COMPOSITIONS AND METHODS FOR INHIBITING THE EXPRESSION OF BETA SUBUNIT GENES AND INHIBIN (INHBE)

Abstract

The disclosure relates to double-stranded ribonucleic acid (dsRNA) targeting an INHBE gene, and methods of using the dsRNA to inhibit expression of INHBE.

Description

1 / 138 COMPOSITIONS AND METHODS FOR INHIBITING THE EXPRESSION OF BETA SUBUNIT GENES AND INHIBIN (INHBE) CROSS-REFERENCE

[001] This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 489,325, filed March 9, 2023, disclosure of which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[002] The instant request contains a Sequence Listing XML that was sent electronically and is incorporated herein by reference in its entirety. The XML copy, created in month XX of 20XX, is named XXXXX and is XXX.XXX bytes in size. FIELD OF THE INVENTION

[003] The present invention relates to targeting double-stranded ribonucleic acid (dsRNA) INHBE genes and methods of using dsRNA to inhibit INHBE expression in a cell. SUMMARY

[004] The present disclosure is based, in part, on the development of double-stranded ribonucleic acid (dsRNA) targeting inhibin beta E subunit genes (INHBE), pharmaceutical compositions comprising the targeted dsRNA INHBE genes, and methods of using dsRNA to inhibit INHBE expression in a cell.

[005] In some respects, the disclosure provides a double-stranded ribonucleic acid (dsRNA) to inhibit INHBE expression comprising a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein: (a) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 598, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID Petition 870250080602, dated 09 / 08 / 2025, p. 16 / 193 2 / 138 NO: 589; (b) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 599, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 590; (c) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 600, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 591; (d) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 601, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 592; (e) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 602, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 593;(f) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 603, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 594; (g) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 604, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 595; (h) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 605, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 596;or (i) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 606, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 597. In some respects, disclosure provides a double-stranded ribonucleic acid (dsRNA) to inhibit INHBE expression, wherein; Petition 870250080602, dated 09 / 08 / 2025, p. 17 / 193 3 / 138 dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides long, wherein: (a) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 616, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 607; (b) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 617, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 608; (c) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 618, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 609;(d) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 619, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 610; (e) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 620, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 611; (f) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 621, and the sense strand comprises at least 15 contiguous nucleotides of a sequence from the sense strand that comprises the sequence with SEQ ID NO: 612; (g) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 622, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 613;(h) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 623, and the sense tape comprises a sequence that is at least 70% or 80% identical; Petition 870250080602, dated 09 / 08 / 2025, p. 18 / 193 4 / 138 identical to the sequence with SEQ ID NO: 614; or (i) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 624, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 615.

[006] In some respects, the disclosure provides a double-stranded ribonucleic acid (dsRNA) to inhibit INHBE expression comprising a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein: (a) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 598, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 589; (b) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 599, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 590;(c) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 600, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 591; (d) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 601, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 592; (e) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 602, and the sense strand comprises at least 15 contiguous nucleotides of a sequence; Petition 870250080602, dated 08 / 09 / 2025, page 19 / 193 5 / 138 sense strand sequence comprising the sequence of SEQ ID NO: 593; (f) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 603, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 594; (g) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 604, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 595; (h) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 605, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 596;or (i) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence with SEQ ID NO: 606, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 597. In some respects, the disclosure provides a double-stranded ribonucleic acid (dsRNA) to inhibit INHBE expression, wherein the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein: the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence with SEQ ID NO: 616, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 607;(b) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 617, and the sense strand comprises at least; Petition 870250080602, dated 08 / 09 / 2025, page 20 / 193 (a) the antisense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 608; (b) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 618, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 609; (c) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 619, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 610; (e) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 620, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 611;(f) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 621, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 612; (g) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 622, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 613; (h) the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence comprising the sequence of SEQ ID NO: 623, and the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 614; or (i) the antisense strand comprises at least 15 contiguous nucleotides of a sequence of; Petition 870250080602, dated 09 / 08 / 2025, p. 21 / 193 7 / 138 antisense strand comprising the sequence with SEQ ID NO: 624, and the sense strand comprising at least 15 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 615.

[007] In some embodiments, the INHBE gene is human INHBE. In some embodiments, INHBE is human INHBE comprising the sequence shown in SEQ ID NO: 588 (NM_031479.5).

[008] In some embodiments, the sense tape is 70%, 80%, 90%, 95% or more identical to the sense tape sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614, or SEQ ID NO: 615. In some embodiments, the sense strand comprises at least 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of a sense strand sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615. In some embodiments, the sense strand comprises: (a) 20 contiguous nucleotides of a sense strand sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ (a) 21 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615; (b) 21 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 594, SEQ ID NO: 595, SEQ Petition 870250080602, dated 08 / 09 / 2025, page 22 / 193 8 / 138 (c) 22 contiguous nucleotides of a sense strand sequence comprising the sequence SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615; and / or (d) 23 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 594 or SEQ ID NO: 612. In some embodiments, the antisense strand comprises at least 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence with SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624. In some embodiments, the antisense strand comprises: (a) 21 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO:606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO:619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624; (b) 22 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624; and / or (c) 23 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, Petition 870250080602, dated 08 / 09 / 2025, page 23 / 193 9 / 138 SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624. In some embodiments, the sense tape sequence is selected from a sense tape sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615, and the antisense tape is selected from a tape sequence. nonsense comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623, or SEQ ID NO: 624. In some embodiments, the sense tape sequence is selected from a sense tape sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615. In some embodiments, the antisense tape is selected from an antisense tape sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQID NO: 623 or SEQ ID NO: 624. In some models, the anti-slip tape Petition 870250080602, dated 09 / 08 / 2025, p. 24 / 193 10 / 138 sense tape comprises the sequence with SEQ ID NO: 598 and the sense tape comprises the sequence with SEQ ID NO: 589. In some embodiments, the antisense tape comprises the sequence with SEQ ID NO: 599 and the sense tape comprises the sequence with SEQ ID NO: 590. In some embodiments, the antisense tape comprises the sequence with SEQ ID NO: 600 and the sense tape comprises the sequence with SEQ ID NO: 591. In some embodiments, the antisense tape comprises the sequence with SEQ ID NO: 601 and the sense tape comprises the sequence with SEQ ID NO: 592. In some embodiments, the antisense tape comprises the sequence with SEQ ID NO: 602 and the sense tape comprises the sequence with SEQ ID NO: 593. In some embodiments, the antisense tape comprises the sequence with SEQ ID NO: 603 and the sense tape comprises the sequence with SEQ ID NO: 594. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 604 and the sense tape comprises the sequence SEQ ID NO: 595.In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 605 and the sense tape comprises the sequence SEQ ID NO: 596. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 606 and the sense tape comprises the sequence SEQ ID NO: 597. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 616 and the sense tape comprises the sequence SEQ ID NO: 607. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 617 and the sense tape comprises the sequence SEQ ID NO: 608. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 618 and the sense tape comprises the sequence SEQ ID NO: 609. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 619 and the sense tape comprises the sequence SEQ ID NO: 610. In some embodiments, the antisense tape comprises the sequence SEQ ID NO: 620 and the sense tape comprises the sequence. Petition 870250080602, dated 09 / 08 / 2025, p. 25 / 193 11 / 138 of SEQ ID NO: 611. In some embodiments, the antisense tape comprises the sequence of SEQ ID NO: 621 and the sense tape comprises the sequence of SEQ ID NO: 612. In some embodiments, the antisense tape comprises the sequence of SEQ ID NO: 622 and the sense tape comprises the sequence of SEQ ID NO: 613. In some embodiments, the antisense tape comprises the sequence of SEQ ID NO: 623 and the sense tape comprises the sequence of SEQ ID NO: 614. In some embodiments, the antisense tape comprises the sequence of SEQ ID NO: 624 and the sense tape comprises the sequence of SEQ ID NO: 615.In some embodiments, at least one nucleotide of the dsRNA is a modified nucleotide selected from the group consisting of: a 5'-vinyl phosphonate nucleotide, a modified 2'-O-methyl nucleotide, an inverted deoxyribonucleotide (3'-linked nucleotide or 5'-linked nucleotide), a nucleotide comprising a 5'-phosphorothioate group, a modified 2'-fluoro nucleotide, a nucleotide comprising a modified nucleotide component represented by Formula (I):. Formula (I), and a nucleotide comprising a modified nucleotide component represented by Formula (II): Formula (II); wherein: each of B1 and B2 is a nucleobase; and R1 is selected from the group consisting of hydrogen and C1-6 alkyl; optionally in Petition 870250080602, dated 08 / 09 / 2025, page 26 / 193 12 / 138 that the antisense strand and the sense strand each comprise at least one modified nucleotide.

[009] In some embodiments, the antisense strand has a nucleotide overhang at the 3' end compared to the sense strand. In some embodiments, the nucleotide overhang at the 3' end comprises 1, 2, or 3 nucleotides compared to the sense strand. In some embodiments, the antisense and sense strands are at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary. In some embodiments, the antisense and sense strands are at least 80% complementary. In some embodiments, the antisense and sense strands comprise at least one, at least two, at least three, or at least four mismatched nucleotides. In some embodiments, the antisense strand comprises a nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to a target mRNA corresponding to an INHBE mRNA fragment. In some embodiments, the dsRNA antisense strand comprises at least 80% complementarity to the INHBE mRNA fragment.In some embodiments, the antisense strand of dsRNA comprises one, two, three, or four mismatches with the INHBE mRNA fragment. In some embodiments, at least one nucleotide of the dsRNA is a modified nucleotide. In some embodiments, the modified nucleotide is at least one of a modified nucleotide selected from the group consisting of: a modified 2'-O-methyl nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a modified 2'-fluoro nucleotide; an inverted abasic nucleotide, an S-isomer of thymidine glycol nucleic acid (GNA); an inosine and inverted deoxyribonucleotide (3'-3' linked nucleotide or 5'-5' linked nucleotide), an S-isomer of thymidine glycol nucleic acid (GNA), a nucleotide comprising a nucleotide component. Petition 870250080602, dated 08 / 09 / 2025, page 27 / 193. 13 / 138 modified deo represented by Formula (I): Formula (I), and a nucleotide comprising a modified nucleotide component represented by Formula (II): Formula (II); wherein: each of B1 and B2 is a nucleobase; and R1 is selected from the group consisting of hydrogen and C1-6 alkyl; optionally wherein the antisense strand and the sense strand each comprise at least one modified nucleotide, and a nucleotide comprising a modified nucleotide component represented by Formula (II). In some embodiments, each of B1 and B2 is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof. In some embodiments, each of B1 and B2 is independently selected from adenine, uracil, cytosine, and modified analogs thereof. In some embodiments, R1 is C1-6 alkyl. In some embodiments, wherein R1 is -CH3. In some embodiments, B1 is uracil. In some embodiments, R1 is -CH3 and B1 is uracil. In some embodiments, B2 is adenine. In some sports, B2 is uracil.In some embodiments, the sense strand comprises an inverted deoxyribonucleotide at the 5' end; optionally, the inverted deoxyribonucleotide is a 5'-5' linked deoxythymidine. In some embodiments, the sense strand comprises an inverted deoxyribonucleotide at the 3' end. Petition 870250080602, dated 08 / 09 / 2025, page 28 / 193 14 / 138 optionally wherein the inverted deoxyribonucleotide is a 3'-3' linked deoxythymidine. In some embodiments, the sense strand comprises an inverted deoxyribonucleotide at the 5' end and an inverted deoxyribonucleotide at the 3' end; optionally wherein the inverted deoxyribonucleotide at the 5' end is a 5'-5' linked deoxythymidine and the inverted deoxyribonucleotide at the 3' end is a 3'-3' linked deoxythymidine. In some embodiments, the sense strand comprises a nucleotide comprising the modified nucleotide component represented by Formula (I) at the 3' end; optionally wherein R1 is -CH3 and B1 is uracil.

[0010] In some embodiments, the modified nucleotide is at least one of the following: a 5'-vinyl phosphonate nucleotide, a 5'-phosphate or phosphate mimic, a blocked nucleic acid (LNA), a 2'MOE (methoxyethyl)nucleotide, and / or a 2'-arabino fluoronucleotide (2'araF). In some embodiments, the antisense strand comprises a phosphate mimic at the 5' end; optionally, wherein the phosphate mimic is a 5'-E-vinyl-phosphonate or a 4'-O-phosphonate. In some embodiments, the modified nucleotide is at least one of the following: a 2'-deoxy-2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a blocking nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and / or a non-natural base comprising the nucleotide.

[0011] In some embodiments, the antisense strand and / or the sense strand comprise at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphopiperazidate linkage, an aminoalkylphospho linkage Petition 870250080602, dated 09 / 08 / 2025, p. 29 / 193 15 / 138 ramidate, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranephosphate linkage. In some embodiments, the antisense strand and / or the sense strand comprise at least one nucleotide-modified linkage. In some embodiments, all nucleotide linkages in the antisense strand are modified linkages. In some embodiments, the antisense strand and / or the sense strand comprise at least one phosphorothioate (PS) linkage.

[0012] In some embodiments, the dsRNA further comprises a linker or targeting moiety. In some embodiments, the linker or targeting moiety is conjugated to the 5' end, the 3' end, or both ends of the dsRNA. In some embodiments, the linker or targeting moiety is conjugated to the 3' end of the sense strand of the dsRNA. In some embodiments, the linker or targeting moiety is conjugated to the 5' end of the sense strand of the dsRNA. In some embodiments, the linker or targeting moiety is at least one N-acetylgalactosamine (GalNAc). In some embodiments, the linker or targeting moiety is represented by Formula (I): Petition 870250080602, dated 09 / 08 / 2025, p. 30 / 193 16 / 138 or a pharmaceutically acceptable salt thereof, wherein: A1 is the dsRNA binding site; each occurrence of T1 and T2 is independently selected from a 5-membered heterocyclyl and an alkylene; each occurrence of X is selected from the group consisting of -OH and -SH; and each occurrence of L is a ligand; LA is absent or is a ligand; en is an integer from 1 to 6. In some embodiments, each occurrence of T1 and T2 is independently selected from a 5-membered heterocyclyl with at least one oxygen in the ring and a C1-6 alkylene. In some embodiments, the compound is represented by Formula (IA): or a pharmaceutically acceptable salt thereof. In some embodiments, the compound is represented by the formula (IAI): or a pharmaceutically acceptable salt thereof. In some fashion Petition 870250080602, dated 08 / 09 / 2025, page 31 / 193 17 / 138 properties, the compound is represented by Formula (IA-II): or a pharmaceutically acceptable salt thereof, wherein each occurrence of aeb is an integer from 1 to 20. In some embodiments, the linker or targeting moiety is tri-GalNAc6. In some embodiments, the linker or targeting moiety is L96.

[0013] In some embodiments, a cell comprising a disclosure dsRNA is provided. In some embodiments, a vector encoding at least one unmodified strand of a disclosure dsRNA is provided, optionally both strands. a disclosure cell comprising the vector is provided.

[0014] In some embodiments, a pharmaceutical composition to inhibit INHBE expression comprising dsRNA and a pharmaceutically acceptable vehicle, diluent, excipient or combination thereof is provided.

[0015] In some embodiments, a method of inhibiting INHBE expression in a cell is provided, the method comprising (a) placing the cell in contact with the dsRNA of the disclosure or with the pharmaceutical composition of the disclosure; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation Petition 870250080602, dated 08 / 09 / 2025, page 32 / 193 18 / 138 tion of the mRNA transcript of an INHBE gene, thereby inhibiting the expression of the INHBE gene in the cell, optionally in which the method is in vivo. In some embodiments, INHBE expression is inhibited by at least 30% compared to a control.

[0016] In some embodiments, a method of treating a disorder mediated by or associated with INHBE is provided, comprising administering to an individual in need of such treatment a therapeutically effective amount of a dissemination dsRNA, or a dissemination pharmaceutical composition. In some embodiments, the disorder is a cardiovascular disorder. In some embodiments, the disorder is a cardiovascular disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The novel features of the invention are presented in particular in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description which presents illustrative embodiments in which the principles of the invention are used, and the accompanying drawings of which:

[0018] FIGS. 1A-B show bar graphs of the percentage (%) inhibition of INHBE mRNA in Huh-7 cells transfected with the indicated GalNAc-conjugated modified siRNA at 10 nM and 0.1 nM, relative to INHBE mRNA in sham-treated cells. INHBE mRNA level measured by quantitative PCR and normalized for GAPDH.

[0019] FIG. 2 shows graphs of exemplary INHBE siRNA compounds in the Huh7 cell line in a single-dose screening at 100 nM, 33 nM, 11 nM, 3.7 nM, 1.2 nM, 0.412 nM, 0.137 nM, and 0.046 nM of the selected siRNA. INHBE mRNA levels were measured by quantitative PCR and normalized for GAPDH relative to sham-treated control cells, and mean KD and DP were determined. Petition 870250080602, dated 08 / 09 / 2025, page 33 / 193 19 / 138 mined.

[0020] FIG. 3 shows a bar graph of the percentage (%) reduction of INHBE mRNA in human hepatocyte cells treated with the GalNAc-conjugated modified siRNA indicated at 10 nM and 1 nM relative to INHBE mRNA in cells treated with PBS. INHBE mRNA level measured by quantitative PCR and normalized for GAPDH.

[0021] FIG. 4 shows a graph of the relative expression of human INHBE mRNA in a hydrodynamic injection model with the 13 conjugated and modified siRNAs indicated at 1 mg / kg, relative to INHBE expression in PBS-treated mice. INHBE mRNA levels were measured by quantitative PCR and normalized to NEO.

[0022] FIG. 5 shows a graph of the relative expression of human INHBE mRNA in a hydrodynamic injection model with the 12 conjugated and modified siRNAs indicated at 1 mg / kg or 1.5 mg / kg, relative to INHBE expression in PBS-treated mice. INHBE mRNA levels were measured by quantitative PCR and normalized to NEO.

[0023] FIG. 6 shows a bar graph of the relative expression of INHBE mRNA in a non-human primate model treated with siRNA Compounds A and B at 5 mg / kg. mRNA levels were measured via quantitative PCR using liver biopsy samples, and normalized to INHBE expression level on day -4 for each individual animal.

[0024] FIGS. 7A-7C show graphs representing the agonistic activity of the tested compounds in a cell-based hTLR7 reporter assay (FIG. 7A), hTLR8 reporter assay (FIG. 7B), and hTLR9 reporter assay (FIG. 7C). For each graph, the y-axis shows the activity level as a cell-fold change. Petition 870250080602, dated 08 / 09 / 2025, page 34 / 193 20 / 138 unstimulated. The x-axis shows the concentration of each compound in nM (log10 scale).

[0025] FIG. 8 shows a volcano plot of differentially expressed genes (DEGs) between different groups in primary human hepatocyte (PHH) cells treated with indicated exemplary siRNA compounds. The x-axis represents log 2 (FoldChange), while the y-axis represents the statistical significance for each gene.

[0026] FIG. 9 shows graphs representing the biochemical tests of mice over 7 days after receiving a single dose of PBS control or siRNA compound 100635, 100642, or 100643. The mean plasma concentration of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TRIG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), creatinine (CREZ), cholesterol (CHOL), lactate dehydrogenase (LDH), total urinary microprotein (UP), and plasma urea (UREA) is shown. DETAILED DESCRIPTION

[0027] The details of one or more embodiments of the invention are presented in the description below. Other features, objects and advantages of the invention will be evident from the description, drawings and claims.

[0028] This disclosure provides dsRNA oligonucleotides and methods for using dsRNA oligonucleotides to inhibit the expression of a lipoprotein (A) gene (INHBE) in a cell or mammal where the dsRNA oligonucleotide targets an INHBE gene. The disclosure also provides compositions and methods for treating pathological conditions and diseases in a mammal caused by the expression of an INHBE gene, for example, cardiovascular disease. An INHBE dsRNA oligonucleotide targets the specific degradation of the INHBE mRNA sequence. Petition 870250080602, dated 08 / 09 / 2025, page 35 / 193 21 / 138 I. Definitions

[0029] For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims are provided below. If there is an apparent discrepancy between the use of a term elsewhere in this specification and its definition provided in this section, the definition in this section shall prevail.

[0030] As used herein, all numeric values ​​or numeric ranges comprise whole numbers within or encompassing such ranges and portions of the values ​​or whole numbers within or encompassing ranges, unless the context clearly indicates otherwise. Thus, for example, reference to a range of 90100% comprises 91%, 92%, 93%, 94%, 95%, 95%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth. In another example, the reference to an interval of 1 to 5,000 times includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times, etc., as well as 1,1, 1,2, 1,3, 1,4 or 1,5 times, etc., 2,1, 2,2, 2,3, 2,4 or 2,5 times, etc., and so on.

[0031] The articles a and an are used here to refer to one or more than one (i.e., at least one) grammatical object of the article. As an example, an element means one element or more than one element, for example, a plurality of elements.

[0032] The term including is used here to mean, and is used interchangeably with, the phrase including, but not limited to.

[0033] The term about is used here to mean within the typical tolerance ranges in the technique. For example, about can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series Petition 870250080602, dated 09 / 08 / 2025, p. 36 / 193 22 / 138 of numbers or a range, it is understood that approximately can modify each of the numbers in the series or range.

[0034] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that could logically be included, as the context makes clear. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides of a nucleic acid molecule of 21 nucleotides" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.

[0035] As used herein, not more than or less than is understood to mean the value adjacent to the phrase and logical values ​​less than or integers, as logically contextual, to zero. For example, a duplex with a protrusion of not more than 2 nucleotides has a protrusion of 2, 1, or 0 nucleotides. When not more than is present before a series of numbers or a range, it is understood that not more than can modify each of the numbers in the series or range. As used herein, ranges include the upper and lower bounds.

[0036] G, C, A, and U generally represent a nucleotide containing guanine, cytosine, adenine, and uracil as a base, respectively. T and dT are used interchangeably here and refer to a deoxyribonucleotide in which the nucleobase is thymine, for example, deoxyribothymine. However, it should be understood that the term ribonucleotide or nucleotide or deoxyribonucleotide may also refer to a modified nucleotide, as detailed below, or to a substituent moiety. Those versed in Petition 870250080602, dated 08 / 09 / 2025, page 37 / 193 23 / 138 technique is aware that guanine, cytosine, adenine, and uracil can be substituted by other moieties without substantially altering the base-pairing properties of an oligonucleotide comprising a nucleotide containing such a substitution moiety. For example, without limitation, a nucleotide comprising inosine as its base can form base pairs with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in disclosure nucleotide sequences by a nucleotide containing, for example, inosine. Sequences comprising such substitution moieties are disclosure embodiments.

[0037] INHBE refers to the inhibin beta E subunit gene. According to the NCBI NLM website, this gene encodes a member of the TGF-beta (transforming growth factor-beta) protein superfamily. The encoded preproprotein is proteolytically processed to generate an inhibin beta subunit. Inhibins have been implicated in the regulation of several cellular processes, including cell proliferation, apoptosis, immune response, and hormone secretion. This gene can be upregulated under endoplasmic reticulum stress conditions, and this protein can inhibit cell proliferation and growth in the pancreas and liver. A human INHBE mRNA sequence is GenBank accession number NM_031479.5, included here as SEQ ID NO: 588. A rhesus macaque (Macaca mulata) INHBE mRNA sequence is GenBank accession number XM_028847001.1.

[0038] As used herein, target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an INHBE gene, including mRNA that is a product of RNA processing of a primary transcription product. Petition 870250080602, dated 08 / 09 / 2025, page 38 / 193 24 / 138

[0039] As used herein, the term strand comprising a sequence refers to an oligonucleotide comprising a strand of nucleotides that is described by the sequence referred to using standard nucleotide nomenclature.

[0040] As used herein, and unless otherwise indicated, the term complementary, when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by those skilled in the art.

[0041] For example, a first nucleotide sequence can be described as complementary to a second nucleotide sequence when the two sequences hybridize (e.g., annealing) under strict hybridization conditions. Hybridization conditions include temperature, ionic strength, pH, and organic solvent concentration for the annealing and / or washing steps. The term strict hybridization conditions refers to the conditions under which a first nucleotide sequence will preferentially hybridize with its target sequence, e.g., a second nucleotide sequence, and to a lesser degree, or not at all, with other sequences. Strict hybridization conditions depend on the sequence and are different under different environmental parameters. Generally, strict hybridization conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the nucleotide sequence at a defined ionic strength and pH.Tm is the temperature (under defined ionic strength and pH) at which 50% of the first nucleotide sequences hybridize with a given sequence. Petition 870250080602, dated 09 / 08 / 2025, p. 39 / 193 25 / 138 perfectly matching target. A comprehensive guide on nucleic acid hybridization can be found in, for example, Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes Part I, Chapter 2, Overview of Hybridization Principles and Nucleic Acid Probe Assay Strategy, Elsevier, NY (Tijssen).

[0042] Other conditions, such as physiologically relevant conditions that may be found within an organism, may be applied. One skilled in the art will be able to determine the most appropriate set of conditions for a complementarity test of two sequences according to the final application of the hybridized nucleotides.

[0043] This includes base pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence with the oligonucleotide or polynucleotide comprising the second nucleotide sequence along the entire length of the first and second nucleotide sequences. Such sequences may be referred to herein as fully complementary to each other. However, when a first sequence is referred to as substantially complementary with respect to a second sequence herein, the two sequences may be fully complementary or may form one or more, but generally no more than 4, 3, or 2 mismatched base pairs after hybridization, while retaining the ability to hybridize under the conditions most relevant to their final application.However, when two oligonucleotides are designed to form, after hybridization, one or more single-stranded overhangs, such overhangs should not be considered incompatibilities with respect to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length... Petition 870250080602, dated 08 / 09 / 2025, page 40 / 193 26 / 138 ment, in which the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may also be referred to as fully complementary for the purposes described herein.

[0044] Complementary sequences, as used herein, may also include, or be formed entirely of, non-Watson-Crick base pairs and / or base pairs formed of non-natural and modified nucleotides, provided that the above requirements regarding their ability to hybridize are met. These non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairs.

[0045] The terms complementary, fully complementary and substantially complementary herein may be used with respect to base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0046] As used herein, a polynucleotide that is substantially complementary to at least part of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an INHBE-coding mRNA) including a 5' UTR, an open reading frame (ORF), or a 3' UTR. For example, a polynucleotide is complementary to at least part of an INHBE mRNA if the sequence is substantially complementary to an unbroken portion of an mRNA encoding INHBE.

[0047] In one embodiment, the antisense strand of dsRNA is sufficiently complementary to a target mRNA so as to cause cleavage of the target mRNA.

[0048] The term double-stranded RNA or dsRNA, as used herein, refers to a complex of ribonucleic acid molecules, Petition 870250080602, dated 09 / 08 / 2025, p. 41 / 193 27 / 138 having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, as defined above. In general, most of the nucleotides in each strand are ribonucleotides, but, as described in detail herein, each or both strands may also include at least one non-ribonucleotide, for example, a deoxyribonucleotide and / or a modified nucleotide. Furthermore, as used in this specification, dsRNA may include chemical modifications to ribonucleotides, including substantial modifications to multiple nucleotides and including all types of modifications disclosed herein or known in the art. Any such modifications, as used in an siRNA-type molecule, are encompassed by dsRNA for the purposes of this specification and claims.

[0049] The two strands that form the duplex structure may be different portions of a larger RNA molecule or may be separate RNA molecules. When the two strands are part of a larger molecule and are therefore connected by an uninterrupted strand of nucleotides between the 3' end of one strand and the 5' end of the other strand, forming the duplex structure, the connecting RNA strand is called a hairpin loop. When the two strands are covalently connected by means other than an uninterrupted strand of nucleotides between the 3' end of one strand and the 5' end of the other respective strand forming the duplex structure, the connecting structure is called a linker. The RNA strands may have the same number of nucleotides or different numbers. The maximum number of base pairs is the number of nucleotides in the shorter strand of the dsRNA minus any overhangs present in the duplex. In addition to the duplex structure, a dsRNA may comprise one or more nucleotide overhangs.The term siRNA is also used here to refer to a dsRNA as described above. Petition 870250080602, dated 09 / 08 / 2025, p. 42 / 193 28 / 138

[0050] As used herein, a nucleotide projection refers to the unpaired nucleotide or nucleotides that project from the duplex structure of a dsRNA when a 3' end of one dsRNA strand extends beyond the 5' end of the other strand, or vice versa. Blunt-ended or blunt-ended means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no excess nucleotides. A blunt-ended dsRNA is a dsRNA that is double-stranded throughout its length, i.e., no excess nucleotides at either end of the molecule.

[0051] The term antisense strand refers to the strand of a dsRNA that includes a region that is substantially complementary to a target sequence. As used herein, the term complementarity region refers to the region in the antisense strand that is substantially complementary to a sequence, for example, a target sequence as defined herein. When the complementarity region is not fully complementary to the target sequence, mismatches are more tolerated in the terminal regions and, if present, are usually in one or more terminal regions, for example, within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' terminal.

[0052] The term sense strand, as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0053] Introduction into a cell, when referring to a dsRNA, means facilitating uptake or absorption into the cell, as understood by experts in the field. Uptake or absorption of dsRNA can occur by unassisted diffusion or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; a dsRNA can also be introduced into a cell where the cell is part of a living organism. In this case, introduction into the cell will include delivery to the organism. Petition 870250080602, dated 08 / 09 / 2025, page 43 / 193 29 / 138 For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art, such as electroporation and lipofection. Other approaches are described herein or known in the art.

[0054] The terms silence, inhibit expression of, negatively regulate expression of, suppress expression of, and similar terms, insofar as they refer to an INHBE gene, herein refers to the at least partial suppression of the expression of an INHBE gene, manifested by a reduction in the amount of mRNA that can be isolated from a first cell or group of cells in which an INHBE gene is transcribed and which has been or is treated in such a way that the expression of an INHBE gene is inhibited, compared with a second cell or group of cells substantially identical to the first cell or group of cells, but which has or has not been treated in this way (control cells). The degree of inhibition is generally expressed in terms of (mRNA in control cells) - (mRNA in treated cells)Q(mRNA in control cells).

[0055] Alternatively, the degree of inhibition can be given in terms of a reduction in a parameter that is functionally linked to INHBE gene expression, for example, the amount of protein encoded by an INHBE gene secreted by a cell, the level of plasma lipids, or the number of cells exhibiting a given phenotype. In principle, INHBE gene silencing can be determined in any cell expressing the target, either constitutively or through genomic engineering, and by any appropriate assay. However, when a reference is needed to determine whether a given dsRNA inhibits the expression of an INHBE gene to a certain degree and is therefore covered by disclosure, the assays provided in the Examples below will serve as such a reference. Petition 870250080602, dated 08 / 09 / 2025, page 44 / 193 30 / 138

[0056] For example, in certain cases, the expression of an INHBE gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the double-stranded disclosure oligonucleotide. In some embodiments, an INHBE gene is suppressed by at least about 60%, 70%, or 80% by administration of the double-stranded disclosure oligonucleotide. In some embodiments, an INHBE gene is suppressed by at least about 85%, 90%, or 95% by administration of the double-stranded disclosure.

[0057] As used herein, in the context of INHBE expression, the terms treat, treatment and the like refer to the relief or attenuation of pathological processes mediated by INHBE expression. In the context of this disclosure, to the extent that it relates to any of the other conditions mentioned below (except pathological processes mediated by INHBE expression), the terms treat, treatment and the like mean to relieve or attenuate at least one symptom associated with such condition, or to slow or reverse the progression of such condition.

[0058] As used herein, the term effective amount refers to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes mediated by INHBE expression or evident symptoms of pathological processes mediated by INHBE expression. The specific amount that is effective can be readily determined by a general practitioner and may vary depending on factors known in the art, such as, for example, the type of pathological processes mediated by INHBE expression, the patient's history and age, the stage of the pathological processes mediated by INHBE expression, and the administration of other antipathological agents mediated by INHBE expression. Petition 870250080602, dated 08 / 09 / 2025, page 45 / 193 31 / 138

[0059] As used herein, a pharmaceutical composition comprises a pharmacologically effective amount of a dsRNA and a pharmaceutically acceptable carrier. As used herein, pharmacologically effective amount, therapeutically effective amount, or simply effective amount refers to the amount of an RNA effective in producing the intended pharmacological, therapeutic, or preventive outcome. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount required to effect at least a 25% reduction in that parameter. For example, a therapeutically effective amount of an INHBE that targets dsRNAs may reduce serum INHBE levels by at least 25%.

[0060] The term pharmaceutically acceptable vehicle refers to a vehicle for the administration of a therapeutic agent. Such vehicles include, but are not limited to, saline solution, buffered saline solution, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture media. For orally administered medications, pharmaceutically acceptable vehicles include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents.Binding agents may include starch and gelatin, while the lubricating agent, if present, will usually be magnesium stearate, stearic acid, or talc. If desired... Petition 870250080602, dated 09 / 08 / 2025, p. 46 / 193 32 / 138 jado, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

[0061] As used here, tri-GalNAc6 refers to the structure: Tri-GalNAc6

[0062] As used here, L96 ligand or L96 refers to the structure: L96 II. Double-Stranded Ribonucleic Acids (dsRNA)

[0063] In one aspect of the disclosure, double-stranded ribonucleic acid (dsRNA) molecules are provided here to inhibit the expression of an INHBE gene, for example, in a cell within an individual, such as a mammal (e.g., a human). The use of these dsRNA oligonucleotides allows for the targeted degradation of mRNAs of the corresponding gene (INHBE gene) in mammals.

[0064] In certain embodiments, dsRNA comprises an an strand Petition 870250080602, dated 09 / 08 / 2025, p. 47 / 193 33 / 138 tissue with a complementarity region that is complementary to at least part of an mRNA or mRNA fragment formed in the expression of an INHBE gene. In some embodiments, the dsRNA comprises at least 70% complementarity to the mRNA or mRNA fragment of the human INHBE mRNA.

[0065] In certain embodiments, the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence shown in Table 1 and Table 2. In certain embodiments, the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises a sequence that is at least 70% or 80% identical to an antisense strand sequence shown in Table 1 and Table 2. In some embodiments, the dsRNA is Compound 100494, 100506, 100509, 100535, 100557, 100561, 100563, 100563, 100569, 100580, 100589, 100604, 100613, 100625 and 100629.In certain embodiments, the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence shown in Table 6 and Table 7. In certain embodiments, the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises a sequence that is at least 70% or 80% identical to an antisense strand sequence shown in Table 6 and Table 7. In some embodiments, the dsRNA is Compound 100635, 100636, 100637, 100638, 100639, 100640, 100641, 100642, 100643, 100644, 100645, 100646 and 100647. In certain embodiments, dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises at least... Petition 870250080602, dated 08 / 09 / 2025, page 48 / 193 34 / 138 minus 15 contiguous nucleotides of an antisense strand sequence shown in Table 9 and Table 10. In certain embodiments, the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides in length, wherein the antisense strand comprises a sequence that is at least 70% or 80% identical to an antisense strand sequence shown in Table 9 and Table 10. In some embodiments, the dsRNA is Compound 100643, 100647, 100648, 100649, 100650, 100651, 100652, 100653, 100654, 100655, 100656, and 100657. In some embodiments, the INHBE is Human INHBE. In some embodiments, the INHBE is human INHBE comprising the sequence shown in SEQ ID NO: 588 (NM_031479.5).

[0066] In some embodiments, the sense strand is 70%, 80%, 90%, 95% or more identical to the sense strands listed in Table 1 and Table 2. In some embodiments, the sense strand is 70%, 80%, 90%, 95% or more identical to the sense strands listed in Table 6 and Table 7. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence shown in Table 6 and Table 7. In some embodiments, the sensor strand is 70%, 80%, 90%, 95% or more identical to the sense strands listed in Table 9 and Table 10. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence shown in Table 9 and Table 10. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence shown in Table 1 and Table 2.In some embodiments, the sense strand comprises at least 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a sense strand sequence shown in Table 1 and Table 2. In some embodiments, the sense strand comprises 21 contiguous nucleotides of a sense strand sequence shown in Table 1 and Table 2. In some embodiments, the se. Petition 870250080602, dated 08 / 09 / 2025, page 49 / 193 35 / 138 The sense strand sequence is selected from a sense strand sequence shown in Table 1 and Table 2. In some embodiments, the sense strand comprises at least 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides from a sense strand sequence shown in Table 6 and Table 7. In some embodiments, the sense strand comprises 21 contiguous nucleotides from a sense strand sequence shown in Table 6 and Table 7. In some embodiments, the sense strand comprises 22 contiguous nucleotides from a sense strand sequence shown in Table 6 and Table 7. In some embodiments, the sense strand comprises 23 contiguous nucleotides from a sense strand sequence shown in Table 6 and Table 7. In some embodiments, the sense strand sequence is selected from a sense strand sequence shown in Table 6 and Table 7.In some embodiments, the sense strand comprises at least 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of a sense strand sequence shown in Table 9 and Table 10. In some embodiments, the sense strand comprises 21 contiguous nucleotides of a sense strand sequence shown in Table 9 and Table 10. In some embodiments, the sense strand comprises 22 contiguous nucleotides of a sense strand sequence shown in Table 9 and Table 10. In some embodiments, the sense strand comprises 23 contiguous nucleotides of a sense strand sequence shown in Table 9 and Table 10. In some embodiments, the sense strand sequence is selected from a sense strand sequence shown in Table 8 and Table 9.

[0067] In some embodiments, the antisense strand is 70%, 80%, 90%, 95% or more identical to the antisense tapes listed in Table 1 and Table 2.In some embodiments, the antisense strand comprises at least 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a sense-antisense strand sequence shown in Table 1 and Table 2. In some embodiments, the antisense strand comprises 21 nucleotides. Petition 870250080602, dated 08 / 09 / 2025, page 50 / 193 36 / 138 contiguous nucleotides of a sense-antisense strand sequence shown in Table 1 and Table 2. In some embodiments, the antisense strand is selected from an antisense strand sequence shown in Table 1 and Table 2. In some embodiments, the antisense strand is 70%, 80%, 90%, 95% or more identical to the antisense strands listed in Table 6 and Table 7. In some embodiments, the antisense strand comprises at least 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleotides of a sense-antisense strand sequence shown in Table 6 and Table 7. In some embodiments, the antisense strand comprises 21 contiguous nucleotides of a sense-antisense strand sequence shown in Table 6 and Table 7. In some embodiments, the The antisense strand comprises 22 contiguous nucleotides of a sense-antisense strand sequence shown in Table 6 and Table 7.In some embodiments, the antisense strand comprises 23 contiguous nucleotides of a sense-antisense strand sequence shown in Table 6 and Table 7. In some embodiments, the antisense strand is selected from an antisense strand sequence shown in Table 6 and Table 7. In some embodiments, the antisense strand is 70%, 80%, 90%, 95% or more identical to the antisense strands listed in Table 9 and Table 10. In some embodiments, the antisense strand comprises at least 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleotides of a sense-antisense strand sequence shown in Table 9 and Table 10. In some embodiments, the antisense strand comprises 21 contiguous nucleotides of a sense-antisense strand sequence shown in Table 10. 9 and in Table 10. In some embodiments, the antisense strand comprises 22 contiguous nucleotides of a sense-antisense strand sequence shown in Table 9 and Table 10.In some embodiments, the antisense strand comprises 23 contiguous nucleotides of a sense-antisense strand sequence shown in Table 9 and Table 10. In some... Petition 870250080602, dated 08 / 09 / 2025, page 51 / 193 37 / 138 but modes, the antisense tape is selected from an antisense tape sequence shown in Table 9 and Table 10.

[0068] In some embodiments, the sense tape sequence is selected from a sense tape sequence shown in Table 1 and Table 2, and the antisense tape is selected from an antisense tape sequence shown in Table 1 and Table 2. In some embodiments, the sense tape sequence is selected from a sense tape sequence shown in Table 6 and Table 7, and the antisense tape is selected from an antisense tape sequence shown in Table 6 and Table 7. In some embodiments, the sense tape sequence is selected from a sense tape sequence shown in Table 9 and Table 10, and the antisense tape is selected from an antisense tape sequence shown in Table 9 and Table 10.

[0069] In some embodiments, the dsRNA exhibits a mismatch with an INHBE mRNA fragment. In some embodiments, the dsRNA comprises one or two mismatches with human INHBE mRNA or mRNA fragment. In some embodiments, the dsRNA is more than 70% identical to human INHBE mRNA or mRNA fragment. In some embodiments, the dsRNA is more than 70%, 75%, 80%, 85%, 90%, or 95% identical to human INHBE mRNA or mRNA fragment. In some embodiments, the antisense strand comprises a nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to a target mRNA corresponding to an INHBE mRNA fragment. In some embodiments, the antisense strand of dsRNA comprises at least 80% complementarity to the INHBE mRNA fragment. In some embodiments, the mismatch is in the sense strands. In some embodiments, the mismatch is in the antisense strand.In some embodiments, the antisense strand of dsRNA comprises one, two, three, or four mismatches with the fragment. Petition 870250080602, dated 09 / 08 / 2025, p. 52 / 193 38 / 138 to do mRNA INHBE. In some embodiments, the mismatch is located in the middle of the dsRNA. In some embodiments, the mismatch is in the 5' or 3' region of the dsRNA. In some embodiments, the mismatch is no more than 5 nucleotides from the 5' or 3' end of the dsRNA.

[0070] In some embodiments, at least one strand of the dsRNA comprises a 3' or 5' overhang of at least 1 nucleotide. In some embodiments, the overhang is at least 2 or at least 3 nucleotides. In some embodiments, in the dsRNA at least one strand comprises a 3' overhang. In some embodiments, in the dsRNA at least one strand comprises a 5' overhang.

[0071] In some embodiments, the antisense strand has a nucleotide overhang at the 3' end compared to the sense strand. In some embodiments, the nucleotide overhang at the 3' end comprises 1, 2, or 3 nucleotides compared to the sense strand. In some embodiments, the antisense strand and the sense strand are at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary. In some embodiments, the antisense strand and the sense strand are at least 80% complementary. In some embodiments, the antisense strand and the sense strand comprise at least one, at least two, at least three, or at least four mismatched nucleotides.

[0072] dsRNA can be synthesized by standard methods known in the art, as discussed later, for example, by using an automated DNA synthesizer, such as those commercially available, for example, from Biosearch, Applied Biosystems, Inc. dsRNA includes two RNA strands that are complementary enough to hybridize and form a duplex structure. One strand of dsRNA (the antisense strand) includes a region of complementarity that is complementary to a target sequence, derived from the sequence of an mRNA formed during the expression of an INHBE gene, the other strand Petition 870250080602, dated 09 / 08 / 2025, p. 53 / 193 39 / 138 (the sense ribbon) includes a region that is complementary to the antisense ribbon, such that the two ribbons hybridize and form a duplex structure when combined under suitable conditions.

[0073] In some embodiments, the duplex structure is between 15 and 30, or between 25 and 30, or between 18 and 25, or between 19 and 24, or between 19 and 21, or 19, 20, or 21 base pairs long. In one embodiment, the duplex is 19 base pairs long. In another embodiment, the duplex is 20 base pairs long. In yet another embodiment, the duplex is 21 base pairs long. When two different single-stranded RNAs (ssRNAs) are used in combination, the duplex lengths may be identical or different.

[0074] In some embodiments, each strand of the disclosure dsRNA is between 15 and 30, or between 18 and 25, or 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides long. In other embodiments, each strand is about 25-30 nucleotides long. In some embodiments, each strand of the duplex has the same length or different lengths. When two different ssRNAs are used in combination, the lengths of each strand of each ssRNA may be identical or may be different.

[0075] In some embodiments, dsRNA includes dsRNA with more than 21-23 nucleotides, for example, dsRNA that is long enough to be processed by the RNase III Dicer enzyme into siRNA of 21-23 base pairs, which is then incorporated into an RNA-induced silencing complex (RISC). Consequently, a disclosure dsRNA has at least 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90 or at least 100 base pairs in length.

[0076] The inhibition of INHBE gene expression can be analyzed, for example, by a nucleic acid-based assay, such as quantitative PCR, or by a protein-based method, such as Petition 870250080602, dated 08 / 09 / 2025, page 54 / 193 40 / 138 Western blot. The expression of an INHBE gene can be reduced by at least 50% when measured by an assay as described in the Examples below. For example, the expression of an INHBE gene in cell culture, such as in Huh-7 cells, can be analyzed by measuring INHBE mRNA levels, such as by quantitative PCR assay, or by measuring protein levels, such as by ELISA assay.

[0077] In another aspect, the disclosure provides a single-stranded antisense RNAi oligonucleotide. An antisense oligonucleotide is a single-stranded oligonucleotide that is complementary to a sequence within the target mRNA. Antisense oligonucleotides can inhibit translation stoichiometrically by base-pairing with mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol. Cancer Ther. 1:347-355. Antisense oligonucleotides can also inhibit target protein expression by binding to the target mRNA and promoting the destruction of the target mRNA via RNase-H. The single-stranded antisense RNA molecule can be 13 to 30 nucleotides long and have a sequence complementary to the target sequence.For example, a single-stranded antisense RNA molecule may comprise a sequence that has at least about 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the antisense sequences in Table 1 and Table 2, Table 6 and Table 7, or Table 9 and Table 10. Modifications

[0078] In certain embodiments, dsRNA is chemically modified to increase dsRNA stability. The nucleic acids presented in the disclosure can be synthesized and / or modified by well-established methods in the art, such as those described in Current Protocols in Nucleic Acid Chemistry, Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Specific examples of dsRNA compounds Petition 870250080602, dated 09 / 08 / 2025, p. 55 / 193 41 / 138 useful in this disclosure include dsRNAs containing modified structures or unnatural internucleoside linkages. As defined in this specification, dsRNAs with modified structures include those that retain a phosphorus atom in the structure and those that do not have a phosphorus atom in the structure. For the purposes of this descriptive report, and as sometimes referenced in the art, modified dsRNAs that do not have a phosphorus atom in their internucleoside linkage may also be considered oligonucleosides.In some embodiments, a modified dsRNA structure includes at least one of the following: a modified 2'-O-methyl nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a modified 2'-fluoro nucleotide; an inverted abasic nucleotide, an S-isomer of thymidine glycol nucleic acid (GNA); an inosine and an inverted deoxyribonucleotide (3-3' linked nucleotide or 5'-5' linked nucleotide), an S-isomer of thymidine glycol nucleic acid (GNA), a nucleotide comprising a modified nucleotide component represented by Formula (I):. Formula (I), and a nucleotide comprising a modified nucleotide component represented by Formula (II): Formula (II); in which: Each of B1 and B2 is a nucleobase; and Petition 870250080602, dated 08 / 09 / 2025, page 56 / 193 42 / 138 R1 is selected from the group consisting of hydrogen and C1-6 alkyl; optionally, wherein the antisense strand and the sense strand each comprise at least one modified nucleotide.

[0079] In some embodiments, the nucleotide comprising a modified nucleotide component represented by Formula (I) comprises a nucleobase represented by B1, wherein B1 is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof. In some embodiments, the nucleotide comprising a modified nucleotide component represented by Formula (II) comprises a nucleobase represented by B2, wherein B2 is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof. In some embodiments, each of B1 and B2 is independently selected from adenine, uracil, cytosine, and modified analogs thereof. In some embodiments, R1 is C1-6 alkyl. In some embodiments, R1 is -CH3. In some embodiments, B1 is uracil. In some forms, R1 is -CH3 and B1 is uracil. In some forms, B2 is adenine. In some forms, B2 is uracil.

[0080] In some embodiments, the sense strand comprises an inverted deoxyribonucleotide at the 3' end; optionally wherein the inverted deoxyribonucleotide is a 3'3' linked deoxythymidine. In some embodiments, the sense strand comprises an inverted deoxyribonucleotide at the 5' end and an inverted deoxyribonucleotide at the 3' end; optionally wherein the inverted deoxyribonucleotide at the 5' end is a 5'-5' linked deoxythymidine and the inverted deoxyribonucleotide at the 3' end is a 3'-3' linked deoxythymidine. In some embodiments, the sense strand comprises a nucleotide comprising the modified nucleotide component. Petition 870250080602, dated 08 / 09 / 2025, page 57 / 193 43 / 138 represented by Formula (I) at the 3' end; optionally where R1 is -CH3 and B1 is uracil.

[0081] In some embodiments, the modification includes one or more phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and boranephosphates with normal 3'-5' linkages, 2'-5' linked analogs of these with inverted polarity, wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0082] In some embodiments, the modified nucleotide includes at least one of the following: a 5'-vinyl phosphonate nucleotide, a 5'-phosphate or phosphate mimic, a blocked nucleic acid (LNA), a 2'-MOE (methoxyethyl)nucleotide, and / or a 2'-arabino fluoronucleotide (2'-araF). In some embodiments, the modified nucleotide antisense strand comprises a phosphate mimic at the 5' end; optionally, wherein the phosphate mimic is a 5'-E-vinyl-phosphonate or a 4'-O-phosphonate.

[0083] In some embodiments, the modified nucleotide comprises at least one of the following: a 2'-deoxy-2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a blocking nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate and / or a non-natural base comprising a nucleotide.

[0084] In some embodiments, the antisense strand and / or the sense strand comprise at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a linkage Petition 870250080602, dated 09 / 08 / 2025, p. 58 / 193 44 / 138 phosphorothioate, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranephosphate linkage. In some embodiments, the antisense strand and / or the sense strand comprise at least one nucleotide-modified linkage. In some embodiments, all nucleotide linkages in the antisense strand are modified linkages. In some embodiments, the antisense strand and / or the sense strand comprise at least one phosphorothioate (PS) linkage. Conjugates

[0085] Another modification of the present disclosure dsRNAs involves the chemical attachment to the dsRNA of one or more ligands or targeting groups or conjugates that increase the activity, cellular distribution, or cellular uptake of the dsRNA (e.g., a GalNAc from the present disclosure, e.g., tri-GalNAc6). Such moieties include, but are not limited to, lipid moieties, such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330;, Biochimie, 1993, 75:49-54), a phospholipid, for example, dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O. Petition 870250080602, dated 09 / 08 / 2025, p. 59 / 193 45 / 138 hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol ribbon (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmitic moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine moiety or hexylaminocarbonyloxycholesterol (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0086] In some embodiments, the linker or targeting moiety (e.g., a GalNAc of the present disclosure, e.g., tri-GalNAc6) is conjugated to the 5' end, 3' end, or both ends of the dsRNA. In some embodiments, the linker or targeting moiety (e.g., a GalNAc of the present disclosure, e.g., tri-GalNAc6) is conjugated to the 3' end of the sense strand of the dsRNA. In some embodiments, the linker or targeting moiety (e.g., a GalNAc of the present disclosure, e.g., tri-GalNAc6) is conjugated to the 3' end of the antisense strand of the modified dsRNA. In some embodiments, the linker or targeting moiety (e.g., a GalNAc of the present disclosure, e.g., tri-GalNAc6) is conjugated to the 5' end of the sense strand of the dsRNA.In some embodiments, the linker or targeting moiety (e.g., a GalNAc of the present disclosure, e.g., tri-GalNAc6) is conjugated to the 5' end of the antisense strand of the modified dsRNA. In some embodiments, the linker or targeting moiety is at least one N-acetylgalactosamine (GalNAc).

[0087] In some embodiments, dsRNA can be modified by a non-binding group. Several non-binding molecules have been conjugated to dsRNAs to increase activity, cellular distribution or Petition 870250080602, dated 09 / 08 / 2025, p. 60 / 193 46 / 138 Cellular uptake of dsRNA, and procedures for performing such conjugations are available in the scientific literature. These non-binding portions include lipid portions, such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic band, for example, dodecandiol or undecyl residues. (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, for example, dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol ribbon (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophysics. Acta, 1995, 1264:229), or an octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Typical conjugation protocols involve the synthesis of dsRNAs containing an amino ligand at one or more positions in the oligonucleotide sequence. The amino group then reacts with the molecule to be conjugated using appropriate coupling or activation reagents. The conjugation reaction can be carried out with the dsRNA still bound to the solid support or after cleavage of the dsRNA in the solution phase. The dsRNA conjugate can be purified, for example, by HPLC methods.

[0088] Conjugating a ligand to a dsRNA can increase its cellular uptake as well as its targeting to a specific tissue. Petition 870250080602, dated 08 / 09 / 2025, page 61 / 193 47 / 138 or uptake by specific cell types, such as liver cells. In certain cases, a hydrophobic ligand is conjugated to dsRNA to facilitate direct permeation of the cell membrane and / or absorption by liver cells. Alternatively, the ligand conjugated to dsRNA is a substrate for receptor-mediated endocytosis. These approaches have been used to facilitate the cellular permeation of antisense oligonucleotides as well as dsRNA agents. For example, cholesterol has been conjugated to various antisense oligonucleotides, resulting in compounds that are substantially more active compared to their unconjugated analogs. See M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103. Other lipophilic compounds that have been conjugated to oligonucleotides include 1-pyrenebutyric acid, 1,3-bis-O-(hexadecyl)glycerol, and menthol. An example of a ligand for receptor-mediated endocytosis is folic acid.Folic acid enters the cell via folate receptor-mediated endocytosis. Folic acid-containing dsRNA compounds would be efficiently transported into the cell via folate receptor-mediated endocytosis. Li et al. report that binding folic acid to the 3' terminus of an oligonucleotide resulted in an 8-fold increase in cellular uptake of the oligonucleotide. Li, S.; Deshmukh, HM; Huang, L. Pharm. Res. 1998, 15, 1.540. Other ligands that have been conjugated to oligonucleotides include polyethylene glycols, carbohydrate clusters, crosslinking agents, porphyrin conjugates, delivery peptides, and lipids such as cholesterol and cholesterylamine. Examples of carbohydrate clusters include Chol-p-(GalNAc)3 (N-acetylgalactosamine cholesterol) and LCO(GalNAc)3 (N-acetylgalactosamine - 3'-lithocholic-oleoyl). Carbohydrate Conjugates

[0089] In some embodiments, a disseminating dsRNA oligonucleotide also comprises a carbohydrate. The conjugated dsRNA Petition 870250080602, dated 09 / 08 / 2025, p. 62 / 193 48 / 138 with carbohydrate is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, carbohydrate refers to a compound that is a carbohydrate itself consisting of one or more monosaccharide units with at least 6 carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound that has as part of it a carbohydrate moiety consisting of one or more monosaccharide units, each with at least six carbon atoms (which may be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.Representative carbohydrates include sugars (mono-, di-, tri-, and oligosaccharides containing approximately 4, 5, 6, 7, 8, or 9 monosaccharide units) and polysaccharides, such as starches, glycogen, cellulose, and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8 sugars); di- and trisaccharides include sugars with two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0090] In some embodiments, a carbohydrate conjugate for use in the compositions and methods of disclosure is a monosaccharide. In some embodiments, the monosaccharide is N-acetylgalactosamine, of formula I or formula II, such as Formula 1 Petition 870250080602, dated 08 / 09 / 2025, page 63 / 193 49 / 138 Formula II.

[0091] In some embodiments, a carbohydrate is conjugated to the 5' end, 3' end, or both ends of the modified dsRNA. In some embodiments, the linker or targeting portion is conjugated to the 3' end of the sense strand of the modified dsRNA. In some embodiments, the linker or targeting portion is conjugated to the 3' end of the antisense strand of the modified dsRNA. In some embodiments, the carbohydrate is at least one N-acetylgalactosamine (GalNAc). III. Pharmaceutical Compositions

[0092] Pharmaceutical compositions comprising INHBE genes that target dsRNAs for disclosure are also disclosed here.

[0093] In certain embodiments, the disclosure provides pharmaceutical compositions containing a dsRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the dsRNA is useful for treating a disease or disorder associated with the expression or activity of targeting INHBE genes, such as pathological processes mediated by targeting INHBE gene expression. Such pharmaceutical compositions are formulated based on the mode of administration.

[0094] The pharmaceutical compositions presented here are administered in dosages sufficient to inhibit the expression of INHBE genes. Petition 870250080602, dated 08 / 09 / 2025, page 64 / 193 50 / 138

[0095] Those skilled in the art will recognize that certain factors may influence the dosage and time required to treat an individual effectively, including, but not limited to, the severity of the disease or disorder, prior treatments, the individual’s general health and / or age, and other present illnesses. Furthermore, treatment of an individual with a therapeutically effective amount of a composition may involve a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual dsRNAs covered by the disclosure may be made using conventional methodologies or based on in vivo testing using an appropriate animal model, as described elsewhere in this document.

[0096] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes mediated by INHBE expression. Such models are used for in vivo testing of dsRNA, as well as to determine a therapeutically effective dose. A suitable mouse model is, for example, a mouse containing a plasmid that expresses human INHBE. Another suitable mouse model is a transgenic mouse carrying a transgene that expresses human INHBE.

[0097] Data obtained from cell culture assays and animal studies can be used in formulating a range of dosages for human use. The dosage of the compositions presented in the disclosure is generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending on the dosage form employed and the route of administration used. For any compound used in the methods presented in the disclosure, the therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated Petition 870250080602, dated 08 / 09 / 2025, page 65 / 193 51 / 138 in animal models to achieve a circulating plasma concentration range of the compound or, where appropriate, the polypeptide product of a target sequence (e.g., achieving a reduced concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound that achieves a half-maximum inhibition of symptoms) as determined in cell culture. This information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0098] The dsRNAs presented in this disclosure can be administered in combination with other agents known to be effective in treating pathological processes mediated by INHBE gene expression. In any case, the attending physician may adjust the amount and timing of dsRNA administration based on observed results using standard efficacy measures known in the art or described herein. Liposomal Formulations

[0099] In certain embodiments, the pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions, including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[00100] In some embodiments, the dissemination dsRNA is introduced into pre-formed liposomes or lipoplexes made of mixtures of cationic and neutral lipids. In certain methods, dsRNA complexes with mono- or polycationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to enhance the distribution of a pharmacist. Petition 870250080602, dated 08 / 09 / 2025, page 66 / 193 52 / 138 pharmaceutical to a specific cell or tissue. In certain embodiments, a lipid moiety is selected to increase the distribution of a pharmaceutical agent to adipose tissue. In certain embodiments, a lipid moiety is selected to increase the distribution of a pharmaceutical agent to muscle tissue. Excipients

[00101] In certain embodiments, the pharmaceutical composition comprises an excipient. In contrast to a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, bearing in mind the planned mode of administration, so as to provide the desired volume, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone, or hydroxypropylmethylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylates, or calcium hydrogen phosphate, etc.).); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[00102] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acids may also be used to formulate the compositions of this disclosure. Vehicle Petition 870250080602, dated 08 / 09 / 2025, page 67 / 193 53 / 138 Pharmaceutically acceptable suitable substances include, but are not limited to, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[00103] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or nucleic acid solutions in liquid or solid oil bases. Solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acids may be used.

[00104] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. Other Components

[00105] The compositions of this disclosure may additionally contain other auxiliary components conventionally found in pharmaceutical compositions, at their levels of use established in the art. Thus, for example, the compositions may contain compatible additional pharmaceutically active materials, such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in the physical formulation of various dosage forms of the compositions of this disclosure, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components. Petition 870250080602, dated 08 / 09 / 2025, page 68 / 193 54 / 138 of the compositions of this disclosure. The formulations may be sterilized and, if desired, mixed with auxiliary agents, for example, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to influence osmotic pressure, buffers, colorants, flavorings and / or aromatic substances and the like that do not interact in a harmful way with the nucleic acid(s) of the formulation.

[00106] Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. Administration

[00107] Methods of administration for pharmaceutical compositions and formulations, including dsRNA compositions and pharmaceutical compositions of disclosure, are also disclosed here. In some embodiments, the dsRNA composition or pharmaceutical composition of disclosure is administered in various ways, depending on whether the treatment is local or systemic and the area to be treated.

[00108] In certain embodiments, the administration of the pharmaceutical composition is topical (including buccal and sublingual), pulmonary, for example, by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. In some embodiments, parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, for example, intraparenchymal, intrathecal or intraventricular administration.

[00109] Pharmaceutical compositions containing a disclosure dsRNA may be presented in a dosage unit form and may be prepared by any suitable method. A pharmaceutical composition must be formulated to be compatible with Petition 870250080602, dated 08 / 09 / 2025, page 69 / 193 55 / 138 the intended route of administration. Useful formulations can be prepared by methods well known in pharmaceutical art. For example, see Remington's Pharmaceutical Sciences, 18th edition. (Mack Publishing Company, 1990).

[00110] Pharmaceutical formulations, for example, are sterile. Sterilization can be carried out, for example, by filtration through sterile filtration membranes. When the composition is lyophilized, sterilization by filtration can be conducted before or after lyophilization and reconstitution.

[00111] In certain modalities, dsRNA is administered in a way that targets a specific tissue, for example, the liver.

[00112] The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated and the specific mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be the amount of the compound (e.g., dsRNA molecule) that produces a therapeutic effect.

[00113] In certain embodiments, a formulation of the present disclosure comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle-forming agents, for example, bile acids, and polymeric carriers, for example, polyesters and polyanhydrides; and a compound (for example, a dsRNA molecule) of the present disclosure. In certain embodiments, a formulation mentioned above makes a compound (for example, a dsRNA molecule) of the present disclosure orally bioavailable.

[00114] The formulations of the dissemination suitable for oral administration may be in the form of capsules, tablets, pills, lozenges (using a flavored base, usually sucrose and acacia or tragacanth), powders, granules or as a solution. Petition 870250080602, dated 08 / 09 / 2025, page 70 / 193 56 / 138 or suspension in an aqueous or non-aqueous liquid, or as a liquid oil-in-water or water-in-oil emulsion, or as an elixir or syrup, or as lozenges (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and / or as mouthwashes and the like, each containing a predetermined amount of a compound (e.g., dsRNA molecule) of the present disclosure as the active ingredient. A compound (e.g., dsRNA molecule) of the present disclosure may also be administered as a bolus, electurium, or paste.

[00115] Liquid pharmaceutical forms for oral administration of the compounds (e.g., dsRNA molecules) of the disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. IV. Methods for Inhibiting the Expression of an INHBE Gene

[00116] In one aspect, the disclosure provides a method for inhibiting the expression of an INHBE gene in a cell. The method comprises delivering a dsRNA targeted to an INHBE gene into a cell so that the expression of the target INHBE gene in the cell is reduced. The disclosure includes methods performed on cells in vitro or in vivo. In some embodiments, the method is performed on an animal cell, for example, a mouse, a rat, a non-human primate, or a human.

[00117] This disclosure also provides methods for using a dsRNA from the disclosure and / or a composition containing a dsRNA from this disclosure to reduce and / or inhibit INHBE expression in a cell. The methods include contacting the cell with a dsRNA from the disclosure and maintaining the cell for a sufficient time to achieve degradation of the mRNA transcript of an INHBE gene, thereby inhibiting INHBE gene expression in the cell. The reduction in gene expression can be assessed by any co- Petition 870250080602, dated 08 / 09 / 2025, page 71 / 193 57 / 138 known in the art. For example, a reduction in INHBE expression can be determined by determining the mRNA expression level of INHBE using routine methods for a specialist in the field, for example, Northern blotting, qRT-PCR, determining the protein level of INHBE using routine methods for a specialist in the field, such as Western blotting, immunological techniques and / or determining a biological activity of INHBE, such as affecting one or more molecules associated with the cellular blood coagulation mechanism (or in an in vivo setting, blood coagulation itself).

[00118] In the methods of dissemination, the cell can be contacted in vitro or in vivo, that is, the cell can be inside an individual.

[00119] A cell suitable for treatment using the disclosure methods can be any cell that expresses an INHBE gene. A cell suitable for use in the disclosure methods can be a mammalian cell, for example, a primate cell (such as a human cell or a non-human primate cell, for example, a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster cell, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (for example, a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, for example, a human liver cell.

[00120] In some embodiments, INHBE expression is inhibited by at least 30% compared to a control after administration of the disseminating dsRNA oligonucleotide.

[00121] In some modalities, a treatment method of a Petition 870250080602, dated 08 / 09 / 2025, page 72 / 193 58 / 138 INHBE-mediated disorder is provided, comprising administering to an individual in need of such treatment a therapeutically effective amount of a dsRNA oligonucleotide or a pharmaceutical disclosure composition.

[00122] In some modalities, the disorder is a cardiovascular disorder. In some modalities, the disorder is a cardiovascular disease. EXAMPLES

[00123] The following examples are provided for the purpose of illustrating various embodiments of the disclosure and are not intended to limit the present disclosure in any way. The examples presented, together with the methods described herein, are currently representative of preferred embodiments, are exemplary, and are not intended to be limitations on the scope of the disclosure. Changes herein and other uses that are covered by the spirit of the disclosure, as defined by the scope of the claims, will occur to those skilled in the art. Example 1. Screening for in vitro RNA interference (RNAi) in the Huh-7 cell line.

[00124] This example describes a screening for siRNA-based inhibition of the INHBE gene in a hepatocyte-derived cellular carcinoma (Huh-7) cell model. Briefly, Huh-7 cells were transfected with 147 3'-GalNAc-conjugated and modified siRNAs (Duplexes 100488 - 100634, SEQ ID NOs: 294 - 440, sense strand; and SEQ ID NOs: 441- 587, antisense strand) at 10 nM and 0.1 nM. The sequences of exemplary, unmodified, and modified siRNA compounds are shown in Table 1 and Table 2, respectively. Compounds in Table 2 were 3'-GalNAc modified. INHBE mRNA levels were measured by quantitative PCR and normalized for GAPDH relative to treated control cells. Petition 870250080602, dated 08 / 09 / 2025, page 73 / 193 59 / 138 simulated. Table 3 and FIG. 1A, B and C show the results of single-dose screenings at 10 nM and 0.1 nM in Huh7 cells using the selected INHBE siRNAs. Data are presented as percentage of INHBE mRNA inhibition in siRNA-transfected cells relative to INHBE mRNA in sham-treated control cells. Table 1. Unmodified INHBE siRNA sequences Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position at NM_031479.5 (SEQ ID NO: 588) GGGUCAAGCAC AGCUAUCCAU 1 AUGGAUAGCU GUGCUUGACC CUC 147 23 CACAGCUAUCC AUCAGAUGAU 2 AUCAUCUGAU GGAUAGCUGU GCU 148 31 CAGCUAUCCAU CAGAUGAUCU 3 AGAUCAUCUG AUGGAUAGCU GUG 149 33 AGCUAUCCAUC AGAUGAUCUA 4 UAGAUCAUCU GAUGGAUAGC UGU 150 34 CUAUCCAUCAG AUGAUCUACU 5 AGUAGAUCAU CUGAUGGAUA GCU 151 36 UAUCCAUCAGA UGAUCUACUU 6 AAGUAGAUCA UCUGAUGGAU AGC 152 37 CCAUCAGAUGA UCUACUUUCA 7 UGAAAGUAGA UCAUCUGAUG GAU 153 40 CUACUUUCAGC CUUCCUGAGU 8 ACUCAGGAAG GCUGAAAGUA GAU 154 52 Petition 870250080602, of 08 / 09 / 2025, p. 74 / 193 60 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GACAAUAGAAG ACAGGUGGCU 9 AGCCACCUGU CUUCUAUUGU CUG 155 77 GCAGUGGUCAGUCAGUCAGUCAGUCAGCAGUG GACACCACUG CCA 156 123 CUCAUUGGCCC CCAGCAAUCA 11 UGAUUGCUGG GGGCCAAUGA GGG 157 149 CUCCUGUGGG GGCUCCAAACU 12 AGUUUGGAGC CCCCACAGGA GGG 158 31GAGAGCAAG GGCUA13 UUGCUGCUUG GCUAGCUCCA GCA 159 360 UGGAGCUAGCC AAGCAGCAAA 14 UUUGCUGCUU GGCUAGCUCC AGC 160 361 GGAGCUAGCCA AGCAGCAAAU 15 AUUUGCUGCU UGGCUAGCUC CAG 1621 AAGCCAA GCAAGCCAA 161 GAUUUGCUGC UUGGCUAGCU CCA 162 363 AGCUAGCCAAG CAGCAAAUCC 17 GGAUUUGCUG CUUGGCUAGC UCC 163 364 GCUAGCCAAGC AGCAAAUCCU 18 AGGAUUUGCU GCUUGGACUAG CUC 164 UAGCUAGCCAGCAAGCAAGCA 19 CCAGGAUUUG CUGCUUGGCU AGC 165 367 Petition 870250080602, of 08 / 09 / 2025, p. 75 / 193 61 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GCCAAGCAGCA AAUCCUGGAU 20 AUCCAGGAUU UGCUGCUUGG 2 CUAA166 UCCGACCAU 36 UUAUUCUGGG AGG 167 400 CHANGE GGAACCUGGUC UCA 168 402 CHANGE AUUCUGGGAC 23 CHANGE AUUCGGGAC869CCGAC0 CUCC0 G4 GAC 24 UCCGGAGGGC UCUGGUCAGC GCU 170 442 GCUGACCAGAG CCCUCCGGAG 25 CUCCGGAGGG CUCUGGUCAG CGC 171 443 CUGACCAGAGC CCUCCGGAGA 26 UCUCCGGAGG GCUCCCG4CCUGGAUCGA4 GCG4 27 GUCUCCGGAG GGCUCUGGUC AGC 173 445 GACCAGAGCCC UCCGGAGACU 28 AGUCUCCGGA GGGCUCUGG UCAG 174 446 ACCAGAGCCCU CCGGAGACUA 29 UAGUCUCCGG AGGGGCUGGG AGGGCUGGG 1AG4UCA4 AGGAGGUCAU 30 AUGACCUCCU CCCCAUUCCC UGG 176 488 Petition 870250080602, dated 08 / 09 / 2025, p. 76 / 193 62 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) AGGAGGUCAUC AGCUUUGCUA 31 UAGCAAAGCU GAUGACCUCC UCC 177 499 GAGGUCAAGCUAGCAUCACUAGUACUACU2 CUGAUGACCU CCU 178 501 GCUUUGCUACU GUCACAGACU 33 AGUCUGUGAC AGUAGCAAAG CUG 179 511 CGGUCCCACCA CCUGUACCAU 34 AUGGUACAGG UGGUGGGACC GAG 180 579 GGUCCACCAGUGCACUGCAGUGCAGUG35 GUGGUGGGA CCGA 181 580 GUCCCACCACC UGUACCAUGC 36 GCAUGGUACA GGUGGUGGG ACCG 182 581 UCCCACCACCU GUACCAUGCC 37 GGCAUGGUAC AGGUGGUGG GACC 183 5ACCAACCCAG UGCCAUG383 GGGCAUGGUA CAGGUGGUG GGAC 184 583 CCACCACCUGU ACCAUGCCCG 39 CGGGCAUGGU ACAGGUGGUG GGA 185 584 CACCACCUGUA CCAUGCCCGC 40 GCGGGCAUG GUACAGGUGG UGGGGGUACCGU855 CAUGCCCGCC 41 GGCGGGCAU GGUACAGGUG GUGG 187 586 Petition 870250080602, of 08 / 09 / 2025, p. 77 / 193 63 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) CCACCUGUACC AUGCCCGCCU 42 AGGCGGGCAU GGUACAGGUG GUG 188 587 CACACCU UGCCA GGCGGGGG34 UGGUACAGGU GGU 189 588 CCACCCUUCCU GGCACUCUUU 44 AAAGAGUGCC AGGAAGGGUG GGG 190 625 CCCUUCCUGGC ACUCUUUGCU 45 AGCAAAGAGU GCCAGGAAGG GUG 191 628 UGCAAGAUGCAUGAUGGCUGCUUG46 AUCCUCAAGC AAAGAGUGCC AGG 192 635 GCACUCUUUGC UUGAGGAUCU 47 AGAUCCUCAA GCAAAGAGUG CCA 193 637 CACUCUUUGCU UGAGGAUCUU 48 AAGAUCCUCA AGCAAAGAGU GCC 194 CGUGAUCGUGA 49 UCUCACCCCU CAAGCCACUA GAG 195 754 GGCUUGAGGG GUGAGAAGUCU 50 AGACUUCUCA CCCCUCAAGC CAC 196 759 GAAGUCUGGUG UCCUGAAACU 51 AGUUUCAGGA CACCAGACUU CUC 19727277272727272727272727272727272727272727272727 UGAACUGA AGUUUCAGGA UCCUGAAAGC CAC AGUUGCAGUU UCAGGACACC AGA 198 779 Petition 870250080602, of 08 / 09 / 2025, p. 78 / 193 64 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GGUGUCCUGAA ACUGCAACUA 53 UAGUUGCAGU UUCAGGACAC CAG 199 780 CAGCCCUAGCUAGCUAGUA 54CUAGUA AGGAAGGGCU GCU 200 876 GCCCUUCCUAG AGCUUAAGAU 55 AUCUUAAGCU CUAGGAAGGG CUG 201 878 GAGCUUAAGAU CCGAGCCAAU 56 AUUGGCUCGG AUCUUAAGCU CUA 202 888 CAGGUAGGA AUCCUCU77 UCCUGGAAGU CUACGUAAUG GUC 203 983 CCCGAGGGGUA CCAGCUGAAU 58 AUUCAGCUGG UACCCCUCGG GCU 204 1032 CGAGGGGUACC AGCUGAAUUA 59 UAAUUCAGCU GGUACCCCUC052034GGUACCUC AAUUACUGCA 60 UGCAGUAAUU CAGCUGGUAC CCC 206 1039 GUACCAGCUGA AUUACUGCAG 61 CUGCAGUAAU UCAGCUGGUA CCC 207 1040 UACCAGCUGAA UUACUGCAGU 62 ACUGCAGUAA UUCAGGUAA 10418GAGUA ACCAGCUGAAU UACUGCAGUG 63 CACUGCAGUA AUUCAGCUGG UAC 209 1042 Petition 870250080602, of 08 / 09 / 2025, p. 79 / 193 65 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) CCAGCUGAAUU ACUGCAGUGG 64 CCACUGCAGU AAUUCAGCUG GUA 210 UAG5CAGUGAC1044 GCCCACUGCA GUAAUUCAGC UGG 211 1045 GCUGAAUUACU GCAGUGGGCA 66 UGCCCACUGC AGUAAUUCAG CUG 212 1046 CUGAAUUACUG CAGUGGGCAG 67 CUGCCCACUG 1CAGUAAUCAU3 GGGCAGUGCC 68 GGCACUGCCC ACUGCAGUAA UUC 214 1051 GGCAUUGCUGC CUCUUCCAU 69 AUGGAAAGAG GCAGCAAUGC CUG 215 1095 GCAUUGCUGCC UCUUUCCAUGA261CAUGAU 70 GGCAUGAUGAU CUCUUUCCAUU CURRICULUM 71 AAGACGGCAG AAUGGAAAGA GGC 217 1106 UCAGCCUCCUC AAAGCCAACA 72 UQUGGCUUU GAGGAGGGCUG AAG 218 1126 CAGCCAUCUCA A2CUT9CUT 73 1127 UCCUCAAAGCC AACAAUCCUU 74 AAGGAUUGUU GGCUUUGAGG AGG 220 1132 Petition 870250080602, dated 08 / 09 / 2025, p. 80 / 193 66 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) UCUCUCCUCUA CCUGGAUCAU 75 AUGAUCCAGG UAGAGGAGAG AGA 221 1200 UCUCCAC UUAGAUCAUGAUCAUGAUCAU76 GGUAGAGGAG AGA 222 1202 CUCCUCUACCU GGAUCAUAAU 77 AUUAUGAUCC AGGUAGAGGA GAG 223 1203 UACCUGGAUCA UAAUGGCAAU 78 AUUGCCAUUA UGAUCCAGGU AGA 224 1209 CUCCUCUACCU GGAUCAUAU 77 ACAUUGCCAU UAUGAUCCAG GUA 225 1211 AUCAUAAUGGC AAUGUGGUCA 80 UGACCACAUU GCCAUUAUGA UCC 226 1216 UCAUAAUGGCA AUGUGGUCAA 81 UUGACCACAU UGCAU2221UAGCUAGAA7 UGUGGUCAAG 82 CUUGACCACA UUGCCAUUAU GAU 228 1218 AUAAUGGCAAU GUGGUCAAGA 83 UCUUGACCAC AUUGCCAUUA UGA 229 1219 UAAUGGCAAUG UGGUCAAGAC 84 GUCUUGACCA CAUGCAUGCAUGCAU303 1220 AAUGGCAAUGU GGUCAAGACG 85 CGUCUUGACC ACAUUGCCAU UAU 231 1221 Petition 870250080602, of 08 / 09 / 2025, p. 81 / 193 67 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position at NM_031479.5 (SEQ ID NO: 588) CAAUGUGGUCA AGACGGAUGU 86 ACAUCCGUCU UGACCACAUU GCC CAUCCGUCUU GAC 233 1235 GAGGCCUGUG GCUGCAGCUAG 88 CUAGCUGCAG CCACAGGCCU CCA 234 1263 AGGCCUGUGGC UGCAGCUAGC 89 GCUAGCUGCA GCCACAGGCC 295 UCC 29AG 12AGGCUGC4 GGCACAG AGCCACAGGC CUC 236 1265 GCCUGUGGCU GCAGCUAGCAA 91 UUGCUAGCUG CAGCCACAGG CCU 237 1266 CCUGUGGCUGC AGCUAGCAAG 92 CUGCUAGCU GCAGCCACAG GCC 238 GCCGAAA96AAUU 12 CCC 239 1298 CAACACCUGG CAAUAUGACU 94 AGUCAUAUUG CCAGGUGGUU GUU 240 1389 UGAGUCAUAU UGCCAGCUGGGG3921CAUCAGUGG CAUAUGACUGG 96 AGUGAGUCAU AUUGCCAGGU GGU 242 1393 Petition 870250080602, dated 08 / 09 / 2025, p. 82 / 193 68 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GGACCCAAAUG GGCACUUUCU 97 AGAAAGUGCC CAUUUGGGUCUCCCA 245 CAUGUGCC AAUUCU214 BACKGROUND GCCCAUUUGG GUC 244 1428 CAAAUGGGCAC UUUCUUGCU 99 CAUGGGGCAC UUUCUUUUU GGG 245 1430 GGCAUUUGAC CUT 100 CAUGCAUUGG 4CAU3AAGUGC6 CONNECTIONS 101 CONNECTIONS GCC 247 1438 CONNECTIONS CONNECTIONS GAA 248 1444 CONNECTIONS AGAAAAAAUUA 1049U CONNECTIONS10 GGGAAGGCAGA GAAAAAUUAC 104 GUAAUUUUUC UCUGCCUUCC CUC 250 1587 ACCCUCUCCCA AGAUGAGAAA 105 UUUCUCAUCU UGGGAGAGGC UAA 251 1610 CCUCUCCCAAG AUGAGAAUUUC25CUC10 1612 CUCKAGAGAUG AGAAAGUCUCU 107 COMMERCIAL COMMUNICATIONS GAG 253 1615 Petition 870250080602, dated 08 / 09 / 2025, p. 83 / 193 69 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GGGGAGGAGG AAGCAGAUAGA 108 UCUAUCUGCU UCCUCCUCCC CUC 2354 GGAGAUG 16 AUCUAUCUGC UUCCCUCCC CCU 255 1644 HOUSEHOLDING CCU 110 HOUSING HOUSING GGG 256 1786 HOUSING HOUSEHOLDING 111 HOUSEHOLDING AGCA81CC1CCUAGUG7 ACAAGCAUUU 112 AAAUGCUUGU CUCCCAGUGG GUC 258 1855 CCACUGGGAGA CAAGCAUUA 113 UAAAUGCUUG UCUCCCAGUG GGU 259 1856 ACUGGGAGACA ACCAUUUUAUA 26 UAUGAUCAUA 16 UAUGAUCAUA 1858 UGGGAGACAAG CAUUUAUACU 115 AGUAUAAAUG CUUGUCUCCC AGU 261 1860 GGGAGACAAGC AUUUAUACUU 116 AAGUAUAAAU CAUUUAUACU CAG 262 1861 GAUUGAAGAUUUUUUUUUU AAAUGCUUGU CUC 263 1865 GAGCCACCGCG CCUGGCUUAU 118 AUAAGCCAGG CGCGGUGGC UCAC 264 2153 Petition 870250080602, dated 08 / 09 / 2025, p. 84 / 193 70 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) CCACCGCGCCU GGCUUAUACU 119 AGUAUAAGCC AGGGCGGU GGCU 265 2156 ACCUGUG AAAGUAUAAG CCAGGCGCGG UGG 266 2158 CGCGCCUGGCU UAUACUUUCU 121 AGAAAGUAUA AGCCAGGCGC GGU 267 2160 GCGCCUGGCUU AUACUUUCUU 122 AAGAAAGUAU AAGCCAGGGC26 CGGCU18 GGCCU1216 UACUUUCUUA 123 UAAGAAAGUA UAAGCCAGGC GCG 269 2162 GCCUGGCUUAU ACUUUCUUAA 124 UUAAGAAAGU AUAAGCCAGG CGC 270 2163 CCUGGCUUAUA CUUUCUUAAU 125 AUAGAAAGAG1247 GUAAG UGGCUUAUACU UUCUUAAAUAA 126 UUAUUAAGAA AGUAUAAGCC AGG 272 2166 GGCUUAUACUU UCUUAAUAAA 127 UUUAUUAAGA AAGUAUAAGC CAG 273 2167 CUUAUACUUUC UUAUAAAAA 128 UAGUAUAUAAGUAAGUAA 274 2169 AGGGGUGUCCA CAAAGUCAAA 129 UUUGACUUUG UGGACACCCC UGA 275 2296 Petition 870250080602, of 08 / 09 / 2025, p. 85 / 193 71 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) GGGGUGUCCAC AAAGUCAAAG 130 CUUUGACUUU GUGGACACCC CUG 276 2297 UCAUAAUAAUA CUAACAUGUU 131 AACAUGUUAG UAUUAUUAUG AAA 277 2324 ACUAACAUGUU AUUUGCCUUU 132 AAAGGCAAAU AACAUGUUAG UAU 278 2334 GUUAUUUGCCU UUUGAAUUCU 133 AGAAUUCAAA AGGCAAAUAA CAU 279 2342 UGCCUUUUGAA UUCUCAUUAU 134 AUAAUGAGAA UUCAAAAGGC AAA 280 2349 283 2351 UGAAUUCUCAU UAUCUUAAAA 138 UUUUAAGAUA AUGAGAAUUC AAA 284 2355 GAAUUCUCAUU AUCUUAAAAU 139 AUUUUAAGAU AAUGAGAAUU CAA 285 2356 CCGUGUGACAU GUGAUUACAU 140 AUGUAAUCAC AUGUCCACACG GCC 286 2400 Petition 870250080602, dated 08 / 09 / 2025, page 86 / 193 72 / 138 Sense 5'-3' SEQ ID NO: Antisense 5'3' SEQ ID NO: Position in NM_031479.5 (SEQ ID NO: 588) UGUGACAUGUG AUUACAUCAU 141 AUGAUGUAAU CACAUGUCAC ACG 287 2403 UGACAUGUGAU UACAUCAUCU 142 AGAUGAUGUA AUCACAUGUC ACA 288 2405 GACAUGUGAUU ACAUCAUCUU 143 AAGAUGAUGU AAUCACAUGU CAC 289 2406 UCUUUCUGACA UCAUUGUUAA 144 UUAACAAUGA UGUCAGAAAG AUG 290 2423 CUUUCUGACAU CAUUGUUAAU 145 AUUAACAAUG AUGUCAGAAA GAU 291 2424 GACAUCAUUGU UAAUGGAAUG 146 CAUUCCAUUA ACAAUGAUGU CAG 292 2430 GUUAAUGGAAU GUGUGCUUGU 147 ACAAGCACAC AUUCCAUUAA CAA 293 2439 Table 2. Modified GalNAc sense and antisense strand sequences conjugated with 3'-GalNAc targeting INHBE mRNA. Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100488 g*g*gucaAgCACa gcuauccau 294 a*U*ggaUaGCug ugCuUgaccc*u*c 441 100489 c*a*cagcUaUCCa ucagaugau 295 a*U*cauCuGAug gaUaGcugug*c*u 442 100490 c*a*gcuaUcCAUc agaugaucu 296 a*G*aucAuCUga ugGaUagcug*u*g 443 Petition 870250080602, dated 09 / 08 / 2025, p. 87 / 193 73 / 138 Duplex name Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100491 a*g*cuauCcAUCa gaugaucua 297 u*A*gauCaUCug auGgAuagcu*g*u 444 100492 A*CAuCA ugaucuacu 298 a*G*uagAuCAuc ugAuGgauag*c*u 445 100493 u*a*uccaUcAGAu gaucuacuu 299 a*A*guaGaUCau cuGaUggaua*g*c 446 100494 c*c*aucaGaucau3 u*G*aaaGuAGau caUcUgaugg*a*u 447 100495 c*u*acuuUcAGCc uuccugagu 301 a*C*ucaGgAAgg cuGaAaguag*a*u 448 100496 g*a*caauAgAAGGa caggu202CagucGucUc uuCuAuuguc*u*g 449 100497 g*c*agugGuGUC ugcugucacu 303 a*G*ugaCaGCag acAcCacugc*c*a 450 100498 c*u*cauuGgCCCc cagcaauca 304 u*G*GauGugg*c*c*c 451 100499 c*u*ccugUgGGGg cuccaaacu 305 a*G*uuuGgAGcc ccCaCaggag*g*g 452 100500 c*u*ggagCuAGCc aagcagcaa 306 u*U*gcuGcUggCuccag*a*c*a535 100501 u*g*gagcUaGCCa agcagcaaaa 307 u*U*ugcUgCUug gcUaGcucca*g*c 454 100502 g*g*agcuAgCCAa gcagcaaau 308 a*U*uugCuGCuu ggCuAg*cug*0450550 g*a*gcuaGcCAAg cagcaaauc 309 g*A*uuuGcUGcu ugGcUagcuc*c*a 456 100504a*g*cuagCcAAGc agcaaaucc 310 g*G*auuUgCUgc uuGgCuagcu*c*c 457 100505 g*c*uagcCaAGCa gcaaauccu 311 a*G*gauUuGCug cuUgGcuagc*u*c 458 100506 u*a*gccaAgCAGc aaauccugg 312 c*C*aggAuUUgc ugCuUggcua*g*c 459 Petition 870250080602, dated 09 / 08 / 2025, p. 88 / 193 74 / 138 Duplex name Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100507 g*c*caagCaGCAa auccuggau 313 a*U*ccaGgAUuu gcUgCuuggc*u *a 460808 GucG*Cacca ccagaauaa 314 u*U*auuCuGGga cgAcUgguca*g*g 461 100509 a*c*caguCgUCCc agaauaacu 315 a*G*uuaUuCUgg gaCgAcuggu*c*a 462 100510 c*g*g*ucc a*G*gauGaGUua uuCuGggacg*a*c 463 100511 c*g*cugaCcAGAg cccuccgga 317 u*C*cggAgGGcu cuGgUcagcg*c*u 464 100512 g*c*ugacCaGAGc ccu18GGGGGGGCC ucUgGucagc*g*c 465 100513 c*u*gaccAgAGCc cuccggaga 319 u*C*uccGgAGgg cuCuGgucag*c*g 466 100514 u*g*accaGaGCCc uccggagac 320 g*UgGA*cUggc*c*c*c*g 467 100515 g*a*ccagAgCCCu ccggagacu 321 a*G*ucuCcGGag ggCuCugguc*a*g 468 100516 a*c*cagaGcCCUc cggagacua 322 u*A*gucUcCGga ggGcGc*c*10404010 a*g*ggaaUgGGG aggaggucau 323 a*U*gacCuCCuc ccCaUucccu*g*g 470 100518 a*g*gaggUcAUCa gcuuugcua 324 u*A*gcaAaGCug auGaCcuccu*c *c 4711019A*aGc uuugcuacu 325 a*G*uagCaAAgc ugAuGaccuc*c*u 472 100520g*c*uuugCuACUg ucacagacu 326 a*G*ucuGuGAca guAgCaaagc*u*g 473 100521 c*g*guccCaCCAc cuguaccau 327 a*U*gguAcAGgu ggUgGgaccg*a*g 474 10cc AC022 g*c*c*c*c uguaccaug 328 c*A*uggUaCAgg ugGuGggacc*g*a 475 Petition 870250080602, of 08 / 09 / 2025, p. 89 / 193 75 / 138 Duplex name Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100523 g*u*cccaCcACCu guaccaugc 329 g*C*augGuACag guGgUgggac*g 476 1052 C*c*c*c*c uaccaugcc 330 g*G*cauGgUAca ggUgGuggga*c*c 477 100525 c*c*caccAcCUGu accaugccc 331 g*G*gcaUgGUac agGuGguggg*a*c 478 100526 c*c*accaCc c*G*ggcAuGGua caGgUggugg*g*a 479 100527 c*a*ccacCuGUAc caugcccgc 333 g*C*gggCaUGgu acAgGuggug*g*g 480 100528 a*c*caccUgUACccc augccc g344G*Gcggc uaCaGguggu*g*g 481 100529 c*c*accuGuACCa ugcccgccu 335 a*G*gcgGgCAug guAcAggugg*u*g 482 100530 c*a*ccugUaCCAu gcccgccug 336 c*A*GGGGGGG* 483 100531 c*c*acccUuCCUg gcacucuuu 337 a*A*agaGuGCca ggAaGggugg*g*g 484 100532 c*c*cuucCuGGCa cucuuugcu 338 a*G*caaAgAGug ccAgGa*g*0453853 u*g*gcacUcUUUg cuugaggau 339 a*U*ccuCaAGca aaGaGugcca*g*g 486 100534 g*c*acucUuUGCu ugaggaucu 340 a*G*aucCuCAag caAaGagugc*c *a 487 c*0535 c*aGugcca*cucucu gaggaucuu 341 a*A*gauCcUCaa gcAaAgagug*c*c 488 100536c*u*agugGcUUGa ggggugaga 342 u*C*ucaCcCCuc aaGcCacuag*a*g 489 100537 g*g*cuugAgGGG ugagaagucu 343 a*G*acuUcUCac ccCuCaagcc*a*c 490 100538 g*a*agucUgGUG uccugaaacu 344 a*G*uuuCaGGac acCaGacuuc*u*c 491 Petition 870250080602, dated 08 / 09 / 2025, pp. 90 / 193 76 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100539 u*g*guguCcUGAa acugcaacu 345 a*G*uugCaGUuu caGgAcacca*g*a 492 100540 g*g*ugucCuGAAa cugcaacua 346 u*A*guuGcAGuu ucAgGacacc*a*g 493 100541 c*a*gcccUuCCUa gagcuuaag 347 c*U*uaaGcUCua ggAaGggcug*c*u 494 100542 g*c*ccuuCcUAGa gcuuaagau 348 a*U*cuuAaGCuc uaGgAagggc*u*g 495 100543 g*a*gcuuAaGAUc cgagccaau 349 a*U*uggCuCGga ucUuAagcuc*u*a 496 100544 c*c*auuaCgUAGa cuuccagga 350 u*C*cugGaAGuc uaCgUaaugg*u*c 497 100545 c*c*cgagGgGUAc cagcugaau 351 a*U*ucaGcUGgu acCcCucggg*c*u 498 100546 c*g*agggGuACCa gcugaauua 352 u*A*auuCaGCug guAcCccucg*g*g 499 100547 g*g*uaccAgCUGa auuacugca 353 u*G*cagUaAUuc agCuGguacc*c*c 500 100548 g*u*accaGcUGAa uuacugcag 354 c*U*gcaGuAAuu caGcUgguac*c*c 501 100549 u*a*ccagCuGAAu uacugcagu 355 a*C*ugcAgUAau ucAgCuggua*c*c 502 100550 a*c*cagcUgAAUu acugcagug 356 c*A*cugCaGUaa uuCaGcuggu*a*c 503 100551 c*c*agcuGaAUUa cugcagugg 357 c*C*acuGcAGua auUcAgcugg*u*a 504 100552a*g*cugaAuUACu gcagugggc 358 g*C*ccaCuGCag uaAuUcagcu*g*g 505 100553 g*c*ugaaUuACUg cagugggca 359 u*G*cccAcUGca guAaUucagc*u*g 506 100554 c*u*gaauUaCUGc agugggcag 360 c*U*gccCaCUgc agUaAuucag*c*u 507 Petition 870250080602, dated 08 / 09 / 2025, pp. 91 / 193 77 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: g*g*cauuGcUGCc ucuuuccau 362 a*U*ggaAaGAgg caGcAaugcc*u*g 509 100557 g*c*auugCuGCCu cuuccauu 363 a*A*uggAAGag gcAgCaugc1uc10 c*u 509 ugccgucuu 364 a*A*gacGgCAga auGgAaagag*g*c 511 100559 u*c*agccUcCUCa aagccaaca 365 u*G*uugGcUUug agGaGgcuga*a*cag 512 1006ag60C c*UCac*a u*U*guuGgCUuu gaGgAggcug*a*a 513 100561 u*c*cucaAaGCa acaauccuu 367 a*A*ggaUuGUug gcUuUgagga*g*g 514 100562 u*c*ucuc8CucauAG*a*cuggau3 cuggau3 agAgGagaga*g*a 515 100563 u*c*uccuCuACCu ggaucauaa 369 u*U*augAuCCag guAgAggaga*g*a 516 100564 c*u*ccucUaCCUg gaucauau.g ggau*aUCaU 370 a*Ga* 517 100565 u*a*ccugGaUCAu auggcaau 371 a*U*ugcCaUUau gaUcCaggua*g*a 518 100566 c*c*uggaUcAUAa uggcaugu 372 a*C*auuGcCAu7*aUaUccagg*u7 a*u*cauaAuGGCa augugguca 373 u*G*accAcAUugc cAuUauugau*c*c 520 100568u*c*auaaUgGCAa uguggucaa 374 u*U*gacCaCAuu gcCaUuauga*u*c 521 100569 c*a*uaauGgCAAu guggucaag 375 c*U*ugaCcACau ugCcAuuaug*a*u 522 100570 a*u*aaugGcAAUg uggucaaga 376 u*C*uugAcCAca uuGcCauuau*g*a 523 Petition 870250080602, dated 08 / 09 / 2025, pp. 92 / 193 78 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: huggacg 378 c*G*ucuUgACca caUuGccauu*a*u 525 100573 c*a*auguGgUCAa gacggaugu 379 a*C*aucCgUCuu gaCcAcauug*c*c 526 100574G cAU*a* a*U*aucUgGCac auCcGucuug*a*c 527 100575 g*a*ggccUgUGGc ugcagcuag 381 c*U*agcUgCAgcc aCaGgccuc*c*a 528 100576 a*g*gccugCugCugC* ug3cagC ccAcAggccu*c*c 529 100577 g*g*ccugUgGCUg cagcuagca 383 u*G*cuaGcUGca gcCaggcc*u*c 530 100578 g*c*cuguGgCUGc agcuagccaa 380 agcu*gcA ug*Agg*U* 531 100579 c*c*ugugGcUGCa gcuagcaag 385 c*U*ugcUaGCug caGcCacagg*c*c 532 100580 g*c*uuugGaGUG aagagaccaa 386 u*U*gguCuCUuc*81 acUc10caagc c*a*accaCcUGGc aauauugacu 387 a*G*ucaUaUUgc caGgUgguug*u*u 534 100582 a*c*caccUgGCaa uauugacuca 388 u*G*aguCaUccuAuu gcCaGguggug*Gc0 c*A0*53 ugacucacu 389 a*G*ugaGuCAua uuGcCaggug*g*u 536 100584g*g*acccAaAUGg gcacuuucu 390 a*G*aaaGuGCcc auUuGggucc*c*a 537 100585 c*c*caaaUgGGCa cuuucuugu 391 a*C*aagAaAGug ccCaUuuggg*u *c 53586 c*0586 c*GaCaG uucuugucu 392 a*G*acaAgAAag ugCcCauuug*g*g 539 Petition 870250080602, of 08 / 09 / 2025, p. 93 / 193 79 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: ugagacucu 394 a*G*aguCuCAga caAagAagug*c*c 541 100589 c*u*ugucUgAGAc ucuggcuua 395 u*A*agcCaGAgu cuCaGacaag*a*a 542 100590 a*a9CAGau*agaa u*A*auuUuUCuc ugCcUucccu*c*c 543 100591 g*g*gaagGcAGAg aaaaauuac 397 g*U*aauUuUUcu cuGcCuuccc*u*c 544 100592 a*u*ccuga8gacu8ucCCA*a ggGaggcu*a*a 545 100593 c*c*ucucCcAAGa ugagaaagu 399 a*C*uuuCuCAuc uuGgGagagg*c*u 546 100594 c*u*cccaAgAUGa gaaaguccu 400*uCug70 agg*ucG*ga*u 100595 g*g*ggagGaGGA agcagauaga 401 u*C*uauCuGCuu ccUcCucccc*u*c 548 100596 g*g*gaggAgGAAg cagauagau 402 a*U*cuaUcUGcu 549*ucCu*Ccu c*a*gaaaCaGGAg ucaggaaaa 403 u*U*uucCuGAcu ccUgUuucg*g*g 550 100598 g*c*acuaAgCCUa agaguucc 404 g*G*aacUuCUua ggCuUagugc0591*c* c*c*cacuGgGAGa caagcauuu 405 a*A*augCuUGuc ucCCAguggg*u*c 552 100600c*c*acugGgAGAc aagcauuua 406 u*A*aauGcUUgu cuCcCagugg*g*u 553 100601 a*c*ugggAgACAa gcauuuaua 407 u*A*uaaAuGCuu guCuCccagu*g*g 554 100602 u*g*ggagAcAAGc auuuauacu 408 a*G*uauAaAUgc uuGuCuccca*g*u 555 Petition 870250080602, dated 08 / 09 / 2025, pp. 94 / 193 80 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100603 g*g*gagaCaAGCa uuuauacuu 409 a*A*guaUaAAug cuUgUcuccc*a*g 556 100604 g*a*caagCaUUUa uacuuucuu 410 a*A*gaaAgUAua aaUgCuuguc*u*c 557 100605 g*a*gccaCcGCGc cuggcuuau 411 a*U*aagCcAGgc gcGgUggcuc*a*c 558 100606 c*c*accgCgCCUg gcuuauacu 412 a*G*uauAaGCca ggCgCggugg*c*u 559 100607 a*c*cgcgCcUGGc uuauacuuu 413 a*A*aguAuAAgcc aGgCgcggu*g*g 560 100608 c*g*cgccUgGCUu auacuuucu 414 a*G*aaaGuAUaa gcCaGgcgcg*g*u 561 100609 g*c*gccuGgCUUa uacuuucuu 415 a*A*gaaAgUAua agCcAggcgc*g*g 562 100610 c*g*ccugGcUUAu acuuucuua 416 u*A*agaAaGUau aaGcCaggcg*c*g 563 100611 g*c*cuggCuUAUa cuuucuuaa 417 u*U*aagAaAGua uaAgCcaggc*g*c 564 100612 c*c*uggcUuAUAc uuucuuaau 418 a*U*uaaGaAAgu auAaGccagg*c*g 565 100613 u*g*gcuuAuACUu ucuuaauaa 419 u*U*auuAaGAaa guAuAagcca*g*g 566 100614 g*g*cuuaUaCUUu cuuaauaaa 420 u*U*uauUaAGaa agUaUaagcc*a*g 567 100615 c*u*uauaCuUUCu uaauaaaa 421 u*U*uuuAuUAag aaAgUauaag*c*c 568 100616a*g*ggguGuCCAc aaagucaaa 422 u*U*ugaCuUUgu ggAcAccccu*g*a 569 100617 g*g*ggugUcCACa aagucaaag 423 c*U*uugAcUUug ugGaCacccc*u*g 570 100618 u*c*auaaUaAUAc uaacauguu 424 a*A*cauGuUAgu auUaUuauga*a*a 571 Petition 870250080602, dated 08 / 09 / 2025, pages 95 / 193 81 / 138 Name of the duplex Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100619 a*c*uaacAuGUUa uuugccuuu 425 a*A*aggCaAAua acAuGuuagu*a*u 572 100620 g*u*uauuUgCCUu uugaauucu 426 a*G*aauUcAAaa ggCaAauaac*a*u 573 100621 u*g*ccuuUuGAAu ucucauuau 427 a*U*aauGaGAau ucAaAaggca*a*a 574 100622 g*c*cuuuUgAAUu cucauuauc 428 g*A*uaaUgAGaa uuCaAaaggc*a*a 575 100623 c*c*uuuuGaAUUc ucauuaucu 429 a*G*auaAuGAga auUcAaaagg*c*a 576 100624 c*u*uuugAaUUCu cauuaucuu 430 a*A*gauAaUGag aaUuCaaaag*g*c 577 100625 u*g*aauuCuCAUu aucuuaaaa 431 u*U*uuaAgAUaa ugAgAauuca*a*a 578 100626 g*a*auucUcAUUa ucuuaaaau 432 a*U*uuuAaGAua auGaGaauuc*a*a 579 100627 c*c*guguGaCAUg ugauuacau 433 a*U*guaAuCAca ugUcAcacgg*c*c 580 100628 u*g*ugacAuGUGa uuacaucau 434 a*U*gauGuAAuc acAuGucaca*c*g 581 100629 u*g*acauGuGAUu acaucaucu 435 a*G*augAuGUaa ucAcAuguca*c*a 582 100630 g*a*caugUgAUUa caucaucuu 436 a*A*gauGaUGua auCaCauguc*a*c 583 100631 u*c*uuucUgACAu cauguuaa 437 u*U*aacAaUGau guCaGaaaga*u*g 584 100632c*u*uucuGaCAUc auuguuaau 438 a*U*uaaCaAUga ugUcAgaaag*a*u 585 100633 g*a*caucAuUGUu aauggaaug 439 c*A*uucCaUUaa caAuGauguc*a*g 586 100634 g*u*uaauGgAAUg ugugcuugu 440 a*C*aagCaCAca uuCcAuuaac*a*a 587 Abbreviation: (*) = PS connection; (-) = PO connection; lowercase = 2'-OMe; Petition 870250080602, dated 09 / 08 / 2025, pp. 96 / 193 82 / 138 uppercase = 2'-F; rX = RNA; dX = DNA; invAb = inverted abasic; Tgn = S isomer of thymidine glycol nucleic acid (GNA); i = inosine; invdN = inverted deoxyribonucleotide (3'-3' linked nucleotide or 5'-5' linked nucleotide) Agn = S isomer of adenosine glycol (GNA) nucleic acid; Cgn = S isomer of cytidine glycol (GNA) nucleic acid; VP = 5'-E-vinylphosphonate. Table 3. Single-dose screening results of 10 nM and 0.1 nM in Huh7 cells using selected modified INHBE siRNAs shown as Mean % inhibition and SD. Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100488 -5.35 5.35 -38.35 54.87 100489 37.83 9.72 -25.09 23.01 100490 33.23 4.19 2.17 17.95 100491 33.01 5.79 -2.32 7.93 100492 62.61 3.47 37.88 14.26 100493 52.64 4.18 5.94 12.72 100494 66.97 5.86 -8.14 13.30 100495 17.99 18.55 -38.42 5.00 100496 -1.87 2.86 -12.67 65.05 100497 11.41 8.24 -27.87 4.39 100498 6.01 9.66 2.04 12.74 100499 8.46 26.75 -35.43 8.51 100500 41.01 12.56 28.92 19.85 100501 65.34 2.08 40.38 7.72 100502 35.53 10.67 45.79 8.53 100503 -5.01 7.58 -22.95 6.70 100504 -0.27 15.93 -7.15 11.52 100505 60.17 2.80 -7.48 14.07 100506 66.21 0.85 9.93 4.35 100507 72.48 2.01 20.90 3.77 Petition 870250080602, dated 08 / 09 / 2025, page 97 / 193 83 / 138 Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100508 46.83 1.89 26.11 6.19 100509 81.14 4.63 38.85 18.83 100510 36.30 22.83 13.27 37.06 100511 2.34 12.26 -4.98 9.67 100512 -10.95 3.33 -17.49 2.44 100513 2.67 2.85 -3.68 2.34 100514 -2.59 9.74 -3.02 10.27 100515 27.36 12.13 7.48 8.08 100516 9.59 11.30 13.53 11.12 100517 23.71 9.63 23.04 28.34 100518 36.59 8.04 2.30 7.98 100519 64.14 3.60 35.23 15.42 100520 33.42 3.20 -4.67 20.21 100521 15.52 13.25 -23.84 3.48 100522 -33.65 11.75 -11.62 10.71 100523 7.10 9.53 -1.90 14.80 100524 -7.80 4.06 -10.19 8.80 100525 -4.53 4.74 -6.45 10.07 100526 -21.17 15.69 -33.23 20.13 100527 -45.62 22.22 -25.92 18.84 100528 -26.98 12.15 -5.43 22.85 100529 -3.72 4.98 -13.90 4.38 100530 4.07 5.95 -0.27 9.78 100531 22.47 6.13 16.97 7.18 100532 15.61 7.43 19.46 17.58 100533 26.41 7.79 9.36 8.87 100534 34.02 3.29 -11.20 6.44 100535 85.19 3.13 34.61 5.39 100536 -3.01 18.07 -25.60 10.69 100537 8.81 16.07 -30.49 19.16 100538 -2.31 22.08 -5.04 13.00 Petition 870250080602, dated 09 / 08 / 2025, pp. 98 / 193 84 / 138 Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100539 21.46 13.90 4.71 18.36 100540 45.70 28.80 0.07 8.28 100541 49.25 8.91 10.43 7.94 100542 33.24 11.87 -0.17 11.73 100543 41.67 14.86 8.09 27.00 100544 4.52 5.12 2.61 11.66 100545 28.05 31.74 14.39 42.11 100546 37.79 12.09 -1.95 12.26 100547 -25.80 4.06 -54.29 25.21 100548 -12.11 21.78 -49.30 7.75 100549 58.93 1.75 -20.45 19.96 100550 -4.66 6.98 2.61 8.97 100551 22.47 0.21 0.37 6.39 100552 -16.76 27.81 0.37 13.86 100553 -1.38 14.62 -31.00 16.34 100554 6.08 28.04 -12.79 19.47 100555 3.70 11.78 -2.77 9.74 100556 44.87 2.94 16.18 2.60 100557 76.66 2.23 52.70 1.33 100558 62.62 4.14 34.69 3.68 100559 28.15 5.10 18.72 20.77 100560 37.94 22.04 -6.69 23.88 100561 68.11 6.19 31.17 6.84 100562 26.76 1.80 25.79 12.14 100563 77.60 0.75 69.69 3.31 100564 70.51 0.56 47.60 4.97 100565 75.19 1.77 64.73 3.92 100566 47.23 12.69 23.51 5.52 100567 58.40 7.24 1.61 24.05 100568 73.44 0.72 36.93 3.46 100569 85.47 0.81 27.85 23.08 Petition 870250080602, dated 09 / 08 / 2025, p. 99 / 193 85 / 138 Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100570 63.92 2.80 39.92 9.93 100571 73.26 12.14 24.30 6.65 100572 58.31 4.40 14.67 6.54 100573 82.91 2.36 36.04 2.19 100574 80.59 0.59 60.99 6.06 100575 47.59 24.11 23.03 12.74 100576 34.93 25.86 26.51 33.73 100577 12.18 20.28 24.40 0.62 100578 57.62 2.89 30.66 4.41 100579 46.56 3.86 28.50 16.18 100580 77.56 3.09 62.93 3.55 100581 61.60 7.82 35.76 7.39 100582 35.56 11.61 14.33 3.68 100583 26.60 11.02 -29.00 5.86 100584 49.62 10.36 39.66 5.41 100585 55.47 4.71 33.40 8.89 100586 57.59 946.65 57.48 2.91 100587 61.43 6.19 35.20 8.80 100588 74.82 0.61 43.78 5.03 100589 77.21 1.32 72.42 7.41 100590 -10.86 8.29 -8.61 10.34 100591 23.74 3.05 -0.83 9.84 100592 44.68 1.51 17.87 5.46 100593 25.04 24.50 8.82 49.83 100594 56.17 11.48 10.22 55.97 100595 46.61 1.94 0.06 6.23 100596 26.00 8.58 -4.84 25.31 100597 54.05 1.65 37.73 2.68 100598 53.90 7.21 29.24 6.23 100599 44.04 13.44 20.95 13.84 100600 58.54 5.93 52.44 5.82 Petition 870250080602, dated 09 / 08 / 2025, pp. 100 / 193 86 / 138 Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100601 66.62 6.01 59.79 3.95 100602 54.88 13.17 44.11 5.65 100603 64.42 5.51 57.19 3.57 100604 81.15 1.68 70.42 5.87 100605 -22.92 9.16 -51.17 8.84 100606 33.44 6.94 -51.72 16.18 100607 21.71 11.71 -18.49 9.38 100608 48.27 3.33 31.48 5.29 100609 54.85 6.31 42.50 5.50 100610 45.02 3.84 60.83 5.59 100611 55.49 11.13 66.79 6.64 100612 74.28 3.53 67.82 7.71 100613 77.76 0.38 76.84 0.48 100614 70.48 1.17 66.71 4.23 100615 75.16 2.43 60.80 15.84 100616 24.73 15.95 48.26 7.56 100617 43.65 16.26 13.90 5.70 100618 66.45 4.43 55.43 25.80 100619 63.86 18.07 59.99 8.47 100620 64.18 3.56 42.90 11.82 100621 68.17 1.40 66.24 5.45 100622 43.81 6.21 15.94 12.38 100623 73.30 2.99 56.78 2.34 100624 71.82 4.23 45.80 2.40 100625 72.15 1.49 71.54 1.93 100626 46.27 5.87 60.75 4.49 100627 61.59 4.07 60.24 4.80 100628 70.82 2.90 63.11 2.26 100629 74.35 1.86 73.52 1.63 100630 62.37 1.45 37.68 9.75 100631 -56.56 14.48 -23.69 20.04 Petition 870250080602, dated 08 / 09 / 2025, pp. 101 / 193 87 / 138 Compound ID AVERAGE 10nM SD of 10nM Average of 0.1 nM SD of 0.1 nM 100632 62.92 0.50 48.87 5.08 100633 34.44 10.48 45.64 17.04 100634 18.76 15.92 -7.97 14.05 Example 2. In vitro dose-response screening in the Huh7 cell line

[00125] This example describes an example screening of INHBE siRNA compounds in primary human hepatocyte (PHH) cells in a single dose screening of 100 nM, 33 nM, 11 nM, 3.7 nM, 1.2 nM, 0.412 nM, 0.137 nM, and 0.046 nM of the selected siRNA (Table 2). The INHBE mRNA level was measured by quantitative PCR and normalized for GAPDH relative to sham-treated control cells, and the mean KD and SD were determined. Data are presented as percentage of INHBE mRNA inhibition in cells treated with siRNAs related to INHBE mRNA in PBS control cells. Table 4 and FIG. 2 show the results of in vitro dose-response siRNA screenings. Table 4. Maximum inhibition of INHBE mRNA (%) and IC50 (nM) for exemplary INHBE siRNAs. Compound ID IC50 (nM) Maximum Inhibition 100494 0.879527207 60% 100506 3.168648402 70% 100509 0.288812209 62% 100519 0.133171004 69% 100535 0.102147368 78% 100557 0.117147936 63% 100561 0.447047125 71% 100563 0.055169498 76% 100569 0.720001201 79% 100580 0.033891417 68% 100589 0.015619441 70% Petition 870250080602, dated 08 / 09 / 2025, pp. 102 / 193 88 / 138 Compound ID IC50 (nM) Maximum Inhibition 100604 0.289690693 71% 100613 0.042248546 74% 100625 0.014322142 70% 100629 0.057614467 64% Example 3. In vitro dose-response screening in primary human hepatocytes.

[00126] This example describes an example screening of INHBE siRNA compounds in primary human hepatocyte (PHH) cells in a single-dose screening of 10 nM and 1 nM of the selected siRNA (Table 2). The INHBE mRNA level was measured by quantitative PCR and normalized for GAPDH relative to sham-treated control cells, and the mean KD and SD were determined. Data are presented as percentage of INHBE mRNA inhibition in siRNA-treated cells relative to INHBE mRNA in PBS control cells. Table 5 and FIGURE 3 show the results of the in vitro dose-response screenings of INHBE siRNA. Table 5. Results of single-dose screenings of 10 nM and 0.1 nM in Huh7 cells using the selected modified siRNAs INHBE shown as % MEAN inhibition and SD. Compound ID AVERAGE 10nM SD of 10nM 1nM AVERAGE SD of 1nM 100494 10.7 22.4 -22.5 4.0 100506 -13.0 15.9 -30.9 14.1 100509 40.1 19.4 -16.7 10.5 100519 37.1 11.9 0.2 22.0 100535 51.9 4.1 13.7 9.8 100557 29.2 13.3 -2.5 13.2 100561 26.8 14.3 -13.5 6.6 100563 60.1 9.7 26.5 3.5 Petition 870250080602, dated 08 / 09 / 2025, pp. 103 / 193 89 / 138 Compound ID AVERAGE 10nM SD of 10nM 1nM AVERAGE SD of 1nM 100569 4.4 10.2 5.1 23.5 100580 35.6 5.7 9.6 8.5 100589 37.8 6.4 21.7 12.9 100604 48.6 4.9 30.9 6.9 100613 50.8 3.1 31.8 5.9 100625 55.7 2.8 35.7 11.1 100629 45.7 5.6 5.1 5.0 Example 4. Evaluation of human INHBE suppression with selected siRNAs in a hydrodynamic injection (HDI) model in mice in vivo.

[00127] Thirteen exemplary siRNA compounds (Compounds 100635100647) were tested for knockdown of human INHBE in a hydrodynamic mouse model injected with a DNA plasmid encoding the full-length human INHBE transcript. Briefly, 6–7 week old female BALB / c mice were subcutaneously injected with INHBE siRNA compounds from Table 6 at 1 mg / kg. Three days after injection, the mice were hydrodynamically injected with a DNA plasmid encoding the full-length human INHBE transcript. One day after plasmid injection, liver samples were collected and analyzed for INHBE mRNA expression relative to mice treated with the same volume of PBS. INHBE mRNA levels were measured by quantitative PCR and normalized to the NEO gene included in the plasmid used to express INHBE. The data are presented as relative gene expression of INHBE mRNA in the liver in relation to animals treated with PBS.

[00128] The modified and unmodified sense and antisense strand sequences of compounds 100329-100341 are summarized in Tables 6-7. Petition 870250080602, dated 09 / 08 / 2025, p. 104 / 193 90 / 138

[00129] Table 8 and FIG. 4 show the results of single-dose INHBE siRNA injection in INHBE BALB / c mice. The results show that siRNA compounds 100635, 100638, 100639, 100642, 100643, 100644, 100645, and 100646 reduce INHBE expression by more than 80%. Furthermore, compounds 100635–100646 showed improved potency compared to siRNA compound 100647. Table 6. Modified INHBE siRNA compounds, conjugated with tri-GalNAc6 or L96, in which the sense strand is conjugated with 5'-triGalNAc6, 3'-triGalNAc6 or 3-L96 targeting the INHBE mRNA. L96 binder Petition 870250080602, dated 09 / 08 / 2025, p. 105 / 193 91 / 138 Modified siRNA nucleotide sugar, where B is the nucleotide base uracil (nucleotide abbreviation: tmU) or cytosine (nucleotide abbreviation: tmC). Analog of TNA, where B is a uracil base (abbreviation: utU) or an adenine base (abbreviation utA) Glycol Nucleic Acid (GNA) Compos to ID Senso 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100635 a*c*ucuUuGCUuG aggaucuu(L6) 607 va*A*gAuCcUcaagc AaAgagug*c*c 616 100636 (L6)invdT*a*c*ucu UuGCUuGaggaucu u*u*u 625 va*A*gAuCcUcaagc AaAgagug*c*c 632 100637 (L6)invdT*a*c*ucu UuGCUuGagga(ut U)cuu*u*(tmU) 626 va*A*gAuCcUcaagc AaAgagug*c*c 633 Petition 870250080602, dated 09 / 08 / 2025, pp. 106 / 193 92 / 138 Compos to ID Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: 100638 a*c*ucuUuGCUuG agga(utU)cu(tmU)( L6) 100639 a*c*aagCaUUUaU acuuucuu(L6) 609 va*A*gaaAgUauaaa Ugcuuguc*u*c 618 100640 (L6)invdT*a*c*aag CaUUUaUacuuuacuua2a2Au*u*u Ugcuuguc*u*c 634 100641 (L6)invdT*a*c*aag CaUUUaUacuu(tm) U)cuu*u*(tmU) 628 va*A*gaaAgUauaaa Ugcuuguc*u*c 635 10UcUa642 a acuuucu(tmU)(L6) 610 va*A*gaaAgUauaaa Ugcuuguc*u*c 619 100643 g*g*cuuAuACUuUc uaauaa(L6) 611 vu*U*aUAaGaaagu 10 AuAagcca*4g*g (L6)invdT*g*g*cuu AuACUuUcuuaaua a*u*u 629 vu*U*aUAaGaaagu AuAagcca*g*g 636 100645 (L6)invdT*g*g*cuu AuACUuUcuua(utA) 6(uaa.*u vu*U*aUuAaGaaagu AuAagcca*g*g 621 100646 g*g*cuuAuACUuUc uaauaa(L6) 630 vu*U*aUAaGaaagu AuAag(tmC)ca*g*g 637 1006u(L9u*Ca6u C*u) 631 A*U*gadAg(Tgn)gga gucUgUgacag*u*a 638 Abbreviations: (*) = PS linkage; lowercase = 2'-OMe; uppercase = 2'-F; invdN = inverted deoxyribonucleotide (3'-3' linked nucleotide or 5'-5' linked nucleotide); v = 5-E-Vinylphosphonate; (tmU) = siRNA nucleotide with a modified sugar and a uracil base; (utU) = a TNA analog with a uracil base, i.e., utU above; (utA) = a TNA analog with an adenine base, i.e., utA above; (L6) = tri-GalNAc6 linker; (L96) = L96 linker; (Tgn) = a thymidine glycol nucleic acid, i.e., GNA above; dX = DNA. Petition 870250080602, dated 08 / 09 / 2025, pp. 107 / 193 93 / 138 Table 7. Unmodified INHBE siRNA sequences Sense 5'-3' SEQ ID NO: Antisense 5'-3' SEQ ID NO: ACUCUUUGCUUGAGG AUCUU 589 AAGAUCCUCAAGCA AAGAGUGCC 598 TACUCUUUGCUUGAG GAUCUUUU 639 AAGAUCCUCAAGCA AAGAUCCUCAAGCA AAGAUCCUUGCAAGCA AAGAUCCUUGCAAGCA AAGAUCCUUGCAAGCA AAGAUCCUUGAGCA AAGAUCCUUGCA GAUCUUUU 640 AAGAUCCUCAAGCA AAGAGUGCC 647 ACUCUUUGCUUGAGG AUCUU 590 AAGAUCCUCAAGCA AAGAGUGCC 599 ACAAGCAUUUAUACUU UCUU 591 AAGAAAGUAUAAAU GCUUGUCUUCAUCAUCUUUUACUUU 641 AAGAAAGUAUAAAU GCUUGUCUC 648 TACAAGCAU UUAUACU UUCUUUUU 642 AAGAAAGUAUAAAU GCUUGUCUC 649 ACAAGCAUUUAUACUU UCUU 592 AAGAAAGUAUAAAU GCUUGUCUC 601 GGCUUAUAUAUACUAU UUAUUAAGAAAGUA UAAGCCAGG 602 TGGCUUAUACUUUCU UAAUAAUU 643 UUAUUAAGAAAGUA UAAGCCAGG 650 TGGCUUAUACUUUCU UAAUAAUU 594 UUAUUAAGAAAGUA UAAGCCAGG 603 GGCUUAUAUAUAUAUAUAUU444 UUAUUAAGAAAGUA UAAGCCAGG 651 CUGUCACAGACUCCA CUUCAU 645 AUGAAGTGGAGUCU GUGACAGUA 652 Table 8. Knockdown percentage (KD) in vivo em model H DI. Compound ID % KD and model HDI 100635 83 100636 73 100637 79 100638 82 Petition 870250080602, of 08 / 09 / 2025, p. 108 / 193 94 / 138 Compound ID % KD on model HDI 100639 81 100640 72 100641 69 100642 84 100643 88 100644 87 100645 84 100646 85 100647 64 Example 5. Evaluation of human INHBE suppression with selected siRNAs in a hydrodynamic injection (HDI) model in mice in vivo.

[00130] 12 exemplary siRNA compounds (compounds 100643 and Human INHBE (100647-100657) were tested for knockdown in a hydrodynamic mouse model injected with a DNA plasmid encoding the full-length human INHBE transcript. Briefly, 6–7 week old female BALB / c mice were subcutaneously injected with INHBE siRNA compounds from Table 9 at 1.5 mg / kg. Three days after injection, the mice were hydrodynamically injected with a DNA plasmid encoding the full-length human INHBE transcript. One day after plasmid injection, liver samples were collected and analyzed for INHBE mRNA expression relative to mice treated with the same volume of PBS. INHBE mRNA levels were measured by quantitative PCR and normalized to the NEO gene included in the plasmid used to express INHBE. The data are presented as relative gene expression of INHBE mRNA in the liver in relation to animals treated with PBS. Petition 870250080602, dated 09 / 08 / 2025, p. 109 / 193 95 / 138

[00131] The modified and unmodified sense and antisense strand sequences of compounds 100643 and 100647-100657 are summarized in Tables 9-10.

[00132] FIG. 5 shows the results of single-dose INHBE siRNA injection in INHBE BALB / c mice. The results show that siRNA compounds 100643, 100649, 100650, 100654, 100655, and 100657 exhibited improved potency compared to siRNA compound 100647. Table 9. Modified INHBE siRNA compounds, conjugated with tri-GalNAc6 or L96, in which the sense strand is conjugated with 3'triGalNAc6 or 3-L96 targeting the INHBE mRNA. L96 binder Petition 870250080602, dated 09 / 08 / 2025, pp. 110 / 193 96 / 138 Glycol Nucleic Acid (GNA) Compound ID Sense 5'-3' (modified) SEQ ID NO: Antisense 5'-3' (modified) SEQ ID NO: C*u*gucaCaGACu ccacuucau(L96) 631 A*U*gadAg(Tgn)gg agucUgUgacag*u* a 638 100648 u*g*gcuuAuACUuu cuaaaua(L96) 653 u*GAUa0au*augAagAag 100649 u*u*ggagugAAGag accaagau(L96) 654 vu*U*cUuGgUcucu uCaCuccaaag 661 100650 u*c*uuuccaUUCug ccgucuuc(L96) 655 vu*A*aGaC065Gagagg1agagg g*g*agacaaGCAuu uauacuuu(L96) 656 vu*A*aGuAuAaaug cUuGucuccca 663 100652 a*c*aagcauUUAua cuucuuuu(L96) 613 vu*A*aGaAaGuauacuua 10 aAu625 u*g*aagagaCCAag augaaguu(L96) 614 vu*A*cUuCaUcuug gUcUcuucacu 623 100654 g*a*gacaagCAUuu auacuuuc(L96) 657 vu*A*aAgUaUaauc 106654 gCu6Ugucu a*a*ugggcaCUUuc uugucuga(L96) 615 vu*C*aGaCaAgaaa gUgCccauuug 624 100656 a*g*agaccaAGAug aaguuucc(L96) 658 vu*G*aAaCuUcauc uuguga5u7 a*ug0666 gouuuucc(L96) 659 wu*G*aAaAaCcagg gACuucuuag 666 Abbreviation: (*) = PS connection; lowercase = 2'-OMe; uppercase = 2'-F; v Petition 870250080602, dated 09 / 08 / 2025, p. 111 / 193 97 / 138 = 5'-E-Vinyl-phosphonate; (L96) = L96 ligand; (Tgn) = a thymidine-glycol nucleic acid, i.e., GNA from above; dX = DNA. Table 10. Unmodified INHBE siRNA sequences Sense 5'-3' SEQ ID NO: Antisense 5'-3' SEQ ID NO: ACUCUUUGCUUGAGG AUCUU 593 AAGAUCCUCAAGCAAA GAGUGCC 602 CUGUCACAGACUCCA CUUCAU 645 AUGAAGTGGAGUCUGU GACAGUA 652 UGGCUUAUACUUUCU UAAUAA 667 UUAU UAAGAAAG UAUAA GCCAGG 675 UUGGAGUGAAGAGAC CAAGAU 668 UUCUUGGUCUCUUCAC UCCAAAG 676 UCUUUCCAUUCUGCC GUCUUC 670 UAAGACGGCAGAAUGG AAAGAGG 677 GGAGACAAGCAUUUA UACUUU 671 UAAGUAUAAAUGCUUG UCUCCCA 678 ACAAGCAUUUAUACUU UCUUU 595 UAAGAAAGUAUAAAUGC UUGUCU 604 UGAAGAGACCAAGAU GAAGUU 596 UACUUCAUCUUGGUCU CUUCACU 605 GAGACAAGCAUUUAUA CUUUC 672 UAAAGUAUAAAUGCUU GUCUCCC 679 AAUGGGCACUUUCUU GUCUGA 597 UCAGACAAGAAAGUGC CCAUUUG 606 AGAGACCAAGAUGAAG UUUCC 673 UGAAACUUCAUCUUGG UCUCUUC 680 AAGAAGUUCCCUGGU UUUUCC 674 UGAAAAACCAGGGAAC UUCUUAG 681 Example 6. Evaluation of INHBE knockdown with siRNAs in an in vivo non-human primate model.

[00133] Two exemplary siRNA compounds, referred to here as Compound A and Compound B, were selected from among those with Petition 870250080602, dated 08 / 09 / 2025, pages 112 / 193 98 / 138 posts listed in Table 6 and Table 9 were tested for INHBE knockdown in a non-human primate model. Briefly, male cynomolgus monkeys aged 3 to 8 years were injected subcutaneously with one of the following: INHBE A or B siRNA compounds at 5 mg / kg (n=2-3 monkeys per compound tested). The animals underwent clinical observation twice daily after injection. Liver biopsies were obtained 4 days before injection and 56 days after injection. Liver INHBE mRNA levels were measured by quantitative PCR at a normalized level to day 4 for each individual animal.

[00134] FIGS. 6 show the results of single-dose INHBE siRNA injection in cynomolgus monkeys. The results show that 69% knockdown (Compound A) and 75% knockdown (Compound B) were observed in animals on day 56 after injection (FIG. 6). Example 7. In vitro activity and dose-response screening in hTLR7, hTLR8, and hTLR9 cells.

[00135] This example evaluates the agonist activity of compounds in the cell-based human Toll-like receptor (hTLR) reporter assay. Exemplary siRNA compounds 100647, 100635, 100638, 100639, 100642, 100643, and 10064 were tested using commercial cell-based hTLR7, hTLR8, and hTLR9 reporter assays. Briefly, the assays were performed using a 4-fold dilution of 100 nM at 9 concentrations per transfection of HEK-293 cells in duplicate and with a treatment duration of 24 hours. R848 was purchased from a commercial supplier and used as an agonist for the hTLR7 and hTLR8 reporter assays. ODN 2006 was purchased from a commercial supplier and used as an agonist for the hTRL9 reporter assays.

[00136] The data is presented as the level of activity in Petition 870250080602, dated 08 / 09 / 2025, pp. 113 / 193 99 / 138 cells treated with test compounds showed a fold shift relative to the activity of unstimulated cells in cell-based hTLR7, hTLR8, and hTLR9 reporter assays. Table 11 and FIGS. 7A-7C show the results of the cell-based hTLR7, hTLR8, and hTLR9 reporter assays. The results show that all siRNA compounds tested did not exhibit activity against the hTLR7, hTLR8, and hTLR9 pathways. Table 11. Activity of exemplary INHBE siRNA compounds in cell-based hTLR7, hTLR8, and hTLR9 reporter assays. Compound ID EC50 CC50 Unit hTLR7 hTLR8 hTLR9 hTLR7 hTLR8 hTLR9 100647 >100 >100 >100 >100 >100 >100 nM 100635 >100 >100 >100 >100 >100 >100 nM 100638 >100 >100 >100 >100 >100 >100 nM 100639 >100 >100 >100 >100 >100 >100 nM 100642 >100 >100 >100 >100 >100 >100 nM 100643 >100 >100 >100 >100 >100 >100 nM 100645 >100 >100 >100 >100 >100 >100 nM R848 0.924 9.863 / >10 >10 / μM ODN 2006 / / 80.79 / / >1000 nM Example 8. Transcriptome analysis of RNA sequence in primary human hepatocytes.

[00137] This example evaluates the RNA sequence transcriptome in primary human hepatocytes to assess the potential risk of target deviation of exemplary siRNA compounds 100647, 100635, 100638, 100639, 100642, 100643, and 100645. Briefly, primary human hepatocyte (PHH) cells were collected after 48 hours of treatment with exemplary siRNA compounds for RNA extractions, library construction, and sequencing.

[00138] FIG. 8 shows the results of the transcriptome analysis. Petition 870250080602, dated 08 / 09 / 2025, pages 114 / 193 100 / 138 of the RNA sequence in primary human hepatocytes treated with exemplary siRNA compounds. The data are presented as a volcano plot of differentially expressed genes (DEGs) between different groups and show that INHBE is significantly downregulated in all groups. Of all the exemplary siRNA compounds tested, compound 100639 returned the cleanest RNAseq result. Example 9. Non-GLP minitoxicology study of selected siRNAs in an in vivo mouse model.

[00139] The exemplary siRNA compounds 100635, 100642, and 100643 were evaluated using a non-GLP mini toxicology study in mice. Briefly, 7-week-old male C57BL / 6J mice (5 per group) were subcutaneously injected with a single dose of 50 mg / kg of one of the siRNA compounds 100635, 100642, and 100643 (i.e., on day 0).

[00140] Blood was collected on day 0 (pre-dosage) and on day 7. Tissues (liver and kidney) were collected on day 7 after completion.

[00141] Urine and blood samples collected on day 0 (pre-dosage) were handled as follows. Plasma was flash-frozen on dry ice after collection, stored at -80 degrees, and transferred for biochemical analysis. Urine was stored at 4 degrees or -80 degrees Celsius until transferred for biochemical analysis.

[00142] Urine, blood, liver, and kidney samples collected on day 7 were handled as follows. Plasma: rapidly frozen on dry ice after collection, stored at -80 degrees, and transferred for biochemical analysis. Plasma was stored on ice until transferred for coagulation assays.

[00143] The liver and kidney were fixed in 4% paraformaldehyde until they were transferred for histopathological evaluation. Petition 870250080602, dated 08 / 09 / 2025, pages 115 / 193 101 / 138

[00144] FIG. 9 and Table 12 show the results of injecting C57BL / 6J mice with a single dose of 50 mg / kg of one of the 100635, 100642 or 100643 siRNA compounds.

[00145] FIG. 9 shows the results of biochemical tests of mice over 7 days after dosing. Compared with the results of the PBS control group, no significant difference was observed in the mean plasma concentration of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TRIG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), creatinine (CREZ), cholesterol (CHOL), and lactate dehydrogenase (LDH) in mice in the test compound groups. The mean plasma urea concentration of mice in the 100635 group was significantly higher than that of mice in the PBS group on day 7. Compared to the results of the PBS control group, no significant difference was observed in the mean concentration of urinary urea (UREA), total urinary microprotein (UP), and creatinine (CREZ) of mice in the test compound groups.

[00146] Table 12 shows the results of the liver and kidney pathology study over 7 days after administration. The study results do not indicate significant lesions (damage) in the experimental subjects. The changes observed in the PBS group may be due to background lesions. Petition 870250080602, dated 08 / 09 / 2025, pages 116 / 193 102 / 138 Table 12. Results of studies of liver and kidney pathology. Hepatic Pathological Diagnosis Renal Pathological Diagnosis Group 1 PBS 5mL / kg, SC Inflammatory cells were occasionally seen around blood vessels and liver margins No significant lesions were found Few foci of inflammatory cell aggregation were found along with hepatocellular degeneration No significant lesions were found Inflammatory cells were occasionally seen in the portal area No significant lesions were found Inflammatory cells were occasionally seen No significant lesions were found No significant lesions were found No significant lesions were found Group 2 Compound 100635 50mpk,SC No significant lesions were found No significant lesions were found No significant lesions were found Interstitial cell hyperplasia was observed occasionally No significant lesions were found No significant lesions were found No significant lesions were found No significant lesions were found No significant lesions were found No significant lesions were found Group 3 Composite 100642 No significant lesions were found No significant lesions were found No significant lesions were found No significant lesions were found Petition 870250080602, dated 08 / 09 / 2025, pp. 117 / 193 103 / 138 Group 3: Liver Pathological Diagnosis | Renal Pathological Diagnosis | No significant lesions found | No significant lesions found | Foci of inflammatory cell aggregation were occasionally observed in the portal area | No significant lesions found | Inflammatory cells were occasionally seen | No significant lesions found | Group 4: Composite 100643 50mpk, SC | No significant lesions found | No significant lesions found | Foci of inflammatory cell aggregation were occasionally observed in the portal area | Basophilic tubular cells were occasionally seen | No significant lesions found | No significant lesions found | No significant lesions found | No significant lesions found | No significant lesions found | Scattered inflammatory cells were occasionally seen

[00147] In conclusion, no significant differences were detected in the biochemical indices tested, and no significant lesions or damage were observed in the pathological diagnosis of the liver and kidneys. Therefore, in general, the single subcutaneous administration of the test compounds 100635, 100642 or 100643 in mice was considered safe and no obvious toxicity was observed in this non-GLP study.

[00148] Although preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided only by way of example. Petition 870250080602, dated 08 / 09 / 2025, pages 118 / 193 104 / 138 example. Numerous variations, changes and substitutions will now occur for those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein may be employed. The following claims are intended to define the scope of the invention and that methods and structures within the scope of these claims and their equivalents are covered by them. SEQUENCE LISTING SEQ ID NO: Description Sequence 1 Sense 5'-3' GGGUCAAGCACAGCUAUCCAU 2 Sense 5'-3' CACAGCUAUCCAUCAGAUGAU 3 Sense 5'-3' CAGCUAUCCAUCAGAUGAUCU 4 Sense 5'-3' AGCUAUCCAUCAGAUGAUCUA 5 Sense 5'-3' CUAUCCAUCAGAUGAUCUACU 6 Sense 5'-3' UAUCCAUCAGAUGAUCUACUU 7 Sense 5'-3' CCAUCAGAUGAUCUACUUUCA 8 Sense 5'-3' CUACUUUCAGCCUUCCUGAGU 9 Sense 5'-3' GACAAUAGAAGACAGGUGGCU 10 Sense 5'-3' GCAGUGGUGUCUGCUGUCACU 11 Sense 5'-3' CUCAUUGGCCCCCAGCAAUCA 12 Senso 5'-3' CUCCUGUGGGGGCUCCAAACU 13 Senso 5'-3' CUGGAGCUAGCCAAGCAGCAA 14 Senso 5'-3' UGGAGCUAGCCAAGCAGCAAA 15 Senso 5'-3' GGAGCUAGCCAAGCAGCAAAU 16 Senso 5'-3' GAGCUAGCCAAGCAGCAAAUC 17 Senso 5'-3' AGCUAGCCAAGCAGCAAAUCC 18 Senso 5'-3' GCUAGCCAAGCAGCAAAUCCU 19 Senso 5'-3' UAGCCAAGCAGCAAAUCCUGG 20 Senso 5'-3' GCCAAGCAGCAAAUCCUGGAU 21 Senso 5'-3' UGACCAGUCGUCCCAGAAUAA 22 Senso 5'-3' ACCAGUCGUCCCAGAAUAACU Petition 870250080602, dated 08 / 09 / 2025, pages 119 / 193 105 / 138 SEQ ID NO: Sequence Description 23 Direction 5'-3' CGUCCCAGAAUAACUCAUCCU 24 Direction 5'-3' CGCUGACCAGAGCCCUCCGGA 25 Direction 5'-3' GCUGACCAGAGCCCUCCGGAG 26 Direction 5'-3' CUGACCAGAGCCCUCCGGAGA 27 Direction 5'-3' UGACCAGAGCCCUCCGGAGAC 28 Direction 5'-3' GACCAGAGCCCUCCGGAGACU 29 Direction 5'-3' ACCAGAGCCCUCCGGAGACUA 30 Direction 5'-3' AGGGAAUGGGGAGGAGGUCAU 31 Direction 5'-3' AGGAGGUCAUCAGCUUUGCUA 32 Direction 5'-3' GAGGUCAUCAGCUUUGCUACU 33 Direction 5'-3' GCUUUGCUACUGUCACAGACU 34 Direction 5'-3' CGGUCCCACCACCUGUACCAU 35 Direction 5'-3' GGUCCCACCACCUGUACCAUG 36 Direction 5'-3' GUCCCACCACCUGUACCAUGC 37 Direction 5'-3' UCCCACCACCUGUACCAUGCC 38 Direction 5'-3' CCCACCACCUGUACCAUGCCC 39 Direction 5'-3' CCACCACCUGUACCAUGCCCG 40 Direction 5'-3' CACCACCUGUACCAUGCCCGC 41 Direction 5'-3' ACCACCUGUACCAUGCCCGCC 42 Direction 5'-3' CCACCUGUACCAUGCCCGCCU 43 Direction 5'-3' CACCUGUACCAUGCCCGCCUG 44 Direction 5'-3' CCACCCUUCCUGGCACUCUUU 45 Direction 5'-3' CCCUUCCUGGCACUCUUUGCU 46 Direction 5'-3' UGGCACUCUUUGCUUGAGGAU 47 Direction 5'-3' GCACUCUUUGCUUGAGGAUCU 48 Direction 5'-3' CACUCUUUGCUUGAGGAUCUU 49Senso 5'-3' CUAGUGGCUUGAGGGGUGAGA 50 Senso 5'-3' GGCUUGAGGGGUGAGAAGUCU 51 Senso 5'-3' GAAGUCUGGUGUCCUGAAACU 52 Senso 5'-3' UGGUGUCCUGAAACUGCAACU 53 Senso 5'-3' GGUGUCCUGAAACUGCAACUA Petition 870250080602, dated 08 / 09 / 2025, pp. 120 / 193 106 / 138 SEQ ID NO: Description Sequence 54 Direction 5'-3' CAGCCCUUCCUAGAGCUUAAG 55 Direction 5'-3' GCCCUUCCUAGAGCUUAAGAU 56 Direction 5'-3' GAGCUUAAGAUCCGAGCCAAU 57 Direction 5'-3' CCAUUACGUAGACUUCCAGGA 58 Direction 5'-3' CCCGAGGGGUACCAGCUGAAU 59 Direction 5'-3' CGAGGGGUACCAGCUGAAUUA 60 Direction 5'-3' GGUACCAGCUGAAUUACUGCA 61 Direction 5'-3' GUACCAGCUGAAUUACUGCAG 62 Direction 5'-3' UACCAGCUGAAUUACUGCAGU 63 Direction 5'-3' ACCAGCUGAAUUACUGCAGUG 64 Sense 5'-3' CCAGCUGAAUUACUGCAGUGG 65 Direction 5'-3' AGCUGAAUUACUGCAGUGGGC 66 Direction 5'-3' GCUGAAUUACUGCAGUGGGCA 67 Direction 5'-3' CUGAAUUACUGCAGUGGGCAG 68 Direction 5'-3' AUUACUGCAGUGGGCAGUGCC 69 Direction 5'-3' GGCAUUGCUGCCUCUUUCCAU 70 Direction 5'-3' GCAUUGCUGCCUCUUUCCAUU 71 Direction 5'-3' CUCUUUCCAUUCUGCCGUCUU 72 Direction 5'-3' UCAGCCUCCUCAAAGCCAACA 73 Direction 5'-3' CAGCCUCCUCAAAGCCAACAA 74 Direction 5'-3' UCCUCAAAGCCAACAAUCCUU 75 Direction 5'-3' UCUCUCCUCUCUACCUGGAUCAU 76 Direction 5'-3' UCUCCUCUACCUGGAUCAUAA 77 Direction 5'-3' CUCCUCUACCUGGAUCAUAAU 78 Direction 5'-3' UACCUGGAUCAUAAUGGCAAU 79 Direction 5'-3' CCUGGAUCAUAAUGGCAAUGU 80Senso 5'-3' AUCAUAAUGGCAAUGUGGUCA 81 Senso 5'-3' UCAUAAUGGCAAUGUGGUCAA 82 Senso 5'-3' CAUAAUGGCAAUGUGGUCAAG 83 Senso 5'-3' AUAAUGGCAAUGUGGUCAAGA 84 Senso 5'-3' UAAUGGCAAUGUGGUCAAGAC Petition 870250080602, dated 08 / 09 / 2025, pages 121 / 193 107 / 138 SEQ ID NO: Description Sequence 85 Direction 5'-3' AAUGGCAAUGUGGUCAAGACG 86 Direction 5'-3' CAAUGUGGUCAAGACGGAUGU 87 Direction 5'-3' CAAGACGGAUGUGCCAGAUAU 88 Direction 5'-3' GAGGCCUGUGGCUGCAGCUAG 89 Direction 5'-3' AGGCCUGUGGCUGCAGCUAGC 90 Direction 5'-3' GGCCUGUGGCUGCAGCUAGCA 91 Direction 5'-3' GCCUGUGGCUGCAGCUAGCAA 92 Direction 5'-3' CCUGUGGCUGCAGCUAGCAAG 93 Direction 5'-3' GCUUUGGAGUGAAGAGACCAA 94 Direction 5'-3' CAACCACCUGGCAAAUUGACU 95 Sense 5'-3' ACCACCUGGCAAUAUGACUCA 96 Direction 5'-3' CACCUGGCAAUAUGACUCACU 97 Direction 5'-3' GGACCCAAAUGGGCACUUUCU 98 Direction 5'-3' CCCAAAUGGGCACUUUCUUGU 99 Direction 5'-3' CAAAUGGGCACUUUCUUGUCU 100 Direction 5'-3' GGCACUUUCUUGUCUGAGACU 101 Direction 5'-3' CACUUUCUUGUCUGAGACU 102 Direction 5'-3' CUUGUCUGAGACUCUGGCUUA 103 Direction 5'-3' AGGGAAGGCAGAGAAAAAUUA 104 Direction 5'-3' GGGAAGGCAGAGAAAAAUUAC 105 Direction 5'-3' AGCCUCUCCCAAGAUGAGAAA 106 Direction 5'-3' CCUCUCCCAAGAUGAGAAAGU 107 Direction 5'-3' CUCCCAAGAUGAGAAAGUCCU 108 Direction 5'-3' GGGGAGGAGGAAGCAGAUAGA 109 Direction 5'-3' GGGAGGAGGAAGCAGAUAGAU 110 Direction 5'-3'CAGAAACAGGAGUCAGGAAAA 111 Senso 5'-3' GCACUAAGCCUAAGAAGUUCC 112 Senso 5'-3' CCCACUGGGAGACAAGCAUUU 113 Senso 5'-3' CCACUGGGAGACAAGCAUUUA 114 Senso 5'-3' ACUGGGAGACAAGCAUUUAUA 115 Senso 5'-3' UGGGAGACAAGCAUUUAUACU Petition 870250080602, dated 08 / 09 / 2025, pp. 122 / 193 108 / 138 SEQ ID NO: Description Sequence 116 Sense 5'-3' GGGAGACAAGCAUUUAUACUU 117 Sense 5'-3' GACAAGCAUUUAUACUUUCUU 118 Sense 5'-3' GAGCCACCGCGCCUGGCUUAU 119 Sense 5'-3' CCACCGCGCCUGGCUUAUACU 120 Sense 5'-3' ACCGCGCCUGGCUUAUACUUU 121 Direction 5'-3' CGCGCCUGGCUUAUACUUUCU 122 Direction 5'-3' GCGCCUGGCUUAUACUUUCUU 123 Direction 5'-3' CGCCUGGCUUAUACUUUCUUA 124 Direction 5'-3' GCCUGGCUUAUACUUUCUUAA 125 Sense 5'-3' CCUGGCUUAUACUUUCUUAAU 126 Direction 5'-3' UGGCUUAUACUUUCUUAAUAA 127 Direction 5'-3' GGCUUAUACUUUCUUAAUAAA 128 Direction 5'-3' CUUAUACUUUCUUAAUAAAA 129 Direction 5'-3' AGGGGUGUCCACAAAGUCAAA 130 Direction 5'-3' GGGGUGUCCACAAAGUCAAAG 131 Direction 5'-3' UCAUAAUAAUACUAACAUGUU 132 Direction 5'-3' ACUAACAUGUUAUUUGCCUUU 133 Direction 5'-3' GUUAUUUGCCUUUUGAAUUCU 134 Direction 5'-3' UGCCUUUUGAAUUCUCAUUAU 135 Direction 5'-3' GCCUUUUGAAUUCUCUCAUUAUC 136 Direction 5'-3' CCUUUUGAAUUCUCUCAUUAUCU 137 Direction 5'-3' CUUUUGAAUUCUCUCAUUAUCUU 138 Direction 5'-3' UGAAUUCUCAUUAUCUUAAAA 139 Direction 5'-3' GAAUUCUCAUUAUCUUAAAAU 140 Direction 5'-3' CCGUGUGACAUGUGAUUACAU 141 Direction 5'-3'UGUGACAUGUGAUUACAUCAU 142 Senso 5'-3' UGACAUGUGAUUACAUCAUCU 143 Senso 5'-3' GACAUGUGAUUACAUCAUCUU 144 Senso 5'-3' UCUUUCUGACAUCAUUGUUAA 145 Senso 5'-3' CUUUCUGACAUCAUUGUUAAU 146 Senso 5'-3' GACAUCAUUGUUAAUGGAAUG Petition 870250080602, dated 08 / 09 / 2025, pp. 123 / 193 109 / 138 SEQ ID NO: Description Sequence 147 Sense 5'-3' GUUAAUGGAAUGUGUGCUUGU 147 Nonsense 5'-3' AUGGAUAGCUGUGCUUGACCCUC 148 Nonsense 5'-3' AUCAUCUGAUGGAUAGCUGUGCU 149 Nonsense 5'-3' AGAUCAUCUGAUGGAUAGCUGUG 150 Nonsense 5'-3' UAGAUCAUCUGAUGGAUAGCUGU 151 Nonsense 5'-3' AGUAGAUCAUCUGAUGGAUAGCU 152 Nonsense 5'-3' AAGUAGAUCAUCUGAUGGAUAGC 153 Nonsense 5'-3' UGAAAGUAGAUCAUCUGAUGGAU 154 Nonsense 5'-3' ACUCAGGAAGGCUGAAAGUAGAU 155 Nonsense 5'-3' AGCCACCUGUCUUCUAUUGUCUG 156 Nonsense 5'-3' AGUGACAGCAGACACCACUGCCA 157 Nonsense 5'-3' UGAUUGCUGGGGGCCAAUGAGGG 158 Nonsense 5'-3' AGUUUGGAGCCCCCACAGGAGGG 159 Nonsense 5'-3' UUGCUGCUUGGCUAGCUCCAGCA 160 Nonsense 5'-3' UUUGCUGCUUGGCUAGCUCCAGC 161 Nonsense 5'-3' AUUUGCUGCUUGGCUAGCUCCAG 162 Nonsense 5'-3' GAUUUGCUGCUUGGCUAGCUCCA 163 Nonsense 5'-3' GGAUUUGCUGCUUGGCUAGCUCC 164 Nonsense 5'-3' AGGAUUUGCUGCUUGGCUAGCUC 165 Nonsense 5'-3' CCAGGAUUUGCUGCUUGGCUAGC 166 Nonsense 5'-3' AUCCAGGAUUUGCUGCUUGGCUA 167 Nonsense 5'-3'UUAUUCUGGGACGACUGGUCAGG 168 Nonsense 5'-3' AGUUAUUCUGGGACGACUGGUCA 169 Nonsense 5'-3' AGGAUGAGUUAUUCUGGGACGAC 170 Nonsense 5'-3' UCCGGAGGGCUCUGGUCAGCGCU 171 Nonsense 5'-3' CUCCGGAGGGCUCUGGUCAGCGC 172 Nonsense 5'-3' UCUCCGGAGGGCUCUGGUCAGCG 173 Nonsense 5'-3' GUCUCCGGAGGGCUCUGGUCAGC 174 Nonsense 5'-3' AGUCUCCGGAGGGCUCUGGUCAG 175 Nonsense 5'-3' UAGUCUCCGGAGGGCUCUGGUCA 176 Nonsense 5'-3' AUGACCUCCUCCCCAUUCCCUGG Petition 870250080602, dated 08 / 09 / 2025, pp. 124 / 193 110 / 138 SEQ ID NO: Description Sequence 177 Nonsense 5'-3' UAGCAAAGCUGAUGACCUCCUCC 178 Nonsense 5'-3' AGUAGCAAAGCUGAUGACCUCCU 179 Nonsense 5'-3' AGUCUGUGACAGUAGCAAAGCUG 180 Nonsense 5'-3' AUGGUACAGGUGGUGGGACCGAG 181 Nonsense 5'-3' CAUGGUACAGGUGGUGGGACCGA 182 Nonsense 5'-3' GCAUGGUACAGGUGGUGGGACCG 183 Nonsense 5'-3' GGCAUGGUACAGGUGGUGGGACC 184 Nonsense 5'-3' GGGCAUGGUACAGGUGGUGGGAC 185 Nonsense 5'-3' CGGGCAUGGUACAGGUGGUGGGA 186 Nonsense 5'-3' GCGGGCAUGGUACAGGUGGUGGG 187 Nonsense 5'-3' GGCGGGCAUGGUACAGGUGGUGG 188 Nonsense 5'-3' AGGCGGGCAUGGUACAGGUGGUG 189 Nonsense 5'-3' CAGGCGGGCAUGGUACAGGUGGU 190 Nonsense 5'-3' AAAGAGUGCCAGGAAGGGUGGGG 191 Nonsense 5'-3' AGCAAAGAGUGCCAGGAAGGGUG 192 Nonsense 5'-3' AUCCUCAAGCAAAGAGUGCCAGG 193 Nonsense 5'-3' AGAUCCUCAAGCAAAGAGUGCCA 194 Nonsense 5'-3' AAGAUCCUCAAGCAAAGAGUGCC 195 Nonsense 5'-3' UCUCACCCCUCAAGCCACUAGAG 196 Nonsense 5'-3' AGACUUCUCACCCCUCAAGCCAC 197 Nonsense 5'-3' AGUUUCAGGACACCAGACUUCUC 198 Nonsense 5'-3'AGUUGCAGUUUCAGGACACCAGA 199 Nonsense 5'-3' UAGUUGCAGUUUCAGGACACCAG 200 Nonsense 5'-3' CUUAAGCUCUAGGAAGGGCUGCU 201 Nonsense 5'-3' AUCUUAAGCUCUAGGAAGGGCUG 202 Nonsense 5'-3' AUUGGCUCGGAUCUUAAGCUCUA 203 Nonsense 5'-3' UCCUGGAAGUCUACGUAAUGGUC 204 Nonsense 5'-3' AUUCAGCUGGUACCCCUCGGGCU 205 Nonsense 5'-3' UAAUUCAGCUGGUACCCCUCGGG 206 Nonsense 5'-3' UGCAGUAAUUCAGCUGGUACCCC 207 Nonsense 5'-3' CUGCAGUAAUUCAGCUGGUACCC Petition 870250080602, dated 08 / 09 / 2025, pages 125 / 193 111 / 138 SEQ ID NO: Description Sequence 208 Nonsense 5'-3' ACUGCAGUAAUUCAGCUGGUACC 209 Nonsense 5'-3' CACUGCAGUAAUUCAGCUGGUAC 210 Nonsense 5'-3' CCACUGCAGUAAUUCAGCUGGUA 211 Nonsense 5'-3' GCCCACUGCAGUAAUUCAGCUGG 212 Nonsense 5'-3' UGCCCACUGCAGUAAUUCAGCUG 213 Nonsense 5'-3' CUGCCCACUGCAGUAAUUCAGCU 214 Nonsense 5'-3' GGCACUGCCCACUGCAGUAAUUC 215 Nonsense 5'-3' AUGGAAAGAGGCAGCAAUGCCUG 216 Nonsense 5'-3' AAUGGAAAGAGGCAGCAAUGCCU 217 Nonsense 5'-3' AAGACGGCAGAAUGGAAAGAGGC 218 Nonsense 5'-3' UGUUGGCUUUGAGGAGGCUGAAG 219 Nonsense 5'-3' UUGUUGGCUUUGAGGAGGCUGAA 220 Nonsense 5'-3' AAGGAUUGUUGGCUUUGAGGAGG 221 Nonsense 5'-3' AUGAUCCAGGUAGAGGAGAGAGA 222 Nonsense 5'-3' UUAUGAUCCAGGUAGAGGAGAGA 223 Nonsense 5'-3' AUUAUGAUCCAGGUAGAGGAGAG 224 Nonsense 5'-3' AUUGCCAUUAUGAUCCAGGUAGA 225 Nonsense 5'-3' ACAUUGCCAUUAUGAUCCAGGUA 226 Nonsense 5'-3' UGACCACAUUGCCAUUAUGAUCC 227 Nonsense 5'-3' UUGACCACAUUGCCAUUAUGAUC 228 Nonsense 5'-3' CUUGACCACAUUGCCAUUAUGAU 229 Nonsense 5'-3'UCUUGACCACAUUGCCAUUAUGA 230 Nonsense 5'-3' GUCUUGACCACAUUGCCAUUAUG 231 Nonsense 5'-3' CGUCUUGACCACAUUGCCAUUAU 232 Nonsense 5'-3' ACAUCCGUCUUGACCACAUUGCC 233 Nonsense 5'-3' AUAUCUGGCACAUCCGUCUUGAC 234 Nonsense 5'-3' CUAGCUGCAGCCACAGGCCUCCA 235 Nonsense 5'-3' GCUAGCUGCAGCCACAGGCCUCC 236 Nonsense 5'-3' UGCUAGCUGCAGCCACAGGCCUC 237 Nonsense 5'-3' UUGCUAGCUGCAGCCACAGGCCU 238 Nonsense 5'-3' CUUGCUAGCUGCAGCCACAGGCC Petition 870250080602, dated 08 / 09 / 2025, pp. 126 / 193 112 / 138 SEQ ID NO: Description Sequence 239 Nonsense 5'-3' UUGGUCUCUUCACUCCAAAGCCC 240 Nonsense 5'-3' AGUCAUAUUGCCAGGUGGUUGUU 241 Nonsense 5'-3' UGAGUCAUAUUGCCAGGUGGUUG 242 Nonsense 5'-3' AGUGAGUCAUAUUGCCAGGUGGU 243 Nonsense 5'-3' AGAAAGUGCCCAUUUGGGUCCCA 244 Nonsense 5'-3' ACAAGAAAGUGCCCAUUUGGGUC 245 Nonsense 5'-3' AGACAAGAAAGUGCCCAUUUGGG 246 Nonsense 5'-3' AGUCUCAGACAAGAAAGUGCCCA 247 Nonsense 5'-3' AGAGUCUCAGACAAGAAAGUGCC 248 Antisense 5'-3' UAAGCCAGAGUCUCAGACAAGAA 249 Antisense 5'-3' UAAUUUUUCUCUGCCUUCCCUCC 250 Antisense 5'-3' GUAAUUUUUCUCUGCCUUCCCUC 251 Antisense 5'-3' UUUCUCAUCUUGGGAGAGGCUAA 252 Antisense 5'-3' ACUUUCUCAUCUUGGGAGAGGCU 253 Antisense 5'-3' AGGACUUUCUCAUCUUGGGAGAG 254 Antisense 5'-3' UCUAUCUGCUUCCUCCUCCCCUC 255 Antisense 5'-3' AUCUAUCUGCUUCCUCCUCCCCU 256 Antisense 5'-3' UUUUCCUGACUCCUGUUUCUGGG 257 Nonsense 5'-3' GGAACUUCUUAGGCUUAGUGCCU 258 Nonsense 5'-3' AAAUGCUUGUCUCCCAGUGGGUC 259 Nonsense 5'-3' UAAAUGCUUGUCUCCCAGUGGGU 260 Nonsense 5'-3'UAUAAAUGCUUGUCUCCCAGUGG 261 Nonsense 5'-3' AGUAUAAAUGCUUGUCUCCCAGU 262 Nonsense 5'-3' AAGUAUAAAUGCUUGUCUCCCAG 263 Nonsense 5'-3' AAGAAAGUAUAAAUGCUUGUCUC 264 Nonsense 5'-3' AUAAGCCAGGCGCGGUGGCUCAC 265 Nonsense 5'-3' AGUAUAAGCCAGGCGCGGUGGCU 266 Nonsense 5'-3' AAAGUAUAAGCCAGGCGCGGUGG 267 Nonsense 5'-3' AGAAAGUAUAAGCCAGGCGCGGU 268 Nonsense 5'-3' AAGAAAGUAUAAGCCAGGCGCGG 269 Nonsense 5'-3' UAAGAAAGUAUAAGCCAGGCGCG Petition 870250080602, dated 08 / 09 / 2025, pp. 127 / 193 113 / 138 SEQ ID NO: Description Sequence 270 Nonsense 5'-3' UUAAGAAAGUAUAAGCCAGGCGC 271 Nonsense 5'-3' AUUAAGAAAGUAUAAGCCAGGCG 272 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 273 Nonsense 5'-3' UUUAU UAAGAAAGUAUAAGCCAG 274 Nonsense 5'-3' UUUUUAUUAAGAAAGUAUAAGCC 275 Nonsense 5'-3' UUUGACUUUGUGGACACCCCUGA 276 Nonsense 5'-3' CUUUGACUUUGUGGACACCCCUG 277 Nonsense 5'-3' AACAUGUUAGUAUUAUUAUGAAA 278 Nonsense 5'-3' AAAGGCAAAUAACAUGUUAGUAU 279 Nonsense 5'-3' AGAAUUCAAAAGGCAAAUAACAU 280 Nonsense 5'-3' AUAAUGAGAAUUCAAAAGGCAAA 281 Nonsense 5'-3' GAUAAUGAGAAUUCAAAAGGCAA 282 Nonsense 5'-3' AGAUAAUGAGAAUUCAAAAGGCA 283 Nonsense 5'-3' AAGAUAAUGAGAAUUCAAAAGGC 284 Nonsense 5'-3' UUU UAAGAUAAU GAGAAU U CAAA 285 Nonsense 5'-3' AUUU UAAGAUAAUGAGAAU U CAA 286 Nonsense 5'-3' AUGUAAUCACAUGUCACACGGCC 287 Nonsense 5'-3' AUGAUGUAAUCACAUGUCACACG 288 Nonsense 5'-3' AGAUGAUGUAAUCACAUGUCACA 289 Nonsense 5'-3' AAGAUGAUGUAAUCACAUGUCAC 290 Nonsense 5'-3' UUAACAAUGAUGUCAGAAAGAUG 291 Nonsense5'-3' AUUAACAAUGAUGUCAGAAAGAU 292 Nonsense 5'-3' CAUUCCAUUAACAAUGAUGUCAG 293 Nonsense 5'-3' ACAAGCACACAUUCCAUUAACAA 294 Sense 5'-3' (modified) g*g*gu caAg CACagcuaucca u 295 Sense 5'-3' (modified) c*a*cagcUaUCCaucagaugau 296 Sense 5'-3' (modified) c*a*gcuaUcCAUcagaugaucu 297 Sense 5'-3' (modified) a*g*cuauCcAUCagaugaucua Petition 870250080602, dated 09 / 08 / 2025, pp. 128 / 193 114 / 138 SEQ ID NO: Description Sequence 298 Sense 5'-3' (modified) c*u*auccAuCAGaugaucuacu 299 Sense 5'-3' (modified) u*a*uccaUcAGAugaucuacuu 300 Sense 5'-3' (modified) c*c*aucaGaUGAucuacuuuca 301 Sense 5'-3' (modified) c*u*acuuUcAGCcuuccugagu 302 Sense 5'-3' (modified) g*a*caauAgAAGacagguggcu 303 Sense 5'-3' (modified) g*c*agugGuGUCugcugucacu 304 Sense 5'-3' (modified) c*u*cauuGgCCCccagcaauca 305 Sense 5'-3' (modified) c*u*ccu gUgGGGgcu ccaaacu 306 Senso 5'-3' (modified) c*u*ggagCuAGCcaagcagcaa 307 Senso 5'-3' (modified) u*g*gagcUaGCCaagcagcaaa 308 Senso 5'-3' (modified) g*g*agcuAgCCAagcagcaaau 309 Senso 5'-3' (modified) g*a*gcuaGcCAAgcagcaaauc 310 Senso 5'-3' (modified) a*g*cuagCcAAGcagcaaaucc 311 Senso 5'-3' (modified) g*c*uagcCaAGCagcaaauccu 312 Senso 5'-3' (modified) u *a*g ccaAg CAGcaaauccu gg 313 Senso 5'-3' (modified) g*c*caagCaGCAaauccuggau Petition 870250080602, dated 09 / 08 / 2025, p. 129 / 193 115 / 138 SEQ ID NO: Description Sequence 314 Sense 5'-3' (modified) u *g *accaGu CGU cccagaauaa 315 Sense 5'-3' (modified) a*c*caguCgUCCcagaauaacu 316 Sense 5'-3' (modified) c*g*ucccAgAAUaacucauccu 317 Sense 5'-3' (modified) c*g*cugaCcAGAg cccu ccg ga 318 Sense 5'-3' (modified) g*c*ugacCaGAGcccuccggag 319 Sense 5'-3' (modified) c*u*gaccAgAGCccuccggaga 320 Sense 5'-3' (modified) u*g*accaGaGCCcuccggagac 321 Sense 5'-3' (modified) g*a*ccagAgCCCuccggagacu 322 Senso 5'-3' (modified) a*c*cagaGcCCUccggagacua 323 Senso 5'-3' (modified) a*g*ggaaUgGGGaggaggucau 324 Senso 5'-3' (modified) a*g*gaggUcAUCagcuuugcua 325 Sense 5'-3' (modified) g*a*ggucAuCAGcuuugcuacu 326 Sense 5'-3' (modified) g*c*uuugCuACUgucacagacu 327 Sense 5'-3' (modified) c*g*guccCaCCAccuguaccau 328 Sense 5'-3' (modified) g *g*ucccAcCACcu g uaccaug 329 Sense 5'-3' (modified) g*u*cccaCcACCuguaccaugc Petition 870250080602, dated 08 / 09 / 2025, pp. 130 / 193 116 / 138 SEQ ID NO: Description Sequence 330 Senso 5'-3' (modified) u*c*ccacCaCCUguaccaugcc 331 Senso 5'-3' (modified) c*c*caccAcC UGua cca ug ccc 332 Senso 5'-3' (modified) c*c*accaCcUGUaccaugcccg 333 Senso 5'-3' (modified) c*a*ccacC u G UAccaug cccg c 334 Senso 5'-3' (modified) a*c*caccUg UACcaug cccg cc 335 Senso 5'-3' (modified) c*c*accu GuACCaug cccg ccu 336 Senso 5'-3' (modified) c*a*ccu gUaCCAug cccg ccu g 337 Sense 5'-3' (modified) c*c*acccU uCCUggcacucuuu 338 Senso 5'-3' (modified) c*c*cuucCuGGCacucuuugcu 339 Senso 5'-3' (modified) u*g*gcacUcUUUgcuugaggau 340 Senso 5'-3' (modified) g*c*acucUuUGCuugaggaucu 341 Senso 5'-3' (modified) c*a*cucuUuGCUugaggaucuu 342 Senso 5'-3' (modified) c*u*agugGcUUGaggggugaga 343 Senso 5'-3' (modified) g*g*cuugAgGGGugagaagucu 344 Senso 5'-3' (modified) g*a*agucUgGUGuccugaaacu 345 Sense 5'-3' (modified) u*g*guguCcUGAaacugcaacu Petition 870250080602, dated 09 / 08 / 2025, pp. 131 / 193 117 / 138 SEQ ID NO: Description Sequence 346 Sense 5'-3' (modified) g*g*ugucCuGAAacugcaacua 347 Sense 5'-3' (modified) c*a*gcccUuCCUagagcuuaag 348 Sense 5'-3' (modified) g*c*ccuuCcUAGagcuuaagau 349 Sense 5'-3' (modified) g*a*gcuuAaGAUccgagccaau 350 Sense 5'-3' (modified) c*c*auuaCgUAGacuuccagga 351 Sense 5'-3' (modified) c*c*cgagGgG UAccagcu gaau 352 Sense 5'-3' (modified) c*g*agggGuACCagcugaauua 353 Sense 5'-3' (modified) g*g*uaccAgCUGaauuacugca 354 Senso 5'-3' (modified) g*u*accaGcUGAauuacugcag 355 Senso 5'-3' (modified) u*a*ccagCuGAAuuacugcagu 356 Senso 5'-3' (modified) a*c*cagcUgAAUuacugcagug 357 Sense 5'-3' (modified) c*c*agcuGaAUUacugcagugg 358 Sense 5'-3' (modified) a*g*cugaAuUACugcagugggc 359 Sense 5'-3' (modified) g*c*ugaaUuACUgcagugggca 360 Sense 5'-3' (modified) c*u*gaauUaCUGcagugggcag 361 Senso 5'-3' (modified) a*u*uacuGcAGUgggcagugcc Petition 870250080602, dated 08 / 09 / 2025, pages 132 / 193 118 / 138 SEQ ID NO: Description Sequence 362 Sense 5'-3' (modified) g*g*cauuGcUGCcucuuuccau 363 Sense 5'-3' (modified) g*c*auugCuGCCucuuuccauu 364 Sense 5'-3' (modified) c*u*cuuuCcAUUcugccgucuu 365 Sense 5'-3' (modified) u*c*agccUcCUCaaagccaaca 366 Sense 5'-3' (modified) c*a*gccuCcUCAaagccaacaa 367 Sense 5'-3' (modified) u*c*cucaAaGCCaacaauccuu 368 Sense 5'-3' (modified) u*c*ucucCuCUAccuggaucau 369 Sense 5'-3' (modified) u*c*uccuCuACCuggaucauaa 370 Senso 5'-3' (modified) c*u*ccucUaCCUggaucauaau 371 Senso 5'-3' (modified) u*a*ccugGaUCAuaauggcaau 372 Senso 5'-3' (modified) c*c*uggaUcAUAauggcaaugu 373 Sense 5'-3' (modified) a*u*cauaAuGGCaaugugguca 374 Sense 5'-3' (modified) u*c*auaaUgGCAauguggucaa 375 Sense 5'-3' (modified) c*a*uaauGgCAAuguggucaag 376 Sense 5'-3' (modified) a*u*aaugGcAAUguggucaaga 377 Sense 5'-3' (modified) u*a*auggCaAUGuggucaagac Petition 870250080602, dated 09 / 08 / 2025, pp. 133 / 193 119 / 138 SEQ ID NO: Description Sequence 378 Sense 5'-3' (modified) a*a*uggcAaUGUggucaagacg 379 Sense 5'-3' (modified) c*a*auguGgUCAagacggaugu 380 Sense 5'-3' (modified) c*a*agacGgAUGugccagauau 381 Sense 5'-3' (modified) g*a*ggccUgUGGcugcagcuag 382 Sense 5'-3' (modified) a*g*gccuGuGGCugcagcuagc 383 Sense 5'-3' (modified) g*g*ccugUgGCUgcagcuagca 384 Sense 5'-3' (modified) g*c*cuguGgCUGcagcuagcaa 385 Sense 5'-3' (modified) c*c*ugugGcUGCagcuagcaag 386 Senso 5'-3' (modified) g*c*uuugGaGUGaagagaccaa 387 Senso 5'-3' (modified) c*a*accaCcUGGcaauaugacu 388 Senso 5'-3' (modified) a*c*caccUg G CAa uaugacuca 389 Senso 5'-3' (modified) c*a*ccugGcAAUaugacucacu 390 Senso 5'-3' (modified) g*g *acccAaA UGggcacuuucu 391 Senso 5'-3' (modified) c*c*caaaUgGGCacuuucuugu 392 Senso 5'-3' (modified) c*a*aaugGgCACuuucuugucu 393 Sense 5'-3' (modified) g*g*cacuUuCUUgucugagacu Petition 870250080602, dated 09 / 08 / 2025, pp. 134 / 193 120 / 138 SEQ ID NO: Description Sequence 394 Sense 5'-3' (modified) c*a*cuuuCuUGUcugagacucu 395 Sense 5'-3' (modified) c*u*ugucUgAGAcucuggcuua 396 Sense 5'-3' (modified) a*g*ggaaGgCAGagaaaaauua 397 Sense 5'-3' (modified) g*g*gaagGcAGAgaaaaauuac 398 Sense 5'-3' (modified) a*g*ccucUcCCAagaugagaaa 399 Sense 5'-3' (modified) c*c*ucucCcAAGaugagaaagu 400 Sense 5'-3' (modified) c*u*cccaAgAUGagaaaguccu 401 Sense 5'-3' (modified) g*g*ggagGaGGAagcagauaga 402 Senso 5'-3' (modified) g*g*gaggAgGAAgcagauagau 403 Senso 5'-3' (modified) c*a*gaaaCaGGAgucaggaaaa 404 Senso 5'-3' (modified) g*c*acuaAgCCUaagaaguucc 405 Senso 5'-3' (modified) c*c*cacuGgGAGacaagcauuu 406 Senso 5'-3' (modified) c*c*acugGgAGAcaagcauuua 407 Senso 5'-3' (modified) a*c*ugggAgACAagcauuuaua 408 Senso 5'-3' (modified) u*g*ggagAcAAGcauuuauacu 409 Sense 5'-3' (modified) g*g*gagaCaAGCauuauacuu Petition 870250080602, dated 09 / 08 / 2025, pp. 135 / 193 121 / 138 SEQ ID NO: Description Sequence 410 Sense 5'-3' (modified) g*a*caagCaUUUauacuuucuu 411 Sense 5'-3' (modified) g*a*gccaCcGCGccuggcuuau 412 Sense 5'-3' (modified) c*c*accgCgCCUggcuuauacu 413 Sense 5'-3' (modified) a*c*cgcgCcUGGcuuauacuuu 414 Sense 5'-3' (modified) c*g*cgccUgGCUuauacuuucu 415 Sense 5'-3' (modified) g*c*gccuGgCUUauacuuucuu 416 Sense 5'-3' (modified) c*g*ccugGcUUAuacuuucuua 417 Sense 5'-3' (modified) g*c*cuggCuUAUacuuuucuuaa 418 Senso 5'-3' (modified) c*c*uggcUuAUAcuuucuuaau 419 Senso 5'-3' (modified) u*g*gcuuAuACUuucuuaauaa 420 Senso 5'-3' (modified) g*g*cuuaUaCUUucuuaauaaa 421 Senso 5'-3' (modified) c*u*uauaCuUUCuuaauaaaaa 422 Senso 5'-3' (modified) a*g*ggguGuCCAaagucaaa 423 Senso 5'-3' (modified) g*g*ggugUcCACaaagucaaag 424 Sense 5'-3' (modified) u*c*auaaUaAUAcuaacauguu 425 Senso 5'-3' (modified) a*c*uaacAuGUUauuugccuuu Petition 870250080602, dated 08 / 09 / 2025, pp. 136 / 193 122 / 138 SEQ ID NO: Description Sequence 426 Sense 5'-3' (modified) g*u*uauuUgCCUuuugaauucu 427 Sense 5'-3' (modified) u*g*ccuuUuGAAuucucauuau 428 Sense 5'-3' (modified) g*c*cuuuUgAAUucucauuauc 429 Sense 5'-3' (modified) c*c*uuuuGaAUUcucauuaucu 430 Sense 5'-3' (modified) c*u*uuugAaUUCucauuaucuu 431 Sense 5'-3' (modified) u*g*aauuCuCAUuaucuuaaaa 432 Sense 5'-3' (modified) g*a*auucUcAUUaucuuaaaau 433 Sense 5'-3' (modified) c*c*guguGaCAUgugauuacau 434 Sense 5'-3' (modified) u*g*ugacAuGUGauuacaucau 435 Sense 5'-3' (modified) u*g*acauGuGAUuacaucaucu 436 Sense 5'-3' (modified) g*a*caugUgAUUacaucaucuu 437 Senso 5'-3' (modified) u*c*uuucUgACAucauuguuaa 438 Senso 5'-3' (modified) c*u*uucuGaCAUcauuguuaau 439 Senso 5'-3' (modified) g*a*caucAuUGUuaauggaaug 440 Senso 5'-3' (modified) g*u*uaauGgAAUgugugcuugu 441 Nonsense 5'-3' (modified) a*U*ggaUaGCugugCuUgaccc*u*c Petition 870250080602, dated 09 / 08 / 2025, pp. 137 / 193 123 / 138 SEQ ID NO: Description Sequence 442 Nonsense 5'-3' (modified) a*U*cauCuGAuggaUaGcugug*c*u 443 Nonsense 5'-3' (modified) a*G*aucAuCUgaugGaUagcug*u*g 444 Nonsense 5'-3' (modified) u*A*gauCaUCugauGgAuagcu*g*u 445 Nonsense 5'-3' (modified) a*G*uagAuCAucugAuGgauag*c*u 446 Nonsense 5'-3' (modified) a*A*guaGaUCaucuGaUggaua*g*c 447 Nonsense 5'-3' (modified) u*G*aaaGuAGaucaUcUgaugg*a*u 448 Nonsense 5'-3' (modified) a*C*ucaGgAAggcuGaAaguag*a*u 449 Nonsense 5'-3' (modified) a*G*ccaCcUGucuuCuAuuguc*u*g 450 Nonsense 5'-3' (modified) a*G*ugaCaGCagacAcCacugc*c*a 451 Nonsense 5'-3' (modified) u*G*auuGcUGggggCcAaugag*g*g 452 Nonsense 5'-3' (modified) a*G*uuuGgAGccccCaCaggag*g*g 453 Nonsense 5'-3' (modified) u*U*gcuGcUUggcuAgCuccag*c*a 454 Nonsense 5'-3' (modified) u*U*ugcUgCUuggcUaGcucca*g*c 455 Nonsense 5'-3' (modified) a*U*uugCuGCuuggCuAgcucc*a*g 456 Nonsense 5'-3' (modified) g*A*uuuGcUGcuugGcUagcuc*c*a 457 Nonsense 5'-3' (modified)g*G*auuUgCUgcuuGgCuagcu*c*c Petition 870250080602, dated 09 / 08 / 2025, pp. 138 / 193 124 / 138 SEQ ID NO: Description Sequence 458 Nonsense 5'-3' (modified) a*G*gauUuGCugcuUgGcuagc*u*c 459 Nonsense 5'-3' (modified) c*C*aggAuUUgcugCuUggcua*g*c 460 Nonsense 5'-3' (modified) a*U*ccaGgAUuugcUgCuuggc*u*a 461 Nonsense 5'-3' (modified) u*U*auuCuGGgacgAcUgguca*g*g 462 Nonsense 5'-3' (modified) a*G*uuaUuCUgggaCgAcuggu*c*a 463 Nonsense 5'-3' (modified) a*G*gauGaGUuauuCuGggacg*a*c 464 Nonsense 5'-3' (modified) u*C*cggAgGGcucuGgUcagcg*c*u 465 Nonsense 5'-3' (modified) c*U*ccgGaGGgcucUgGucagc*g*c 466 Nonsense 5'-3' (modified) u*C*uccGgAGggcuCuGgucag*c*g 467 Nonsense 5'-3' (modified) g*U*cucCgGAgggcUcUgguca*g*c 468 Nonsense 5'-3' (modified) a*G*ucuCcGGagggCuCugguc*a*g 469 Nonsense 5'-3' (modified) u*A*gucUcCGgaggGcUcuggu*c*a 470 Nonsense 5'-3' (modified) a*U*gacCuCCucccCaUucccu*g*g 471 Nonsense 5'-3' (modified) u*A*gcaAaGCugauGaCcuccu*c*c 472 Nonsense 5'-3' (modified) a*G*uagCaAAgcugAuGaccuc*c*u 473 Nonsense 5'-3' (modified)a*G*ucuGuGAcaguAgCaaagc*u*g Petition 870250080602, dated 08 / 09 / 2025, pp. 139 / 193 125 / 138 SEQ ID NO: Description Sequence 474 Nonsense 5'-3' (modified) a*U*gguAcAGguggUgGgaccg*a*g 475 Nonsense 5'-3' (modified) c*A*uggUaCAggugGuGggacc*g*a 476 Nonsense 5'-3' (modified) g*C*augGuACagguGgUgggac*c*g 477 Nonsense 5'-3' (modified) g*G*cauGgUAcaggUgGuggga*c*c 478 Nonsense 5'-3' (modified) g*G*gcaUgGUacagGuGguggg*a*c 479 Nonsense 5'-3' (modified) c*G*ggcAuGGuacaGgUggugg*g*a 480 Nonsense 5'-3' (modified) g*C*gggCaUGguacAgGuggug*g*g 481 Nonsense 5'-3' (modified) g*G*cggGcAUgguaCaGguggu*g*g 482 Nonsense 5'-3' (modified) a*G*gcgGgCAugguAcAggugg*u*g 483 Nonsense 5'-3' (modified) c*A*ggcGgGCauggUaCaggug*g*u 484 Nonsense 5'-3' (modified) a*A*agaGuGCcaggAaGggugg*g*g 485 Nonsense 5'-3' (modified) a*G*caaAgAGugccAgGaaggg*u*g 486 Nonsense 5'-3' (modified) a*U*ccuCaAGcaaaGaGugcca*g*g 487 Nonsense 5'-3' (modified) a*G*aucCuCAagcaAaGagugc*c*a 488 Nonsense 5'-3' (modified) a*A*gauCcUCaagcAaAgagug*c*c 489 Nonsense 5'-3' (modified)u*C*ucaCcCCucaaGcCacuag*a*g Petition 870250080602, dated 09 / 08 / 2025, pp. 140 / 193 126 / 138 SEQ ID NO: Description Sequence 490 Nonsense 5'-3' (modified) a*G*acuUcUCacccCuCaagcc*a*c 491 Nonsense 5'-3' (modified) a*G*uuuCaGGacacCaGacuuc*u*c 492 Nonsense 5'-3' (modified) a*G*uugCaGUuucaGgAcacca*g*a 493 Nonsense 5'-3' (modified) u*A*guuGcAGuuucAgGacacc*a*g 494 Nonsense 5'-3' (modified) c*U*uaaGcUCuaggAaGggcug*c*u 495 Nonsense 5'-3' (modified) a*U*cuuAaGCucuaGgAagggc*u*g 496 Nonsense 5'-3' (modified) a*U*uggCuCGgaucUuAagcuc*u*a 497 Nonsense 5'-3' (modified) u*C*cugGaAGucuaCgUaaugg*u*c 498 Nonsense 5'-3' (modified) a*U*ucaGcUGguacCcCucggg*c*u 499 Nonsense 5'-3' (modified) u*A*auuCaGCugguAcCccucg*g*g 500 Nonsense 5'-3' (modified) u*G*cagUaAUucagCuGguacc*c*c 501 Nonsense 5'-3' (modified) c*U*gcaGuAAuucaGcUgguac*c*c 502 Nonsense 5'-3' (modified) a*C*ugcAgUAauucAgCuggua*c*c 503 Nonsense 5'-3' (modified) c*A*cugCaGUaauuCaGcuggu*a*c 504 Nonsense 5'-3' (modified) c*C*acuGcAGuaauUcAgcugg*u*a 505 Nonsense 5'-3' (modified)g*C*ccaCuGCaguaAuUcagcu*g*g Petition 870250080602, dated 09 / 08 / 2025, pp. 141 / 193 127 / 138 SEQ ID NO: Description Sequence 506 Nonsense 5'-3' (modified) u*G*cccAcUGcaguAaUucagc*u*g 507 Nonsense 5'-3' (modified) c*U*gccCaCUgcagUaAuucag*c*u 508 Nonsense 5'-3' (modified) g*G*cacUgCCcacuGcAguaau*u*c 509 Nonsense 5'-3' (modified) a*U*ggaAaGAggcaGcAaugcc*u*g 510 Nonsense 5'-3' (modified) a*A*uggAaAGaggcAgCaaugc*c*u 511 Nonsense 5'-3' (modified) a*A*gacGgCAgaauGgAaagag*g*c 512 Nonsense 5'-3' (modified) u*G*uugGcUUugagGaGgcuga*a*g 513 Nonsense 5'-3' (modified) u*U*guuGgCUuugaGgAggcug*a*a 514 Nonsense 5'-3' (modified) a*A*ggaUuGUuggcUuUgagga*g*g 515 Nonsense 5'-3' (modified) a*U*gauCcAGguagAgGagaga*g*a 516 Nonsense 5'-3' (modified) u*U*augAuCCagguAgAggaga*g*a 517 Nonsense 5'-3' (modified) a*U*uauGaUCcaggUaGaggag*a*g 518 Nonsense 5'-3' (modified) a*U*ugcCaUUaugaUcCaggua*g*a 519 Nonsense 5'-3' (modified) a*C*auuGcCAuuauGaUccagg*u*a 520 Nonsense 5'-3' (modified) u*G*accAcAUugccAuUaugau*c*c 521 Nonsense 5'-3' (modified)u*U*gacCaCAuugcCaUuauga*u*c Petition 870250080602, dated 08 / 09 / 2025, pages 142 / 193 128 / 138 SEQ ID NO: Description Sequence 522 Nonsense 5'-3' (modified) c*U*ugaCcACauugCcAuuaug*a*u 523 Nonsense 5'-3' (modified) u*C*uugAcCAcauuGcCauuau*g*a 524 Nonsense 5'-3' (modified) g*U*cuuGaCCacauUgCcauua*u*g 525 Nonsense 5'-3' (modified) c*G*ucuUgACcacaUuGccauu*a*u 526 Nonsense 5'-3' (modified) a*C*aucCgUCuugaCcAcauug*c*c 527 Nonsense 5'-3' (modified) a*U*aucUgGCacauCcGucuug*a*c 528 Nonsense 5'-3' (modified) c*U*agcUgCAgccaCaGgccuc*c*a 529 Nonsense 5'-3' (modified) g*C*uagCuGCagccAcAggccu*c*c 530 Nonsense 5'-3' (modified) u*G*cuaGcUGcagcCaCaggcc*u*c 531 Nonsense 5'-3' (modified) u*U*gcuAgCUgcagCcAcaggc*c*u 532 Nonsense 5'-3' (modified) c*U*ugcUaGCugcaGcCacagg*c*c 533 Nonsense 5'-3' (modified) u*U*gguCuCUucacUcCaaagc*c*c 534 Nonsense 5'-3' (modified) a*G*ucaUaUUgccaGgUgguug*u*u 535 Nonsense 5'-3' (modified) u*G*aguCaUAuugcCaGguggu*u*g 536 Nonsense 5'-3' (modified) a*G*ugaGuCAuauuGcCaggug*g*u 537 Nonsense 5'-3' (modified)a*G*aaaGuGCccauUuGggucc*c*a Petition 870250080602, dated 09 / 08 / 2025, pp. 143 / 193 129 / 138 SEQ ID NO: Description Sequence 538 Nonsense 5'-3' (modified) a*C*aagAaAGugccCaUuuggg*u*c 539 Nonsense 5'-3' (modified) a*G*acaAgAAagugCcCauuug*g*g 540 Nonsense 5'-3' (modified) a*G*ucuCaGAcaagAaAgugcc*c*a 541 Nonsense 5'-3' (modified) a*G*aguCuCAgacaAgAaagug*c*c 542 Nonsense 5'-3' (modified) u*A*agcCaGAgucuCaGacaag*a*a 543 Nonsense 5'-3' (modified) u*A*auuUuUCucugCcUucccu*c*c 544 Nonsense 5'-3' (modified) g*U*aauUuUUcucuGcCuuccc*u*c 545 Nonsense 5'-3' (modified) u*U*ucuCaUCuuggGaGaggcu*a*a 546 Nonsense 5'-3' (modified) a*C*uuuCuCAucuuGgGagagg*c*u 547 Nonsense 5'-3' (modified) a*G*gacUuUCucauCuUgggag*a*g 548 Nonsense 5'-3' (modified) u*C*uauCuGCuuccUcCucccc*u*c 549 Nonsense 5'-3' (modified) a*U*cuaUcUGcuucCuCcuccc*c*u 550 Nonsense 5'-3' (modified) u*U*uucCuGAcuccUgUuucug*g*g 551 Nonsense 5'-3' (modified) g*G*aacUuCUuaggCuUagugc*c*u 552 Nonsense 5'-3' (modified) a*A*augCuUGucucCcAguggg*u*c 553 Nonsense 5'-3' (modified)u*A*aauGcUUgucuCcCagugg*g*u Petition 870250080602, dated 09 / 08 / 2025, pp. 144 / 193 130 / 138 SEQ ID NO: Description Sequence 554 Nonsense 5'-3' (modified) u*A*uaaAuGCuuguCuCccagu*g*g 555 Nonsense 5'-3' (modified) a*G*uauAaAUgcuuGuCuccca*g*u 556 Nonsense 5'-3' (modified) a*A*g uaU aAAug cuUgUcu ccc*a*g 557 Nonsense 5'-3' (modified) a*A*gaaAgUAuaaaUgCuuguc*u*c 558 Nonsense 5'-3' (modified) a*U*aagCcAGgcgcGgUggcuc*a*c 559 Nonsense 5'-3' (modified) a*G*uauAaGCcaggCgCggugg*c*u 560 Nonsense 5'-3' (modified) a*A*aguAuAAgccaGgCgcggu*g*g 561 Nonsense 5'-3' (modified) a*G*aaaGuAUaagcCaGgcgcg*g*u 562 Nonsense 5'-3' (modified) a*A*gaaAgUAuaagCcAggcgc*g*g 563 Nonsense 5'-3' (modified) u*A*agaAaGUauaaGcCaggcg*c*g 564 Nonsense 5'-3' (modified) u*U*aagAaAGuauaAgCcaggc*g*c 565 Nonsense 5'-3' (modified) a*U*uaaGaAAguauAaGccagg*c*g 566 Nonsense 5'-3' (modified) u*U*auuAaGAaaguAuAagcca*g*g 567 Nonsense 5'-3' (modified) u*U*uauUaAGaaagUaUaagcc*a*g 568 Nonsense 5'-3' (modified) u*U*uuuAuUAagaaAgUauaag*c*c 569 Nonsense 5'-3' (modified)u*U*ugaCuUUguggAcAccccu*g*a Petition 870250080602, dated 09 / 08 / 2025, pp. 145 / 193 131 / 138 SEQ ID NO: Description Sequence 570 Nonsense 5'-3' (modified) c*U*uugAcUUugugGaCacccc*u*g 571 Nonsense 5'-3' (modified) a*A*cauGuUAguauUaUuauga*a*a 572 Nonsense 5'-3' (modified) a*A*aggCaAAuaacAuGuuagu*a*u 573 Nonsense 5'-3' (modified) a*G*aauUcAAaaggCaAauaac*a*u 574 Nonsense 5'-3' (modified) a*U*aauGaGAauucAaAaggca*a*a 575 Nonsense 5'-3' (modified) g*A*uaaUgAGaauuCaAaaggc*a*a 576 Nonsense 5'-3' (modified) a*G*auaAuGAgaauUcAaaagg*c*a 577 Nonsense 5'-3' (modified) a*A*gauAaUGagaaUuCaaaag*g*c 578 Nonsense 5'-3' (modified) u*U*uuaAgAUaaugAgAauuca*a*a 579 Nonsense 5'-3' (modified) a*U*uuuAaGAuaauGaGaauuc*a*a 580 Nonsense 5'-3' (modified) a*U*guaAu CAca ugU cAcacg g *c*c 581 Nonsense 5'-3' (modified) a*U*gauGuAAucacAuGucaca*c*g 582 Nonsense 5'-3' (modified) a*G*augAuGUaaucAcAuguca*c*a 583 Nonsense 5'-3' (modified) a*A*gauGaUGuaauCaCauguc*a*c 584 Nonsense 5'-3' (modified) u*U*aacAaUGauguCaGaaaga*u*g 585 Nonsense 5'-3' (modified)a*U*uaaCaAUgaugUcAgaaag*a*u Petition 870250080602, dated 09 / 08 / 2025, pp. 146 / 193 132 / 138 SEQ ID NO: Description Sequence 586 Antisense 5'-3' (modified) c*A*uucCaUUaacaAuGauguc*a*g 587 Antisense 5'-3' (modified) a*C*aagCaCAcauuCcAuuaac*a*a Petition 870250080602, dated 09 / 08 / 2025, pp. 147 / 193 133 / 138 SEQ ID NO: Description Sequence 588 >NM_031479.5 Homo sapiens inhibin (INHBE) beta subunit E, mRNA AGTAGCCAGACATGAGCTGTGAGG GTCAAGCACAGCTATCCATCAGATG ATCTAC 1 1 1 CAGCCTTCCTGAGTGAGGAGCAGGAG TACCCTTGGCCAAGGGTAGGTGTG GCAGTGGTGTCTGCTGTCACTGTG CCCTCATTGGCCCCCAGCAATCAG ACTCAACAGACGGAGCAACTGCCA TCCGAGGCTCCTGAACCAGGGCCA TTCACCAGGAGCATGCGGCTCCCT GATGTCCAGGCTGGCTGGTGGCTGGGGCC GGGACAGGGTCTGTGTGTCCCTCC TGTGGGGGCTCCAAACTGGCACCC CAAGCAGAACGAGCTCTGGTGCTG GAGCTAGCCAAGCAGCAAATCCTG GATGGGTTGCACCTGACCAGTCGT CCCAGAATAACTCATCCTCCACCCC AGGCAGCGCTGACCAGAGCCCTCCGGAGGGGGGCTG CTCCAGGGAATGGGGAGGAGGTCA TCAGC111GCTACTGTCACAGACTC CACTTCAGCCTACAGCTCCCTGCTC Petition 870250080602, dated 09 / 09 / 2025, p.148 / 193 ACIIIICACC1G1CCAC1CC1CGG 1 CCCACCACCTGTACCATGCCCGCC TGTGGCTGCACGTGCTCCCCACCC TTCCTGGCACTC ! ! ! GCTTGAGGAT CTTCCGATGGGGACCAAGGAGGAG GCGCCAAGGGTCCCGCACTCTCCT GGCTGAGCACCACATCACCAACCT GGGCTGGCATACCTTAACTCTGCC CTCTAGTGGCTTGAGGGGTGAGAA GTCTGGTGTCCTGAAACTGCAACTA GACTGCAGACCCCTAGAAGGCAAC AGCACAGTTACTGGACAACCGAGG CGGCTCTTGGACACAGCAGGACAC CAGCAGCCCTTCCTAGAGCTTAAGA TCCGAGCCAATGAGCCTGGAGCAG GCCGGGCCAGGAGGAGGACCCCC. 134 / 138 SEQ ID NO: Description Sequence 589 Sense 5'-3' ACUCUUUGCUUGAGGAUCUU 590 Sense 5'-3' ACUCUUUGCUUGAGGAUCUU 591 Sense 5'-3' ACAAGCAUUUAUACUUUCUU 592 Sense 5'-3' ACAAGCAUUUAUACUUUCUU 593 Sense 5'-3' GGCUUAUACUUUCUUAAUAA 594 Sense 5'-3' TGGCUUAUACUUUCUUAAUAAUU 595 Sense 5'-3' ACAAGCAUUUAUACUUUCUUU 596 Sense 5'-3' UGAAGAGACCAAGAUGAAGUU 597 Sense 5'-3' AGAGACCAAGAUGAAGUUUCC 598 Antisense 5'-3' AAGAUCCUCAAGCAAAGAGUGCC 599 Nonsense 5'-3' AAGAUCCUCAAGCAAAGAGUGCC 600 Nonsense 5'-3' AAGAAAGUAUAAAUGCUUGUCUC 601 Nonsense 5'-3' AAGAAAGUAUAAAUGCUUGUCUC 602 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 603 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 604 Nonsense 5'-3' UAAGAAAGUAUAAAUGCUUGUCU 605 Nonsense 5'-3' UACUUCAUCUUGGUCUCUUCACU 606 Nonsense 5'-3' UGAAACUUCAUCUUGGUCUCUUC 607 Sense 5'-3' (modified) a*c*ucuUuGCUuGaggaucuu 608 Senso 5'-3' (modified) a*c*ucuUuGCUuGagga(utU)cu(tmU) 609 Senso 5'-3' (modified) a*c*aagCaUUUaUacuuucuu 610 Senso 5'-3' (modified) a*c*aagCaUUUaUacuuucu(tmU) 611Sense 5'-3' (modified) g*g*cuuAuACUuUcuuaauaa 612 Sense 5'-3' (modified) invdT*g*g*cuuAuACUuUcuua(utA)uaa* u*(tmU) 613 Sense 5'-3' (modified) a*c*aagcauUUAuacuuucuuu Petition 870250080602, dated 08 / 09 / 2025, pages 149 / 193 135 / 138 SEQ ID NO: Description Sequence 614 Sense 5'-3' (modified) u*g*aagagaCCAagaugaaguu 615 Sense 5'-3' (modified) a*g*agaccaAGAugaaguuucc 616 Nonsense 5'3' (modified) va*A*gAuCcUcaagcAaAgagug*c*c 617 Nonsense 5'3' (modified) va*A*gAuCcUcaagcAaAgagug*c*c 618 Nonsense 5'3' (modified) va*A*gaaAgUauaaaUgcuuguc*u*c 619 Nonsense 5'3' (modified) va*A*gaaAgUauaaaUgcuuguc*u*c 620 Nonsense 5'3' (modified) vu*U*aUuAaGaaaguAuAagcca*g*g 621 Nonsense 5'3' (modified) vu*U*aUuAaGaaaguAuAagcca*g*g 622 Nonsense 5'3' (modified) vu*A*aGaAaGuauaaAuGcuugucu 623 Nonsense 5'3' (modified) vu*A*cUuCaUcuuggUcUcuucacu 624 Nonsense 5'3' (modified) vu*G*aAaCuUcaucuuggucucuuc 625 Sense 5'-3' (modified) invdT*a*c*ucuUuGCUuGaggaucuu*u*u 626 Sense 5'-3' (modified) invdT*a*c*ucuUuGCUuGagga(utU)cuu *u*(tmU) 627 Senso 5'-3' (modified) invdT*a*c*aagCaUUUaUacuuucuu*u*u 628 Senso 5'-3' (modified) invdT*a*c*aagCaUUUaUacuu(tmU)cuu *u*(tmU) 629 Sense 5'-3' (modified)invdT*g*g*cuuAuACUuUcuuaauaa*u*u Petition 870250080602, dated 08 / 09 / 2025, pages 150 / 193 136 / 138 SEQ ID NO: Description Sequence 630 Sense 5'-3' (modified) g*g*cuuAuACUuUcuuaauaa 631 Sense 5'-3' (modified) C*u*gucaCaGACuccacuucau(L96) 632 Nonsense 5'3' (modified) va*A*gAuCcUcaagcAaAgagug*c*c 633 Nonsense 5'3' (modified) va*A*gAuCcUcaagcAaAgagug*c*c 634 Nonsense 5'3' (modified) va*A*gaaAgUauaaaUgcuuguc*u*c 635 Nonsense 5'3' (modified) va*A*gaaAgUauaaaUgcuuguc*u*c 636 Nonsense 5'3'(modified) vu*U*aUuAaGaaaguAuAagcca*g*g 637 Antisense 5'3'(modified) vu*U*aUuAaGaaaguAuAag(tmC)ca*g* g 638 Antisense 5'3'(modified) A*U*gadAg(Tgn)ggagucUgUgacag*u*a 639 Senso 5'-3' TACUCUUUGCUUGAGGAUCUUUU 640 Senso 5'-3' TACUCUUUGCUUGAGGAUCUUUU 641 Senso 5'-3' TACAAGCAUUUAUACUUUCUUUU 642 Senso 5'-3' TACAAGCAUUUAUACUUUCUUUU 643 Sense 5'-3' TGGCUUAUACUUUCUUAAUAAUU 644 Sense 5'-3' GGCUUAUACUUUCUUAAUAA 645 Sense 5'-3' CUGUCACAGACUCCACUUCAU 646 Nonsense 5'-3' AAGAUCCUCAAGCAAAGAGUGCC 647 Nonsense 5'-3' AAGAUCCUCAAGCAAAGAGUGCC 648 Nonsense 5'-3' AAGAAAGUAUAAAUGCUUGUCUC 649Nonsense 5'-3' AAGAAAGUAUAAAUGCUUGUCUC 650 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 651 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 652 Nonsense 5'-3' AUGAAGTGGAGUCUGUGACAGUA Petition 870250080602, dated 08 / 09 / 2025, pp. 151 / 193 137 / 138 SEQ ID NO: Description Sequence 653 Sense 5'-3' (modified) u*g*gcuuAuACUuucuuaauaa 654 Sense 5'-3' (modified) u*u*ggagugAAGagaccaagau 655 Sense 5'-3' (modified) u*c*uuuccaUUCugccgucuuc 656 Sense 5'-3' (modified) g*g*agacaaGCAuuuauacuuu 657 Sense 5'-3' (modified) g*a*gacaagCAUuuauacuuuc 658 Sense 5'-3' (modified) a*g*agaccaAGAugaaguuucc 659 Sense 5'-3' (modified) a*a*gaaguuCCCugguuuuucc 660 Antisense 5'-3' (modified) u*U*auuAaGAaaguAuAagcca*g*g 661 Nonsense 5'-3' (modified) vu*U*cUuGgUcucuuCaCuccaaag 662 Nonsense 5'-3' (modified) vu*A*aGaCgGcagaaUgGaaagagg 663 Nonsense 5'-3' (modified) vu*A*aGuAuAaaugcUuGucuccca 664 Nonsense 5'-3' (modified) vu*A*aAgUaUaaaugCuUgucuccc 665 Nonsense 5'-3' (modified) vu*G*aAaCuUcaucuuggucucuuc 666 Nonsense 5'-3' (modified) vu*G*aAaAaCcagggAaCuucuuag 667 Senso 5'-3' UGGCUUAUACUUUCUUAAUAA 668 Senso 5'-3' UUGGAGUGAAGAGACCAAGAU 670 Senso 5'-3' UCUUUCCAUUCUGCCGUCUUC 671 Senso 5'-3' GGAGACAAGCAU U UAUACUU U 672 Senso 5'-3'GAGACAAGCAUUAUACUUUC Petition 870250080602, dated 09 / 08 / 2025, pp. 152 / 193 138 / 138 SEQ ID NO: Description Sequence 673 Sense 5'-3' AGAGACCAAGAUGAAGUUUCC 674 Sense 5'-3' AAGAAGUUCCCUGGUUUUUCC 675 Nonsense 5'-3' UUAUUAAGAAAGUAUAAGCCAGG 676 Nonsense 5'-3' UUCUUGGUCUCUUCACUCCAAAG 677 Nonsense 5'-3' UAAGACGGCAGAAUGGAAAGAGG 678 Nonsense 5'-3' UAAGUAUAAAUGCUUGUCUCCCA 679 Nonsense 5'-3' UAAAGUAUAAAUGCUUGUCUCCC 680 Nonsense 5'-3' UGAAACUUCAUCUUGGUCUCUUC 681 Nonsense 5'-3' UGAAAAACCAGGGAACUUCUUAG Incorporation by Reference

[00149] The full disclosure of each of the patents and scientific documents mentioned herein is incorporated by reference for all purposes. EQUIVALENTS

[00150] The disclosure may be incorporated into other specific forms without departing from its essential characteristics. The previous embodiments, therefore, should be considered illustrative and not limiting of the disclosure described herein. The scope of the disclosure is indicated by the appended claims and not by the previous description, and all changes that fall within the meaning and range of equivalence of the claims shall be encompassed by them. Petition 870250080602, dated 08 / 09 / 2025, pages 153 / 193

Claims

1 / 19 CLAIMS 1. Double-stranded ribonucleic acid (dsRNA) for inhibiting Angiotensinogen (INHBE) expression, characterized in that the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides long, wherein: (a) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 598, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 589; (b) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 599, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 590; (c) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 600, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 591;(d) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 601, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 592; (e) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 602, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 593; (f) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 603, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 594; (g) the nonsense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 604, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 595;(h) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 605, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 596; or (i) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 606, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO:

597.

2. Double-stranded ribonucleic acid (dsRNA) to inhibit INHBE expression, characterized in that the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 nucleotides long, wherein: (a) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 616, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 607; (b) the antisense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 617, and the sense strand comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 608; (c) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 618, and the sense tape a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 609;(d) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 619, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 610; (e) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 620, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence of SEQ ID NO: 611; (f) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 621, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 612; (g) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 622, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 613;(h) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 623, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 614; or (i) the antisense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO: 624, and the sense tape comprises a sequence that is at least 70% or 80% identical to the sequence with SEQ ID NO:

615.

3. dsRNA, according to claim 1 or 2, characterized in that INHBE is human INHBE.

4. dsRNA, according to claim 1 or 2, characterized in that INHBE is human INHBE comprising the sequence shown in SEQ ID NO: 588 (NM_031479.5).

5. dsRNA, according to claim 1 or 2, characterized in that the sense strand is 70%, 80%, 90%, 95% or more identical to the sense strand sequence comprising the sequence with SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, Petition 870250080602, dated 08 / 09 / 2025, p. 156 / 193 4 / 19 SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO:

615.

6. dsRNA, according to claim 1 or 2, characterized in that the sense strand comprises at least 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleotides of a sense strand sequence comprising the sequence of SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO:

615.

7. dsRNA, according to claim 1, characterized in that the sense strand comprises: (a) 20 contiguous nucleotides of a sense strand sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615; (b) 21 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615; (c) 22 contiguous nucleotides of a sense strand sequence comprising the sequence with SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615; and / or Petition 870250080602, dated 08 / 09 / 2025, page.157 / 193 5 / 19 (d) 23 contiguous nucleotides of a sense strand sequence comprising the sequence SEQ ID NO: 594 or SEQ ID NO:

612.

8. dsRNA, according to claim 1, characterized in that the antisense strand comprises at least 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO:

624.

9. dsRNA, according to claim 1, characterized in that the antisense strand comprises: (a) 21 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624; (b) 22 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624;and / or (c) 23 contiguous nucleotides of a sense-antisense strand sequence comprising the sequence of SEQ ID NO: 598, Petition 870250080602, dated 08 / 09 / 2025, page. 158 / 193 6 / 19 SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO: 624.; 10. dsRNA, according to claim 1 or 2, characterized in that the sense strand sequence is selected from a sense strand sequence comprising the sequence SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO: 615, and the antisense strand is selected from a sense strand sequence. antisense comprising the sequence of SEQ ID NO: 598, SEQ ID NO: 599, SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO:

624.

11. dsRNA, according to claim 1 or 2, characterized in that the sense strand sequence is selected from a sense strand sequence of SEQ ID NO: 589, SEQ ID NO: 590, SEQ ID NO: 591, SEQ ID NO: 592, SEQ ID NO: 593, SEQ ID NO: 594, SEQ ID NO: 595, SEQ ID NO: 596, SEQ ID NO: 597, SEQ ID NO: 606, SEQ ID NO: 607, SEQ ID NO: 608, SEQ ID NO: 609, SEQ ID NO: 610, SEQ ID NO: 611, SEQ ID NO: 612, SEQ ID NO: 613, SEQ ID NO: 614 or SEQ ID NO:

615.

12. dsRNA, according to claim 1 or 2, characterized in that the antisense strand is selected from an antisense strand sequence of SEQ ID NO: 598, SEQ ID NO: 599, SEQ Petition 870250080602, dated 08 / 09 / 2025, page. 159 / 193 7 / 19 ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, SEQ ID NO: 604, SEQ ID NO: 605, SEQ ID NO: 606, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623 or SEQ ID NO:

624.

13. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 598 and the sense strand comprises the sequence with SEQ ID NO:

589.

14. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 599 and the sense strand comprises the sequence with SEQ ID NO:

590.

15. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 600 and the sense strand comprises the sequence with SEQ ID NO:

591.

16. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 601 and the sense strand comprises the sequence with SEQ ID NO:

592.

17. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 602 and the sense strand comprises the sequence with SEQ ID NO:

593.

18. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 603 and the sense strand comprises the sequence with SEQ ID NO:

594.

19. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence SEQ ID NO: 604 and the sense strand comprises the sequence SEQ ID NO:

595.

20. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 605 and the sense strand comprises the sequence with SEQ ID NO:

596.

21. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 606 and the sense strand comprises the sequence with SEQ ID NO:

597.

22. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 616 and the sense strand comprises the sequence with SEQ ID NO:

607.

23. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 617 and the sense strand comprises the sequence with SEQ ID NO:

608.

24. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 618 and the sense strand comprises the sequence with SEQ ID NO:

609.

25. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 619 and the sense strand comprises the sequence with SEQ ID NO:

610.

26. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 620 and the sense strand comprises the sequence with SEQ ID NO:

611. Petition 870250080602, dated 08 / 09 / 2025, pp. 161 / 193 9 / 19 27. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 621 and the sense strand comprises the sequence with SEQ ID NO:

612.

28. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 622 and the sense strand comprises the sequence with SEQ ID NO:

613.

29. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 623 and the sense strand comprises the sequence with SEQ ID NO:

614.

30. dsRNA, according to claim 11 or 12, characterized in that the antisense strand comprises the sequence with SEQ ID NO: 624 and the sense strand comprises the sequence with SEQ ID NO:

615.

31. dsRNA, according to any one of claims 13 to 30, characterized in that at least one nucleotide of the dsRNA is a modified nucleotide selected from the group consisting of: a 5'-vinyl phosphonate nucleotide, a modified 2'O-methyl nucleotide, an inverted deoxyribonucleotide (3'-linked nucleotide or 5'-linked nucleotide), a nucleotide comprising a 5'-phosphorothioate group, a modified 2'-fluoro nucleotide, a nucleotide comprising a modified nucleotide component represented by Formula (I): Formula (I), and a nucleotide comprising a modified nucleotide component represented by Formula (II): Formula (II); wherein: each of B1 and B2 is a nucleobase; and R1 is selected from the group consisting of hydrogen and C1-6 alkyl; optionally wherein the antisense strand and the sense strand each comprise at least one modified nucleotide.

32. dsRNA, according to any one of claims 1 to 31, characterized in that the antisense strand has a nucleotide overhang at the 3' end compared to the sense strand.

33. dsRNA, according to claim 32, characterized in that the nucleotide overhang at the 3' end comprises 1, 2 or 3 nucleotides compared to the sense strand.

34. dsRNA, according to any one of claims 1 to 33, characterized in that the antisense and sense strands are at least 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary.

35. dsRNA, according to any one of claims 1 to 33, characterized in that the antisense strand and the sense strand are at least 80% complementary.

36. dsRNA, according to any one of claims 1 to 33, characterized in that the antisense strand and the sense strand comprise at least one, at least two, at least three, or at least four non-matching nucleotides.

37. dsRNA according to any of the claims Petition 870250080602, dated 08 / 09 / 2025, pp. 163 / 193 11 / 19 1 to 36, characterized in that the antisense strand comprises a nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% identical to a target mRNA corresponding to an INHBE mRNA fragment.

38. dsRNA, according to any one of claims 1 to 36, characterized in that the antisense strand of the dsRNA comprises at least 80% complementarity to the INHBE mRNA fragment.

39. dsRNA, according to any one of claims 1 to 36, characterized in that the antisense strand of the dsRNA comprises one, two, three, or four mismatches with the INHBE mRNA fragment.

40. dsRNA, according to any one of claims 1 to 39, characterized in that at least one nucleotide of the dsRNA is a modified nucleotide.

41. dsRNA, according to claim 40, characterized in that the modified nucleotide is at least one of a modified nucleotide selected from the group consisting of: a modified 2'-O-methyl nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a modified 2'-fluoro nucleotide; an inverted abasic nucleotide, an S-isomer of thymidine glycol nucleic acid (GNA); an inosine, an inverted deoxyribonucleotide (3'-linked nucleotide or 5'-linked nucleotide), an S-isomer of thymidine glycol nucleic acid (GNA), a nucleotide comprising a modified nucleotide component represented by Formula (I): Formula (I), Petition 870250080602, dated 08 / 09 / 2025, p.164 / 193 12 / 19 and a nucleotide comprising a modified nucleotide component represented by Formula (II): Formula (II); wherein: each of B1 and B2 is a nucleobase; and R1 is selected from the group consisting of hydrogen and C1-6 alkyl; optionally wherein the antisense strand and the sense strand each comprise at least one modified nucleotide, and a nucleotide comprising a modified nucleotide component represented by Formula (II).

42. dsRNA, according to claim 41, characterized in that each of B1 and B2 is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine and modified analogs thereof.

43. dsRNA, according to claim 41 or 42, characterized in that each of B1 and B2 is independently selected from adenine, uracil, cytosine and modified analogues thereof.

44. dsRNA, according to any one of claims 41 to 43, characterized in that R1 is C1-e alkyl.

45. dsRNA, according to any one of claims 41 to 44, characterized in that R1 is -CH3.

46. ​​dsRNA, according to any one of claims 41 to 45, characterized in that B1 is uracil.

47. dsRNA, according to any one of claims 41 to 46, characterized in that R1 is -CH3 and B1 is uracil. Petition 870250080602, dated 09 / 08 / 2025, p. 165 / 193 13 / 19 48. dsRNA, according to any one of claims 41 to 45, characterized in that B2 is adenine.

49. dsRNA, according to any one of claims 41 to 45, characterized in that B2 is uracil.

50. dsRNA, according to claim 41, characterized in that the sense strand comprises an inverted deoxyribonucleotide at the 5' end; optionally wherein the inverted deoxyribonucleotide is a 5'-5' linked deoxythymidine.

51. dsRNA, according to claim 41, characterized in that the sense strand comprises an inverted deoxyribonucleotide at the 3' end; optionally wherein the inverted deoxyribonucleotide is a 3'-3' linked deoxythymidine.

52. dsRNA, according to claim 41, characterized in that the sense strand comprises an inverted deoxyribonucleotide at the 5' end and an inverted deoxyribonucleotide at the 3' end; optionally wherein the inverted deoxyribonucleotide at the 5' end is a 5'-5' linked deoxythymidine and the inverted deoxyribonucleotide at the 3' end is a 3'-3' linked deoxythymidine.

53. dsRNA, according to any one of claims 41 to 47, characterized in that the sense strand comprises a nucleotide comprising the modified nucleotide component represented by Formula (I) at the 3' end; optionally wherein R1 is -CH3 and B1 is uracil.

54. dsRNA, according to claim 40, characterized in that the modified nucleotide is at least one of the following: a 5'-vinyl phosphonate nucleotide, a 5'-phosphate or phosphate mimic, a locked nucleic acid (LNA), a 2'-MOE (methoxyethyl)nucleotide and / or a 2'-arabino fluoronucleotide (2'-araF).

55. dsRNA, according to claim 54, is characterized by the fact that the antisense strand comprises a phosphate mimic at the 5' end; optionally wherein the phosphate mimic is a 5'-E-Vinyl-phosphonate or a 4'-O-phosphonate.

56. dsRNA, according to claim 40, characterized in that the modified nucleotide is at least one of the following: a 2'-deoxy-2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a blocking nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate and / or a non-natural base comprising a nucleotide.

57. dsRNA, according to claim 40, characterized in that the antisense strand and / or the sense strand comprise at least one internucleosidic linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphopiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage and a boranephosphate linkage.

58. dsRNA, according to claim 57, characterized in that the antisense strand and / or the sense strand comprises at least one modified nucleotide bond.

59. dsRNA, according to claim 57, characterized in that all nucleotide bonds in the antisense strand are modified bonds.

60. dsRNA, according to claim 57, characterized in that the antisense strand and / or the sense strand comprise at least one phosphorothioate (PS) linkage. Petition 870250080602, dated 09 / 08 / 2025, pp. 167 / 193 15 / 19 61. dsRNA, according to any one of claims 1 or 3 to 60, characterized in that it further comprises a linker or targeting moiety.

62. dsRNA, according to claim 61, characterized in that the linker or targeting portion is conjugated to the 5' end, 3' end, or both ends of the dsRNA.

63. dsRNA, according to claim 61, characterized in that the linker or targeting portion is conjugated to the 3' end of the sense strand of the dsRNA.

64. dsRNA, according to claim 61, characterized in that the linker or targeting portion is conjugated to the 5' end of the sense strand of the dsRNA.

65. dsRNA, according to claim 61 or 64, characterized in that the linker or targeting moiety is at least one N-acetylgalactosamine (GaINAc).

66. dsRNA, according to any one of claims 61 to 65, characterized in that the linker or targeting moiety is represented by Formula (I): IN^O Petition 870250080602, dated 08 / 09 / 2025, page 168 / 193 16 / 19 Formula (I) or a pharmaceutically acceptable salt thereof, wherein: A1 is the dsRNA binding site; each occurrence of T1 and T2 is independently selected from 5-membered heterocyclyl and alkylene; each occurrence of X is selected from the group consisting of -OH and -SH; and each occurrence of L is a linker; LA is absent or is a linker; en is an integer from 1 to 6.

67. dsRNA, according to any one of claims 61 to 66, characterized in that each occurrence of T1 and T2 is independently selected from a 5-membered heterocycline with at least one oxygen in the ring and a C1-6 alkylene.

68. dsRNA, according to any one of claims 61 to 67, characterized in that the compound is represented by Formula (IA): or a pharmaceutically acceptable salt thereof.

69. dsRNA, according to any one of claims 61 to 65, characterized in that the compound is represented by Formula (IAI): or a pharmaceutically acceptable salt thereof.

70. dsRNA, according to any one of claims 61 to 65, characterized in that the compound is represented by Formula (IA-II): or a pharmaceutically acceptable salt thereof, wherein each occurrence of aeb is an integer from 1 to 20.

71. dsRNA, according to any of the claims Petition 870250080602, dated 08 / 09 / 2025, pp. 170 / 193 18 / 19 61 to 70, characterized in that the linker or targeting portion is tri-GalNAc6.

72. dsRNA, according to any one of claims 61 to 65, characterized in that the linker or targeting moiety is L96.

73. Cell, characterized in that it comprises dsRNA, as defined in any one of claims 1 to 72.

74. Vector, characterized in that it encodes at least one unmodified strand of dsRNA, as defined in any one of claims 1 to 72, optionally both strands.

75. Cell, characterized in that it comprises the vector, as defined in claim 74.

76. Pharmaceutical composition for inhibiting INHBE expression, characterized in that it comprises dsRNA, as defined in any one of claims 1 to 72, and a pharmaceutically acceptable vehicle, diluent, excipient or combination thereof.

77. Method for inhibiting INHBE expression in a cell, characterized in that it comprises: (a) bringing the cell into contact with dsRNA as defined in any one of claims 1 to 72 or the pharmaceutical composition as defined in claim 76; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of an INHBE gene, thereby inhibiting INHBE gene expression in the cell, optionally wherein the method is in vivo.

78. Method according to claim 77, characterized in that the expression of INHBE is inhibited by at least 30% compared to a control.

79. Method for treating a disorder mediated by or associated with INHBE, characterized in that it comprises administering to an individual in need of such treatment a therapeutically effective amount of dsRNA, as defined in any one of claims 1 to 72, or the pharmaceutical composition, according to claim 76.

80. Method according to claim 79, characterized in that the disorder is a cardiovascular disorder.

81. Method, according to claim 79, characterized in that the disorder is a cardiovascular disease. Petition 870250080602, dated 08 / 09 / 2025, pp. 172 / 193

Images