Cell line derived from fish belonging to family anguillidae and use thereof
Patent Information
- Application Number
- PCT/JP2026/006229
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-19
- Filing Date
- 2026-02-19
- Publication Date
- 2026-08-27
Smart Images

Figure JP2026006229_27082026_PF_FP_ABST
Abstract
Description
Cell lines derived from eel-like fish and their use
[0001] This invention relates to cell lines derived from eel fish and their use. Furthermore, this invention relates to a method for producing cells with accumulated fat, a fat production kit, a fat-containing composition, a method for producing a fat-containing composition, and a method for screening cell proliferation-promoting substances. This application claims priority based on Japanese Patent Application No. 2025-25185, filed in Japan on February 19, 2025, the contents of which are incorporated herein by reference.
[0002] Currently, the practical application of cultured meat is progressing worldwide. Cultured meat is produced by culturing large quantities of muscle cells from animals such as chickens, pigs, cattle, or fish, and then agglomerating or organizing them. While muscle cells are the main component of meat, fat, which contributes to the juiciness and flavor of meat and is rich in calories as an energy source, is also an important component in the production of cultured meat. Fat-accumulating cells that can be used in the production of cultured meat are particularly important in reproducing the flavor of meat or fish that are rich in fat. The addition of fat to cultured meat can be done by agglomerating or organizing fat-accumulating cells together with muscle cells and other cells.
[0003] Furthermore, animal cells generally have an inherent limit to the number of divisions they can undergo, and once this limit is reached, they stop proliferating. Therefore, it is preferable that the fat-accumulating cells used in the production of cultured meat be cell lines that can be cultured for a long period of time. Such cell lines that can be cultured for a long period of time are called immortalized cell lines.
[0004] Patent Document 1 describes adipose-derived cell lines from various fish species. Patent Document 1 also describes the establishment of an adipocyte cell line by single-cell cloning of stromal vascular cells collected from adipose tissue.
[0005] Furthermore, as an example of an immortalized cell line, Patent Document 2 describes a cell line derived from triggerfish that can be subcultured substantially without restriction. Patent Document 2 describes the establishment of an immortalized cell line by seeding a microscopic fragment obtained from a living triggerfish into a culture vessel, separating the cultured cells from the microscopic fragment, and subculturing them, and that this cell line shows differentiation into adipocytes.
[0006] Special Publication No. 2024-525652 Publication Patent No. 5846384
[0007] The cell lines used in the production of cultured meat should preferably be immortalized cells and have a fast doubling acceleration. By using cell lines with a fast doubling acceleration, the production efficiency of cultured meat can be increased. The doubling acceleration of the adipose-derived cell line from Japanese eels established in Patent Document 1 is approximately 31.2 hours, and for efficient mass culture, it is preferable to have a faster doubling acceleration.
[0008] Based on the above circumstances, this disclosure aims to provide a cell line of an anguillidae fish that exhibits rapid doubling of growth rate and the ability to accumulate fat. It also provides a method for producing fat-accumulating cells using the cell line derived from the anguillidae fish. Furthermore, it provides a fat production kit, a fat-containing composition, a method for producing the fat-containing composition, and a method for screening cell proliferation-promoting substances using the cell line derived from the anguillidae fish.
[0009] To solve the above problems, one aspect of the present invention includes the following:
[0010] [1] A cell line derived from an anguillidae fish that expresses at least one selected from the group consisting of vimentin, CD29, CD73, and CD105, and has the ability to accumulate fat. [2] A cell line derived from an anguillidae fish according to [1], further expressing at least one selected from the group consisting of Perioxisome Proliferator-Activated Receptor γ (PPARγ) and Fatty acid binding protein 4 (FABP4). [3] A cell line derived from an anguillidae fish according to [1] or [2] that has the ability to form a multilayer structure. [4] A cell line derived from an anguillidae fish according to any one of [1] to [3], wherein the anguillidae fish is the Japanese eel. [5] A cell line derived from an anguillidae fish according to [1], which is selected from the group consisting of JE-KRT224 (accession number NITE BP-04244), JE-EK4 (accession number NITE BP-04245), JE-EK9 (accession number NITE BP-04246), and JE-F1140 (accession number BP-04247). [6] A method for producing cells with accumulated fat, comprising the step of culturing a cell line derived from an anguillidae fish according to any one of [1] to [4] in a culture medium to accumulate fat in the cells. [7] A method for producing cells with accumulated fat according to [6], wherein the culture medium contains cyclodextrin encapsulating unsaturated fatty acids. [8] A method for producing cells with accumulated fat according to [6] or [7], wherein the culture medium contains cyclodextrin encapsulating phytoestrogens. [9] A method for producing fat-accumulating cells according to any one of [6] to [8], wherein the culture is performed using a scaffold made of an edible substance that has been plasma-treated.
[10] A fat production kit comprising a cell line derived from an anguillidae fish according to any one of [1] to [3], a fat-accumulating culture medium, and a culture vessel.
[11] A fat production kit according to
[10] , wherein the fat-accumulating culture medium comprises cyclodextrin encapsulating unsaturated fatty acids.
[12] A fat-containing composition comprising a cell line derived from an anguillidae fish according to any one of [1] to [3].
[13] A fat-containing composition according to
[12] , wherein the fat-containing composition is selected from the group consisting of food, feed, cosmetics, food additives, and pharmaceutical compositions.
[14] A method for producing a fat-containing composition, comprising the steps of: culturing a cell line derived from an eel-like fish according to any one of [1] to [3] to accumulate fat; and mixing the fat-accumulating cell line or fat extracted from the fat-accumulating cell line with at least one other component.
[15] A method for producing a fat-containing composition according to
[14] , wherein the fat-containing composition is selected from the group consisting of food, feed, cosmetics, food additives, and pharmaceutical compositions.
[16] A screening method for a cell proliferation-promoting substance, comprising the step of culturing a cell line derived from an eel-like fish according to any one of [1] to [3] in a medium containing serum at a concentration of 1 to 3% in the presence of a test substance, wherein an increase in the number of cells in the cell line compared to the absence of the test substance indicates that the test substance is a cell proliferation-promoting substance.
[0011] This disclosure provides a cell line derived from anguillidae fish that exhibits rapid double-rate growth and the ability to accumulate fat. Furthermore, this disclosure provides a method for producing fat-accumulating cells using the anguillidae cell line. Additionally, this disclosure provides a fat production kit, a fat-containing composition, a method for producing the fat-containing composition, and a method for screening cell proliferation-promoting substances using the anguillidae cell line.
[0012] This image shows an example of a cell population derived from primary cultured cells recovered from anguillidae fish, obtained in the example. A cell population of cells with a round shape and granules inside the cell (the cell population circled) was recovered and cultured. The scale bar represents 200 μm. This image shows an example of cells that migrated from a cell mass derived from primary cultured cells recovered from anguillidae fish, obtained in the example. These migrating cells were recovered and cultured further. The scale bar represents 200 μm. This is a phase-contrast observation image of a Japanese eel-derived cell line obtained in the example. The scale bar represents 200 μm. This is a phase-contrast observation image showing the multilayer structure of a Japanese eel-derived cell line obtained in the example. The scale bar represents 200 μm. This graph shows the amount of fat accumulation when Japanese eel-derived cell lines (JE-KRT224, JE-EK4, JE-EK9) obtained in the example were cultured in each medium. This graph shows the amount of fat accumulated when the Japanese eel-derived cell line (JE-F1140) obtained in the examples was cultured in each medium. This is a fluorescence image detecting the accumulated fat when the Japanese eel-derived cell line obtained in the examples was cultured in each medium. This is a fluorescence image detecting the accumulated fat when the Japanese eel-derived cell line (JE-KRT224) obtained in the examples was cultured in each medium. This is a fluorescence image detecting the expression of mesenchymal cell markers and mesenchymal stem cell markers in the Japanese eel-derived cell line (JE-KRT224) obtained in the examples. The scale bar represents 20 μm. This is a fluorescence image detecting the expression of mesenchymal cell markers and mesenchymal stem cell markers in the Japanese eel-derived cell line (JE-EK4) obtained in the examples. The scale bar represents 20 μm. These are fluorescence images showing the expression of mesenchymal cell markers and mesenchymal stem cell markers in the Japanese eel-derived cell line (JE-EK9) obtained in the examples. The scale bar represents 20 μm. These are fluorescence images showing the expression of mesenchymal cell markers and mesenchymal stem cell markers in the Japanese eel-derived cell line (JE-F1140) obtained in the examples. The scale bar represents 20 μm. These are fluorescence images showing the expression of PPARγ in the Japanese eel-derived cell line obtained in the examples. The scale bar represents 20 μm. This is a graph showing the expression level of the PPARγ gene in the Japanese eel-derived cell line obtained in the examples.These are fluorescence images detecting the expression of PPARγ when the Japanese eel-derived cell line (JE-KRT224) obtained in the example was cultured in each medium. These are fluorescence images detecting the expression of FABP4 when the Japanese eel-derived cell line (JE-KRT224) obtained in the example was cultured in each medium. This is a graph showing the relationship between the amount of fat accumulation-inducing additive added during the culture of the Japanese eel-derived cell line (JE-KRT224) obtained in the example and the number of cells. These are fluorescence images detecting the accumulated fat when the Japanese eel-derived cell line (JE-F1140) obtained in the example was cultured in each medium. These are fluorescence images detecting the accumulated fat when the Japanese eel-derived cell line (JE-KRT224) obtained in the example was cultured in each medium. This is a fluorescence image of the Japanese eel-derived cell line (JE-KRT224 strain) obtained in the example, cultured using stored rice as a scaffold. The scale bar represents 1,000 μm. This is a phase-contrast observation image of the Japanese eel-derived cell line (JE-F1140 strain) obtained in the example, cultured using edible bamboo fiber as a scaffold. The scale bar represents 200 μm. This is a phase-contrast observation image of the Japanese eel-derived cell line (JE-EK4 strain) obtained in the example, cultured using edible bamboo fiber as a scaffold. The scale bar represents 500 μm. This is a graph showing the roundness of cells when the Japanese eel-derived cell line (JE-EK4 strain) obtained in the example was cultured using plasma-treated or untreated edible bamboo fiber as a scaffold. These are phase-contrast images of the Japanese eel-derived cell line (JE-F1140 strain) obtained in the examples, cultured on rice as a scaffold. The scale bar represents 500 μm. These are phase-contrast images of primary cultured cells derived from Japanese eel muscle tissue, including the Japanese eel-derived cell lines (JE-KRT224, JE-EK4, JE-EK9, and JE-F1140) obtained in the examples, cultured on an agar sheet as a scaffold. The scale bar represents 500 μm. These are phase-contrast images of the Japanese eel-derived cell line (JE-KRT224 strain) obtained in the examples, cultured on agar sticks as a scaffold. The scale bar represents 200 μm. These are fluorescence images detecting accumulated fat when the Japanese eel-derived cell line (JE-KRT224-F1) obtained in the examples was cultured in each medium.These are fluorescence images detecting accumulated fat when the Japanese eel-derived cell line (JE-F1140-F1) obtained in the examples was cultured in each medium. These are graphs showing the absorbance when the Japanese eel-derived cell line (JE-F1140-F1) obtained in the examples was cultured in the presence of different concentrations of ITS-A supplement (×100). These are graphs showing the absorbance when the Japanese eel-derived cell line (JE-F1140-F1) obtained in the examples was cultured in the presence of different concentrations of ITS-A supplement (×100). These are fluorescence images detecting accumulated fat when the Japanese eel-derived cell line (JE-F1140-F1) obtained in the examples was cultured in each medium.
[0013] One embodiment of the present invention will be described below. The embodiments shown below illustrate configurations for realizing the technical idea of the present invention, and the present invention is not limited to these embodiments. Various modifications can be made to the technical idea of the present invention within the technical scope defined by the claims described in the claims.
[0014] A numerical range indicated using "~" signifies a range that includes the numbers before and after the "~" as the lower and upper limits, respectively. If multiple upper and lower limits are listed for a particular parameter, any combination of these upper and lower limits can be used to create a suitable numerical range.
[0015] Unless otherwise specified, "a," "an," and "the" encompass both singular and plural forms and are understood to mean "one or more."
[0016] The term "comprise" means that it may include components other than the component being discussed. The term "consist of" means that it does not include components other than the component being discussed. The term "consistently of" means that it does not include components other than the component being discussed in a manner that performs a special function (such as a manner that completely negates the effect of the invention). In this specification, when "comprise" is used, it includes the "consist of" and "consistently of" manners.
[0017] Cells may be isolated. "Isolated" means separated from other components. An "isolated" component may be separated from its natural state. An "isolated" component may be substantially free of other components. "Substantially free of other components" means that the content of other components in the isolated component is negligible. The content of other components in the isolated component may be, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less, or 0.1% by mass or less. The cells described herein may be isolated cells.
[0018] <Cell line derived from eel fish> In one embodiment, the present disclosure provides a cell line derived from eel fish that expresses at least one selected from the group consisting of vimentin, CD29, CD73, and CD105, and has the ability to accumulate fat.
[0019] A "cell line" refers to a cell population capable of continuous or sustained proliferation and division in vitro. Typically, a cell line is a cloned population of cells derived from a single cell. Cell lines may contain mutant cells that occur during storage or passage. A population of cells obtained by passage a cell line is sometimes called a passaged cell. A passaged cell is included within a cell line.
[0020] A "cell line derived from anguillidae fish" refers to a cell line established from the cells of anguillidae fish. Anguillidae fish are not particularly limited, but examples include the Japanese eel (Anguillia japonica), European eel (Anguillia anguilla), American eel (Anguillia rostrata), giant eel (Anguillia marmorata), and Bengal eel (Anguillia bengalensis). The Japanese eel is preferred among the anguillidae fish.
[0021] Cells derived from cell lines of eel-like fish are not particularly limited, but examples include cells taken from muscle tissue. Cells derived from cell lines of eel-like fish may also be cells obtained by subculturing cells taken from muscle tissue. Cells derived from cell lines of eel-like fish may be adipocyte-like cells or fibroblast-like cells obtained by subculturing cells taken from muscle tissue 3 to 10 times. Cells derived from cell lines of eel-like fish may also be adipose stem cell-like cells included in an adipocyte-like cell population obtained by subculturing cells taken from muscle tissue about 3 to 10 times.
[0022] (Mesenchymal cell markers and mesenchymal stem cell markers) The cell line of this embodiment is characterized by expressing at least one selected from the group consisting of vimentin, CD29 (also called Integrin subunit β1 (ITGB1)), CD73 (also called 5'-nucleotide ecto (NT5E)), and CD105 (also called endoglin (ENG)). Vimentin is an intermediate filament unique to mesenchymal cells. CD29, CD73, and CD105 are proteins known as mesenchymal stem cell markers. Since the cell line of this embodiment expresses at least one of these cell markers, it can be said to be a cell having the properties of a mesenchymal stem cell. The cell line of this embodiment preferably expresses at least two selected from the group consisting of vimentin, CD29, CD73, and CD105, more preferably expresses at least three, and even more preferably expresses all four. A "cell marker" refers to a protein that is strongly expressed in specific cells. A mesenchymal cell marker refers to a protein that is strongly expressed in mesenchymal cells. Vimentin is a mesenchymal cell marker. A mesenchymal stem cell marker refers to a protein that is strongly expressed in mesenchymal stem cells. CD29, CD73, and CD105 are mesenchymal stem cell markers. In this specification, when referring to a gene, the protein name is followed by "gene." For example, the gene encoding vimentin is referred to as the vimentin gene. Expressing a cell marker means that the transcript (mRNA) and / or translation product (protein) of the cell marker gene are present in the cell to an extent that can be detected by conventional detection methods. When detecting the amount of mRNA of a cell marker, it may be described as the expression of the cell marker gene (e.g., the vimentin gene).
[0023] The expression of the four cell markers described above can be detected by known methods. Cell marker expression may be detected by detecting mRNA or by detecting proteins. When detecting proteins, for example, a method using antibodies that can detect each cell marker can be used. Examples of antibody-based methods include, but are not limited to, immunofluorescence assays and enzyme immunoassays. Preferably, antibodies produced using each cell marker of the eel fish from which the cell line is derived are used as antigens. Antibodies produced using each cell marker of other species as antigens are also acceptable, as long as they can specifically bind to each cell marker. For example, antibodies produced using vimentin, CD29, CD73, or CD105 of mammals such as humans, mice, and rabbits as antigens may be used. Commercially available antibodies may also be used. For example, antibodies commercially available for the detection of each cell marker of mammals such as humans and mice may be used. For example, vimentin, CD29, CD73, and CD105 of eel fish have approximately 70% sequence identity with vimentin, CD29, CD73, and CD105 of mammals such as humans, mice, and rats. Therefore, CD29, CD73, or CD105 of eel fish can be detected by using antibodies that react to CD29, CD73, or CD105 of mammals such as humans, mice, and rats.
[0024] (Ability to accumulate fat) The cell line of this embodiment has the ability to accumulate fat. "Ability to accumulate fat" refers to the ability to accumulate fat within cells when cells are cultured under specific conditions. Whether or not a cell line has the ability to accumulate fat within cells can be confirmed by culturing the cell line in the presence of unsaturated fatty acids (e.g., oleic acid) and detecting fat within the cells. As the culture medium used for the above, for example, the (differentiation medium + OACD) used in the example can be used. The culture time is not particularly limited, but for example, it can be 1 to 5 days. The culture temperature can be 20 to 30°C, and 25°C is preferred. The fat present in the cells can be detected by known methods. For example, fat can be detected in cells by using a fluorescently labeled lipophilic substance. Commercially available reagents may be used to detect fat in cells. Examples of commercially available fat detection reagents include a fat droplet staining fluorescent dye (Lipi-DeepRed, Dojin Chemical Research Institute). For example, if the amount of fat measured by a fat detection reagent is increased by, for example, 20% or more, preferably 30% or more, more preferably 40% or more, and even more preferably 50% or more, compared to a cell line known not to accumulate fat (e.g., a myoblast cell line), then it can be determined that the cell line has the ability to accumulate fat.
[0025] (Adipose Cell Markers) The cell line of this embodiment preferably expresses PPARγ (Perioxisome Proliferator-Activated Receptor γ) and FABP4 (Fatty acid binding protein 4). PPARγ and FABP4 are adipocyte markers expressed in adipocytes. PPARγ is a master regulator of adipocyte differentiation and is also involved in the regulation of fat accumulation. PPARγ is expressed in the nucleus and cytoplasm. FABP4 is abundantly expressed in adipocytes and is expressed throughout the cytoplasm. The cell line of this embodiment can be said to have the properties of an adipocyte because it expresses these adipocyte markers. The expression of these adipocyte markers may be detected by detecting mRNA or by detecting proteins. When detecting proteins, for example, a method using antibodies that can detect each adipocyte marker can be used. These cell markers can be detected by known methods such as immunofluorescence. Antibodies may be those produced using PPARγ or FABP4 from mammals such as humans, mice, and rabbits as antigens. Commercially available antibodies may also be used. For example, antibodies commercially available for the detection of various markers in mammals such as humans and mice may be used. For example, PPARγ and FABP4 from eels have approximately 70% sequence identity with PPARγ and FABP4 from mammals such as humans, mice, and rats. Therefore, PPARγ or FABP4 from eels can be detected by using antibodies that react to PPARγ or FABP4 from mammals such as humans, mice, and rats.
[0026] (Multilayer Structure) The cell line of this embodiment preferably has the ability to form a multilayer structure. Having the ability to form a multilayer structure simplifies the cultivation of large quantities of cells and is expected to make it easier to form fat into a suitable shape during the production of cultured meat. A "multilayer structure" refers to a structure in which two or more cell layers are formed. In cell lines that do not form a multilayer structure, proliferation stops when a single cell layer reaches a confluent state that covers the entire bottom surface of the culture vessel. On the other hand, in cell lines that can form a multilayer structure, proliferation continues even after the single cell layer reaches a confluent state, and another cell layer is formed on top of the single cell layer. Whether or not a cell line has the ability to form a multilayer structure can be confirmed by continuing cultivation even after the single cell layer reaches a confluent state. The fact that the cell layer is a multilayer structure can be confirmed by phase contrast observation with an optical microscope.
[0027] (Doubling Time) Doubling time refers to the time required for the number of cells to double. Doubling time can be measured by known methods. Doubling time can be calculated by counting the number of cells at two or more time points during culture. The cell line of this embodiment preferably has a doubling acceleration of 40 hours or less, more preferably 35 hours or less, even more preferably 30 hours or less, even more preferably 29 hours or less, 28 hours or less, or 27 hours or less, and particularly preferably 22 hours or less, 21 hours or less, or 20 hours or less.
[0028] (Immortalized Cell Line) The cell line of this embodiment is preferably an immortalized cell line. An immortalized cell line refers to a cell line that is substantially capable of division indefinitely. For example, a cell line can be determined to be an immortalized cell line if its theoretical number of divisions is 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 75 or more, even more preferably 100 or more, and particularly preferably 130 or more.
[0029] (Deposited Cell Lines) Specific examples of cell lines in this embodiment include JE-KRT224 (accession number NITE BP-04244), JE-EK4 (accession number NITE BP-04245), JE-EK9 (accession number NITE BP-04246), and JE-F1140 (accession number NITE BP-04247). JE-KRT224 was internationally deposited with the Patent Microbial Depository Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) on December 26, 2024, under accession number NITE BP-04244. Name of principal depositor: Tokyo Metropolitan Industrial Technology Research Institute, a local independent administrative agency Address of principal depositor: 2-4-10 Aomi, Koto-ku, Tokyo Name of other depositors: Kitasato Institute, a school corporation Address of other depositors: 5-9-1 Shirokane, Minato-ku, Tokyo The principal depositor and the other depositors have given the applicant the authority to refer to the deposited organism in this application. The principal depositor and the other depositors have given the applicant consent to the deposit of the organism being made available to the public.
[0030] JE-EK4 was internationally deposited with the Patent Microorganism Depository Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture, Japan) on December 26, 2024, under accession number NITE BP-04245. Principal depositor name: Tokyo Metropolitan Industrial Technology Research Institute Principal depositor address: 2-4-10 Aomi, Koto-ku, Tokyo Other depositors name: Kitasato Institute Other depositors address: 5-9-1 Shirokane, Minato-ku, Tokyo The principal depositor and the other depositors have authorized the applicant to refer to the deposited organism in this application. The principal depositor and the other depositors have given the applicant consent to the public availability of the deposited organism.
[0031] JE-EK9 was internationally deposited with the Patent Microorganism Depository Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture, Japan) on December 26, 2024, under accession number NITE BP-04246. Principal depositor name: Tokyo Metropolitan Industrial Technology Research Institute Principal depositor address: 2-4-10 Aomi, Koto-ku, Tokyo Other depositors name: Kitasato Institute Other depositors address: 5-9-1 Shirokane, Minato-ku, Tokyo The principal depositor and the other depositors have authorized the applicant to refer to the deposited organism in this application. The principal depositor and the other depositors have given the applicant consent to the public availability of the deposited organism.
[0032] JE-F1140 was internationally deposited with the Patent Microorganism Depository Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture, Japan) on December 26, 2024, under accession number NITE BP-04247. Principal depositor name: Tokyo Metropolitan Industrial Technology Research Institute Principal depositor address: 2-4-10 Aomi, Koto-ku, Tokyo Other depositors name: Kitasato Institute Other depositors address: 5-9-1 Shirokane, Minato-ku, Tokyo The principal depositor and the other depositors have authorized the applicant to refer to the deposited organism in this application. The principal depositor and the other depositors have given the applicant consent to the public availability of the deposited organism.
[0033] JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 are cell lines derived from the Japanese eel and were established using the method described in the examples below. JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 are cell lines that express vimentin, CD29, CD73, and CD105, and are capable of accumulating lipids in culture.
[0034] JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 express PPARγ and FABP4. The inventors experimentally confirmed that PPARγ and FABP4 are expressed in JE-KRT224, JE-EK4, JE-EK9, and JE-F1140, and that fat accumulates intracellularly in these cell lines. Also, JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 have the ability to form a multilayer structure. JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 have all been confirmed to have undergone more than 70 cell divisions and can be said to be immortalized cell lines.
[0035] (Method for Producing a Cell Line Derived from a Fish of the Family Anguillidae) Next, the method for producing a cell line derived from a fish of the family Anguillidae according to this embodiment will be described. The method for producing a cell line derived from a fish of the family Anguillidae according to this embodiment is not particularly limited, but for example, it can be produced by the following method.
[0036] As an example, the method for producing a cell line derived from a fish of the family Anguillidae according to this embodiment may include a step of collecting cells from a fish of the family Anguillidae, a step of identifying a characteristic cell population from primary cultured cells and collecting the cells within that cell population, a step of seeding the cells collected from the cell population into a cell culture dish and culturing them, and a step of collecting a single colony from the cultured cells and performing expansion culture.
[0037] <<Cell Collection from a Fish of the Family Anguillidae>> First, cells are collected from a fish of the family Anguillidae. The fish of the family Anguillidae from which cells are collected is not particularly limited, but examples include those described above, and Japanese eel is preferred. The tissue from which cells are collected is not particularly limited, but muscle tissue or adipose tissue is preferred. Known methods can be used to collect cells from a fish of the family Anguillidae.
[0038] <<Primary cell culture>> Next, primary cells obtained from a fish of the family Anguillidae are cultured and proliferated. As the medium used for cell culture, a medium for animal cell culture can be used. As the medium, for example, Leibovitz's L-15 medium (FUJIFILM Wako Pure Chemical Corporation) or the like can be used. The medium may be a medium obtained by adding fetal bovine serum (FBS), antibiotics, etc. to an animal culture medium. A specific example of the medium is the growth medium used in the examples. The culture can be carried out, for example, at 25°C under aseptic conditions. The primary cells are preferably subcultured. Subculture can be carried out, for example, every 5 to 10 days. The number of subcultures is, for example, 3 to 10 times, preferably 2 to 8 times, more preferably 6 times.
[0039] The primary cells may be maintained only by changing the medium without subculture. Examples of the medium to be used are the same as those described above. A specific example of the medium is the growth medium used in the examples. Medium exchange can be carried out, for example, every 5 to 10 days. The culture can be carried out, for example, at 25°C under aseptic conditions. The culture by medium exchange can be carried out, for example, for 10 months or more, preferably 12 months or more, more preferably 15 months or more, further preferably 18 months or more, particularly preferably 19 months or more.
[0040] <<Identification of cell population>> Next, a characteristic cell population is identified from the cells obtained by subculturing the primary cells recovered from a fish of the family Anguillidae, and the cells within the cell population are recovered. The cell population containing the cells to be recovered is a population of cells with a round cell shape and the presence of granules inside the cells. An example of such a cell population is shown in FIG. 1. Furthermore, a cell population in which the presence of fat inside the cells can be confirmed may be obtained. By identifying the characteristic cell population as described above and recovering cells therefrom, the recovery of cells having the ability to accumulate fat can be made more reliable. The presence of fat inside the cells can be confirmed by a known method. For example, the cells may be stained using a fat droplet fluorescent staining dye, and the fluorescence of the dye that specifically stains fat may be confirmed. The recovery of cells from the cell population can be carried out using a known method such as the scratch method under an optical microscope.
[0041] Alternatively, primary cells recovered from eel-like fish may be maintained by changing the culture medium, and the resulting cell mass may be seeded in a culture vessel (such as a culture flask), and cells that migrate from the cell mass may be collected. An example of such migratory cells is shown in Figure 2. The period required from seeding the cell mass to collecting the migratory cells may be, for example, 10 to 50 days, 15 to 50 days, or 20 to 50 days.
[0042] Next, the cells collected from the cell population are cultured. For the cell culture vessel, known culture vessels such as multi-cell dishes or 48-well plates may be used. For the cell culture medium, known animal culture media may be used. The same medium as in the "Culture of Primary Cells" described above can be used. A specific example of the medium is the growth medium used in the examples. By culturing the cells collected from the cell population, cells with good growth can be selected. Culturing can be carried out, for example, under sterile conditions at 25°C.
[0043] <<Expansion Culture and Cell Line Establishment>> Next, a single colony or cell is selected from the cultured cells and subjected to expansion culture. The colony or cell selected for expansion culture is preferably one that is in good growth condition. A known culture medium may be used for expansion culture, but L-15 medium is preferred. The culture medium used for expansion culture is preferably supplemented with fetal bovine serum (FBS). The concentration of FBS is preferably 2-20%, more preferably 5-15%, and even more preferably 8-12%. The culture medium used for expansion culture is preferably contained in a 1% antibiotic-antifungal mixed solution.
[0044] In addition to the above, the culture medium used for expansion may contain known physiologically active substances, nutritional factors, and growth factors that are necessary or preferable for cell survival or proliferation. These additives may be added to the medium beforehand or added during cell culture. Methods for adding them during cell culture include known methods such as adding one or more solutions to the medium. Additives may be added to the medium once or multiple times, and may be added continuously or intermittently.
[0045] Examples of physiologically active substances that can be added to the culture medium include, but are not limited to, insulin, insulin-like growth factor 1 (IGF-1), transferrin, albumin, coenzyme Q10 (CoQ10), interleukins such as interleukin 2, interleukin 7, and interleukin 15, stem cell factor (SCF), activin, hormones, basic fibroblast growth factor (bFGF), transforming growth factor β (TGF-β), and leukemia suppressor factor (LIF). The culture medium used for expansion culture preferably contains bFGF. The concentration of bFGF is preferably 0 to 10 ng / mL, more preferably 1 to 10 ng / mL, and even more preferably 5 to 10 ng / mL.
[0046] Examples of physiologically active substances that can be added to the culture medium include, but are not limited to, sugars, amino acids, vitamins, hydrolysates, and lipids. Any type of sugar that is suitable for food use is acceptable, but examples include galactose, glucose, fructose, mannose, sucrose, lactose, and maltose. One type of sugar may be added, or a combination of two or more.
[0047] Furthermore, known antibiotics may be added to the culture medium as needed. Examples of antibiotics include, but are not limited to, kanamycin, streptomycin, penicillin, and hygromycin.
[0048] The culture medium may contain at least one compound selected from the group consisting of heparin, bFGF, ascorbic acid, antibiotics, and antifungal agents. Specific examples of culture media used for expansion include the growth medium used in the examples. Culture can be carried out, for example, under sterile conditions at 25°C. Cells that have undergone expansion culture have divided approximately 25 times or more (cell count 3 × 10⁶). 7 Cells that have reached a certain number (or more) can be obtained as a cell line. The obtained cell line may be stored by cryopreservation or other means.
[0049] The cell lines established as described above are confirmed to express at least one selected from the group consisting of vimentin, CD29, CD73, and CD105, and to have the ability to accumulate fat. A cell line that expresses at least one selected from the group consisting of vimentin, CD29, CD73, and CD105, and has the ability to accumulate fat, can be obtained as the cell line of this embodiment.
[0050] For cell lines established as described above, the potential for fat accumulation may be confirmed by detecting fat accumulation markers. Preferably, at least one marker selected from the group consisting of PPARγ and FABP4 is used as the fat accumulation marker. Known methods may be used to detect these markers. Since fat accumulation markers are expressed in fat-accumulating adipocytes, cells expressing these markers are considered to have the potential for fat accumulation.
[0051] The cell lines established as described above may be used to confirm their ability to accumulate fat using a fat detection reagent. The ability to accumulate fat can be confirmed using the same method as described above.
[0052] The cell line of this embodiment can be maintained and cultured in an animal cell-like medium. Examples of such media include those described above. A specific example of a medium is the growth medium used in the example.
[0053] <Method for producing cells with accumulated fat> Next, a method for producing cells with accumulated fat will be described. The method for producing cells with accumulated fat includes at least the step of culturing the cell line derived from the eel family fish in a culture medium to cause fat to accumulate.
[0054] The cell line of this embodiment can accumulate fat without inducing differentiation into adipocytes. "Induction of differentiation into adipocytes" refers to the forced induction of differentiation into adipocytes by culturing non-adipocytes in the presence of a specific drug. In mammalian cells, it is known that adipocytes can be differentiated by culturing adipocyte precursor cells (or mesenchymal stem cells) in a medium containing insulin, indomethacin, IBMX (3-isobutyl-1-methylxanthine), and DEX (dexamethasone), etc. In this specification, a medium containing a drug known to induce differentiation into adipocytes as described above may be referred to as a "differentiation medium." A specific example of a differentiation medium is the differentiation medium used in the example.
[0055] On the other hand, HepG2 cells, a cell line derived from human liver cancer, are known to accumulate lipids when cultured in a medium containing fatty acids. Inducing lipid accumulation in cells by adding lipids, fatty acids, etc., to the culture medium is sometimes called "lipid accumulation induction." The method of this embodiment can also be described as a lipid accumulation induction method that includes the step of culturing the cell line derived from eel-like fish in a culture medium.
[0056] As an example, a method for producing cells that have accumulated fat includes the steps of seeding a cell line derived from an eel-like fish into a culture medium and culturing the cell line derived from the eel-like fish in the culture medium. As the culture medium, a known culture medium used for culturing animal cells may be used, but it is preferable to use a culture medium containing unsaturated fatty acids such as oleic acid. Examples of unsaturated fatty acids include unsaturated fatty acids having 10 to 30 carbon atoms. The number of unsaturated bonds contained in the unsaturated fatty acid is not particularly limited, but for example, it is 1 to 3. Examples of unsaturated fatty acids include, but are not limited to, oleic acid, myristoleic acid, palmitoleic acid, sapienic acid, and linoleic acid. The unsaturated fatty acid may be added to the culture medium in a form encapsulated in cyclodextrin. By using a culture medium containing cyclodextrin encapsulated in unsaturated fatty acids, fat can be efficiently accumulated in the cell line derived from the eel-like fish. Furthermore, cyclodextrin is a substance used as a food additive, and is expected to offer improved safety compared to known culture medium additives (dimethyl sulfoxide, albumin solution, etc.) used to dissolve or disperse unsaturated fatty acids in culture media. The concentration of unsaturated fatty acids in the culture medium can be, for example, 1 to 500 μM, preferably 10 to 300 μM, and more preferably 10 to 100 μM. Cyclodextrin containing encapsulated unsaturated fatty acids can be prepared by adding and dissolving unsaturated fatty acids in an aqueous solution of cyclodextrin.
[0057] The culture medium may be the same as the one described in the section "Expansion Culture and Cell Line Establishment" above. The culture medium may be an animal cell medium (e.g., L-15 medium) to which FBS or a serum substitute has been added. The culture medium may further contain at least one, preferably all, substances selected from the group consisting of heparin, bFGF, and ascorbic acid phosphate or its salts. The culture medium may be an animal cell medium (e.g., L-15 medium) to which FBS or a serum substitute, heparin, bFGF, and ascorbic acid phosphate or its salts have been added. The culture medium may further contain at least one, preferably all, substances selected from the group consisting of insulin, dexamethasone, and 3-isobutyl-1-methylxanthine (IBMX). The culture medium may be a medium for animal cells (e.g., L-15 medium) to which FBS or a serum substitute, heparin, bFGF, ascorbic acid phosphate ester or its salt, insulin, dexamethasone, and IBMX have been added. The culture medium may further contain at least one selected from the group consisting of antibiotics and antifungal agents. A lipid mixture may further be added to the culture medium. As the lipid mixture, a wax ester mixture or the like can be used.
[0058] The concentration of FBS in the culture medium is preferably 1-20%, more preferably 2-20%, even more preferably 5-15%, and still more preferably 8-12%. The concentration of heparin in the culture medium is, for example, 50-150 μg / mL. The concentration of bFGF in the culture medium is, for example, 1-50 ng / mL. The concentration of ascorbic acid phosphate or its salt in the culture medium is, for example, 0.01-10 mM. The concentration of insulin in the culture medium is, for example, 0.1-10 μg / mL. The concentration of dexamethasone in the culture medium is, for example, 0.5-10 μM. The concentration of IBMX in the culture medium is, for example, 50-500 μM.
[0059] The manufacturing method of this embodiment may include one or more steps selected from the group consisting of (1) to (4) below: (1) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute. (2) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute and an unsaturated fatty acid. (3) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute and at least one selected from the group consisting of insulin, dexamethasone, and IBMX. (4) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute and an unsaturated fatty acid, and at least one selected from the group consisting of insulin, dexamethasone, and IBMX. Preferably, the unsaturated fatty acid is encapsulated in cyclodextrin. The manufacturing method of this embodiment may include two or more steps selected from the group consisting of (1) to (4). In this embodiment, the manufacturing method may, for example, involve performing (2) after (1), or (4) after (1). Alternatively, in this embodiment, steps (1), (3), and (4) may be performed in this order.
[0060] (Use of phytoestrogens) The culture medium may contain phytoestrogens, which are food-derived components, instead of insulin, dexamethasone, and IBMX as described above.
[0061] Phytoestrogens are substances derived from plants. It has been reported that even the same compound can exhibit both estrogen-like effects (similar to female hormones) and anti-estrogen-like effects (the opposite) depending on conditions such as the target species, compound concentration, model system, and receptor expression status in the target organism. Because phytoestrogens are plant-derived components, and many are derived from plants used as food, they are considered suitable for food manufacturing. Examples of phytoestrogens include, but are not limited to, isoflavones, lignans, stilbenoids, coumestans, flavonols, and flavanones. Examples of isoflavones include, but are not limited to, genistein, daidzein, and glycitein. Examples of lignans include, but are not limited to, lariciresinol and secoisolariciresinol. Examples of stilbenoids include, but are not limited to, resveratrol. Examples of coumestans include, but are not limited to, coumestrol. Examples of flavonols include, but are not limited to, kaempferol and quercetin. Examples of flavanones include, but are not limited to, naringenin.
[0062] The plant estrogen contained in the culture medium is preferably isoflavone, and more preferably one or more selected from the group consisting of genistein and daidzein.
[0063] When a culture medium contains phytoestrogens, it is preferable that the phytoestrogens be added to the medium in a form encapsulated in cyclodextrin. Phytoestrogens are poorly soluble in water, and it is common practice to dissolve them in organic solvents such as DMSO or ethanol before adding them to the culture medium. A previously published paper (Sara et al., Fish Physiology and Biochemistry, 2025 March 25, Volume 51, article number 71) reported that in an evaluation using adipose progenitor cells obtained from the visceral adipose tissue of rainbow trout or European sea bream, dissolving 100 μM genistein and daidzein in DMSO and then adding it to the culture medium increased fat accumulation in the adipose progenitor cells. In contrast, encapsulating phytoestrogens in cyclodextrin allows for the addition of phytoestrogens to the culture medium without the use of organic solvents. Examples of the concentration of phytoestrogens in the culture medium include 1 to 500 μM, preferably 10 to 400 μM, and more preferably 10 to 200 μM. Cyclodextrins containing phytoestrogens can be prepared by adding and dissolving phytoestrogens in an aqueous cyclodextrin solution.
[0064] The cyclodextrin used to encapsulate the plant estrogen is preferably γ-cyclodextrin (hereinafter also referred to as "γ-CD").
[0065] By culturing the cell line derived from the eel family using a culture medium containing phytoestrogens encapsulated in cyclodextrin (hereinafter also referred to as "phytoestrogen-containing medium") instead of the insulin, dexamethasone, and IBMX mentioned above, it is possible to produce cells with accumulated fat that can be directly used in food manufacturing.
[0066] The manufacturing method of this embodiment may include one or more steps selected from the group consisting of (1) to (4) above, and (5) and (6) below. (5) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute, and at least one selected from the group consisting of genistein and daidzein. (6) A step of culturing the cell line derived from the Anguilliidae fish in a medium containing FBS or a serum substitute, and at least one selected from the group consisting of an unsaturated fatty acid, and genistein and daidzein. The unsaturated fatty acid is preferably encapsulated in cyclodextrin. The manufacturing method of this embodiment may include two or more steps selected from the group consisting of (1) to (6). In the manufacturing method of this embodiment, for example, (6) may be performed after (1). Alternatively, in the manufacturing method of this embodiment, (1), (5) and (6) may be performed in this order.
[0067] The culture can be carried out under sterile conditions at 20-32°C. The culture vessel is not particularly limited. Examples of culture vessels include, but are not limited to, well plates, culture dishes, and culture flasks. The culture method is not particularly limited and can be performed by, for example, static culture, shaking culture, suspension culture, or reflux culture. The culture period is not particularly limited, but for example, it can be 2 days or more, and 3 days or more is preferred.
[0068] (Use of plasma edible scaffolds) Culturing may be carried out using a scaffold made of plasma-treated edible material (hereinafter also referred to as "plasma edible scaffolds").
[0069] The main cells that make up cultured meat (myoblasts and adipocytes) are adherent cells, and these cells require an adherent surface called a scaffold for growth. The culture vessels mentioned above are subjected to various types of surface treatments to enhance cell adhesion. One type of surface treatment, plasma treatment, introduces hydrophilic functional groups to the target surface. These hydrophilic functional groups play a role in stably adsorbing and retaining adhesive proteins from the culture medium or cells. As a result, proteins containing adhesion sequences are presented in a state that can be recognized by cell surface receptors, and cell adhesion is established.
[0070] In the mass cultivation of cells in the production of cultured meat, microcarriers made of non-edible components are sometimes used. However, this method ultimately requires the cells to be detached from the microcarriers, so efforts are being made to use scaffolds made of edible components (edible scaffolds) in the production of cultured meat.
[0071] In the production of cultured meat derived from fish, edible scaffolds made from edible plant-derived components are preferred, as they do not pose a problem even if they remain in the final product. However, polysaccharides derived from plant components (cellulose, agarose, starch, pectin, alginic acid, etc.) have poor cell adhesion despite being hydrophilic. Similarly, most plant-derived proteins (soybeans, wheat, peas, corn, etc.) also have poor cell adhesion. Therefore, in research on the construction of three-dimensional cultured meat using edible plant-derived components, methods such as gelatin coating and protein cross-linking using transglutaminase are employed to improve adhesion.
[0072] International Publication No. 2022 / 211039 (title of invention: "Adhesion enhancer containing edible plant-derived components") describes a cell adhesive that solves the problem that even when a porous plant-derived edible material (e.g., defatted soybean tofu cheese) is used as a scaffold, cell infiltration does not occur and cells can only adhere to the surface, and the problem that scaffolds derived from soy meat do not have excellent cell adhesion properties.
[0073] A previously published paper (Yunan et al., Curr. Res. Food Sci., 2024 Sep 13:9:100846) states that cell adhesion, scaling, and mechanical properties are major challenges in edible scaffolds containing cellulose. Another previously published paper (Sohyeon et al. Matter, 2024 Mar 6, Volume 7, Issue 3, Pages 1292-1313) reports that cell adhesion was made possible by crosslinking fish gelatin to rice (starch) using an enzyme (transglutaminase).
[0074] Japanese Patent Publication No. 2022-513441 (title of invention: "Synthetic Food Composition") discloses the adhesive culture of trout hygienic muscle cells and duck fibroblasts using a glucomannan microscaffold (water-soluble polysaccharide derived from konjac) at 10% (W / V) as a scaffold. However, both adhesion and proliferation are considered to be poor.
[0075] ≪Edible Scaffolding≫ Edible scaffolding can be made from food products, food-grade materials, or materials that contribute to being edible. Examples include edible bamboo fiber mainly composed of cellulose; cellulose nanofibers, powdered cellulose, glucomannan, agar mainly composed of agarose; starch; gellan gum, etc. All of these are contained in high molecular weight polysaccharides with monosaccharides as constituent sugars, and may be used individually or mixed in an aqueous solution and dried to form a sheet for use.
[0076] Commercially available edible bamboo fibers can be used, such as Unicell Bamboo Fiber, but are not limited to this. When using Unicell Bamboo Fiber, the particle size is not particularly limited.
[0077] <<Plasma Treatment>> Plasma treatment may be a treatment using only oxygen gas or argon gas, a mixed treatment of oxygen gas and argon gas, or a mixed treatment with other gases such as nitrogen, air, or hydrogen. However, treatment using only oxygen gas or only argon gas is preferred, and treatment using only oxygen gas is more preferred.
[0078] Plasma treatment can be carried out according to known methods. Such methods include, but are not limited to, atmospheric pressure plasma, vacuum plasma, static treatment, and rotation. Among these, vacuum plasma is preferred.
[0079] The duration and intensity of the plasma treatment are not particularly limited, but irradiation at a duration and intensity that does not carbonize the edible scaffold is preferred. Furthermore, other plasma treatment conditions are preferably such that they do not generate reactive oxygen species (ROS). ROS generated in the plasma can oxidize and damage biomolecular structures (cell membranes, proteins, DNA, etc.), potentially damaging cells and inducing cell death. A previously published paper (Hak et al., PLoS One, 2014 Jan 21;9(1):e86173) reported that ROS / RNS generated by atmospheric pressure plasma treatment affect intracellular mitochondria and induce apoptosis (cell death) in human cervical cancer cells (HeLa cells) via the JNK and p38 pathways.
[0080] In plasma processing, the observed operating pressure can be, for example, 10-50 Pa, 20-40 Pa, 20-30 Pa, 30-40 Pa, etc.
[0081] ≪Cell Culture Using Plasma Edible Scaffolds≫ Plasma edible scaffolds are used in culture in a state where they can come into contact with cells, regardless of whether it is suspension culture or adherent culture. The cells to be seeded may be single cells treated with trypsin, spheroids, or sheet-like cells. As an example, single cells treated with trypsin and plasma edible scaffolds are mixed and placed in a culture vessel. It is preferable to use a culture vessel that has not been surface-treated for cell adhesion, as cells will adhere to the vessel. However, the effects of the present invention can also be achieved by seeding cells in a pre-surface-treated cell culture vessel, confirming adhesion to the vessel, and then adding the edible scaffold. (For example, if edible bamboo fiber is added when cells have reached confluence in a culture vessel, the cells will adhere to the edible bamboo fiber.)
[0082] ≪Evaluation of Cell Adhesion to Plasma Edible Scaffolds≫ While it is possible to confirm that cells are cultured while adhered to a plasma edible scaffold by identifying either the cells or the edible scaffold, it is preferable to confirm this by identifying the cells. Methods for identifying cells include, but are not limited to, methods of staining living cells with 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) reagent, or methods of staining the cell nucleus with DAPI.
[0083] By culturing the cell line derived from the eel family fish using a plasma edible scaffold, it is possible to produce fat-accumulating cells that can be directly used in food manufacturing.
[0084] <Fat Production Kit> In one embodiment, the present disclosure provides a fat production kit comprising the cell line derived from the Anguilliformes fish described above, the fat accumulation culture medium, and a culture vessel. The culture vessel is not particularly limited as long as it is capable of culturing cells derived from the Anguilliformes fish. For example, commercially available culture vessels may be used. Examples of culture vessels include, but are not limited to, well plates, culture dishes, and culture flasks.
[0085] A fat accumulation culture medium refers to a culture medium used to cultivate cells in order to accumulate fat. In addition to cyclodextrin encapsulating unsaturated fatty acids, the fat accumulation culture medium may also contain components of known cell culture media. Examples of components of the fat accumulation culture medium include, but are not limited to, those that can be added to the culture medium used for the above-mentioned expansion culture. A specific example of a fat accumulation culture medium is the medium containing cyclodextrin encapsulating unsaturated fatty acids, as described in the above-mentioned method for producing fat-accumulating cells.
[0086] The fat production kit may include fat accumulation culture additives used in the preparation of fat accumulation culture media. Fat accumulation culture additives refer to additives used in the preparation of culture media for accumulating fat in cells. In addition to cyclodextrin encapsulating unsaturated fatty acids, fat accumulation culture additives may also include known culture medium additives to the extent that they do not impair the effect. Examples of culture medium additives include, but are not limited to, additives that can be used in the culture medium used for the expansion culture described above. Fat accumulation culture additives may also include, for example, drugs known to induce differentiation into adipocytes (insulin, dexamethasone, IBMX, etc.) in addition to cyclodextrin encapsulating unsaturated fatty acids.
[0087] In this application, "fat accumulation culture" refers to inducing fat accumulation in cells by adding lipids or fatty acids, etc., to the culture medium or culture solution. Fat accumulation culture does not necessarily include inducing differentiation of the cultured cells into adipocytes.
[0088] <Fat-containing composition> In one embodiment, the present disclosure provides a fat-containing composition comprising a cell line derived from an eel-like fish. The fat-containing composition can be produced by mixing the cell line derived from an eel-like fish with other components. The fat-containing composition may, but is not limited to, a food, feed, food additive, or pharmaceutical composition.
[0089] <Method for Producing a Fat-Containing Composition> In one embodiment, the present disclosure provides a method for producing a fat-containing composition, comprising the steps of culturing a cell line derived from an eel-like fish to accumulate fat, and mixing the fat-accumulating cell line or fat extracted from the fat-accumulating cell line with at least one other component. The component to be mixed with the fat-accumulating cell line or fat extracted from the fat-accumulating cell line includes, but is not limited to, foods, feeds, food additives, and pharmaceutical compositions, as well as raw materials for foods, feeds, food additives, and pharmaceutical compositions. The method for mixing the fat-accumulating cell line or fat extracted from the fat-accumulating cell line with other components may be, for example, known methods for mixing cells or fats in the manufacture of foods, feeds, food additives, and pharmaceutical compositions.
[0090] As detailed in the section on (Use of Phytoestrogens) of the above-mentioned method for producing fat-accumulating cells, fat-accumulating cells that can be directly used in food production can be produced by culturing the cell line derived from the Anguilliidae fish using a phytoestrogen-containing medium. Therefore, the method for producing fat-accumulating cells using a phytoestrogen-containing medium can also be described as a method for producing a fat-containing composition by mixing the cell line derived from the Anguilliidae fish with phytoestrogens encapsulated in cyclodextrin.
[0091] As detailed in the section (Utilization of Plasma Edible Scaffold) of the above-mentioned method for producing fat-accumulating cells, fat-accumulating cells that can be directly used in food production can be produced by culturing the cell line derived from eel-family fish using a plasma edible scaffold. Therefore, the method for producing fat-accumulating cells using a plasma edible scaffold can also be described as a method for producing a fat-containing composition by mixing the cell line derived from eel-family fish with a plasma edible scaffold.
[0092] <Screening Method for Cell Proliferation Promoting Substances> In one embodiment, the present disclosure provides a screening method for cell proliferation promoting substances, comprising the step of culturing a cell line derived from an eel-like fish in a medium containing serum at a concentration of 1-3% in the presence of a test substance, wherein an increase in the number of cells in the cell line compared to the absence of the test substance indicates that the test substance is a cell proliferation promoting substance.
[0093] The screening method of this embodiment allows for the screening of substances that can promote cell proliferation (cell proliferation substances). The test substance is not particularly limited, and for example, a natural compound library, a synthetic compound library, an existing drug library, etc., can be used.
[0094] (Step of culturing in a medium containing serum at a concentration of 1-3%) The medium used for culturing in this step is not particularly limited as long as the serum concentration is 1-3%, and for example, known media used for culturing animal cells can be used. The medium may be one in which the conditions other than serum are the same as those of the medium described in the section <Method for producing cells with accumulated fat> above.
[0095] The culture period may be, for example, one day or more, two days or more, or three days or more. Alternatively, the culture period may be within ten days, within nine days, or within eight days.
[0096] Examples of serum include fetal bovine serum (FBS) and horse serum (HS), but are not limited to these. Serum may also be a serum substitute. In this embodiment, FBS is preferred as the serum.
[0097] A serum concentration of 1-2% is more preferable. For example, the serum concentration may be 1%.
[0098] This process may include a step of adapting the cell line derived from the eel family to a low-serum or serum-free environment. The adaptation of the cell line to a low-serum or serum-free environment can be carried out according to known methods. Such methods may include directly exposing the cells to a low-serum or serum-free environment and obtaining cells that have grown in that environment, or it may be a method of gradually decreasing the serum concentration to acclimate the cells to a low-serum or serum-free environment (acclimatization). However, from the viewpoint of minimizing stress on the cells, the latter method is preferred.
[0099] When gradually decreasing serum concentration, for example, one could start with a 5% concentration and decrease it by 1% at a time, culturing in a culture medium at the target serum concentration.
[0100] The "increase in cell count" can be confirmed visually or quantitatively.
[0101] The method for quantitatively confirming the increase in cell number is not particularly limited. The cell number can be quantified using methods known to those skilled in the art. For example, such a method involves using the Cell Counting Kit-8 (Dojin Chemical Laboratories Co., Ltd.) as a cell proliferation / cytotoxicity assay kit.
[0102] In this embodiment, the appropriate concentration of the test substance for promoting cell proliferation may be estimated by culturing the cell line derived from the eel family in the presence of various concentrations of the test substance and confirming the increase in the number of cells.
[0103] <Other Embodiments> In one embodiment, the present disclosure provides a cell line derived from the eel family that is adapted to a low-serum or serum-free environment.
[0104] Fetal bovine serum (FBS), used in cell cultures of fish cells, is heterologous to fish, potentially leading to problems in terms of physiological compatibility and reproducibility. Therefore, the development of FBS suitable for fish cells, as well as low-FBS and serum-free media, are crucial issues. For industrial applications, FBS-free culture systems are particularly desirable, and in addition to developing culture media, cell lines capable of growing in low-FBS or serum-free environments are required.
[0105] The cell line derived from eel-like fish, provided in this embodiment and adapted to a low-serum or serum-free environment, can be suitably used in the above-described method for screening cell proliferation-promoting substances.
[0106] The effects of the present invention will be made clearer by the following examples. However, the present invention is not limited to the following examples and can be implemented with appropriate modifications without altering its essence.
[0107] <Composition of Culture Medium> Unless otherwise specified, the compositions of the growth medium and differentiation medium used in the following examples are as follows: Growth medium: Leibowitz L-15 medium (FUJIFILM Wako Pure Chemical Corporation) 10% FBS (Thermo Fisher Scientific) 1% antibiotic-antifungal mixed solution (100-fold concentrated) (stabilized) (NACALAI TESQUE, Inc.)
[0108] Differentiation medium: The following additives were added to the growth medium: 2.5 μg / mL insulin, 1.25 μM dexamethasone, and 250 μM IBMX.
[0109] <Primary Antibodies> Unless otherwise specified, the primary antibodies used to detect each cell marker in the following examples are as follows: Vimentin: CoraLite® 555-conjugated Vimentin Recombinant Antibody (Product No.: CL555-80232, Proteintech) CD29: ITGB1 Polyclonal Antibody (PA5-29606 Thermo Fisher Scientific) CD73: Polyclonal Antibody (12231-1-AP Proteintech) CD105 (Endoglin): Polyclonal Antibody (10862-1-AP Proteintech) PPARγ: PPAR Gamma Polyclonal Antibody (16643-1-AP Proteintech) FABP4:FABP4 Polyclonal Antibody (12802-1-AP Proteintech)
[0110] <Establishment of cell lines derived from eel-like fish> The inventors established cell lines derived from eel-like fish using the following method.
[0111] (Recovery of cell populations: JE-KRT224, JE-EK4, JE-EK9) Cells obtained from the muscle tissue of the Japanese eel were passed through six times in growth medium. The cells that had been passed through six times were observed under a light microscope, and cell populations of cells that were round in shape and contained granules were recovered by the scratch method. An example of a cell population of cells that are round in shape and contain granules is shown in Figure 1. The cell populations circled in Figure 1 are examples of this. The recovered cell populations were each single-cell cloned using the following methods to establish cell lines JE-KRT224, JE-EK4, and JE-EK9.
[0112] (Cell population recovery: JE-F1140) Primary cultured cells obtained from the muscle tissue of juvenile Japanese eels were maintained in a T75 flask for 19 months. After 19 months of maintenance culture, a cell cluster of surviving cells was seeded into another culture flask (March 21, 2024). Approximately one month after seeding, 423 cells that had migrated from the cell cluster were recovered by scratching (April 30, 2024), and cultured using the following method to establish the cell line JE-F1140. An example of cells that migrated from the cell cluster is shown in Figure 2.
[0113] (Single-cell cloning: JE-KRT224) The cell population recovered by the above method was divided into 5 cells / cm². 2 The cells were then seeded into a multi-cell culture dish. The cells growing in each cell were periodically observed using a light microscope under phase contrast, and cells that showed signs of single-colony growth were detached from the dish and transferred to a 12-well plate (May 15, 2024). The grown cells were then sequentially transferred to 6-well, T25, T75, and T300 flasks, and cultured using growth medium. Of the single colonies cultured, 3 × 10⁶ cells, corresponding to 25 or more cell divisions, were selected. 7 We selected cells that could be propagated to more than one cell, and obtained the Japanese eel-derived cell line JE-KRT224.
[0114] (Single-cell cloning: JE-EK4 and JE-EK9) The cell populations recovered by the above method were dispensed into 17 wells of a 48-well plate and cultured. One well with good growth was selected, and the cells were detached from the well by trypsin treatment (April 30, 2024). The number of cells was counted, and single-cell cloning was performed in a 96-well plate using the limiting dilution method. Of the cells cultured in the 96-well plate, cells from 12 wells in which growth was confirmed were sequentially transferred to 6-well, T25 flask, T75 flask, and T300, and cultured in growth medium. Among the single colonies cultured in expansion culture, 3 × 10⁶ cells, corresponding to 25 or more cell divisions, were selected. 7 Two cell lines that were able to proliferate to more than one cell were selected, and Japanese eel-derived cell lines JE-EK4 and JE-EK9 were obtained.
[0115] (Cell culture: JE-F1140) Of the 423 cells recovered using the method described above (recovery of cell population: JE-F1140), 381 were cultured in a T25 flask. They were then transferred sequentially to a T75 flask and then a T300 flask, and cultured using growth medium until the number of cells reached 3 × 10⁶, which corresponds to more than 25 cell divisions. 7 We obtained a Japanese eel-derived cell line, JE-F1140, which could be proliferated to more than one cell.
[0116] <Proof of Immortalization of Cell Lines 1> The inventors have proven the immortalization of cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 using the following method.
[0117] (JE-KRT224, JE-EK4, JE-EK9, and JE-F1140) Place 5 to 7 × 10¹³ of each of the above cell lines into a T75 flask. 5 The cells were seeded individually and cultured statically at 25°C in growth medium until semi-confluent or confluent. The semi-confluent or confluent cell lines were detached with trypsin, the number of cells was counted, and each was transferred to a new T75 flask in quantities of 5-7 x 10⁶. 5 Individual seeds were seeded. These operations were repeated, and the number of cells and the time required were measured to calculate the theoretical number of divisions and doubling time for each cell line (September 18, 2024 - December 19, 2024).
[0118] The theoretical number of fission cycles for JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were 85, 58, 61, and 80, respectively, and the doubling times were 23.9 ± 5.0 hours (n=14), 28.3 ± 7.9 hours (n=11), 27.3 ± 7.9 hours (n=11), and 27.4 ± 6.4 hours (n=14), respectively.
[0119] Figure 3 shows the results of phase-contrast observation of JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 using an optical microscope. The scale bar is 200 μm. At the time of phase-contrast observation, JE-KRT224, JE-EK4, and JE-EK9 were obtained by single-cell cloning of cell populations recovered from primary cultured Japanese eel cells that had been subcultured six times, and the resulting cell lines had a theoretical number of divisions equivalent to 40 (cell number 1 × 10⁶). 12cultured until the number of cells reaches the above number (or more). In addition, for JE-F1140, after maintaining the primary cultured cells obtained from Japanese eels for 19 months, the cells migrated from cell aggregates were subcultured until the number of cells theoretically reached the equivalent of 74 divisions (the number of cells was 2 × 10 22 cultured until the number of cells reaches the above number (or more). As a result, it was shown that the cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 are immortalized cell lines.
[0120] <Proof of Immortalization of Cell Lines 2> The inventors further proved the immortalization of the cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 by continuing the culture.
[0121] According to the method described in the section of (JE-KRT224, JE-EK4, JE-EK9, and JE-F1140) in <Proof of Immortalization of Cell Lines 1> above, the four cell lines were cultured, the number of cells and the required time were measured, and the theoretically calculated number of divisions and doubling time of each cell line were calculated (from February 5, 2025 to May 22, 2025).
[0122] The theoretically calculated number of divisions of JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were 142, 89, 123, and ¹³⁵ times, respectively, and the doubling times were 20.8 ± 1.3 hours (n = 10), 22.5 ± 3.4 hours (n = 10), 20.2 ± 1.1 hours (n = 10), and 19.3 ± 1.1 hours (n = 10), respectively.
[0123] These results further clearly showed that the cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 are immortalized cell lines.
[0124] <Confirmation of Multilayer Structure> JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were each seeded at 5 × 10 in a 12-well plate. 4Individual seeds were seeded and cultured in growth medium at 25°C until confluence was reached. Subsequently, each cell was observed using a light microscope under phase contrast. The results are shown in Figure 4. The observations showed that JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 have the ability to form multilayer structures.
[0125] <Quantitative Analysis of Fat Accumulation> The obtained Japanese eel-derived cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were each placed in 96-well black plates in a 1 x 10⁶ layer. 4 Cells were seeded at a density of cells / well and cultured in growth medium for 2 days. After removing the medium, JE-KRT224, JE-EK4, and JE-EK9 were cultured for 3 days in differentiation medium supplemented with 32.8 μM oleic acid cyclodextrin solution (OACD) as a lipid accumulation culture additive, and JE-F1140 was cultured for 7 days. As a control, cells cultured in growth medium for the same number of days instead of differentiation medium supplemented with the lipid accumulation culture additive were used for each cell line. After culturing in differentiation medium supplemented with the lipid accumulation culture additive, the cells were washed twice with PBS at room temperature, stained for 3 hours in the dark using a lipid droplet assay kit (Lipid Droplet Assay Kit-Blue, DOJINDO), and the fluorescence intensity was measured using a fluorescence microplate reader (Synergy HT, CENTRAL SCIENTIFIC COMMERCE Inc.). The fluorescence intensity results are shown in Figures 5 and 6.
[0126] Figure 5 shows the fluorescence intensity graphs of JE-KRT224, JE-EK4, and JE-EK9 cell lines cultured for 3 days in growth medium and differentiation medium supplemented with a lipid accumulation additive, respectively. Higher fluorescence intensity indicates more lipid accumulation within the cells. The rectangles in the graph represent the fluorescence intensity for each cell line: the left rectangle is in growth medium, and the right rectangle is in differentiation medium supplemented with a lipid accumulation additive. The bars represent the mean, and the error bars represent the standard deviation. * indicates a significant difference in fluorescence intensity (p < 0.05, Student's t-test, n = 4) when comparing the same cell line between the two media. In all cell lines, lipid accumulation within the cells was confirmed regardless of whether they were cultured in growth medium or differentiation medium supplemented with a lipid accumulation culture additive. In all cell lines, the differentiation medium supplemented with a lipid accumulation culture additive showed significantly higher fluorescence intensity compared to the growth medium. These results demonstrate that the fat accumulation culture additive can induce fat accumulation in cell lines derived from eel-family fish.
[0127] Figure 6 shows a graph of fluorescence intensity when the JE-F1140 cell line was cultured for 2 days in growth medium (GM) and then for 7 days in differentiation medium (GM + F + OACD) supplemented with a lipid accumulation culture additive. Higher fluorescence intensity indicates greater intracellular lipid accumulation. The rectangles in the graph represent the fluorescence intensity for each cell line: the left rectangle is in growth medium, and the right rectangle is in differentiation medium with the lipid accumulation additive. The bars represent the mean, and the error bars represent the standard deviation. * indicates a significant difference in fluorescence intensity (p < 0.05, Student's t-test, n = 4) when comparing the same cell line between the two media. It was confirmed that intracellular lipid accumulation occurred in the JE-F1140 cell line regardless of whether it was cultured in growth medium or differentiation medium with the lipid accumulation culture additive. Furthermore, it was confirmed that lipid accumulation significantly increased in differentiation medium with the lipid accumulation culture additive.
[0128] <Imaging of Fat Accumulation 1> Figure 7 shows a 1 × 10⁶ image of the JE-KRT224 cell line on a collagen-coated glass chamber slide (Matsunami SCS-N38). 4These images show the fluorescent dye bound to fat within cells after seeding individual cells and culturing them for three days in growth medium and differentiation medium, respectively, with and without the fat accumulation culture additive. The bottom panel shows the transmission image of cultured cells, the top panel shows the fluorescence image when Lipi-Deepred, a fluorescent dye with high fat affinity, was added to the same cells, and the middle panel is a superimposed image of the bottom and top panels. It was revealed that fat accumulates within the cells, and the amount is greater in the differentiation medium than in the growth medium, and in each medium, the amount is greater in the medium with the fat accumulation culture additive than in the medium without it.
[0129] JE-KRT224 cells were seeded in 24-well plates and cultured in growth medium for 2 days. Then, the culture medium was changed to growth medium, growth medium supplemented with 65 μM OACD and a 200-fold diluted lipid mixture (1000x) (product number L5146, Sigma-Aldrich), and differentiation medium supplemented with 65 μM OACD and a 200-fold diluted lipid mixture (1000x), and cultured for 3 days. JE-KRT224 cells cultured under each condition were stained with Lipi-DeepRed (manufactured by Dojin Chemical Laboratories). The results are shown in Figure 8. The top row shows growth medium, the middle row shows growth medium supplemented with OACD and lipid mixture, and the bottom row shows differentiation medium supplemented with OACD and lipid mixture. The right column shows transmission images of cells cultured under each condition, the middle column shows fluorescence images when Lipi-Deepred, a highly lipophilic fluorescent dye, was added, and the left column shows a superimposition of the transmission and fluorescence images. From the results in Figure 8, it was confirmed that lipids accumulate in cells when OACD and a lipid mixture are added to both the growth medium and the differentiation medium.
[0130] As shown in Figures 7 and 8, although the amount of fat accumulation is greater in the differentiation medium than in the growth medium when OACD and lipid mixture are added, it became clear that fat accumulates in cells not only in the differentiation medium but also in the growth medium when lipid accumulation culture additives are added.
[0131] <Protein and Gene Expression Analysis> The expression of various proteins and genes was analyzed for JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 using the following methods.
[0132] (Mesenchymal cell markers and mesenchymal stem cell markers) JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were reacted with antibodies that identify vimentin, a mesenchymal cell marker, and CD29, CD73, and CD105, mesenchymal stem cell markers, and the presence of the above cell markers was confirmed by immunofluorescence. The results are shown in Figures 9, 10, 11, and 12, respectively. In each figure, the center column shows staining with 4',6-diamidino-2-phenylindole (DAPI) that binds to DNA, and the fluorescence indicates the presence of the nucleus of each cell. The right column shows staining with CoraLite® 555 dye (CL555) and Alexa Fluor® 488 dye (AF488), and the fluorescence indicates the presence of the substance written to the left of each row. The left column shows the synthesized fluorescence of DAPI and CL555 or AF488. In each cell line, the expression of the above cell markers was confirmed.
[0133] (Adipose cell markers) JE-KRT224, JE-EK4, JE-EK9, and JE-F1140, cultured in growth medium, were reacted with an antibody that identifies PPARγ, the master regulator of adipocyte differentiation, and the presence of PPARγ was confirmed by immunofluorescence. The results are shown in Figure 13. The left column shows all fluorescence, the middle column shows DAPI fluorescence, and the right column shows PPARγ fluorescence. It was confirmed that adipocyte markers were expressed in JE-KRT224, JE-EK4, JE-EK9, and JE-F1140.
[0134] (Quantification of PPARγ gene expression levels) JE-KRT224, JE-EK4, JE-EK9, and JE-F1140 were placed in a 12-well plate in a 1 × 10⁶ sample. 5Cells were seeded at a density of cells / well and cultured in growth medium for 2 days. Then, the medium was changed to differentiation medium supplemented with 32.8 μM OACD, and cultured for a further 3 days. The cells were washed twice with PBS, and total RNA was extracted using RNeasy® Plus Mini Kit (Qiagen). cDNA was synthesized by reverse transcription using ReverTra Ace® (TOYOBO). Using a QuantStudio® 3 real-time PCR system (Thermo Fisher Scientific) and Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies), we investigated the expression of the PPARγ gene and, as a control, the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers were designed using Primer3 version 4.1.0 based on the predicted sequences of the Japanese eel in the NCBI database. The expression levels of each gene were calculated using a calibration curve, and the relative expression level of the PPARγ gene was normalized against the expression level of the GAPDH gene. The sequences of the primers for the PPARγ gene (SEQ ID NOs: 1 and 2) and the GAPDH gene (SEQ ID NOs: 3 and 4) are shown below. The PPARγ gene primers were designed using Primer3. The GAPDH gene primers were designed based on Gu et al. Fish Shellfish Immunol. 73 (2018) 288-296.
[0135] The base sequences of each primer are shown below. PPARγ Forward: GAGATCGGGGGTGCACGTCTTT (SEQ ID NO: 1) Reverse: AGCAGCGTCACCTGGTCATT (SEQ ID NO: 2) GAPDH Forward: GCGCCAGCCAGAACATCATC (SEQ ID NO: 3) Reverse: GTTAAGCTCGGGGATATC (SEQ ID NO: 4)
[0136] The results are shown in Figure 14. Figure 14 is a graph showing the relative expression level of the PPARγ gene for each cell line, with the relative expression level of the PPARγ gene to the GAPDH gene of the JE-KRT224 cell line cultured in growth medium set to 1. In the graph, for each cell line, the left side shows the expression level when cultured in growth medium, and the right side shows the expression level when cultured in differentiation medium with added lipid accumulation additives (differentiation medium + OACD). The bars represent the mean value, and the error bars represent the standard deviation. All cell lines expressed the PPARγ gene in both growth medium and differentiation medium with added lipid accumulation culture additives.
[0137] (Changes in adipocyte marker expression) The expression of PPARγ and FABP4, which is expressed in differentiated adipocytes, was compared using immunofluorescence in JE-KRT224 cells cultured in growth medium and JE-KRT224 cells cultured in differentiation medium. The results for PPARγ are shown in Figure 15, and the results for FABP4 are shown in Figure 16.
[0138] It was confirmed that culturing in differentiation medium increased the expression of PPARγ and FABP4.
[0139] (Suitable concentration of additives for fat accumulation culture) JE-KRT224 strain in 1 x 10⁶ plates 5 Cells were seeded at a density of cells / well and cultured in growth medium for 2 days. After removing the medium, the cells were cultured for 10 days in growth medium supplemented with OACD at a predetermined concentration of 6.56–164 μM. Growth medium without OACD was used as a control. The cells were washed twice with PBS at room temperature, single-cell preparations were made using trypsin solution, and the cell count was measured using an automated cell counter (Thermo Fisher Scientific). The results are shown in Figure 17.
[0140] Figure 17 shows the cell count of JE-KRT224 cells cultured for 10 days in growth medium supplemented with a predetermined concentration of OACD. The bars represent the mean value, and the error bars represent the standard deviation. * indicates a significant difference compared to the control growth medium without OACD (ANOVA with Dunnett's Test, n=4). When the OACD concentration was between 6.56 and 65.6 μM, the cell count tended to increase compared to the control, while when the OACD concentration was 164 μM, the cell count significantly decreased compared to the control. From these results, it was confirmed that an OACD concentration in the range of 6.56 to 65.6 μM is suitable for cell culture.
[0141] <Induction of fat accumulation by isoflavones> Genistein and daidzein were solubilized using cyclodextrin, a food additive, and added to a culture medium to evaluate their ability to induce fat accumulation.
[0142] A solution containing genistein or daidzein was prepared at a concentration of 10 mM in PBS(-) containing 10% γ-CD, and filtered through a 0.2 μm filter. The γ-CD concentration (10%) is the concentration at which genistein or daidzein is solubilized when the concentration of γ-CD is gradually increased to prepare a 10 mM genistein or daidzein solution.
[0143] Japanese eel cell lines (JE-KRT224 and JE-F1140) were seeded in 24-well or 48-well plates, respectively, and cultured in growth medium until confluence. After removing the medium, the cells were cultured for 14 days in a medium supplemented with genistein solution or daidzein solution (added to a concentration of 1–200 μM each) and 32.8 μM OACD as a lipid accumulation culture additive. Further culture was performed for 1 day in growth medium supplemented with 32.8 μM OACD. As controls, cells cultured in growth medium or growth medium containing γ-CD for each cell line were used. After removing the medium, lipid droplets were stained with Lipi-DeepRed.
[0144] The results are shown in Figures 18 and 19. The bottom row shows the transmission image of cells, the middle row shows the fluorescence image when Lipi-Deepred, a fluorescent dye with high lipophilicity, was added, and the top row shows the transmission image and fluorescence image superimposed. From the results in Figures 18 and 19, it was confirmed that lipid accumulation can be induced by adding a solution containing genistein or daidzein encapsulated in γ-CD, and OACD, to the culture medium.
[0145] These results demonstrate that lipid accumulation can be induced in Japanese eel-derived cell lines under conditions that are beneficial to food production (by utilizing components applicable to food production).
[0146] <Consideration of gas used for plasma treatment> Commercially available rice (2023 stockpiled rice) was used as an edible scaffold. After drying at 40°C for 24 hours, plasma treatment was performed.
[0147] Rice was placed in a plastic petri dish and positioned inside the chamber of a plasma cleaning device (Samco PC-300). Plasma irradiation was performed for 5 minutes at an output RF value (FWD: 200W) and a flow rate of 25 sccm (standard cubic centimeters per minute; sccm) of oxygen or argon gas. At this time, the indicated pressure was 34 Pa for oxygen gas and 20 Pa for argon gas. After processing, the lid of the petri dish was immediately closed to maintain a sterile condition.
[0148] (Cell adhesion evaluation) Japanese eel cell line (JE-KRT224) introduced with red fluorescent protein (RFP) was cultured in a T75 flask. The grown cells were separated into single cells using 0.25% trypsin solution, and the number of viable cells was adjusted in growth medium to prepare a cell suspension. This cell suspension was cultured in an uncoated petri dish (without surface treatment for cell adhesion) in the presence of plasma-treated stored rice. For comparison, unplasma-treated rice was mixed with the cells and cultured on the same day. Fluorescence images were acquired after 14 days.
[0149] The results are shown in Figure 20. Live cells with red fluorescence (shown as white in the figure) were observed in stored rice treated with oxygen plasma or argon plasma, but no live cells were observed in untreated rice.
[0150] These results indicate that either oxygen or argon can be used as the gas for plasma processing.
[0151] <Cultivation using plasma-treated edible scaffold 1-1> Edible bamboo fiber (Unicell® Bamboo Fiber BF500, Interfiber Inc.: hereinafter referred to as "BF500") was used as the edible scaffold. After sterilization in an autoclave, plasma treatment was performed.
[0152] Sterilized BF500 samples were placed in a plastic petri dish and positioned inside the chamber of a plasma cleaning device (Samco PC-300). Plasma irradiation was performed under the conditions shown in Table 1, varying the output RF value (FWD: 50, 100, or 200 W) and the oxygen gas concentration (10 or 50 sccm). After processing, the petri dish lid was immediately closed to maintain a sterile state.
[0153]
[0154] (Cell Adhesion Evaluation) Japanese eel cell line (JE-F1140) was cultured in T75 or T300 flasks. The grown cells were separated into single cells using 0.25% trypsin solution, and the number of viable cells was adjusted using growth medium to prepare a cell suspension. This cell suspension was cultured in an uncoated petri dish (without surface treatment for cell adhesion) in the presence of plasma-treated BF500. For comparison, cells without BF500 and cells with unirradiated BF500 (without plasma treatment) were cultured on the same day. A portion of the culture medium was taken out, viable cells were stained using MTT reagent, and images were acquired using a fluorescence phase-contrast microscope with a digital camera (Evident CKX53).
[0155] The results are shown in Figure 21. After plasma treatment, BF500 formed a net-like complex, and it was observed that living cells adhered along the fibers of BF500 (No. 1 to No. 6). On the other hand, when unirradiated BF500 was cultured with cells, the BF500 was incorporated into the spheroid, and the living cells were observed in a nearly spherical shape (unirradiated).
[0156] These results revealed that treating edible bamboo fibers with oxygen plasma improved the cell adhesion of the Japanese eel-derived cell line (JE-F1140). Furthermore, it was suggested that the optimal plasma treatment conditions for improving the adhesion and proliferation of JE-F1140 are an RF output of 50-200 W, an oxygen gas concentration of 10-50 sccm, an irradiation time of approximately 5 mins, and an observed pressure of approximately 15-40 Pa.
[0157] <Culturing using plasma-treated edible scaffolds 1-2> Sterilized BF500 was placed in a plastic petri dish and positioned in the chamber of a plasma cleaning device (Samco PC-300). Plasma irradiation was performed for 5 minutes at an RF output value (FWD) of 50 W and 50 sccm of oxygen gas. At this time, the indicated pressure was 36 Pa.
[0158] (Cell Spread Evaluation) Japanese eel-derived cell line (JE-EK4 strain) was cultured in a T75 flask, single-cell preparations were made using 0.25% trypsin solution, and the number of viable cells was adjusted using growth medium to prepare a cell suspension. This cell suspension was placed in an uncoated petri dish and cultured in the presence of plasma-treated BF500. After 14 days, a portion was sampled, viable cells were stained using MTT reagent, and cell aggregates were photographed under a microscope. Using the obtained images, the circularity of the cell aggregates was obtained using the image analysis function (particle size analysis: outline shape of cell populations) of ImageJ. Note that only one independent cell aggregate was measured, and two or more cell aggregates that were adhered to each other were excluded from the measurement.
[0159] The results are shown in Figures 22 and 23. Figure 22 is a representative image of cell aggregates cultured with untreated BF500 and cell aggregates cultured with BF500 after plasma treatment. Black represents cell aggregates, and white fibers represent bamboo fibers. Figure 23 is a graph showing the results of the circularity analysis for cell aggregates cultured with untreated BF500 and cell aggregates cultured with BF500 after plasma treatment. The bars represent the mean value, and the error bars represent the standard deviation. * indicates a significant difference in circularity (p < 0.05, Student's t-test) when comparing cell aggregates cultured with untreated BF500 and cell aggregates cultured with BF500 after plasma treatment. Cell aggregates cultured with BF500 after plasma treatment had significantly lower circularity.
[0160] The low degree of circularity indicates that the cell clusters are irregular. In other words, these results suggest that the cells adhered to and extended along the plasma-treated edible bamboo fibers.
[0161] <Cultivation using plasma-treated edible scaffold 2> Commercially available rice (2023 stockpiled rice) was used as the edible scaffold. After drying at 40°C for 18 hours, plasma treatment was applied.
[0162] Rice was placed in a plastic petri dish and positioned inside the chamber of a plasma cleaning device (Samco PC-300). Plasma irradiation was performed for 5 minutes at an output RF value (FWD: 50 or 200 W) and oxygen gas at 25 or 50 sccm. At this time, the indicated pressure was 35 Pa at RF 50 W and 27 Pa at RF 200 W. After processing, the lid of the petri dish was immediately closed to maintain a sterile condition.
[0163] (Cell adhesion evaluation) Japanese eel cell line (JE-F1140 strain) was cultured in T75 flasks or T300 flasks. The grown cells were separated into single cells using 0.25% trypsin solution, and the number of viable cells was adjusted using growth medium to prepare a cell suspension. This cell suspension was cultured in an uncoated petri dish for 13 days in the presence of plasma-treated rice. For comparison, untreated rice was mixed with the cells and cultured on the same day. The rice was removed to a separate uncoated petri dish, viable cells were stained using MTT reagent, and images were acquired using a fluorescence phase-contrast microscope with a digital camera (Evident CKX53).
[0164] The results are shown in Figure 24. Live cells, shown in purple (black in the figure), were observed in the plasma-irradiated rice, but no live cells were observed in the untreated rice. Furthermore, it was confirmed that cell adhesion was greater with RF200W than with RF50W.
[0165] These results revealed that plasma treatment of rice improves the cell adhesion of the Japanese eel-derived cell line (JE-F1140 strain). Furthermore, optimal RF output conditions for plasma treatment were identified.
[0166] <Culturing using plasma-treated edible scaffold 3-1> Agar was used as the edible scaffold. Since plasma irradiation is not possible on agar gel containing water, the agar was dried and formed into a sheet according to the following procedure. 2.0 g of commercially available agar powder was weighed using an electronic balance and placed in a 200 mL pressure-resistant glass container. 200 mL of ultrapure water was added while stirring to prevent lumps, and the agar was completely dissolved and sterilized by autoclaving (121°C, 20 minutes). The resulting agar aqueous solution was cooled to about 80°C, and 7 mL (6 mg / cm³) was placed in a 35 mm sterile plastic petri dish. 2 The agar gel was dispensed. The gelled agar gel was cooled to room temperature and then air-dried in a clean bench to form a sheet.
[0167] An agar sheet was placed in a petri dish and positioned inside the chamber of a vacuum plasma irradiation device (NVC-103, manufactured by Nichiho Denshi). Vacuum plasma treatment was performed under the conditions shown in Table 2. After treatment, the lid was immediately closed to maintain a sterile state. Note that charring occurred on the agar sheet when irradiated with RF 2,000 W, oxygen gas 200 sccm, and 5 min, so a lower power setting was used.
[0168]
[0169] (Cell Adhesion Evaluation) Primary cultured cells derived from Japanese eel muscle tissue, including the acquired Japanese eel cell lines JE-KRT224, JE-EK4, JE-EK9, and JE-F1140, were cultured in T75 flasks. Single cells were prepared using 0.25% trypsin solution, and the number of viable cells was adjusted using growth medium to prepare a cell suspension. This cell suspension was cultured at 25°C in an uncoated petri dish in the presence of a plasma-treated agar sheet. For comparison, cells were mixed with an agar sheet that had not been plasma-treated and cultured on the same day. Viable cells were stained using MTT reagent, and images were acquired using a fluorescence phase-contrast microscope with a digital camera (Evident CKX53).
[0170] The results are shown in Figure 25. Confluently grown cells were observed on the agar sheet after plasma irradiation (No. 1 to No. 6). On the other hand, on the agar sheet that was not irradiated with plasma, there were many areas where cells had not adhered, and it was observed that the cells had become spheroidal.
[0171] These results revealed that plasma treatment of agar sheets improves the cell adhesion of primary cultured cells derived from eel muscle tissue. Furthermore, it was suggested that the optimal plasma treatment conditions for agar sheets to improve the adhesion and proliferation of cells derived from Japanese eel muscle tissue are an RF output of 100–1,000 W, oxygen gas of 100–300 sccm, irradiation time of 1–5 min, and observed pressure of approximately 20–50 Pa.
[0172] <Culturing using plasma-treated edible scaffold 3-2> Commercially available agar sticks were used as the edible scaffold. The agar sticks were placed in a pressure-resistant glass container and sterilized by autoclaving (121°C, 20 minutes). After cooling, the agar sticks were torn into pieces of approximately 5 mm x 10 mm and subjected to plasma treatment.
[0173] Agar rods were placed in a petri dish and positioned inside the chamber of a plasma cleaning device (Samco PC-300). Plasma irradiation was performed for 5 minutes at an RF output value (FWD: 100 or 200 W) and 25 sccm of oxygen gas. At this time, the indicated pressure was 29 Pa at RF 100 W and 34 Pa at RF 200 W. After irradiation, the lid of the petri dish was immediately closed to maintain a sterile condition.
[0174] (Cell adhesion evaluation) Japanese eel cell line (JE-KRT224) was cultured in a T75 flask. The grown cells were separated into single cells using 0.25% trypsin solution. A cell suspension was prepared by adjusting the number of viable cells in growth medium. This cell suspension was cultured in an uncoated petri dish in the presence of plasma-treated agar, and images were acquired after 1 and 3 days using a fluorescence phase-contrast microscope with a digital camera (Evident CKX53). For comparison, a mixture of cells and plasma-treated agar, and cells alone, were cultured on the same day.
[0175] The results are shown in Figure 26. When only cells were cultured, cell aggregates were observed after 1 day (cells only, 1 day). In this state, cells cannot proliferate. After 3 days, cell aggregates that had bonded together and floating dead cells were observed (cells only, 3 days). When cells were cultured with untreated agar sticks, no cells adhered to the agar sticks after 1 day (untreated, 1 day), but slight cell adhesion was observed after 3 days (untreated, 3 days, area enclosed by the black line). When cells were cultured with agar sticks that had been irradiated with RF 100W plasma, cell aggregate adhesion was observed after 1 day (RF 100W, oxygen gas 25 sccm, 5 min, 1 day, area enclosed by the black line). Observation after 3 days confirmed that cells had adhered and cytoplasm had expanded (RF100W, oxygen gas 25 sccm, 5 min, 3 days later, area enclosed by black line). When cells were cultured on agar rods irradiated with RF200W plasma, observation after 1 day confirmed that, in addition to cell aggregate adhesion, cells had adhered and the cytoplasm had expanded well (RF200W, oxygen gas 25 sccm, 5 min, 1 day later, area enclosed by black line). Observation after 3 days confirmed that cells had proliferated across the entire surface of the agar rod, reaching confluence (RF200W, oxygen gas 25 sccm, 5 min, 3 days later).
[0176] These results revealed that treating commercially available agar bars with oxygen plasma improved the cell adhesion of the Japanese eel cell line (JE-KRT224). In particular, it was confirmed that good culture conditions similar to those in culture vessels could be achieved under irradiation conditions of RF 200W, oxygen 25 sccm, and 5 min.
[0177] Commercially available agar sticks have a cost advantage among edible scaffolding options because they do not require the preparation of edible scaffolding.
[0178] <Preparation of 1% FBS-conditioned cell lines> Using cell lines (JE-KRT224 and JE-F1140) cultured in growth medium (10% FBS) in T75 flasks until confluence, the FBS concentration was gradually reduced to 5%, 4%, and 3%, finally acclimatizing to 1% FBS. The cell lines were detached with trypsin, the number of cells was counted, and each was transferred to a new T75 or T25 flask, with a total of 1 to 2.5 × 10⁶ cells. 6 The cells were seeded individually and cultured in L15 medium containing 1% FBS. These procedures were repeated, and the number of cells and the time required were measured to calculate the doubling time for each cell line.
[0179] The doubling times for JE-KRT224 and JE-F1140 were 89 ± 44 hours (n=6) and 147 ± 79 hours (n=5), respectively.
[0180] Hereafter, the acclimatized strain JE-KRT224 that can grow with 1% FBS will be referred to as JE-KRT224-F1, and the acclimatized strain JE-F1140 that can grow with 1% FBS will be referred to as JE-F1140-F1.
[0181] <Imaging of Fat Accumulation 2> The acquired 1% FBS-conditioned Japanese eel cell lines (JE-KRT224-F1 and JE-F1140-F1) were each placed in 24-well plates in a 1 × 10⁶ image. 5 Cells were seeded at a rate of 1 / well and cultured for 3 days in L15 medium containing 1% FBS (1% FBS-GM). After removing the medium, the cells were cultured for 14 days in differentiation medium or differentiation medium supplemented with 32.8 μM OACD as a lipid accumulation culture additive. Furthermore, they were cultured for 1 day in 1% FBS-GM supplemented with 32.8 μM OACD. As a control, cells cultured on the same day in 1% FBS-GM instead of differentiation medium supplemented with lipid accumulation culture additive for each cell line were used. After removing the medium, the cells were stained with Lipi-DeepRed.
[0182] The results are shown in Figures 27 and 28. The left column shows 1% FBS-GM, the middle column shows differentiation medium, and the right column shows differentiation medium with OACD added. The bottom row shows transmission images of cultured cells, the middle row shows fluorescence images when Lipi-Deepred, a highly lipophilic fluorescent dye, is added, and the top row shows a superimposition of the transmission and fluorescence images. From the results in Figures 27 and 28, it was confirmed that lipids accumulated in cells in both the growth medium and the differentiation medium with OACD added. From these results, it was confirmed that the 1% FBS conditioned cell lines (JE-KRT224-F1 and JE-F1140-F1) have the ability to accumulate lipids.
[0183] <Evaluation of cell proliferation-promoting substances using 1% FBS-conditioned cell lines 1> JE-F1140-F1 was placed in 4 × 10⁶ plates in a 96-well plate. 4 After seeding, cells were cultured for 6 days in 1% FBS-GM containing 400-fold, 1,000-fold, or 2,000-fold diluted ITS-A supplement (x100) (Fujifilm Wako Pure Chemical Industries, Ltd.). Then, absorbances at 450 nm and 620 nm were measured using a Cell Counting Kit-8 (Dojin Chemical Laboratories Co., Ltd.) and a microplate reader (Synergy HT). As a control, cells were cultured on the same day in 1% FBS-GM without ITS-A supplement (x100).
[0184] The results are shown in Figure 29. Figure 29 shows the absorbance of JE-F1140-F1 cells cultured for 6 days in 1% FBS-GM (unadded) with a predetermined concentration of ITS-A supplement (×100). The bars represent the mean value, and the error bars represent the standard deviation. The letters indicate that a significant difference was observed when comparing different letters (ANOVA with Fisher's LSD, n=4, p<0.05). Absorbance was significantly increased compared to the control when the ITS-A supplement was added at 2,000-fold, 1,000-fold, and 400-fold dilutions.
[0185] <Evaluation of cell proliferation-promoting substances using 1% FBS-conditioned cell lines, Part 2> 5 × 10⁶ of JE-F1140-F1 were placed in a 12-well plate. 5Cells were seeded individually and cultured for 5 days in 1% FBS-GM containing 100x or 200x diluted ITS-A supplement (x100). As a control, 1% FBS-GM without the ITS-A supplement (x100) was used. Cells were washed twice with PBS at room temperature, single-cell preparations were made with trypsin solution, and the cell count was measured using an automated cell counter (Thermo Fisher Scientific).
[0186] The results are shown in Figure 30. Figure 30 shows the cell count of JE-F1140-F1 cells cultured for 5 days in 1% FBS-GM (unadded) with a predetermined concentration of ITS-A supplement (×100). The bars represent the mean, and the error bars represent the standard deviation. The letters indicate a significant difference observed when comparing different letters (ANOVA with Fisher's LSD, n=4, p<0.05). When the amount of ITS-A supplement added was 200-fold or 100-fold, the cell count increased significantly compared to the control.
[0187] These results suggest that using 1% FBS-conditioned cell lines makes it possible to screen for cell proliferation-promoting substances and evaluate their concentration.
[0188] <Isoflavone-induced lipid accumulation in 1% FBS-conditioned cell lines> 4 x 10 rows of JE-KRT224-F1 cells were placed in a 48-well plate. 4 Individual seeds were seeded and cultured in 1% FBS-GM until confluence. After removing the culture medium, the cells were cultured for 2 days in a medium supplemented with daidzein solution (added to a concentration of 10–200 μM each) and 32.8 μM OACD as a lipid accumulation culture additive. As a control, cells cultured in differentiation medium containing 1% FBS-GM or 1% FBS supplemented with 32.8 μM OACD were used. After removing the culture medium, lipid droplets were stained with Lipi-DeepRed.
[0189] The results are shown in Figure 31. The bottom row shows the transmission image of the cells, the middle row shows the fluorescence image when Lipi-Deepred, a highly lipophilic fluorescent dye, was added, and the top row shows the transmission and fluorescence images superimposed. From the results in Figure 31, it was confirmed that adding a solution containing daidzein encapsulated in γ-CD, and OACD, to the culture medium could induce lipid accumulation in 1% FBS-conditioned cell lines. However, adding γ-CD alone did not show any effect on cell morphology, nor did it result in lipid accumulation (not shown).
Claims
A cell line derived from eel-like fish that expresses at least one selected from the group consisting of vimentin, CD29, CD73, and CD105, and has the ability to accumulate fat. The cell line derived from an eel fish according to claim 1, further expressing at least one selected from the group consisting of Perioxisome Proliferator-Activated Receptor γ (PPARγ) and Fatty acid binding protein 4 (FABP4). A cell line derived from an eel-like fish according to claim 1 or 2, having the ability to form a multilayer structure. The cell line derived from an anguillidae fish according to claim 1 or 2, wherein the anguillidae fish is the Japanese eel. A cell line derived from an eel-like fish according to claim 1, which is a cell line selected from the group consisting of JE-KRT224 (accession number NITE BP-04244), JE-EK4 (accession number NITE BP-04245), JE-EK9 (accession number NITE BP-04246), and JE-F1140 (accession number NITE BP-04247). The process includes culturing a cell line derived from an eel-like fish according to claim 1 or 2 in a culture medium to cause fat to accumulate within the cells, A method for producing cells in which fat has accumulated. The method for producing fat-accumulating cells according to claim 6, wherein the culture medium contains cyclodextrin encapsulating unsaturated fatty acids. The method for producing fat-accumulating cells according to claim 6, wherein the culture medium contains cyclodextrin encapsulating phytoestrogens. The method for producing fat-accumulating cells according to claim 6, wherein the culture is performed using a scaffold made of an edible material that has been treated with plasma. A fat production kit comprising a cell line derived from an eel-like fish according to claim 1 or 2, a culture medium for fat accumulation, and a culture vessel. The fat production kit according to claim 10, wherein the culture medium for fat accumulation contains cyclodextrin encapsulating unsaturated fatty acids. A fat-containing composition comprising a cell line derived from an eel-like fish according to claim 1 or 2. The fat-containing composition according to claim 12, wherein the fat-containing composition is selected from the group consisting of food, animal feed, cosmetics, food additives, and pharmaceutical compositions. A step of culturing a cell line derived from an eel-like fish according to claim 1 or 2 and accumulating fat, A step of mixing the cell line that has accumulated the aforementioned fat or the fat extracted from the cell line that has accumulated the aforementioned fat with at least one other component, A method for producing a fat-containing composition, including the above. The method for producing a fat-containing composition according to claim 14, wherein the fat-containing composition is selected from the group consisting of foods, animal feed, cosmetics, food additives, and pharmaceutical compositions. A method for screening cell proliferation-promoting substances, A screening method comprising the step of culturing a cell line derived from an eel-like fish according to claim 1 or 2 in a culture medium containing serum at a concentration of 1 to 3% in the presence of a test substance, wherein an increase in the number of cells in the cell line compared to the absence of the test substance indicates that the test substance is a cell proliferation promoter.