a protein concentration of approximately 3.7 mg / mL.

[0445] Test Example 1: Product Quality Inspection

[0446] 1. Recombinant Type I human collagen:

[0447] This test example performs multiple quality tests on the recombinant type I human collagen stock solution obtained in Example 10. Other evaluation methods are detailed in "Pharmaceutical Industry Standard YY / T 1849-2022, Recombinant Collagen". The sample tested in this example is the recombinant type I human collagen stock solution prepared in Example 10, with the gene copy number ratio of the source strain being P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2 = (1.80–2.20):(1.80–2.20):(0.80–1.50):(1.80–2.20):1 (see Example 5 and Table 6). This ratio ensures that the product has a high hydroxyproline content (detected value of 12.3%), an intact triple helix structure (verified by circular dichroism chromatography and self-assembly), and high purity (SEC-HPLC purity 99.5%). The specific experimental steps and results are shown below:

[0448] (1) Identification (SDS-PAGE): Molecular weight was determined using non-reducing polyacrylamide gel electrophoresis. A 4% stacking gel / 7.5% separating gel was prepared. 50 μg of recombinant type I human collagen sample was added to a 1.5 mL centrifuge tube, and 0.01 mol / L hydrochloric acid was added to a total volume of 75 μL. 25 μL of loading buffer (4x) was added and mixed well. 6–10 μL of the prepared sample was spotted into the gel wells, and the gel was connected to the electrophoresis apparatus for electrophoresis. Step 1: 80 V, 20 min; Step 2: 160 V or 180 V, 60 min. After electrophoresis, staining and destaining were performed, and images were taken using a gel imaging system. See Figure 28 for the experimental results.

[0449] (2) Purity (SDS-PAGE)

[0450] Sample preparation:

[0451] Sample a (normal sample): Dilute the sample with water to a collagen concentration of 1 mg / mL.

[0452] Sample b (enzyme digestion sample): Dilute the sample with collagenase digestion solution (collagenase concentration: 5U / mL) to a collagen concentration of 1mg / mL, and incubate overnight at 37℃.

[0453] Sample c (collagenase): Dilute the collagenase digestion solution with water to make the collagenase concentration the same as that of sample b.

[0454] Take 50 μL of samples a, b, and c respectively, add 25 μL of water and 25 μL of sample buffer to each, mix well, incubate at 100℃ for 3 min, remove and let stand at room temperature, then take 20 μL of each sample for loading.

[0455] Preparation of BSA solution:

[0456] Preparation of S0: Dilute BSA with water to 0.2 mg / mL.

[0457] Preparation of S1 (20 ng): Take 2 μL of S0, add 148 μL of water and 50 μL of sample buffer, mix well, incubate at 100℃ for 3 min, take out and let it cool to room temperature, then take 10 μL of the sample for loading.

[0458] Preparation of S2 (30ng): Take 3μL of S0, add 147μL of water and 50μL of sample buffer, mix well, incubate at 100℃ for 3min, take out and let it cool to room temperature, then take 10μL for loading.

[0459] Preparation of S3 (40 ng): Take 4 μL of S0, add 146 μL of water and 50 μL of sample buffer, mix well, incubate at 100℃ for 3 min, take out and let it cool to room temperature, then take 10 μL of the sample for loading.

[0460] On-machine testing:

[0461] SDS-polyacrylamide gels were prepared (7% separating gel and 4% stacking gel). Voltage conditions were set as follows: 80V for 20 min; 180V for 60 min. After staining and destaining, the band density was analyzed using a gel imaging system.

[0462] Data Analysis:

[0463] When BC≠0, the purity (%) of collagen in the sample = {A-(BC)} / A*100%

[0464] When BC = 0, the purity (%) of collagen in the sample = (10000 - BSA staining limit) / 10000 * 100%. See Figure 29 for the experimental results.

[0465] (3) Purity (HPLC): The purity was detected by size exclusion chromatography (SEC-HPLC). The detection conditions are shown in Table 12. The specific detection results are shown in Figure 30.

[0466] Table 12: SEC-HPLC Purity Detection Conditions

[0467] (4) Collagen content: The protein content of recombinant type I human collagen was detected using a commercially available biuret assay kit. Simultaneously, the hydroxyproline content determination method described below can be used to determine the content of recombinant type I human collagen through its hydroxyproline content coefficient.

[0468] (5) Hydroxyproline content (UV spectrophotometry): Hydroxyproline is a specific amino acid found in collagen, and its content is positively correlated with the stability of the triple helix structure formed by collagen. The sample to be tested (i.e., the recombinant type I human collagen stock solution prepared in Example 10) was subjected to 105°C and 6 mol / L hydrochloric acid to release hydroxyproline residues. The released hydroxyproline was oxidized by chloramine-T and reacted with p-dimethylaminobenzaldehyde to form a purple-red compound with a maximum absorption peak at 560 nm. Its content could be determined by colorimetry, thereby calculating the collagen content in the sample.

[0469] Solution preparation:

[0470] Hydrochloric acid solution, c(HCl) = 6 mol / L: Mix analytical grade hydrochloric acid with an equal volume of water; pH = 6.0 buffer solution: Weigh 57 g sodium acetate trihydrate, 37.5 g trisodium citrate, 5.5 g citric acid monohydrate, 385 mL isopropanol, add 500 mL of water, adjust the pH to 6.0 with citric acid monohydrate, and dilute with water to 1000 mL; Chloramine T solution: Weigh 3.5 g chloramine T and dilute with water to 50 mL;

[0471] Oxidizing agent solution: Mix chloramine T solution and pH 6.0 buffer at a ratio of 1:4; 60% perchloric acid solution: Measure 43 mL of perchloric acid and dilute with water to 50 mL;

[0472] p-Dimethylaminobenzaldehyde solution: Weigh 10g of p-dimethylaminobenzaldehyde and dissolve it in 15mL of 60% perchloric acid solution;

[0473] Colorimetric reagent: Measure 15 mL of p-dimethylaminobenzaldehyde solution and dissolve it in 65 mL of isopropanol; Sodium hydroxide solution, c(NaOH) = 6 mol / L: Weigh 24 g of sodium hydroxide and dilute it with water to 100 mL.

[0474] Preparation of L-hydroxyproline reference solution: L-hydroxyproline reference stock solution: Take L-hydroxyproline reference standard, accurately weigh it, dissolve it in water and quantitatively dilute it to a solution containing 20 μg per 1 mL;

[0475] L-hydroxyproline reference standard series solutions: Accurately measure 2.5 mL, 3.75 mL, 5.0 mL, 7.5 mL, and 10.0 mL of L-hydroxyproline reference standard stock solution into 10 mL volumetric flasks, and dilute to volume with water to prepare the L-hydroxyproline reference standard series solutions.

[0476] Preparation of test sample: Take the recombinant type I human collagen stock solution sample obtained according to the operation in Example 10, place it in a hydrolysis tube, weigh it accurately, add an appropriate amount of 6 mol / L HCl, fill the tube with nitrogen and seal it; hydrolyze at 105℃ for 22-24 h, cool, transfer the hydrolysis product to a volumetric flask, wash the hydrolysis tube with water, combine the washing liquid and transfer it to a volumetric flask, add 2 drops of phenolphthalein indicator, add 6 mol / L NaOH until the solution turns pink, dilute to volume with water, shake well, and the test solution is obtained.

[0477] Detection: Accurately measure 0.5 mL of blank (water), hydroxyproline reference solution series, and test solution, add 1 mL of isopropanol and 0.5 mL of oxidant solution respectively, mix, and let stand at room temperature for 4 min. Then add 6.5 mL of colorimetric reagent to each, mix, and place each tube in a 60℃ water bath for 15 min, then cool. Use the blank as a control, measure the absorbance at 560 nm, and perform linear regression on the absorbance with the concentration series of hydroxyproline reference solution to obtain the linear regression equation. Calculate the hydroxyproline content.

[0478] (6) Hydroxyproline content (HPLC method):

[0479] Solution preparation:

[0480] Mobile phase A: Preparation of 0.05 mol / L sodium acetate aqueous solution: Weigh 8.2 g of anhydrous sodium acetate, add 1800 mL of purified water to a beaker and dissolve. Stir with a magnetic stirrer to mix the solution. Adjust the pH to 6.50 ± 0.02 with acetic acid, add purified water to make up to 2000 mL, mix well, filter through a 0.22 μm filter membrane and set aside for later use.

[0481] Preparation of mobile phase B: methanol:acetonitrile:water (20:60:20): Taking 1L as an example, measure 200mL of methanol, 600mL of acetonitrile, and 200mL of purified water filtered through a 0.22μm membrane at a volume ratio of (20:60:20), and mix well. Preparation of 7mol / L hydrochloric acid solution: Measure 5.83mL of hydrochloric acid, add purified water filtered through a 0.22μm membrane to a final volume of 10mL, and mix well.

[0482] Preparation of 0.1 mol / L hydrochloric acid solution: Measure 0.25 mL of hydrochloric acid, add purified water filtered through a 0.22 μm filter membrane to a final volume of 30 mL, and mix well.

[0483] Preparation of 1 mol / L triethylamine acetonitrile solution: Measure 140 μL of triethylamine and 860 μL of acetonitrile, and mix well.

[0484] Preparation of 0.1 mol / L PITC acetonitrile solution: Measure 25 μL of PITC and 975 μL of acetonitrile, and mix well.

[0485] Sample processing:

[0486] Take 300 μL of sample into a hydrolysis tube, add 2 mL of 7 mol / L hydrochloric acid solution, purge with nitrogen for 2 min, and hydrolyze at 105 °C for 24 h. Transfer the hydrolyzed sample to a 25 mL rotary evaporator flask, and rinse the hydrolysis tube with purified water, adding 1 mL of purified water each time. After rinsing, transfer the sample to the rotary evaporator flask and rinse twice. Install the rotary evaporator flask on the evaporator and evaporate the sample to dryness until the reaction solution is completely removed. Remove the rotary evaporator flask and add 2.5 mL of 0.05 mol / L sodium acetate aqueous solution to dissolve the sample completely. Take 25 μL each of the sample, amino acid mixed solution standard (1 mmol / L), L-hydroxyproline standard (1 mmol / L), and sample blank (0.05 mol / L sodium acetate aqueous solution) into a 1.5 mL centrifuge tube. Add 12.5 μL of 1 mol / L triethylamine acetonitrile solution and vortex to mix. Then add 12.5 μL of 0.1 mol / L PITC acetonitrile solution, vortex to mix, and let stand at room temperature for 1 h. Add 100 μL of n-hexane solution, vortex for 1 min, and let stand for 10 min. Measure 30 μL of the lower layer solution into a 1.5 mL centrifuge tube, add 270 μL of 0.05 mol / L sodium acetate aqueous solution, mix thoroughly, and filter through a 0.22 μm organic filter membrane to obtain the final product.

[0487] On-machine testing:

[0488] Mobile phase A: 0.05 mol / L sodium acetate aqueous solution

[0489] Mobile phase B: Methanol: Acetonitrile: Water (20:60:20)

[0490] Column: Diamonsil AAA, DIKMA

[0491] Detector: 2489 UV detector; Wavelength: 254nm

[0492] Column temperature: 35℃; Injection volume: 50 μL for sample solution, 10 μL for standard solution.

[0493] Flow rate: 1.0 mL / min

[0494] Elution method: Gradient elution; Elution time: 60 minutes

[0495] The gradient parameters are shown in Table 13:

[0496] Table 13: Chromatographic gradient table for hydroxyproline content detection

[0497] The software was used to integrate each amino acid peak, and the content of proline and hydroxyproline in the sample was calculated by using the peak areas of amino acids in the standard and the sample. See Figure 31 for the experimental results.

[0498] (7) Exogenous DNA residue: The amount of exogenous DNA was detected using the Pichia pastoris DNA extraction kit and Pichia pastoris DNA quantification kit from Applied Biosystems.

[0499] (8) Host protein residue: The host protein detection kit of Pichia pastoris from CYGNUS was used for detection.

[0500] (9) Residual totipotent nuclease: The totipotent nuclease ELISA assay kit from Shanghai Yaxin Company was used for detection.

[0501] (10) Pepsin residue: The pepsin (PG) ELISA detection kit from Shanghai Jining Industrial Co., Ltd. was used for detection.

[0502] (11) Peptidoglycan residue (pro-inflammatory substances): The bacterial peptidoglycan (PG) ELISA kit from Shinnoda was used for detection.

[0503] (12) Cytotoxicity: L929 cells were cultured in MEM medium containing 10% fetal bovine serum and antibiotics (penicillin 100 U / mL, streptomycin 100 μg / mL) at 37°C in a 5% CO2 incubator. Cells were digested with 0.25% trypsin (containing EDTA) to prepare single-cell suspensions, counted, and the cell concentration was adjusted to 1.0 × 10⁻⁶ cells / mL. 5 Cells / mL were added to each dish, along with 2 mL of the above cell suspension. The dishes were incubated at 37°C with 5% CO2 for 24 hours, and the supernatant was discarded. Once the cells formed a monolayer, the original culture medium was aspirated, and 0.8 mL of fresh culture medium was added to each dish. Then, recombinant type I human collagen stock solution was added, covering approximately one-tenth of the cell surface. Negative and positive controls were prepared using the same method, with three replicates for each. The cells were incubated for another 48 hours, and the supernatant was removed. 500 mL of neutral red was added to each dish, and the mixture was incubated for 1 hour. The neutral red was discarded, and 2 mL of PBS was added. Cell morphology changes were observed under a microscope. The cytotoxicity grading is described in Table 14.

[0504] Table 14: Cytotoxicity Grading Standards

[0505] (13) Peptide diagram:

[0506] Solution preparation:

[0507] Mobile phase A: 0.1% trifluoroacetic acid (TFA) aqueous solution: Transfer 1 mL of trifluoroacetic acid, add purified water to make up to 1000 mL, and shake well.

[0508] Mobile phase B: 0.1% trifluoroacetic acid (TFA) - 60% acetonitrile - aqueous solution: Transfer 1 mL of trifluoroacetic acid, add 600 mL of acetonitrile, and dilute to 1000 mL with purified water. Shake well.

[0509] 0.05 mol / L Tris / HCl buffer solution (pH 7.50): Weigh 6.06 g of tris(hydroxymethyl)aminomethane (Tris) and dissolve it in 900 mL of purified water in a beaker. Adjust the pH to 7.50 with hydrochloric acid and bring the volume to 1000 mL. Mix well.

[0510] 0.1 mol / L ammonium bicarbonate solution: Weigh 7.90 g of ammonium bicarbonate, add 900 mL of purified water to a beaker to dissolve, and make up to 1000 mL. Mix well.

[0511] Trypsin solution: Take 20 μg of trypsin, add 0.05 mol / L Tris / HCl buffer solution (pH 7.5) to dissolve, and make up to 10 mL. Mix well.

[0512] Sample preparation: Take 1 mL of sample solution, incubate in a water bath at 60℃ for 3 h, cool to room temperature, dilute with 0.1 mol / L ammonium bicarbonate solution to a concentration of about 2 mg / mL, take 20 μL of 1 mL trypsin solution, incubate in a water bath at 37℃ for 22 h, centrifuge at 10000 rpm for 1-3 min, collect the supernatant, and perform analysis.

[0513] The equipment parameters are shown in Table 15:

[0514] Table 15: Chromatographic parameters for peptide mapping detection

[0515] See Figure 32 for the specific results.

[0516] (14) Circular dichroism (CD)

[0517] The maximum absorption peak of collagen, which has a triple helix structure, is between 222-225 nm in the far-ultraviolet spectrum, and the maximum negative absorption peak is between 197-200 nm.

[0518] Solution preparation:

[0519] 0.5% acetic acid solution: Take 250 μL of anhydrous acetic acid, add it to 50 mL of purified water, and mix well.

[0520] Sample preparation: Add 400 μL of 0.5% acetic acid solution to a cuvette as a sample blank. Dilute the sample to 0.2 mg / mL with 0.5% acetic acid solution, mix well, and then take 400 μL for instrumental analysis.

[0521] The equipment parameters are shown in Table 16:

[0522] Table 16: Parameters for Circular Dichroism Structure Validation

[0523] See Figure 33 for the specific results.

[0524] (15) Self-assembly:

[0525] Solution preparation:

[0526] 10 mmol / L PBS buffer (pH 10.0): Weigh 0.27 g potassium dihydrogen phosphate, 1.14 g disodium hydrogen phosphate, 0.20 g potassium chloride, and 8.00 g sodium chloride. Dissolve in 800 mL of water. Adjust the pH to 10.0 ± 0.05 with 1 mol / L sodium hydroxide solution. Add water to 1000 mL and mix well.

[0527] Sample preparation: Sample dilution was performed on ice. Take 200 μL of sample, add 400 μL of 10 mmol / L PBS buffer (pH 10.0), mix well, and adjust the final pH to between 7.0 and 7.4.

[0528] Instrumental testing: Pipette 200 μL of the prepared test solution into a 96-well plate, place it on an ELISA reader, set the detection wavelength to 313 nm, and control the temperature at 37 °C. Measure the OD value every 30 seconds for a total of 1.5 hours.

[0529] See Figure 34 for the specific results.

[0530] (16) For tests on residue on ignition, total heavy metals, trace elements, thermal stability, bacterial endotoxins, and sterility, please refer to the "Pharmaceutical Industry Standard of the People's Republic of China YY / T 1849-2022, Recombinant Collagen" and the Chinese Pharmacopoeia (2025 edition), which are routine legal methods. For specific results on thermal stability, please refer to Figure 35.

[0531] (17) Methods for sequence coverage, N-terminal sequence analysis, and C-terminal sequence analysis can be found in the published patent CN119954936A. The test items, control standards, and test results are shown in Table 17.

[0532] Table 17: Comparison of Control Standards and Detection Results for Recombinant Type I Human Collagen

[0533] The peptide mapping results are shown in Figure 32, and the circular dichroism chromatogram results are shown in Figure 33. The test results show that the recombinant type I human collagen stock solution obtained in this embodiment has a sequence completely identical to the human type I human collagen sequence, with a sequence coverage of 100%. Both the N-terminal and C-terminal sequences are completely identical to the theoretical sequences. It possesses a triple helix structure, can self-assemble, has a high hydroxyproline content, and a high melting point. Impurities are extremely low, with exogenous DNA residue not exceeding 100 pg / mg, host protein residue not exceeding 0.05%, and residues of totipotent nuclease and pepsin added during the process not exceeding 10 ppm. The protein components in the recombinant type I human collagen stock solution consist of triple helix structures and a small amount of polymer components further assembled from triple helix structures, both of which are effective components with a purity of over 99%. Other components are non-triple helix collagen structural components. Therefore, the actual purity of the obtained recombinant type I human collagen should be 100%. Regarding microbial control, the endotoxin content of the recombinant type I human collagen is below 0.01 EU / mg, and it is sterile.

[0534] Since the designed recombinant type I human collagen sequence is completely identical to the type I human collagen sequence in the human body, it has good biocompatibility. The recombinant type I human collagen stock solution obtained by this invention can be mass-produced and widely used in medical devices, tissue engineering, biological materials and other fields.

[0535] 2. Recombinant type III human collagen:

[0536] This test example performs multiple quality tests on the recombinant type III human collagen stock solution obtained in Example 10. Other evaluation methods are detailed in "Pharmaceutical Industry Standard of the People's Republic of China YY / T 1849-2022, Recombinant Collagen". The sample tested in this test example is the recombinant type III human collagen stock solution prepared in Example 10. Its source strain is the GS115-COL3A1-P4Hb-P4Ha2-vP4H strain (serial number 3) screened in Example 5. Its gene copy number ratio is P4Ha2:P4Hb:vP4H:full-length COL3A1 = 1.99:1.93:1.04:1 (see Example 5 and Table 7). This specific gene copy number ratio ensures that the recombinant type III human collagen product has a hydroxyproline content (detected value of 16.1%) that is essentially consistent with natural type III human collagen, an intact triple helix structure (verified by circular dichroism chromatography and self-assembly), and high purity (SEC-HPLC purity of 99.8%). The specific experimental steps and results are shown below:

[0537] (1) Non-reduction electrophoresis: For specific steps, please refer to the non-reduction electrophoresis steps of recombinant type I human collagen mentioned above. The difference is that 50 μg of recombinant type III human collagen sample is used for the experiment. For the experimental results, please refer to Figure 36.

[0538] (2) Purity determination: The purity was determined by size exclusion chromatography (SEC-HPLC). The detection conditions are shown in Table 18. The specific results are shown in Figure 37.

[0539] Table 18: SEC-HPLC Purity Determination Conditions

[0540] (3) Collagen content: The protein content of recombinant type III human collagen was detected using a commercially available biuret assay kit. Simultaneously, the hydroxyproline content determination method described below can be used to determine the content of recombinant type III human collagen through its hydroxyproline content coefficient.

[0541] (4) Hydroxyproline content: The sample to be tested (i.e., the recombinant type III human collagen stock solution prepared in Example 10) was subjected to 105°C and 6 mol / L hydrochloric acid to release hydroxyproline residues. The specific steps are the same as those described above for the detection steps of hydroxyproline content of recombinant type I human collagen.

[0542] Solution preparation: The specific steps and components (preparation of hydrochloric acid solution, oxidant solution, p-dimethylaminobenzaldehyde solution, L-hydroxyproline reference solution, and L-hydroxyproline reference solution series) shall refer to the steps for preparing recombinant type I human collagen solution described above.

[0543] Preparation of test sample: Take the recombinant type III human collagen stock solution sample obtained according to the operation in Example 10 and prepare it according to the steps of the aforementioned preparation of recombinant type I human collagen test sample.

[0544] Detection: The recombinant type III human collagen obtained in Example 10 was detected according to the steps described above for the detection of recombinant type I human collagen, and the hydroxyproline content in the test solution was calculated.

[0545] (5) Exogenous DNA residue: The amount of exogenous DNA was detected using the Pichia pastoris DNA extraction kit and Pichia pastoris DNA quantification kit from Applied Biosystems.

[0546] (6) Host protein residue: The host protein detection kit of Pichia pastoris from CYGNUS was used for detection.

[0547] (7) Residual totipotent nuclease: The totipotent nuclease ELISA assay kit from Shanghai Yaxin Company was used for detection.

[0548] (8) Pepsin residue: The pepsin (PG) ELISA detection kit from Shanghai Jining Industrial Co., Ltd. was used for detection.

[0549] (9) Peptidoglycan residue (pro-inflammatory substance): The bacterial peptidoglycan (PG) ELISA kit from Shinnoda was used for detection.

[0550] (10) Cytotoxicity: Refer to the above-mentioned steps for the detection of cytotoxicity in recombinant type I human collagen. The cytotoxicity grading is described in Table 19.

[0551] Table 19: Cytotoxicity Grading Standards

[0552] (11) Peptide diagram:

[0553] Solution preparation:

[0554] For specific steps regarding solution preparation, please refer to the steps outlined in the aforementioned diagram of recombinant type I human collagen peptides.

[0555] The equipment parameters are shown in Table 20:

[0556] Table 20: Chromatographic parameters for peptide mapping detection

[0557] See Figure 38 for the specific results.

[0558] (12) Circular dichroism (CD)

[0559] The maximum absorption peak of collagen, which has a triple helix structure, is between 222-225 nm in the far-ultraviolet spectrum, and the maximum negative absorption peak is between 197-200 nm.

[0560] Solution preparation:

[0561] 10 mmol / L PBS buffer (pH 7.4): Weigh 0.27 g potassium dihydrogen phosphate, 1.14 g disodium hydrogen phosphate, 0.20 g potassium chloride, and 8.00 g sodium chloride. Dissolve in 800 mL of water. Adjust the pH to 7.4 ± 0.05 with 1 mol / L sodium hydroxide solution. Add water to 1000 mL and mix well.

[0562] Sample preparation: Add 400 μL of 10 mmol / L PBS buffer (pH 7.4) to a cuvette as a sample blank. Dilute the sample to 0.25 mg / mL with 10 mmol / L PBS buffer (pH 7.4), mix well, and then take 400 μL for instrumental analysis.

[0563] The equipment parameters are shown in Table 21:

[0564] Table 21: Parameters for Circular Dichroism Structure Validation

[0565] See Figure 39 for the specific results.

[0566] (13) Self-assembly:

[0567] Solution preparation:

[0568] The specific steps for preparing the solution in the self-assembly of recombinant type I human collagen are described above. See Figure 40 for the results.

[0569] (14) Disulfide bond analysis:

[0570] Sample preparation: Take the sample solution, dilute it to 1 mg / mL with 150 mmol / L Tris-HCl buffer (pH 7.5), denature at 95℃ for 10 min, cool to room temperature, add 10 μL 2 mg / mL collagenase III, mix well and incubate at 37℃ overnight, take it out, mix well and load the sample.

[0571] The HPLC conditions are shown in Table 22:

[0572] Table 22: Parameters for UPLC-MS coupling for disulfide bond analysis

[0573] Mass spectrometry conditions are shown in Table 23:

[0574] Table 23: Conditions for Mass Spectrometry Identification of Disulfide Bonds

[0575] The results are shown in Figure 41. It can be seen that the protein disulfide bond connection mode should be the form in which three chains are connected by inter-chain disulfide bonds, without free thiol groups, which is consistent with the theoretical disulfide bond connection mode.

[0576] (15) For tests on residue on ignition, total heavy metals, trace elements, thermal stability, bacterial endotoxins, and sterility, please refer to the "Pharmaceutical Industry Standard of the People's Republic of China YY / T 1849-2022, Recombinant Collagen" and the Chinese Pharmacopoeia (2025 edition), which are routine legal methods.

[0577] (16) Methods for sequence coverage, N-terminal sequence analysis, and C-terminal sequence analysis can be found in the published patent CN119874880A.

[0578] The inspection items, control standards, and test results are shown in Table 24:

[0579] Table 24: Comparison of Control Standards and Detection Results for Recombinant Type III Human Collagen

[0580] The peptide mapping results are shown in Figure 38, and the circular dichroism chromatogram results are shown in Figure 39. The test results show that the recombinant type III human collagen stock solution obtained in this embodiment has a sequence completely identical to the human type III human collagen sequence, with a sequence coverage of 100%. The N-terminal sequence, C-terminal sequence, and disulfide bond linkage are all completely consistent with the theoretical sequence. It possesses a triple helix structure, can self-assemble, has a high hydroxyproline content, and a high melting point. Impurities are extremely low; exogenous DNA residue does not exceed 100 pg / mg, host protein residue does not exceed 0.05%, and the residues of totipotent nuclease and pepsin added during the process do not exceed 10 ppm. The protein components in the recombinant type III human collagen stock solution are triple helix structures and a small amount of polymer components further assembled from triple helix structures, both of which are effective components with a purity of over 99%. Other components are non-triple helix collagen structure components. Therefore, the actual purity of the obtained recombinant type III human collagen should be 100%. In terms of microbial control, the endotoxin content of recombinant type III human collagen is less than 0.01 EU / mg, and it is sterile.

[0581] Since the designed recombinant type III human collagen sequence is completely identical to the type III human collagen sequence in the human body, it has good biocompatibility. The recombinant type III human collagen stock solution obtained by this invention can be mass-produced and widely used in medical devices, tissue engineering, biological materials and other fields.

[0582] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0583] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for preparing recombinant human collagen, characterized in that, The method includes: Construct genetically engineered bacteria expressing proline hydroxylase and recombinant human collagen; The genetically engineered bacteria were cultured, and the culture product was digested with pepsin to obtain the recombinant human collagen. The recombinant human collagen is either recombinant type I human collagen or recombinant type III human collagen. When the recombinant human collagen is recombinant type I human collagen: The recombinant type I human collagen includes full-length COL1A1 protein and full-length COL1A2 protein; The amino acid sequence of the full-length COL1A1 is shown in SEQ ID NO:1 or 2, and the amino acid sequence of the full-length COL1A2 is shown in SEQ ID NO:3 or 4. The proline hydroxylase includes P4Ha2, P4Hb, and vP4H; The copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1, and full-length COL1A2 is (1.80–2.20): (1.80–2.20): (0.80–1.50): (1.80–2.20): 1; When the recombinant human collagen is recombinant type III human collagen: The amino acid sequence of the full-length recombinant type III human collagen is shown in SEQ ID NO:11; The proline hydroxylase includes P4Ha2, P4Hb, and vP4H; The copy number ratio of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.80–2.20): (1.80–2.20): (0.80–1.60):

1.

2. The method according to claim 1, characterized in that, When the recombinant human collagen is recombinant type I human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H, full-length COL1A1 and full-length COL1A2 is (1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):

1.

3. The method according to claim 1, characterized in that, When the recombinant human collagen is recombinant type III human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90~2.10):(1.90~2.10):(0.90~1.10):

1.

4. The method according to claim 1, characterized in that, The amount of pepsin added to the culture product is 100-500 U / L; And / or, the temperature of the enzymatic digestion treatment is 2–10°C; And / or, the enzyme digestion treatment time is 16 to 30 hours; And / or, the amino acid sequence of said P4Ha2 is as shown in SEQ ID NO:6; And / or, the amino acid sequence of the P4Hb is shown in SEQ ID NO:7; And / or, the amino acid sequence of the vP4H is as shown in SEQ ID NO:

8.

5. The method according to claim 1, characterized in that, When the recombinant human collagen is recombinant type I human collagen, the amino acid sequence of COL1A1 after enzyme digestion is shown in SEQ ID NO:9, and the amino acid sequence of COL1A2 after enzyme digestion is shown in SEQ ID NO:

10. And / or, when the recombinant human collagen is recombinant type III human collagen, the amino acid sequence of the enzyme-digested COL3A1 is as shown in SEQ ID NO:5; And / or, the genetically engineered bacteria are selected from Pichia pastoris strains.

6. The method according to claim 1, characterized in that, Further including, The enzyme digestion product was purified. Optionally, the purification process consists of microfiltration, salting out, chromatography, and ultrafiltration.

7. The method according to claim 6, characterized in that, The microfiltration process is performed using a filter membrane with a pore size of 0.22 μm or larger. And / or, the salting-out treatment is carried out using a 0.5–3 mol / L sodium chloride solution; And / or, the salting-out treatment lasts for 16 to 30 hours; And / or, the chromatography process is performed using ion exchange chromatography; And / or, the ultrafiltration treatment is performed using a filter membrane with a molecular weight of 50 kD or higher.

8. The method according to claim 1, characterized in that, The purity of the recombinant human collagen is greater than 95%; And / or, when the recombinant human collagen is recombinant type I human collagen, the hydroxyproline content in the recombinant type I human collagen is greater than 10.5%, preferably 10.5% to 11.5%; And / or, when the recombinant human collagen is recombinant type III human collagen, the hydroxyproline content in the recombinant type III human collagen is greater than 16.5%, preferably 16.6% to 17.5%; And / or, the recombinant human collagen has a complete triple helix structure; And / or, in the circular dichroism spectrum, the recombinant human collagen has a negative absorption peak at a wavelength of 190–200 nm and a positive absorption peak at a wavelength of 210–230 nm. And / or, the recombinant human collagen has a negative absorption peak at a wavelength of 195–200 nm; And / or, the recombinant human collagen has a positive absorption peak at a wavelength of 215–225 nm.

9. A recombinant protein, characterized in that, The amino acid sequence of the recombinant protein is shown in SEQ ID NO:2 or 4.

10. Use of the recombinant protein according to claim 9 in the preparation of recombinant type I human collagen.

11. A recombinant human collagen, characterized in that, The recombinant human collagen is prepared by the method according to any one of claims 1 to 8.

12. A composition, characterized in that, The recombinant human collagen prepared by the method according to any one of claims 1 to 8.

13. The composition according to claim 12, characterized in that, The composition further includes excipients; And / or, the composition is selected from at least one of recombinant human collagen hydrogel, recombinant human collagen repair fluid, recombinant human collagen solution, or recombinant human collagen dressing, or recombinant human collagen cross-linked or non-cross-linked facial filler, or recombinant human collagen artificial dermis, or recombinant human collagen sponge and recombinant human collagen bone repair material.

14. A method for large-scale preparation of recombinant human collagen, characterized in that, include: The engineered bacteria were fermented and cultured to express procollagen; The fermentation culture product was purified to obtain recombinant human collagen. The fermentation culture process is a three-stage fermentation, and the final fermentation volume of the three-stage fermentation is not less than 9000 liters; the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen. When the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full length COL1A1:full length COL1A2=(1.80~2.20):(1.80~2.20):(1.80~2.20):1; or P4Ha2:P4Hb:vP4H:full length COL1A1:full length COL1A2=(1.80~2.20):(1.80~2.20):(0.80~1.50):(1.80~2.20):1; And / or, when the recombinant human collagen is recombinant type III human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:full-length COL3A1=(1.80~2.20):(1.80~2.20):1, or P4Ha2:P4Hb:vP4H:full-length COL3A1=(1.80~2.20):(1.80~2.20):(0.80~1.60):

1.

15. The method according to claim 14, characterized in that, When the recombinant human collagen is recombinant type I human collagen, the copy number ratio of the proline hydroxylase gene is: P4Ha2:P4Hb:vP4H:full-length COL1A1:full-length COL1A2=(1.80~2.20):(1.80~2.20):(0.80~1.40):(1.80~2.20):

1.

16. The method according to claim 14, characterized in that, When the recombinant human collagen is recombinant type III human collagen, the copy number ratio of P4Ha2, P4Hb, vP4H and full-length recombinant type III human collagen is (1.90~2.10):(1.90~2.10):(0.90~1.10):

1.

17. The method according to claim 14, characterized in that, The engineered bacteria include at least one of Pichia pastoris genetically engineered bacteria and Saccharomyces cerevisiae genetically engineered bacteria; And / or, the procollagen includes an N-terminal telopeptide, a triple helix region, and a C-terminal telopeptide, wherein the C-terminus of the N-terminal telopeptide is connected to the N-terminus of the triple helix region, and the C-terminus of the triple helix region is connected to the N-terminus of the C-terminal telopeptide.

18. The method according to claim 14, characterized in that, The engineered bacteria co-express proline hydroxylase.

19. The method according to claim 18, characterized in that, The proline hydroxylase includes at least one of human proline hydroxylase and viral proline hydroxylase.

20. The method according to claim 14, characterized in that, The procollagen includes type I procollagen or type III procollagen.

21. The method according to claim 14, characterized in that, The recombinant type I human collagen is a recombinant protein whose sequence composition and length are completely identical to those of natural type I human collagen. And / or, the recombinant type III human collagen is a recombinant protein whose sequence composition and length are completely identical to those of natural type III human collagen.

22. The method according to claim 14, characterized in that, The structure of the recombinant type I human collagen includes two α1 chains and one α2 chain; And / or, the structure of the recombinant type III human collagen includes three α1 chains.

23. The method according to claim 22, characterized in that, The α1 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:9, and the α2 chain of the recombinant type I human collagen has the amino acid sequence shown in SEQ ID NO:

10. And / or, the α1 chain of the recombinant type III human collagen has an amino acid sequence as shown in SEQ ID NO:

5.

24. The method according to claim 20, characterized in that, The α1 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:1 or 2, and the α2 chain of the type I procollagen has an amino acid sequence as shown in SEQ ID NO:3 or 4. And / or, the type III procollagen has an amino acid sequence as shown in SEQ ID NO:

11.

25. The method according to claim 14, characterized in that, The fermentation culture process includes a seed revival treatment prior to the fermentation culture process.

26. The method according to claim 25, characterized in that, When the recombinant human collagen is recombinant type I human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing them at a temperature of 25-30℃ and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.0; And / or, when the recombinant human collagen is recombinant type III human collagen, the seed resuscitation treatment is performed by inoculating the engineered bacteria into YPD medium and culturing OD at a temperature of 28-35℃ and a rotation speed of 200-250 rpm. 600 This was achieved in versions 5.0-8.

0.

27. The method according to claim 14, characterized in that, The three-stage fermentation includes: a) Primary fermentation: carried out in a 10-50L fermenter, with an inoculum ratio of 2-6%, and OD culture... 600 Up to 45-60; b) Secondary fermentation: carried out in a 100-1000L fermenter, with an inoculation ratio of 2-6%, and OD cultured. 600 Up to 45-60; c) Tertiary fermentation: carried out in a 5000-50000 liter fermenter, with an inoculum ratio of 2-6%, and cultured until OD (October Expiratory Scale) is reached. 600 Up to 45-60.

28. The method according to claim 14, characterized in that, The three-stage fermentation also includes fed-batch culture and induced expression treatment after the cell density reaches a predetermined value.

29. The method according to claim 28, characterized in that, The fed-batch culture treatment uses glycerol as a carbon source.

30. The method according to claim 28, characterized in that, The induced expression treatment used methanol as an inducer.

31. The method according to claim 14, characterized in that, The fermentation culture process also includes autolysis of the fermentation culture product.

32. The method according to claim 31, characterized in that, The autolysis treatment of the bacterial cells was carried out by incubation at 2-25℃ and 2-5 mol / L NaCl for 4-10 days.

33. The method according to any one of claims 14, 31 or 32, characterized in that, The method also includes crushing and centrifuging the autolysis product of the bacteria.

34. The method according to claim 33, characterized in that, The method also includes enzymatic digestion of the products from the crushed and centrifuged process.

35. The method according to claim 34, characterized in that, The enzymatic digestion is achieved by using at least one of pepsin and trypsin.

36. The method according to claim 14, characterized in that, The purification process includes microfiltration, ultrafiltration, salting out, and chromatography.

37. The method according to claim 36, characterized in that, The chromatography includes at least one of anion chromatography and cation chromatography.

38. The method according to claim 36, characterized in that, The microfiltration includes at least one of a 0.22 μm filter membrane and a 0.44 μm filter membrane.

39. The method according to claim 36, characterized in that, The ultrafiltration includes at least one of a 50kD pore size and a 100kD pore size.

40. The method according to claim 36, characterized in that, The salting out involves treatment with a 0.5–3 mol / L sodium chloride solution.

41. A recombinant human collagen protein, characterized in that, It is prepared by the method according to any one of claims 14 to 40; wherein the recombinant human collagen includes at least one of recombinant type I human collagen and recombinant type III human collagen.

42. The recombinant human collagen according to claim 41, characterized in that, The recombinant human collagen exists in the form of recombinant human collagen stock solution.

43. The recombinant human collagen according to claim 42, characterized in that, The stock solution contains recombinant type I human collagen at a concentration of 3.0-5.0 mg / mL; And / or, the stock solution contains recombinant type III human collagen at a concentration of 3.0-5.0 mg / mL, as well as pharmaceutically acceptable solvents and stabilizers.

44. The recombinant human collagen according to claim 43, characterized in that, The solvent is selected from at least one of 10-20 mmol / L hydrochloric acid, 10-50 mmol / L phosphate buffer, and 50-100 mmol / L acetic acid.

45. The recombinant human collagen according to claim 43, characterized in that, The stabilizer is glycerol with a final concentration of 1-2 mol / L.

46. ​​The recombinant human collagen according to claim 41, characterized in that, The recombinant type I human collagen has an α1 chain with an amino acid sequence as shown in SEQ ID NO:9 and an α2 chain with an amino acid sequence as shown in SEQ ID NO:10, and the ratio of the two chains is 2:

1. And / or, the recombinant type III human collagen has an amino acid sequence as shown in SEQ ID NO:

5.

47. The recombinant human collagen according to any one of claims 41-46, characterized in that, The recombinant human collagen contains 9-18% hydroxyproline.

48. The recombinant human collagen according to any one of claims 41-46, characterized in that, The recombinant human collagen has a SEC-HPLC purity of not less than 95%.

49. The recombinant human collagen according to any one of claims 41-46, characterized in that, The residual host protein in the recombinant human collagen is no more than 0.05%.

50. The recombinant human collagen according to any one of claims 41-46, characterized in that, The residual host DNA in the recombinant human collagen is no higher than 100 pg / mg.

51. The recombinant human collagen according to any one of claims 41-46, characterized in that, The endotoxin content in the recombinant human collagen is less than 0.1 EU / mg.

52. Use of the recombinant human collagen according to any one of claims 41 to 51 in the preparation of tissue-engineered products and medical devices.