Method
Patent Information
- Application Number
- BRPI0406602
- Authority / Receiving Office
- BR · BR
- Patent Type
- Applications
- Current Assignee / Owner
- Publication Date
- 2006-03-01
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Conventional bioconversion processes for producing sugar esters, protein esters, or hydroxy acid esters require low water environments to prevent unwanted hydrolysis reactions, limiting the efficiency of interesterification and transesterification reactions.
A method using a lipid acyl transferase enzyme in a high water content environment (5% to 98%) to catalyze alcoholysis or transesterification reactions with lipid substrates such as phospholipids, lysophospholipids, triacylglycerides, and glycolipids, forming carbohydrate, protein, or hydroxy acid esters.
Enables the production of esters in high water content environments without organic solvents, enhancing reaction efficiency and reducing the need for costly solvent removal steps, while producing valuable emulsifiers and pharmaceutical compounds.
Abstract
Description
Invention Patent Descriptive Report for "METHOD". REFERENCE TO RELATED DEPOSITS Reference is made to the following related applications: United States Application, Serial Number 09 / 750,990, filed on July 20, 1999 and United States Application, Serial Number 10 / 409,391. Each of these orders and each of the documents cited in each of these orders ("documents cited in the orders"), and each document referred to or cited in the documents cited in the orders, or in the text or during the processing of those orders, as well as all arguments in support of patentability made during such proceedings are hereby incorporated by reference. Various documents are also cited in this text ("documents cited herein"). Each of the documents cited herein, and each document cited or referred to in the documents cited herein, are hereby incorporated by reference. FIELD OF THE INVENTION The present invention relates to a method for the bioconversion of lipids to produce a carbohydrate ester and / or a protein ester and / or an ester of a protein subunit and / or an ester of a hydroxy acid, by the use of an enzyme lipid acyl transferase. The present invention also relates to the use of a lipid acyl transferase enzyme to bioconvert a lipid to one or more of the following: a carbohydrate ester and / or a protein ester and / or a protein subunit ester and / or a protein ester. of a hydroxy acid. The present invention also relates to the use of an immobilized lipid acyl transferase as defined herein, said immobilized lipid acyl transferase being able to be used in the bioconversion of a lipid in an environment with a high water content to produce one or more of an ester of a carbohydrate and / or a protein ester and / or a protein subunit ester and / or an ester of a hydroxy acid. The present invention also further relates to an immobilized lipid acyl transferase. BACKGROUND OF THE INVENTION Lipases have been extensively used in the bioconversion of lipids to manufacture high value-added products, for example sugar esters, for use in a wide variety of industries, including the food and / or feed, cosmetics, and / or food industries. skin care, the oleochemical industry and the pharmaceutical. When bioconversion processes require the hydrolysis of lipid substrates, lipolytic enzymes can be used in environments with high water content. However, when bioconversion processes require interesterification or transesterification reactions, such as alcoholysis, the use of lipases in environments with high water content can be harmful due to unwanted hydrolysis reactions, which result in unwanted byproducts. and / or lower yields of the bioconversion product. Typically, bioconversion processes that require interesterification and / or transesterification have used lipases in waterless environments such as in oil systems and / or in systems in organic solvents such as butanol, methanol or hexane. Such systems provide an environment in which both the polar acceptor molecule and the lipid donor molecule can be at least partially solubilized, and in which the lipase has sufficient enzyme activity. Although a small amount of water is required for any enzymatic activity, the amount of water is kept strictly at a low level to prevent the hydrolytic activity of the enzyme. enzyme. Conventionally sugar esters, protein esters or hydroxy acid esters have been produced by chemical synthesis using inorganic catalysts. Conventional bioconversion processes for producing sugar esters or hydroxy acid esters utilize lipases in organic solvent environments or supercritical fluids where only a small amount of water is present (if any). Lecointe et al. , Biotechnology Letters, Vol 18., No. 8 (August), pp 869 - 874, publish a study regarding some lipase enzymes and their activities in aqueous media in the production of ethyl ester or butyl ester from methanol and butanol, respectively, Lecointe et al., instruct on the production of a lipase / acyltransferase enzyme from Candida parapsilosis which, as the concentrations of methanol or butanol increased, showed a reduced hydrolysis activity and an improved ability of the enzyme to produce ethyl ester or butyl ester. The use of a lipase / acyltransferase enzyme from C. parapsilosis in the production of hydroxamic fatty acid is taught in Vaysse et al., J. of Biotechnology 53 (1997) 41 - 46. Lipase:cholesterol acyl transferases have been known for some time (see for example Buckley - Biochemistry 1983, 22, 5490 - 5493). In particular, it is known that glycerophospholipid:cholesterol acyl transferases (often referred to as GCATs), like lecithin:cholesterol acyl transferases (LCATs), will catalyze the transfer of fatty acids between phosphatidyl choline and cholesterol. Upton and Buckley (TIBS 20, May 1995, pp. 178 - 179) and Brumlik and Buckley (J. of Bacteriology, April 1996, pages 2060 - 2064) instruct on a lipase / acyltransferase enzyme from Aeromonas hydrophila that has the ability to perform acyl transfer to alcohol acceptors in aqueous media. SUMMARY ASPECTS OF THE PRESENT INVENTION According to a first aspect of the present invention, there is provided a method of producing one or more of a carbohydrate ester, a protein ester, a protein subunit ester or a hydroxy acid ester, which method comprises mixing an acyl donor , an acyl acceptor and water, to produce a high water content environment comprising 5% to 98% water, in which said acyl donor is a lipid substrate selected from one or more groups consisting of a phospholipid, a lysophospholipid , a triacylglyceride, a diglyceride, a glycolipid or a lysoglycolipid, the said acyl receptor is selected from one or more of a group consisting of a carbohydrate, a protein, a protein subunit or a hydroxy acid; and contacting the mixture with a lipid acyl transferase enzyme, such that said lipid acyl transferase catalyses one or both of the following reactions: alcoholysis or transesterification. In a further aspect, the present invention provides the use of a lipid acyl transferase enzyme to produce one or more of a carbohydrate ester, a protein ester, a protein subunit ester or an ester of a hydroxy acid by catalyzing one or more either of alcoholysis or trans-esterification in a mixture of an acyl donor, an acyl acceptor and water, which mixture comprises from 5% to 98% water, wherein said acyl donor is a lipid substrate selected from one or more of the composite group of a phospholipid, a lysophospholipid, a triacylglyceride, a diglyceride, a glycolipid or a lysoglycolipid, said acyl receptor being selected from one or more components of a group consisting of a carbohydrate, a protein, a protein subunit or a hydroxy acid. According to another aspect of the present invention, there is provided a carbohydrate ester, a protein ester, a protein subunit ester or an ester of a hydroxy acid produced by a method according to the present invention. As a further aspect of the present invention, there is provided a pharmaceutical product, a cosmetic, a food product, a feed, a paint comprising a carbohydrate ester, a protein ester, a protein subunit ester or an ester of a hydroxy acid produced by a method according to the present invention. As a further aspect, the present invention provides an enzyme-immobilized lipid acyl transferase as defined herein. - DETAILED ASPECTS OF THE PRESENT INVENTION The term "lipid acyl transferase enzyme" as used herein means an enzyme which, while possessing lipase activity (generally classified as E.C. 3.1.1.x, as per the Enzyme Nomenclature Recommendations (1992) of the Union Nomenclature Committee International de Biochemistry and Molecular Biology) also possesses acyl transferase activity (generally classified as E.C. 2.3.1.x), whereby the enzyme is capable of transferring an acyl group from a lipid to one or more of the following receptor substrates: a carbohydrate; a protein; a protein subunit; or a hydroxy acid. Preferably, the acceptor acyl" according to the present invention is not water. In one aspect, preferably the enzyme is capable of transferring an acyl group from a lipid substrate to a carbohydrate. The acceptor acyl carbohydrate can be one or more of the following: a monosaccharide, a disaccharide, an oligosaccharide, or a polysaccharide. Preferably, the carbohydrate is one or more of the following: glucose, fructose, anhydrofructose, maltose, lactose, sucrose, galactose, xylose, xylo-oligosaccharides, arabinose, malto-oligosaccharides. tagatose, microthecin, ascopiron P, ascopiron T or cortalcerone. Carbohydrate esters can function as valuable emulsifiers for example in foodstuffs. In one aspect, preferably the enzyme is capable of transferring an acyl group from a lipid substrate to a protein and / or to a protein subunit. Preferably the protein subunit is one or more of the following structures: an amino acid, a hydrolyzed protein, a peptide, a dipeptide, an oligopeptide, a polypeptide. Suitable proteins can be one or more of the following: protein found in a food product, for example in a milk product and / or a meat product. By way of example only, suitable proteins may be those found in rennet or whey, such as lactoglobulin. Other suitable proteins include ovalbumin (from egg), gliadin, glutenin, puroindoline, wheat protein, grain lipid transfer protein, myosin from meat, or the following milk proteins: caseins, lactalbumins, and lactoferrins . Suitably in the protein or protein subunit the acyl receptor may be one or more of the following constituents of the protein subunit or the protein: a serine, a threonine, a tyrolysine or a cysteine. When the protein subunit is an amino acid, suitably the amino acid can be any amino acid. Preferably the amino acid is one or more of a serine, a threonine, a tyrolysine or a cysteine, for example. In one aspect, preferably the enzyme is capable of transferring an acyl group from a lipid substrate to a hydroxy acid. Suitably the hydroxy acid may be one or more of the following acids: citric acid, tartaric acid, lactic acid, ascorbic acid, glycolic acid, malic acid, alpha-hydroxyethanolic acid, alpha-hydroxyoctanoic acid, alpha-hydroxycaprylic acid, hydroxycaprylic acid, gluconic acid , lactobionic acid or maltobionic acid. Suitably the hydroxy acid may be a fruit acid, for example one or more of malic acid, lactic acid, tartaric acid, citric acid or glycolic acid. In one embodiment, preferably the hydroxy acid is one or more of the following acids: citric acid, lactic acid, tartaric acid or malic acid. , The term "hydroxy acid" as used herein means a carboxylic acid in which one or more of the hydrogen atoms of the alkyl group has been replaced by a hydroxyl group. In one aspect, the lipid acyltransferase may, as well as being capable of transferring an acyl group from a lipid substrate to one or more of a carbohydrate, a protein, a protein subunit or a hydroxy acid, the lipid acyltransferase may additionally be capable of transferring the acyl group of a lipid to one or more of the following: a sterol and / or a stanol, especially a phytosterol and / or a phytostanol. Suitably, when the lipid substrate is a phospholipid it can be a lecithin, for example phosphatidyl choline. The term lecithin as used herein encompasses phosphatidyl choline, phosphatidyl ethanol amine, phosphatidyl inositol, phosphatidyl serine and phosphatidyl glycerol. Suitably, when the lipid substrate is a lysophospholipid it may be a lysolecithin, for example a lysophosphatidyl choline. The term lysophosphatidyl choline as used herein is synonymous with the term lysolecithin and these terms may be used interchangeably in place of each other. Suitably, when the lipid substrate is a glycolipid it may be digalactosyl diglyceride (DGDG), for example. The lipid substrate may be referred to herein as an "acyl donor lipid" or "acyl donor". These terms may here be used interchangeably in place of each other. For some aspects, preferably the lipid substrate on which the lipid acyltransferase acts is a phospholipid, such as lecithin, e.g. phosphatidyl hill. For some aspects, preferably the lipid substrate is a glycolipid, such as DGDG, for example. For some aspects the lipid substrate may be a food lipid, i.e. a lipid component of a foodstuff. For some aspects, the lipid acyltransferase according to the present invention may be incapable, or substantially incapable, of acting on a triglyceride and / or a 1-monoglyceride and / or 2-monoglyceride. Suitably, the lipid substrate or donor acyl lipid may be one or more of the lipids present in one or more of the following substrates: fats, including lard, tallow and butter fats; oils including oils extracted from or derived from palm oil, sunflower oil, soybean oil, safflower oil, cottonseed oil, corn oil, olive oil, peanut oil, coconut oil, and of canola. Soy lecithin, canola or egg yolk are also convenient lipid substrates. The lipid substrate may be an oat or other plant lipid based on the galactolipid content of the material. For some aspects of the present invention, the lipid may be selected from lipids that have a fatty acid chain length of 8 to 22 carbon atoms. For some aspects of the present invention, the lipid may be selected from lipids that have a fatty acid chain length of 16 to 22 carbon atoms, more preferably 16 to 20 carbon atoms. For some aspects of the present invention, the lipid may be selected from lipids having a fatty acid chain length of no greater than 14 carbon atoms, suitably from lipids having a fatty acid chain length of 4 to 14 carbon atoms, suitably 4 to 10 carbon atoms, suitably 4 to 8 carbon atoms. Preferably the acyl donor is not a free fatty acid. Preferably, the acyl donor is not a carbohydrate (sugar) ester. Suitably, the lipid acyl transferase according to the present invention may exhibit one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerol lipase activity (E.C. 3.1.1.3), phospholipase A2 activity (E.C. 3.1.1.4) or phospholipase activity (E.C. 3.1.1.32). The term "glycolipase activity" as used herein encompasses "galactolipase activity". Suitably, the lipid acyltransferase according to the present invention may have at least one or more of the following activities: glycolipase activity (E.C. 3.1.1.26) and / or phospholipase A1 activity (E.C. 3.1.1.32) and / or phospholipase A2 activity (E.C. 3.1.1.4). For some aspects, the lipid acyltransferase according to the present invention may have at least glycolipase activity (E.C. 3.1.1.26). Suitably, for some aspects the lipid acyltransferase according to the present invention may be capable of transferring an acyl group from a glycolipid and / or a phospholipid to one or more of the following receptor substrates: a carbohydrate, a protein, a protein subunit, a hydroxy acid. For some aspects, preferably the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or a phospholipid to a carbohydrate to form at least one carbohydrate ester. For some aspects, preferably the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or a phospholipid to a protein or protein subunit to form at least one protein ester (or a protein ester condensate). protein fatty acid) or a protein subunit ester. The term "protein subunit ester" as used herein means an ester formed from any protein subunit, such as a dipeptide ester, an oligopeptide ester, a polypeptide ester, or an ester of a hydrolyzed protein, for example. For some aspects, preferably the lipid acyltransferase according to the present invention does not exhibit triacylglycerol lipase activity (E.C. 3.1.1.3). Preferably, the lipid acyl transferase enzyme, according to the present invention, can be characterized using the following criteria: (i) the ..enzyme has .acyl transferase activity which can be defined as ester transfer activity whereby the acyl part of an original ste bond of an acyl donor lipid is transferred to an acyl acceptor to form a new ester; and (ii) the enzyme comprises the amino acid sequence GDSX, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S. Preferably, the X of the GDSX theme is L. Thus, preferably the enzyme according to the present invention comprises the GSDL theme of the amino acid sequence. The GDSX theme is comprised of four conserved amino acids. Preferably, the serine within the theme is a catalytic serine of the enzyme Lipid acyl transferase. Suitably, the serine of the GDSX subject can be in a position corresponding to Ser-16, in the lipolytic enzyme of Aeromonas hydrophila, taught in Brumlik and Buckley (Journal of Bacteriology, April 1996, Vol. 178, No. 7, pages 2060 - 2064 ). To determine if a protein has the GDSX motif, according to the present invention, the sequence is preferably compared with model blinded Markov profiles (HMM profiles) from the PFAM database. PFAM is a database of protein family domains. PFAM contains multiple precise sequence alignments of each family as well as model hidden Markov profiles (HMMs profile) used to identify the presence of these domains in new sequences. An introduction to PFAM can be found in Bateman A. et al., (2002) Nucleic Acids Res. 30; 276 - 280. Model hidden Markov profiles are used in several databases that aid in the classification of proteins, and for a review see Bateman A. and Haft D.H. (2002) Brief Bioinform 3; 236 - 245. http: / / www. ncbi . nlm. nih. gov / entrez / query. fcgi?cmd=Retrieve& db=PubMed&list uids=12230032&dopt=Abstract. http: / / www.ncbi.nlm.nih.gov / entrez / query.fcgi?cmd=Retrieve& db=PubMed&list uids=11752314&dopt=Abstract. For a detailed explanation of model hidden Markov profiles and how they are applied to the PFAM database see Durbin R., Eddy S., and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4. The Hammer software package can be obtained from the University of Washington, St Louis, USA. Alternatively, the GDSX theme can be identified using the Hammer software package. Instructions are provided in Durbin R., Eddy.. S., and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4, its references, and the HMMER2 profile provided within this specification. The PFAM database can be accessed, for example, by several servers that are currently located on the following pages: http: / / www.sanger.ac.uk / Software / Pfam / index.shtml http: / / pfam.wustl.edu / http: / / pfam.jouy.inra.fr / http: / / pfam.cgb.ki.se / . The database offers a search facility where any user enters a protein sequence. Using the database reference parameters, the protein sequence will then be analyzed for the presence of PFAM domains. The GDSX domain is a domain established in the database and as such its presence in any sequence query will be recognized. The database will return the alignment of the consensus sequence PFAM00657 with respect to the query sequence. Multiple alignment can be obtained, including the Aeromonas salmonicida or Aeromonas hydrophila by: a) Manually - .......••• Obtaining an alignment of the protein of interest with the consensus sequence PFAM00657' and obtaining a P10480 alignment with the consensus sequence PFAM00657 after the procedure described above; or b) Through the database After identifying the PFAM00657 consensus sequence, the database offers the option to show an alignment of the query sequence to the source alignment of the PFAM00657 consensus sequence. 0 P10480 is part of this alignment origin and is indicated by GCAT_AERHY. so much to question string like P10480 will be shown in the same window. The reference sequence from Aeromonas hydrophila: Aeromonas hydrophila lipase GDSX residues are numbered in the NCBI file P10480, the numbers in this text refer to the numbers given in that file which in the present invention are used to determine the specific amino acid residues which, in a preferred embodiment, are present in the lipid enzyme acyl transferases of the invention. Performing the PFAM alignment (Figures 33 and 34): . The following residues can be recognized and, in a preferred embodiment, can be present in enzymes for use in the compositions and methods of the invention: Block 1 - GDSX block hidden hidden hidden hidden Gli Asp Ser hidden 28 29 30 31 32 33 34 35 Block 2 - GANDY block hidden Gli hidden Asn Asp hidden 130 131 132 133 134 135 block 3 - HPT His block Wherein "hidden" means a hydrophobic residue selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe. Preferably the lipid acyl transferase enzyme for use in the compositions / methods of the invention can be aligned using the consensus sequence PFAM00657. Preferably, a positive match with model hidden Markov profiles (HMM profiles), from the PFAM00657 domain family, indicates the presence of either the GDSL domain or the GDSX domain, in accordance with the present invention. Preferably, when aligned with the -PFAM0Q657 consensus sequence, the lipid acyl transferase enzyme for use in the compositions / methods of the invention have at least one, preferably more than one, preferably more than two, of the following, a GDSx block, a GANDY block , an HPT block. Suitably, the lipid acyl transferase enzyme may have a GDSx block and a GANDY block. Alternatively, the enzyme can have a GDSx block and an HPT block. Preferably the enzyme comprises at least one GDSx block. Preferably, when aligned with the PFAM00657 consensus sequence, the enzyme for use in the compositions / methods of the invention has at least one, preferably more than one, preferably more than two, preferably more than three, preferably more than four, preferably more than five, preferably more than six, preferably more than seven, preferably more than eight, preferably more than nine, preferably more than ten, preferably more than eleven, preferably more than twelve, preferably more than thirteen, preferably more than fourteen, of the following amino acid residues when compared to the reference A. hydrophilia polypeptide sequence, namely SEQ ID NO: 32: 28hidden, 29hidden, 30hidden, 31hidden, 32gly, 33Asp, 34Ser, 35hidden , 130hidden, 131GÜ, 132hidden, 133Asn, 134Asp, 135hidden, 309His. The PFAM00657 GDSX domain is a unique identifier that distinguishes proteins that have this domain from other enzymes. The PFAM00657 consensus sequence is shown in Figure 1 as SEQ ID NO: 1. This is derived from the PFAM family ID 00657, database version 6, which may also be referred to here as PFAM00657.6. The consensus sequence can be updated using later versions of the PFAM database. For example, Figures 33 and 34 show the PFAM alignment of the 00657 family, from database version 11, which may also be referred to here as PFAM00657.il. The presence of the blocks GDSx, GANDY and the HPT is found in the PFAM 00657 family of both database versions. Future versions of the PFAM database may be used to identify the 00657 PFAM family. Preferably, the lipid acyl transferase enzyme according to the present invention can be characterized using the following criteria: (i) the enzyme has acyl transferase activity which can be defined as ester transfer activity whereby the . acyl of a bond is this original .of a lipid acyl donor is transferred to an acyl acceptor to form new ester; (ii) the enzyme comprises the GDSX theme sequence of amino acids s, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.; (Üi) the enzyme comprises His-309 or comprises a histidine residue at a position corresponding to His-309 in the lipolytic enzyme from Aeromonas hydrophila shown in Figure 2 (SEQ ID NO: 2 or SEQ ID NO: 32). Preferably, the amino acid residue of the GDSX motif is In SEQ ID NO: 2 or SEQ ID NO: 32, the first 18 amino acid residues form a signal sequence. The His-309 of the full-length sequence, which is the protein including the signal sequence, matches the His-291 of the mature part of the protein, i.e., the sequence without the signal sequence. Preferably, the lipid acyl transferase enzyme according to the present invention comprises the set of the following catalytic triad: Ser-34, Asp-134 and His-309 or comprises a-serine residue, an aspartic acid residue-and a histidine residue, respectively at positions corresponding to Ser-34, Asp-134 and His-309 in the Aeromonas hydrophila lipolytic enzyme shown in Figure 2 (SEQ ID NO: 2) or Figure 28 (SEQ ID NO: 32). As stated earlier, in the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 32 the first 18 amino acid residues form a signal sequence. Ser-34, Asp-134 and His-309 of the full-length sequence, which is the protein including the signal sequence, if equal to Ser-16, Asp-116 and His-291 of the mature part of the protein, i.e. the string without the sign string. In consensus sequence PFAM00657, such as shown in Figure 1 (SEQ ID NO: 1), the active site residues correspond to Ser-7, Asp-157 and His-348. Preferably, the lipid acyl transferase enzyme according to the present invention can be characterized using the following criteria: (i) the enzyme has acyl transferase activity which can be defined as ester transfer activity whereby the acyl part of an ester bond from an acyl donor lipid is transferred to an acyl acceptor to form a new ester; and (ii) the enzyme comprises at least Gly-32, Asp-33, Ser-34, Asp-134 and His-309 or comprises glycine, aspartic acid, serine, aspartic acid and histidine residues at positions corresponding to Gly-32, Asp-33, Ser-34, Asp-134 and His-309, respectively, on the lipolytic enzyme from Aeromonas hydrophila shown in Figure 2 (SEQ ID NO: 2) or Figure 28 (SEQ ID NO: 32). Suitably, the lipid acyltransferase enzyme according to the present invention can be obtained, preferably obtained, from one or more of the following organisms of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, Schizo Saccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida. Suitably, the Lipid acyl transferase enzyme according to the present invention can be obtained, preferably obtained, from one or more of the following organisms: Aeromonas hydrophila, Aeromonas salmonicida, Streptomyces coelicolor, Streptomyces rimosus, Mycobacterium, Streptococcus pyogenes, Lactococcus lactis, Streptococcus pyogenes , Streptococcus thermophilus, Lactobacillus hel-veticus, Desulfitobacterium dehalogenans, Bacillus sp, Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus solfataricus, Saccharomyces cerevisiae, Aspergillus terreus, SchizoSaccharomyces pombe, Listeria innocua, Listeria monocytogenes, Neisseria meningitidis, Mesorhizobium loti, Ralstonia solanacearum, Xanthomonas campestris, Xanthomonas axonopodis and Candida parapsilosis. In one aspect, preferably the lipid acyl transferase enzyme according to the present invention is obtained, preferably obtained from one or more of Aeromonas hydrophila or Aeromonas salmonicida. Suitably, the enzyme lipid acyl transferase from according to the present invention comprises one or more of following amino acid sequence: (i) the amino acid sequence shown as SEQ ID NO. (see Figure 2); No. No. the sequence Figure 3); the sequence Figure 4); sequence in in in amino acids amino acids amino acids shown shown shown as as as SEQ SEQ SEQ ID ID ID No. Figure 5); the amino acid sequence shown as SEQ ID No. Figure 6); No. 12 (see the No. No. amino acid sequence shown Figure 14); (Figure as SEQ ID amino acid sequence shown amino acid sequence shown as as SEQ SEQ ID ID (Figure (ix) the amino acid sequence shown as SEQ ID No. (Figure 20); (x) the amino acid sequence shown as SEQ ID No. (Figure 22); (xi) the amino acid sequence shown as SEQ ID No. 28 (from Figure 24); (xii) the amino acid sequence shown as SEQ ID NO: 30 (from Figure 26); (xiii) the amino acid sequence shown as SEQ ID NO: 32 (from Figure 28); (xiv) the amino acid sequence shown as SEQ ID NO: 34 (from Figure 30); or an amino acid sequence that has 75% or greater identity with any of the sequences shown as SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28,. SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34. Suitably, the lipid acyl transferase enzyme according to the present invention comprises amino acid sequence shown as SEQ ID No. 2 or as SEQ ID No. 3 or SEQ ID No. 32 or SEQ ID No. 34, or comprises an amino acid sequence which has 75% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, identity with the amino acid sequence shown as SEQ ID NO:2 or the amino acid sequence shown as SEQ ID No. 3 or the amino acid sequence shown as SEQ ID 32 or the amino acid sequence shown as SEQ ID NO: 34. For purposes of the present invention, the degree of identity is based on the number of sequence elements that are the same. The degree of identity according to the present invention can be suitably determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Wisconsin Package Program Manual, Version 8, August 1994, Genetics tere Group, 575 Science Drive, Madison, Wisconsin, US 53711) (Needleman and Wunsch (1970), J. Molecular Biology 48, 443-45) using the following adjustments for polypeptide sequence comparison: GAP 3.0 breeding penalty and 0.1 GAP extension penalty. Suitably the lipid acyl transferase enzyme according to the present invention comprises an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more and even more preferably 95% or more identity to any of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, or SEQ ID No. 34. Suitably, the lipid acyl transferase enzyme according to the present invention comprises one or more of the following amino acid sequences: (a) an amino acid sequence shown as amino acid residues 1 - 100 of SEQ ID NO: 2 or SEQ ID NO: 32; (b) an amino acid sequence shown as amino acid residues 101 - 200 of SEQ ID NO:2 or SEQ ID NO:2 No. 32; (c) an amino acid sequence shown as amino acid residues 201 - 300 of SEQ ID NO:2 or SEQ ID NO:2 No. 32 or; (d) an amino acid sequence that has 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identity with any of the amino acid sequences defined above in items (a) a(c). Suitably, the lipid acyl transferase enzyme according to the present invention comprises one or more of the following amino acid sequences: (a) an amino acid sequence shown as amino acid residues 28 - 39 of SEQ ID NO: 2 or SEQ ID NO: 32; (b) an amino acid sequence shown as amino acid residues 77 - 88 of SEQ ID NO: 2 or SEQ ID NO: 32; (c) a sequence of amino acid residues 126-No. 32; (d) a sequence of amino acid residues 163-No. 32; (e) a sequence of amino acid residues 304 - amino acids shown as 136 of SEQ ID No. 2 or SEQ ID amino acids shown as 175 of SEQ ID No. 2 or SEQ ID amino acids shown as 311 of SEQ ID No. 2 or SEQ ID No. 32 or; (f) an amino acid sequence having 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identity to any of the amino acid sequences defined above in items (a) to (and). Suitably, the lipid acyl transferase enzyme according to the present invention may comprise an amino acid sequence produced by expression of one or more of the following sequences: (a) the nucleotide sequence shown as SEQ ID No. 7 (see Figure 9); (b) the nucleotide sequence shown as SEQ ID No. Figure 10); sequence of nucleotides shown as SEQ ID No. 9 (see the Figure 11); (gives sequence of nucleotides shown as SEQ ID No. 10 (see Figure 12); (e) the nucleotide sequence shown as SEQ ID No. 11 (see Figure 13); (f) the nucleotide sequence shown as SEQ ID No. 13 (see Figure 15); (g) the nucleotide sequence shown as SEQ ID No. 21 (see Figure .17); » (h) the nucleotide sequence shown as SEQ ID NO: 23 (see Figure 19); (i) the nucleotide sequence shown as SEQ ID NO: 25 (see Figure 21); (j) the nucleotide sequence shown as SEQ ID NO: 27 (see Figure 23); (k) the nucleotide sequence shown as SEQ ID NO: 29 (see Figure 25); (1) the nucleotide sequence shown as SEQ ID NO: 31 (see Figure 27); (m) the nucleotide sequence shown as SEQ ID No. 33 (see Figure 29); (n) the nucleotide sequence shown as SEQ ID NO: 35 (see Figure 31); (o) or a nucleotide sequence that has 75% or more identity to any of the sequences shown as SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9 ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: No. 31, SEQ ID No. 33 or SEQ ID No. 35. Suitably the nucleotide sequence may have 80% or more, preferably 85% or more, more preferably 90% or more and even more preferably 95% or more identity with any of the... sequences shown as SEQ ID NO: 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33 or SEQ ID No. 35. In one aspect, the lipid acyl transferase enzyme according to the present invention can be lecithin:cholesterol acyl transferases (LCAT) or variant thereof (eg, a variant made by molecular evolution). Convenient LCATs are known in the art and can be be obtained from one or more of the following organisms, for example: mammals, rat, mouse, chicken, Drosophila melanogaster, plants including Arabidopsis and Oryza sativa, nematodes, fungi and yeast. In one embodiment, the lipid acyl transferase enzyme according to the present invention may be the lipid acyl transferase enzyme obtained, preferably obtained, from the top 10 E. coli strains harboring pPetl2aAhydro and pPetl2aASalmo, deposited by Danisco A / S from Langebrogade 1, DK-1001 Copenhagen K, Denmark, under the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for purposes of Depositing Patents with the National Collection of Industrial, Marine and Food Bacteria (NCIMB) 23 St. Machar Street, . Aberdeen, Scotland, United Kingdom on the 22nd of December 2003 with the following accession numbers NICMB 41204 and NCIMB 41205 respectively. The term "transferase" as used herein is interchangeable with the term "lipid acyl transferase". Suitably, the enzyme lipid acyl transferase as defined catalyses one or both of the following reactions: transesterification and alcoholysis. Thus, according to the present invention, one or more of the following advantageous properties can be achieved: the bioconversion of lipids to form one or more of a carbohydrate ester, a protein ester, a protein subunit or an ester of a hydroxy acid which can be carried out in a high water content environment comprising no organic solvent or a reduced amount of the organic solvent compared to conventional bioconversion processes. The term "bioconversion" as used herein, means the modification of an organic compound to produce another organic compound and / or the synthesis of organic compounds from other organic compounds by enzyme catalysis. The term "transesterification" as used herein means the enzymatically catalyzed transfer of an acyl group from a lipid donor (other than a free fatty acid) to an acyl acceptor (other than water). For the avoidance of doubt, use of the term "transesterification" as used herein includes the transfer of an acyl group from a lipid donor to an acyl acceptor (other than water) where the acyl acceptor comprises a suitable chemical group that , for example, can be any -OH or -SH group. As used herein, the term "alcolysis" refers to the enzymatic cleavage of a covalent bond of an acid derivative by reaction with an alcohol ROH such that one of the products combines with the H of the alcohol and the other product combines with the group OR of the alcohol group. As used herein, the term "hydrolysis" refers to the enzymatically catalyzed transfer of an acyl group of a lipid to the OH group of a water molecule. The acyl transfer that results from hydrolysis necessitates the separation of the water molecule. The term "interesterification" refers to the enzymatically catalyzed transfer of acyl groups between a lipid donor and lipid acceptor, where the lipid donor is not a free acyl group. In other words, "interesterification" refers to the exchange of a fatty acid between two lipid molecules. In... one aspect, the lipid acyl transferase... as defined herein catalyzes interesterification. Suitably, the method or use according to the present invention may further comprise one or more of the following steps: dissolving the acyl receptor in water; adding a donor acyl lipid to a dissolved acyl acceptor to form a two-phase system or an emulsion; stir the reaction mixture or subject it to the action of ultrasound; heating the reaction mixture, for example to denature the enzyme; separation of the aqueous phase from the fat / emulsifier phase by standard separation techniques, such as solvent extraction or water evaporation for example; fractionation of the oil phase by interaction chromatography hydrophobic, crystallization or high vacuum distillation. Suitably, one or more of the steps having heating, separation or fractionation may be carried out after the reaction has reached equilibrium. In one embodiment the lipase acyl transferase, for use in the methods of the present invention, can be immobilized. When that is the case, that the enzyme is immobilized, the mixture comprising an acyl donor, an acyl acceptor and water, passes through a column which for example comprises immobilized enzyme. By immobilizing the enzyme it is possible to reuse it easily. Adequately. immobilized enzyme can . to be. used in a flow reactor or in a batch reactor containing a reaction mixture comprising an acyl acceptor dissolved in water and an acyl donor lipid as a two-phase system or as an emulsion. The reaction mixture can optionally be stirred or sonicated. Once the reaction has reached equilibrium, for example, the reaction mixture and the immobilized enzyme can be separated. Suitably, the reaction product may be fractionated for example by hydrophobic interaction chromatography, crystallization or high vacuum distillation. Immobilized lipid acyl transferase enzyme can be prepared using immobilization techniques known in the art. technical knowledge. There are several methods for preparing immobilized enzymes, which will be evident to a person skilled in the art (for example, the techniques mentioned in EP 0746608; or Balcao V.M., Paiva A.L., Malcata F.X., Enzyme Microb Technol. 1996 Maio 1; 18( 6): 392 - 416; or Retz M.T., Jaeger K.E. Chem Phys Lipids. 1998 Jun; 93(1-2): 3 - 14; Bornscheuer U.T., Bessler C, Srinivas R, Krishna S.H. Trends Biotechnol. 2002 Oct; 20(10): 433 - 7; Piou et al., J. Biotechnology 92(2002) 55-66; Warmuth et al., 1992. Bio Forum 9, 282-283; Ferrer et al., 2000. J. Chem. Technol. Biotechnol. 15, -1 - -8 •; or- Christensen, et al., 19.9.8. .Nachwachsende Rohstoff. 10.98 - 105; Petersen and Christenen, 2000, Applied Biocatalysis. Harwood Academic Publishers, Amsterdam (each of which is incorporated herein by reference). Techniques that can be used here include covalent coupling with Eupergit C, polypropylene adsorption and silica granulation, for example. The term "high water content environment" as used herein preferably means an environment that is poor or lacking in an organic solvent, preferably low in or absent from a polar organic solvent. The term organic solvent as used herein preferably does not encompass edible oils when used as a lipid substrate, and preferably does not cover edible oils which have high contents of non-polar lipids for example. Suitably, a high water content environment in accordance with the present invention may comprise less than 50% by volume organic solvents, less than 30% by volume organic solvents, more preferably less than 15% by volume organic solvents. , more preferably less than 5%, more preferably less than 1%, more preferably less than 0.5% by volume of organic solvent, most preferably 0% by volume of organic solvents ... .... . ....... .... . ... When it is the case that a carbohydrate ester is produced in accordance with the present invention, the carbohydrate ester is preferably an oligosaccharide ester, a monosaccharide ester or a disaccharide ester. Suitably, the carbohydrate ester when produced in accordance with the present invention may be one or more of the following: glucose ester, fructose ester, fructose anhydrous, maltose ester, lactose ester, galactose ester, xylose ester, xylooligosaccharide ester, arabinose ester, maltooligosaccharide ester, tagatose ester, sucrose ester, microthecin ester, ascopirone P ester, ascopirone T ester or cortalcerone ester. Preferably, the carbohydrate ester, when produced in accordance with the present invention, is one or more of the following: a carbohydrate mono-ester, a sugar mono-ester, an oligosaccharide mono-ester, a trisaccharide mono-ester, a disaccharide mono-ester , a monosaccharide mono-ester, a glucose mono-ester, a fructose mono-ester, anhydrous fructose mono-ester, a maltose mono-ester, lactose mono-ester, galactose mono-ester, xylose mono-ester, xylo oligosaccharide mono -ester, -arabinose mono-ester, malto oligosaccharide mono-ester, tagatose mono-ester, sucrose mono-ester, microthecin ester, ascopirone P ester, ascopirone T ester or cortalcerone ester. In one embodiment, the microthecin esters, ascopirone P, ascopirone T ester and / or cortalcerone may function as an antimicrobial agent. Alternatively, or in addition, microthecin ester, ascopirone ester P, ascopirone ester T and / or cortalcerone ester can function as one, or both of, a antioxidant and / or emulsifier. Preferably, formation of the carbohydrate ester (if any) according to the present invention is glucose-UDP independent. Preferably, foodstuffs according to the present invention do not comprise glucose - UDP, or only comprise glucose - UPD in negligible amounts. The lipid acyl transferases used in the compositions and methods of the invention are understood to have unique properties when compared to lipolytic enzymes such that they have a marked preference for transferring lipid acyl groups to receptors other than water, even in the presence of water. .of ..a significant amount of water. In a comparison with prior art enzymes, the lipid acyl transferase used in the invention was evaluated to have a high relative transferase activity in the presence of 6% water, 54% water, 73% water, 89% of water and approximately 95% water. The lipolytic enzymes tested had virtually no significant relative transferase activity at these water concentrations. 0 percent transferase activity (i.e. transferase activity as a percentage of activity total enzymatic activity) can be determined by the following protocol: Protocol for determining the percentage of acyl transferase activity: A substrate to which a lipid acyl transferase enzyme according to the present invention has been added can be extracted following the enzymatic reaction with CHCl 3 :ch 3The H 2:1 and the organic phase containing the lipid material is isolated and analyzed by GLC and HPLC, following the procedure detailed below. From the GLC and HPLC analysis, the amounts of free ..e fatty acids are determined. one or more... esters of. carbohydrates, protein esters; of esters of protein subunits and esters of hydroxy acids. A control substrate to which no enzyme according to the present invention has been added is analyzed in the same way. Calculations: From the results of the GLC and HPLC analyzes the increase in free fatty acids and carbohydrate esters and / or protein esters and / or protein subunit esters and / or hydroxy acid esters can be calculated: A % fatty acid = % fatty acid (enzyme) - % fatty acid (control); o Mv of fatty acid = average molecular weight of fatty acids; A = A % sterol ester / Mv sterol ester (where A % sterol ester = % sterol ester I stanol ester (enzyme) - % sterol ester / stanol ester (control) and Mv sterol ester = sterol ester / stanol ester average molecular weight). Applicable where acyl acceptor is a sterol and / or stanol; B = A % carbohydrate ester / Mv carbohydrate ester (where A % sterol ester = % carbohydrate ester(enzyme) % ester of carbohydrate of Fe (control) and Mv of carbohydrate molecular weight average of the ester in carbohydrate). Applicable where receiver a carbohydrate; C = A % protein ester / Mv protein ester (where A % protein ester = % protein ester (enzyme) - % protein ester (control) and Mv protein = average molecular weight of protein ester). Applicable where acyl receptor is an e protein; D = the absolute value of diglyceride and / or monoglyceride / Mv di / monoglyceride (where A % diglyceride and / or monoglyceride = % diglyceride and / or monoglyceride(enzyme) - % diglyceride and / or monoglyceride(control) and Mv di / monoglyceride = average molecular weight of diglyceride and / or monoglyceride). Applicable where acyl receptor is glycerol. Transferase activity is calculated as a percentage of total enzyme activity: % transferase activity = A*+ B*+ C*+ D*+ x 100. A* + B* + C*+ D*+ A % fatty acid / (Mv of fatty acid) ★ - delete as appropriate. The lipase and acyl transferase activities of an enzyme can be evaluated using the following assays. In this way, a lipid acyl transferase enzyme having the enzyme characteristics defined herein can be obtained or identified. Transferase Assay in Buffered Substrate (see Example 6) Enzymes that function as lipid acyl transferase enzymes for use in the compositions and methods of the invention can be routinely identified using the assay taught in Example 6. This assay will be referred to hereinafter as the "Transferase in Buffered Substrate Assay". In Example 6 the enzyme lipid acyl transferase from Aeromonas salmonicida according to the present invention was analyzed and compared with a variety of lipolytic enzymes not encompassed by the present invention. As can be seen, of the lipolytic enzymes only LIPOPAN® F (Novozymes, Denmark) was found to have any transferase activity and only at a very low level (1.3%). Enzymes suitable for use in the compositions and methods of the invention can be routinely identified using the Buffered Substrate Transferase Assay. Using this assay, in which at very high water content, approximately 95%, the enzymes lipid acyl transferases according to the present invention - are those that have at least 2% of acyl transferase activity (relative transferase activity), preferably at least 5% relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 15%, 20%, 25% 26%, 28%, 30%, 40% 50%, 60% or 75% of relative transferase activity. Suitably, the lipid acyl transferase enzyme according to the present invention may have less than 28%, less than 30%, preferably less than 40%, less than 50%, less than 60%, less than 70%, less than 80% , less than 90% or less than 100% acyl activity transferase. Transferase Assay in an Environment with Low Water Concentration As an alternative to (or in addition to) using the "Transferase Assay in Buffered Substrate", the enzyme lipid acyl transferases for use in accordance with the present invention can be identified using the "Transferase Assay in an Environment with Low Concentration of Water". To determine whether an enzyme is a lipid acyl transferase enzyme in accordance with the present invention, a "Transferase Assay in a Low Water Concentration Environment" can be performed, namely in an oily environment with. water concentration, of 6%, as taught in Example 9. This example shows that in an oily environment with a water content of 6% the lipid acyl transferase enzyme of the invention has a high relative transferase activity, where the lipolytic enzymes of the art above have hydrolytic activity. In one embodiment, the lipid acyl transferase enzyme suitable for use in the methods and / or compositions according to the present invention is one which when tested using the "Transferase Assay in a Low Water Concentration Environment", and measured within a selected time period of 30, 20 or 120 minutes, has a relative transferase activity of at least 1%, preferably at least 2%, preferably at least 5%, preferably at least 10%, preferably at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at at least 70%, preferably at least 75%. Suitably, the lipid acyl transferase enzyme according to the present invention may have less than 30%, 40%, 50%, 60%, 70%, or 80% activity when measured within a time period of 10, 20, 30 or 120 minutes using the "Transferase Assay in a Low Water-Concentration Environment". - - •- .... As described above, the lipase acyl transferase enzyme of the invention can be identified using the "Transferase Assay in Buffered Substrate" or the "Transferase Assay in a Low Water Concentration Environment" using cholesterol as the acyl receptor. Of course, an experienced person would be readily aware that, with the obviously necessary adjustments, the analytical methods "Assay of Transferase on Buffered Substrate", or "Assay of Transferase in an Environment with Low Water Concentration" can be used to determine the activity of the enzyme lipid acyl transferase to any combination of lipid acyl donor or acceptor acyl. A person of skill would, if necessary, simply substitute the acyl donor substrate (e.g. phospholipid) for an alternative acyl donor substrate (e.g. glycolipid, triacylglyceride) and / or replace the acyl acceptor substrate (e.g. cholesterol) for an acyl acceptor substrate (e.g. cholesterol) alternative acyl acceptor (for example, a carbohydrate, a protein, a protein subunit or a hydroxy acid) (for example see Examples 10-13). The term "high water environment", as used herein, means any environment comprising from 5 to 98% water, preferably the environment comprises more than 6% ... of . water content, preferably more than 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. Suitably, an environment with the high water content comprises from 20 to 98%, suitably from 50 to 98%, suitably from 70 to 98%, suitably from 75 to 98% of water. In one embodiment, in the mixture the ratio of the amount of lipid acyl transferase added compared to the amount of water is at least 1:700, preferably 1:10,000, when measured by weight. The term "low water concentration" as used herein means any substrate or genus food with water content less than 5%, preferably less than 4%, 3%, 2%, 1% or 0.5%. Preferably the method and / or use according to the present invention can be carried out, for example, in foodstuffs at a temperature of 15 to 60°C, preferably at a temperature of 20 to 60°C, preferably 20 to 50° C, preferably 20 to 45°C, preferably 20 to 40°C. Suitably, the method or use according to the present invention comprises an additional step of purifying and / or isolating the reaction product, namely one or more than one ester of the carbohydrate one ester. protein, a protein subunit ester, or a hydroxy acid ester. Thus, preferably the reaction product is in purified and / or isolated form. The various methods for purification of esters are known to those of ordinary skill in the art. For example only esters produced by the methods or uses taught herein can be purified using chromatography, such as hydrophobic interaction, filtration, centrifugation, solvent extraction, disposal or crystallization. Proper methodologies are taught in Ulmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co. KgaA. The lipid acyl transferase enzyme of the invention can be expressed in any convenient expression host. For example, the lipid acyl transferase enzyme of the invention can be expressed in Bacillus subtilis and purified by ultrafiltration and / or by ethanol precipitation and / or centrifugation, and can be subsequently spray-dried using starch (maltodextrin) as the enzyme carrier. The spray-dried enzyme can be standardized for PLU specific activity by adding additional carriers in powder form. The techniques involved are well established and routine technical knowledge.- In a - embodiment, the- method- according to-. the .gift invention is an in vitro process. The method may suitably be a continuous or batch process. The enzyme according to the present invention can be used with one or several other additional enzymes, thus It is within the scope of the present invention that in addition to the enzyme of the invention, the mixture is contacted with at least one additional enzyme. Such additional enzymes include starch-degrading enzymes such as endo- or exo-amylases, pullulanases, debranching enzymes, hemicellulases including xylanases, cellulases, oxidoreductases, e.g. glucose oxidase, pyranose oxidase, sulfhydryl oxidase or a carbohydrate oxidases, such as those that oxidize maltose, for example, hexose oxidase (HOX), lipases, phospholipases and hexose oxidases, and proteases. In a preferred embodiment the enzyme lipid acyl transferase is used in combination with a lipase having one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerol lipase activity (E.C. 3.1.1.3), phospholipase A2 (E.C. 3.1.1.4) or phospholipase A1 activity (E.C. 3.1.1.32). Suitably, lipase enzymes are well known within the art and include by way of example the following lipases: . LIPOPAN® F and / or LECI.TASE® ULTRA (Novozymes A / S, 'Denmark), phospholipase A2 (eg, phospholipase A2 from LIPOMOD® 22L from Biocatalysts, LIPOMAX® from Genecor), LIPOLASE® (Novozymes A / S, Denmark), the lipases taught in WO 03 / 97835, EP 0977869 or EP 1193314 USES Thus, methods according to the present invention produce one or more of a carbohydrate ester, a protein ester, a protein subunit ester, a hydroxy acid ester. Many of these esters are useful emulsifiers. By way of example, only sterile amino acids, peptide esters, protein esters, carbohydrate esters, and esters of hydroxy acids (such as tartaric acid) for example, are functionally important emulsifiers. And emulsifiers are useful in a wide range of industries, such as the food industry, the food industry, the cosmetics industry (e.g. in cosmetic bases), the pharmaceutical industry (both in pharmaceutical synthesis and e.g. formulation) and in the paint industry, for example. Emulsifiers can function as wetting agents, active ingredient food ingredients. Additionally, protein and fatty acid condensates, having their own excellent physiological properties, are suitable for use in cosmetics and personal care products, for example. For example, protein esters can be used in bath products as well as shampoos or body washes. Protein fatty acid condensates may also be useful in pharmaceutical compositions, as for example in the form of a base. Fatty acid and protein condensates are well known for their applications in the cosmetic industry. Conventionally, these products are produced by reacting a hydrolyzed protein with an acid chloride. fatty acid under Schotten-Baumann conditions, using water as solvent. ( http: / / www.scf-online.com / english / 26e / rawmaterials26e ,htm#5 ). In the development of protein and fatty acid condensates it is possible to combine fatty acids from renewable resources (from vegetable oil) with protein, which can be obtained both from animal waste (leather) and from many plants, to build a structure of the surfactant with a hydrophobic part (fatty acid) and a hydrophilic part (protein). In this process the fatty acid chloride reacts with the amine group of the amino acid and forms the de. fatty acid and protein .(see. Figure .49.) . The products are obtainable and have excellent compatibility with and additionally have a good cleaning effect. The fact that even small additions of the acylated protein hydrolyzate have a synergistic effect on the compatibility of other surfactants with the skin is extremely important from a technical formulation point of view. An explanation for this protective effect could be found in the amphoteric behavior of the product. There is an interaction between the fatty acid and protein condensate and the skin's collagen. This leads to the formation of a protective layer, which reduces the excessive attack of surfactants on the upper layers of the skin, due to their strong effect. degreaser and by the direct interaction of anionic surfactants with the skin. In the field of cosmetics, protein-based surfactants are mainly used in mild bath products, mild shampoos, surfactant-based face washes, refreshing and fixing preparations or surfactant baby preparations. The fatty acid and hydrolysed protein condensates are also useful as a base for pharmaceutical preparations, for example for creams and ointments containing active ingredients for topical application to the skin. The present invention provides a new way to produce fatty acid-protein condensate without using fatty acid chloride. The reaction, according to the present invention, is described by Figure 50. This reaction can be conducted in water or in a buffered system, at low temperature, without the formation of residues. The condensed term fatty acid and protein used herein encompasses all of the following products protein esters, polypeptide esters, dipeptide esters, oligopeptide esters, peptide esters and amino acid esters. A technically skilled person would be readily aware that carbohydrate esters (particularly sugar esters) have a wide application in the food industry. Other fields of application include cosmetics, oral care products and medicine supply. In addition, these compounds can be used as antibiotics, antitumors, fungicides and insecticides. The enzyme lipid acyl transferase according to the present invention can catalyze the formation of the glucose ester in an environment with high water content (Figure 51). The esters produced according to the present invention find application in the following fields: Cosmetics: including essential oil emulsions (oil / water, - ,HLB 16-18); paraffin-oil emulsions, o / w, HLB 10-14; stearic acid emulsions; wax emulsions, o / w, HLB 14-16; lanolin emulsions, o / w, HLB 12-14; silicone emulsions; toothpaste, o / a; bubble baths, o / w, HLB 14-18; hair lotion. Pharmaceutical preparations: including emulsions for drugs; ointment bases; compounds for o / w suppository; encapsulation and injection preparations. Agriculture: including soil improvement products; as a fertilizer additive; as all-purpose cleaners; fruit and vegetable cleaners; cleaning fluids for milking machines Crop Protection: including natural insecticides; golden hydrocarbons and 140; o / w phosphoric acid esters, HLB 10-14; fungicides, o / w; herbicides, o / a. Food Industry: including bread and cakes; margarine; chocolate; prevention of fat stratification, without, HLB 5-10; sugar freezing, o / w, HLB 14-16; softeners for caramels and chewing gum, o / w, HLB 2-4; hardening prevention, o / a, HLB 2-4; ice cream additives, o / w, HLB 4-6; milk moisture and baking flours, o / w, HLB 9-11; pudding powders, o / w, HLB 2-4; in the beverage industry; in fruit and vegetables; in flavorings, o / a,- and no. .o / a,. HLB 10-12; in the flesh, in the. salad, or in other flavored seasonings, o / a; in food pigments, o / w, HLB 2-4; o / a, HLB 8-18; in foam inhibitors. The benefit of using esters of proteins and fatty acids, esters of hydroxy acids and esters of carbohydrates produced according to the present invention for application in food lies in the fact that they do not cause damage to health, with compatible components and that they are more easily biodegradable compared to other commercially used emulsifiers such as ethoxylated fatty acid esters. These emulsifiers are thus more environmentally friendly and can be used so much at food industry as not food. In one embodiment, the microthecin ester, the ascopirone ester P, the ascopirone ester T and / or the cortalcerone ester can function as an antimicrobial agent. Alternatively or additionally, microthecin ester, ascopirone ester P, ascopirone ester T and / or cortalcerone ester can function as both an antioxidant and an emulsifier. In one embodiment, the methods or uses of the present invention can be used to produce emulsifiers for use in formulating... drugs. particularly in the production of controlled release formulations of active ingredients, in which the active ingredient is acylated using the enzyme lipid acyl transferase. Such slow release formulations are particularly useful for pharmaceutical compositions for oral administration, where the gradual hydrolysis of the ester in the digestive tract provides for the gradual release of the active ingredient. Such acylated oppositions can also be used for subcutaneous or intravenous formulations. In another embodiment, the methods or uses of the present invention can be used to produce phase transfer catalysts for phase transfer. of salts in a solution of organic solvents for example in an organic reaction. For example, transfer of an acyl group to a suitable cationic acceptor, such as a hydroxy acid (citric acid), or alternatively with an anionic acceptor group, such as hydroxyamines which can produce phase transfer catalysts for transfer of salts in a solution of organic solvents. In another embodiment, the methods of the present invention can be used to produce ester prodrugs of pharmaceutical compounds with low biological availability • and / or. low solubility, for example, antiviral agents such as aciclovir and gangaciclovir. The method could also be used for other medicinal compounds with a free hydroxy group, for example a primary, secondary or tertiary hydroxy group. Preferably, the ester produced according to the present invention is used in a pharmaceutical formulation. Preferably, the ester produced according to the present invention is used in a cosmetic and / or personal care product. Preferably, the ester produced according to the present invention is used in some foodstuffs and / or animal foodstuffs. The method according to the present invention can be a step in the manufacturing process of one or more than one pharmaceutical product, a cosmetic, a personal hygiene product, a food product, an animal food product. BENEFITS An advantage of the method according to the present invention is that it results in the manufacture of one or more carbohydrate ester, protein ester, protein subunit ester, or hydroxy acid ester, without the need for organic solvents. This has many advantages, for example in reducing the cost of production, exposing humans and the environment to organic solvents, and simplifying the production process. It is particularly advantageous in the production of esters for food applications to use lipids instead of fatty acids as there is no need to remove excess lipids as they come from the food product where the reaction product will be used. On the other hand, excess free fatty acids should be removed because they are harmful to most food products. ISOLATED In one aspect, preferably the polypeptide or protein for use in the present invention is in an isolated form. The term "isolated" means that the sequence is at least substantially free of at least one other component with which the sequence naturally associates in nature and as found in nature. In one aspect, preferably the bioconversion product according to the present invention, for example the carbohydrate ester and / or the protein ester and / or the protein subunit ester and / or the hydroxy acid ester is isolated from the mixture of reaction. The term "isolated" means that the bioconversion product... is at least substantially free of at least one other component with which the bioconversion product is associated during the bioconversion reaction. PURIFIED In one aspect, preferably the polypeptide or protein for use in the present invention is in a purified form. The term "purified" means that the sequence is in a relatively pure state, e.g., at least approximately 51% pure, or at least approximately 75%, or at least approximately 80%, or at least approximately 90% pure, or at least any less approximately 95% pure or at least approximately 98% pure. In one aspect, preferably the bioconversion product produced in accordance with the present invention, for example the carbohydrate ester and / or the protein ester and / or the protein subunit ester and / or the hydroxy acid ester is purified from the mixture of reaction- and is consequently in a purified form. The term "purified" means that the bioconversion product is in a relatively pure state, e.g., at least approximately 51% pure, or at least approximately 75%, or at least approximately 80%, or at least approximately 90% pure, or at least about 95% pure or at least about 98% pure. PHARMACEUTICAL COMPOSITIONS The present invention also provides a pharmaceutical composition comprising the product of the present invention and a pharmaceutically acceptable carrier, diluent or excipient (or combinations thereof). Pharmaceutical compositions may be for human or animal use in human and veterinary medicine and will typically comprise any one or more of a diluent, carrier, or excipient. pharmaceutically acceptable. Carriers or diluents acceptable for therapeutic use are well known in the pharmaceutical art and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be made with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient or diluent any suitable binder, lubricant, suspending agent, coating agent, solubilizing agent. Preservatives, stabilizers, pigments or even flavoring agents can be provided in the pharmaceutical composition. Examples of preservatives include deodium benzoate, sorbic acid, and p-hydrobenzoic acid esters. Antioxidants and suspending agents can also be used. There may be different compositional and formulation requirements depending on different delivery systems. By way of example, the pharmaceutical composition of the present invention may be formulated to be administered using a minipump or via a transmucosal route, for example, or as a nasal spray or aerosol for inhalation or an ingestible solution, or parenterally in which composition is formulated into an injectable form, for delivery, for example, by an intravenous, intramuscular or subcutaneous route. Alternatively the formulation can be designed to be administered by different routes. Where the agent must be administered transmucosally through the gastrointestinal mucosa, it must be able to remain stable during transit through the gastrointestinal tract; for example, it must be resistant to proteolytic degradation, stable at acidic pH, and resistant to the detergent effects of bile. Where appropriate, the pharmaceutical compositions may be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or powder for use as a dermal patch, or orally in the form of a tablets containing excipients such as starch or lactose, either in the form of capsules or ovules or alone or in mixture with an excipient, or in the form of elixirs, solutions or suspensions, containing flavoring agents or pigments, or they can be dispensed parenterally, Vidal for example via intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions can be best used in the form of a sterile aqueous solution which may contain other substances, for example salts or monosaccharides to make the solution isotonic with the blood. For oral or sublingual administration the compositions may be administered in the form of tablets or lozenges which may be formulated in conventional manner. CLONING OF A NUCLEOTIDE SEQUENCE THAT ENCODS A POLYPEPTIDE ACCORDING TO THE PRESENT INVENTION A nucleotide sequence that encodes a polypeptide that has the specific properties as defined herein or a polypeptide that is suitable for modification can be isolated from. .any cell or organism that produces said polypeptide. . Various methods are well known within the art for isolating nucleotide sequences. For example, a genomic DNA and / or cDNA library can be constructed using chromosomal DNA or messenger RNA from the organism that produces the polypeptide. If the amino acid sequence of the polypeptide is known, labeled oligonucleotide probes can be synthesized and used to identify clones encoding the polypeptide from the genomic library prepared from the organism. Alternatively, a probe could be used. labeled oligonucleotide, containing sequences homologous to another known polypeptide gene, to identify clones encoding the polypeptide. In the latter case, they are lower stringency hybridization and wash conditions are used. Alternatively, clones encoding the polypeptide can be identified by inserting genomic DNA fragments in an expression vector, such as a plasmid, negative enzymatic transformation bacteria, with the production of the DNA library, and subsequent transfer to agar-agar plates that contain an enzyme inhibited by the polypeptide. thus allowing the clones expressing the polypeptide to be identified. In a still further alternative, the nucleotide sequence encoding the polypeptide can be prepared synthetically by established standard methods, for example, the phosphoramidite method described by Beucage S.L. et al., (1981) Tetrahedron Letters 22, p 1859-1869, or the method described by Matthes et al., (1984) EMBO J. 3, p 801 - 805. In the phosphoramidite method, oligonucleotides are synthesized, for example, in an automated DNA synthesizer, purified, annealed, ligated and cloned into appropriate vectors. The nucleotide sequence may be of mixed material of genomic and synthetic origin, mixed of synthetic origin and cDNA, or mixed of genomic and cDNA origin, prepared from ligation of fragments of synthetic, genomic or cDNA origin (as appropriate) in accordance with with standard techniques. Each ligated fragment corresponds to various parts of the entire nucleotide sequence. The DNA sequence can also be prepared by polymerase chain reaction (PCR) using specific primers, for example as described in US patent 4,683,202 or in Saiki R K et al., {Science (1988) 239 , pages 487 - 491). . . NUCLEOTID SEQUENCES ... .. ... The present invention also encompasses nucleotide sequences that encode polypeptides having the specific properties as defined herein. The term "nucleotide sequence" as used herein, refers to an oligonucleotide sequence or a polynucleotide sequence, and variants, homologs, fragments and derivatives thereof (such as portions thereof). The nucleotide sequence may be of genomic or synthetic or recombinant origin, and may be double-stranded or single-stranded if representing the sense strand. or anti-sense. 0 term nucleotide sequence about present invention, includes genomic DNA, cDNA, DNA synthetic, and RNA. Preferably the term means the DNA, more preferably cDNA for the coding sequence. In a preferred embodiment, the nucleotide sequence which itself encodes a polypeptide having the specific properties, as defined herein, does not cover the native nucleotide sequence in its natural environment when it is linked to its naturally associated sequences, i.e. that it also in its natural environment. for ease : for reference, we will call this preferred embodiment "non-native nucleotide sequence". In this sense, the term "native nucleotide sequence" means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter that she is naturally with associated, said promoter also being in its native environment. Thus, the polypeptide of the present invention can be expressed by a nucleotide sequence in its native organism but in which the nucleotide sequence is not under the control of the promoter with which it naturally associates within that organism. Preferably the polypeptide is not a native polypeptide. In this sense, the term "native polypeptide" means an entire polypeptide that is in its native environment and when it has been expressed by its native nucleotide sequence. Typically, the nucleotide sequence encoding polypeptides having the specific properties, as defined herein, is prepared using recombinant DNA (i.e. recombinant DNA) techniques. However, in an alternative embodiment of the invention, the nucleotide sequence could be synthesized, in whole or in part, using chemical methods. well. known in the art (see Caruthers MH et al., (1980) Acids Nuc Res Symp Ser 215-23 and Horn T et al., (1980,) Acids Nuc Res Symp Ser 225-232). MOLECULAR EVOLUTION Once a nucleotide sequence encoding the enzyme has been isolated, or a putative nucleotide sequence encoding the enzyme has been identified, it may be desirable to modify the nucleotide sequence. selected, for example, it may be desirable to mutate the sequence to prepare an enzyme according to the present invention. Mutations can be introduced using synthetic oligonucleotides. Those oligonucleotides contain nucleotide sequences that flank the desired mutation sites. A convenient method is disclosed in Morinaga et al., (Biotechnology (1984) 2, p 646 - 649). Another method of introducing mutations in the nucleotide sequence encoding the enzyme is described in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151). Instead of site-directed mutagenesis as described above, mutations can be introduced randomly, for example by using a commercial kit such as the GeneMorph PCR mutagenesis kit from .Stratagene or the Diversify PCR .clontech random mutagenesis. EP 0583265 relates to methods for optimizing PCR-based mutagenesis, which can also be combined with the use of mutagenic DNA analogues such as those described in EP 0866796. Error-prone PCR technologies are convenient for producing variants of lipid acyl transferase enzymes with wound characteristics. WO 0206457 relates to the molecular evolution of lipases. A third method of obtaining new sequences is to fragment non-identical nucleotide sequences, using any number of restriction enzymes or an enzyme such as DNase I, and reassemble them. coding of sequences whole nucleotide for the functional protein. Alternatively, one can use one or multiple non-identical nucleotide sequences and introduce mutations during reassembly of the entire nucleotide sequence. DNA shuffling and family shuffling technologies are convenient for producing lipid acyl transferase variants with preferred characteristics. Convenient methods for performing "shuffling" can be found in EP 0752008, EP 1138763, EP 1103606. Shuffling can also be combined with other forms of DNA mutagenesis as described in US 6,180,406 and . WO. 01 / 34835. Thus, it is possible to produce numerous site-directed or random mutations in a nucleotide sequence, either in vivo or in vitro, and subsequently evaluate for improved functionality of the encoded polypeptide in various ways. Use in silico- and exo-mediated recombination methods (see WO 00 / 58517, US 6,344,328, US 6,361,974) e.g. molecular evolution can be performed where the variant produced retains very low homology with respect to enzymes or known proteins. Such variants thus obtained may have significant structural analogy to transferase enzymes. known but have very low homology with respect to amino acid sequence. By way of a non-limiting example, additionally, mutations or natural variants of a polynucleotide sequence can be recombined or with wild-type or with other mutations or natural variants to produce new variants. Such new variants can also be evaluated for improved functionality of the encoded polypeptide. The application of the aforementioned molecular evolution methods, or similar ones, allows the identification and selection of ..de. variants of the enzymes of the present invention. that has preferred characteristics without any prior knowledge of protein structure or function, and allows the production of unpredictable but beneficial mutations or variants. There are numerous examples of the application of molecular evolution in the art of optimizing or altering the activity of enzymes, such examples include, but are not limited to, one or more of the following: optimized expression and / or activity in a host cell or in vitro, enzyme activity increased, altered substrate and / or product specificity, increased or reduced enzymatic or structural stability, altered enzyme activity / specificity under conditions preferred environmental conditions, such as temperature, pH or substrate. As will be apparent to a person skilled in the art, using molecular evolution tools an enzyme can be altered to improve the functionality of the enzyme. Suitably, the lipid acyl transferase enzyme used in the invention may be a variant, i.e. contain at least least one amino acid substitution, deletion or addition, when compared to a parent enzyme. The variant enzymes retain at least 1%, 2 O O Q. O f O o r 5%, 10%, 15. %, „20 %., .30 %, .40.%, 50 %, 60 %, 70 %, 8.0 %, . 90 .%, . 95..%, 97%, 99% homology to parent enzyme. Suitable source enzymes can include any enzyme with esterase or lipase activity. Preferably, the parent enzyme aligns with the PFAM00657 consensus sequence. In a preferred embodiment, a variant lipid acyl transferase enzyme retains or incorporates at least one or more of the amino acid residues from the PFAM00657 consensus sequence found in the GDSx, GANDY, and HPT building blocks. Enzymes such as lipases with no or low lipid acyl transferase activity in an aqueous environment can be mutated using tools for molecular evolution to introduce or enhance transferase activity, thereby producing a lipid acyl transferase enzyme with significant transferase activity suitable for use in the compositions of the present invention. Suitably, the lipid acyl transferase enzyme for use in the invention may be a variant with improved enzyme activity on polar lipids, preferably phospholipids and / or glycolipids when compared to the parent enzyme. Preferably, such variants also have little or no activity in lysing polar lipids. The improved activity on polar lipids, phospholipids and / or glycolipids may be the result of hydrolysis and / or transferase activity or a combination of both. The lipid acyl transferase variant enzyme for use in the invention may have reduced activity on triglycerides, and / or monoglycerides and / or diglycerides compared to the parent enzyme. Suitably the variant enzyme may have no activity on triglycerides and / or monoglycerides and / or diglycerides. Alternatively, the variant enzyme for use in the invention can have increased activity on triglycerides, and / or also have increased activity on one or more of the following, polar lipids, phospholipids, lecithin, phosphatidyl choline, glycolipids, digalactosyl monoglyceride, monogalactosyl monoglyceride. Variants of the lipid acyl transferase enzyme are known, and one or more of such variants may be suitable for use in the methods and uses of the present invention. For example, variants of the lipid acyl transferase enzyme that are described in the following references: Hilton & Buckley JT. Studies on the reaction mechanism of a microbial lipase / acyltransferase using chemical modification and site-direct mutagenesis. J_. Biol. Chem., 1991 Jan 15: 266 (2): 997-1000; Robertson DL, Hilton S, Wong KR, Koeper A, Buckley JT. Influence of active site and tirolysin modification on the secretion and activity of the Aeromonas hydrophila lipase / acyltransferase. J. Biol. Chem., 1994 Jan 21; 269(3): 2146-50; Brumlik MJ, Buckley JT., Identification of the catalytic triad of the lipase / acyltransferase from Aeromonas hydrophila. J. Bacteriol., 1996 Apr; 178(7): 2060-4; Peelman F, Vinaimont N, Verhee A, Vanloo B, Verschelde JL, Labeur C, Seguret-Mace S, Duverger N, Hutchinson G, Vandekerckhove J, Tavernier J, Rosseneu M. A proposed architecture for lecithin cholesterol acyl transferase (LCAT): identification of the catalytic triad and molecular modeling. Protein Sci. 1998 March; 7(3): 587-99. AMINO ACID SEQUENCES The present invention also encompasses amino acid sequences of polypeptides having the specific properties as defined herein. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some examples, the term "amino acid sequence" is synonymous with the term "peptide". The amino acid sequence can be prepared / isolated from a convenient source, or it can be made synthetically or it can be prepared using recombinant DNA techniques. Suitably, amino acid sequences can be obtained by standard techniques from the isolated polypeptides taught herein. A convenient method for determining the amino acid sequence of isolated polypeptides is as follows: The purified polypeptide can be vacuum frozen and 100 pg of the vacuum frozen material can be dissolved in 50 yl of a mixture of 8 M urea and sodium bicarbonate 0.4 M ammonia, pH 8.4. The dissolved protein can be denatured and reduced for 15 minutes at 50°C after blanketing with nitrogen and adding 5 µl of 45 mM dithiothreitol. After cooling to room temperature, 5 yl to 100 mM iodine acetamide can be added to the cysteine residues to be derivatized for 15 minutes at room temperature, absence of light and under nitrogen atmosphere. 135 æl of water and 5 æg of Lys-C endoproteinase in 5 æl of water can be added to the above mentioned reaction mixture and the digestion can be carried out at 37°C under nitrogen atmosphere for 24 hours. The resulting peptides can be separated by reverse phase HPLC on a C18 VYDAC column (0.46 x 15 cm; 10 µm; The Separation Group, California, USA) using solvent A: 0.1% TEA in water and solvent B: 0.1% TEA in acetonitrile. Selected peptides can be re-chromatographed on a Develosil C18 column using the same solvent system, prior to N-terminal sequencing. Sequencing can be done using a Biosystems Applied 47 6A sequencer that uses cycles pulsed liquid tests according to the manufacturer's instructions (Biosystems Applied, California, USA). SEQUENCE IDENTITY OR SEQUENCE HOMOLOGY The present invention also encompasses the use of sequences that have a degree of sequence identity or sequence homology with the amino acid sequences of a polypeptide having the specific properties defined herein or of any nucleotide sequences encoding such polypeptide (hereinafter referred to as "homologous sequences"). Here, the term "homologous" means an entity that has a certain homology with as. said amino acid sequences or said nucleotide sequences. Here the term "homology" can be equated with "identity". The amino acid sequence and / or homologous nucleotide sequence should provide and / or encode a polypeptide that has functional activity and / or enhances enzyme inactivity. In the present context, a homologous sequence is understood to include an amino acid sequence that may be at least 75%, 85% or 90% identical, preferably at least 95% or 98% identical to said sequence. Typically the homologs will comprise the same active sites etc as the said sequence of considered in terms of similarity (i.e. amino acid residues having similar chemical properties / functions), in the context of the present invention it is preferable to express homology in terms of sequence identity. In the present context, a homologous sequence is understood to include a sequence of nucleotides that can be at least 75%, 85% or 90% identical, preferably at least 95% or 98% identical to a nucleotide sequence encoding a polypeptide of the present invention. invention (the sequence referred to). Typically, the homologues will comprise the same sequences coding for active sites etc as the referenced sequence. While homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties / functions), in the context of the present invention it is preferable to express homology in terms of sequence identity. Homology comparisons can be conducted visually, or more commonly, with the help of commonly available sequence comparison programs. These commercially available computer programs can calculate the percent homology (%) between two or more sequences. contiguous sequences, i.e. one sequence is aligned with another sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This process is called a "gapless" alignment. Typically, such gapless alignments are performed only over a relatively short number of residues. Although it is a very simple and consistent method, it fails when trying to take into account that, for example, in an identical pair of sequences anyhow, an insertion or deletion will cause . you. following amino acid residues are thrown out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into account possible insertions and deletions without unduly penalizing the total homology count. This is done by inserting "GAPs" in the alignment sequence to try to maximize local homology. However, these more complex methods determine "GAP penalties" for each GAP that occurs in the alignment so that, for the same number of amino acids identical, a sequence alignment with as few gaps as possible will achieve a higher score than a sequence with many gaps. Typically, "gap assignment values" are used as a way to charge relatively high penalties for the existence of a "gap" and lower penalties for each subsequent residue in the "gap". This is the most widely used gap scoring system. High penalties will naturally produce optimized alignments with less gaps. Most alignment programs allow GAP penalties to be modified. However, it is preferable to use reference values when using such software for sequence comparison. For example using the GCG Wisconsin Bestfit package, the benchmark penalty for an amino acid sequence is -12 for a GAP and -4 for each extension. The calculation of the maximum percent homology, therefore, first requires the production of an optimal alignment, taking into account the "GAP penalties". A convenient computer program for performing such an alignment is the GCG Wisconsin Bestfit package (Devereux et al., 1984 Nuc. Acids Research 12, p 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (See Ausubel et al., 1999 Short Protocols in Molecular Biology, 4 a Ed. Chapter 18), FASTA (Altschul et al., 1990 J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for online and offline search (see Ausubel et al., 1999, pages 7-58 to 7-60). However, for some applications, it is preferable to use the GCG Bestfit program. Also available is a new tool called BLAST 2 Sequences, used to compare protein and nucleotide sequence (See FEMS Microbiol Lett 1999, 174(2): 247 - 50; FEMS Microbiol Lett 1999, 177(1): 187 - 8 and . tatiana@ncbi.nlm.nih.gov ) . , Although the final percent homology can be measured in terms of identity, the alignment process itself is typically not based on an "all-or-nothing" comparison of pairs. Instead, a similarity score scale matrix is usually used for each pairwise comparison based on chemical similarity or evolutionary distance. A commonly used example of such a matrix is the BLOSUM62 matrix, the reference matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either published reference values or a comparison table with ordering symbols is provided (see user manual for details). For some applications, it is it is preferable to use the published reference values for the GCG package, or in the case of other software, the reference matrix such as BLOSUM62. Alternatively, percent homologies can be calculated using the multiple alignment features of DNASIS® (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237 - 244) . Once the software has produced an optimal alignment, it is possible to calculate the percent homology, preferably the percent sequence identity. The software typically does this as part... of the string comparison and generates a numerical result. Sequences can also have deletions, insertions or substitutions of amino acid residues that produce silent modification and result in a functionally equivalent substance. Deliberate amino acid substitutions can be made based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues while retaining the secondary binding activity of the substance. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups that have similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine. Conservative substitutions can be made, for example, according to the Table below. Amino acids in the same block in the second column and preferably in the same row in the third column can be substituted for each other: ALIPHATIC Support GAP I L V Polar - uncharged C S T M - -• N Q Polar - charged D E K R AROMATIC H F W Y The present invention also encompasses homologous substitution (substitution and exchange are both used herein to mean the exchange of an existing amino acid residue for an alternative residue) that may occur, i.e., like-for-like substitution, such as basic by basic, acid by acid, polar by polar, etc. Nonhomologous substitution can also occur, that is, of a class of residues to another, or alternatively involving the inclusion of an unnatural amino acid such as ornithine (hereinafter referred to as Z), ornithine diamino butyric acid (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as hereinafter referred to as 0), pyrylalanine, thienylalanine, naphthylalanine and phenylglycine. Substitutions can also be made for unnatural amino acids. The sequence variants of . amino acids may include convenient groups of spacers which may be inserted-between any two residues of . amino acid. sequence, including alkyl groups such as methyl, ethyl, or propyl groups, and amino acid spacers such as glycine or [3-alanine. A further form of variation, implying the presence of one or more amino acid residues in the form of peptoids, will be well understood by those skilled in the art. For the avoidance of doubt, "peptoid form" is used to refer to a variant of amino acid residues in which the alpha carbon substituent group is on the nitrogen atom of the residue rather than on the alpha carbon. Processes for preparing peptides in peptoid form are known in the art, for example, Simon RJ et al., PNAS (1992) 89(20), 9367 9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132 - 134. Nucleotide sequences for use in the present invention, or encoding a polypeptide having the specific properties defined herein, may include synthetic or modified nucleotides therein. Several different types of modifications to oligonucleotides are known in the art. These types include methylphosphanate and phosphorothioate backbones and / or the addition of acridine or polylysine chains at the 3' to 5' ends of the molecule. For purposes of the present invention, it should be understood, that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications can be performed either to improve in vivo activity or to extend the useful life of the nucleotide sequences. The present invention also encompasses the use of nucleotide sequences that are complementary to the sequences discussed herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof, then that sequence can be used as a probe to identify coding sequences. similar in other organisms, etc. Polynucleotides that are not 100% homologous to the sequences of the present invention but are within the scope of the invention can be obtained in several ways. Other variants of the sequences described herein can be obtained, for example, by probing DNA libraries made from a variety of individuals, for example individuals from different populations. In addition, other viral or bacterial or cellular homologs, in particular cellular homologs found in mammalian cells (e.g., rat, mouse, cattle and primate cells), can be obtained and such homologs and fragments thereof generally -, may be - capable of selectively hybridizing. against the sequences shown in the sequence listed here. Such sequences may be obtained by probing cDNA libraries made from genomic DNA libraries or from other animal species, and probing such libraries with probes comprising wholly or partially any of the sequences contained in the attached sequence listing under conditions medium to high stringency. Similar considerations apply to obtaining homologous species and allelic variants of the polypeptide or nucleotide sequences of the invention. Homologous variants, strains or species can also be obtained using a degenerate PCR that will use "primers" designed to focus on sequences within the variants and homologs encoding the conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by aligning the amino acid sequences of several homologues or variants. Sequence alignments can be performed using computer software known in the art. For example, the GCG Wisconsin PileUp program is widely used. Primers used in degenerate PCR will contain one or more degenerate positions and will be used under lower stringency conditions than the. conditions used to clone sequences with sequence-unique primers to known sequences. Alternatively, such polynucleotides can be obtained by site-directed mutagenesis of characterized sequences. This can be useful where, for example, changes to silent codon sequences are needed to optimize codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence modifications may be desired in order to introduce polypeptide restriction recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides. The polynucleotides (sequence of nucleotides) of the invention can be used to produce a primer, for example a PCR primer, a primer for an alternative amplification reaction, a probe, for example, labeled with a marker development by conventional means using radioactive or non-radioactive markers, or the polynucleotides can be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, • 30. or 40 nucleotides ..in their-..length-, and are also encompassed by the term polynucleotides of the invention, as used herein. Polynucleotides, such as DNA polynucleotides and probes, according to the invention can be produced recombinantly, synthetically, or by any means available to those skilled in the art. They can also be cloned by standard techniques. In general, primers will be produced by synthetic means, involving a gradual production of the desired nucleic acid sequence, one nucleotide at a time. The techniques to carry out this production using techniques automated they are completely available by technology. Longer polynucleotides will be produced usually using recombinant techniques, for example using PCR (polymerase chain reaction) cloning techniques. This will involve creating a pair of "primers" (for example, approximately 15 to 30 nucleotides) flanking a region of the lipid that targets a sequence you want to clone, placing the "primers" in contact with the mRNA or cDNA obtained from an animal or a human cell by carrying out the polymerase chain reaction under conditions which. lead to amplification of the desired-region, isolating the amplified fragment (eg, purifying the reaction mixture on an agarose gel) and recovering the amplified DNA. Primers can be designed to contain restriction sites for convenient enzyme recognition so that the amplified DNA can be cloned into a convenient cloning vector. HYBRIDIZATION The present invention also encompasses sequences that are complementary to the sequences of the present invention or sequences that are capable of hybridizing to the sequences of the present invention or to sequences that are complementary thereto. The term "hybridization" as used herein shall include both "the process by which a strand of nucleic acid is joined to a complementary strand by base pairing" and the process of amplification as performed by polymerase chain reaction (PCR) technologies. The present invention also encompasses the use of nucleotide sequences which are capable of hybridizing to sequences which are complementary to the sequences discussed herein, or any derivatives, fragments or derivatives thereof. . The present invention also encompasses sequences that are complementary to sequences that are capable of hybridizing to the nucleotide sequences discussed herein. Hybridization conditions are based on the melting temperature (Tf) of the nucleotide binding complex, as taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152, Academic Press, San Diego, CA ) , and confer a definite "stringency", as explained below. Maximum stringency typically occurs at approximately Tf - 5°C (5°C below probe Tf); The high stringency between approximately 5°C to 10°C below the Tf; the intermediate stringency of approximately 10°C to 20°C below the Tf; and low stringency at approximately 20°C to 25°C below the Tf. As will be understood by those skilled in the art, a maximum stringency of hybridization can be used to identify or detect identical nucleotide sequences while an intermediate (or low) stringency of hybridization can be used to identify or detect similar or related polynucleotide sequences. . Preferably, the present invention encompasses sequences that - are complementary to . sequences that are capable of hybridizing under high stringency conditions or intermediate stringency conditions to nucleotide sequences that encode polypeptides that have the specific properties as defined herein. More preferably, the present invention encompasses sequences that are complementary to sequences that are capable of hybridizing under high stringency conditions (e.g., 65°C and 0.1xSSC {1xSSC = 0.15 M NaCl, 0.015 M sodium citrate , pH 7.0}) to nucleotide sequences encoding polypeptides having specific properties as defined herein. The present invention also relates to nucleotide sequences that can hybridize to the nucleotide sequences discussed herein (including sequences complementary to those discussed herein). The present invention also relates to nucleotide sequences that are complementary to sequences that can hybridize to the nucleotide sequences discussed herein (including sequences complementary to those discussed herein). Also included within the scope of the present invention are polynucleotide sequences which are capable of hybridizing to nucleotide sequences. discussed here-in conditions of intermediate to maximum stringency. In a preferred aspect, the present invention covers nucleotide sequences that can hybridize to the nucleotide sequences discussed herein, or the complement thereof, under stringent conditions (eg, 50°C and 0.2xSSC). In a more preferred aspect, the present invention covers nucleotide sequences that can hybridize to the nucleotide sequences discussed herein, or the complement thereof, under high stringency conditions (eg, 65°C and 0.1xSSC). EXPRESSION OF POLYPEPTIDES A nucleotide sequence for use in the present invention or for encoding a polypeptide having specific properties, as defined herein, can be incorporated into a recombinant replicable vector. The vector can be used to replicate and express the nucleotide sequence, in polypeptide form, in and / or a compatible host cell. Expression can be controlled using control sequences that include promoters or enhancers and other expression regulation signals. Prokaryotic promoters and promoters functional in eukaryotic cells can be used. Tissue-specific or stimulus-specific promoters can be used. Chimeric promoters also may be used comprising sequence elements from two or more different promoters described above. The polypeptide produced by a host cell Recombinant by expression of the nucleotide sequence can be secreted or contained intracellularly depending on the sequence and / or vector used. Coding sequences can be designed with signal sequences that direct secretion of the coding substance. sequences across a given prokaryotic or eukaryotic cell membrane. EXPRESSION VECTOR The term "expression vector" means a construct capable of in vivo or in vitro expression. Preferably, the expression vector is incorporated into the genome of the organism. The term "incorporated" preferably encompasses stable incorporation within the genome. The nucleotide sequence of the present invention or the coding for a polypeptide having the specific properties as defined herein, may be present in a vector, in which .• the -sequence of . nucleotides is operably linked to the regulatory sequences of such so that the regulatory sequences are capable of providing for expression of the nucleotide sequence by a suitable host organism, ie the vector is an expression vector. The vectors of the present invention can be transformed within a cell of a suitable host as described below to provide expression of a polypeptide having the specific properties as defined herein. The choice of vector, for example a plasmid, cosmid, virus or phage vector, will often depend on of the host cell in which same should to be introduced. The vectors may contain one or more selectable marker genes - such as a gene conferring resistance to antibiotics, for example ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Alternatively, selection can be performed by co-transformation (as described in WO 91 / 17243). Vectors can be used in vitro, for example, for RNA production or used to transfect or transform a host cell. Thus, in a further embodiment, the-invention.provides a method for making the nucleotide sequences of the present invention or nucleotide sequences that encode polypeptides that have the specific properties, as defined herein, by introducing a nucleotide sequence into a vector replicable, introducing the vector into a compatible host cell, and culturing the host cell under conditions that bring about replication of the vector. The vector may further comprise a nucleotide sequence which enables the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMBl and pIJ702. REGULATORY SEQUENCES In some applications, a nucleotide sequence for use in the present invention, or a nucleotide sequence encoding a polypeptide having specific properties as defined herein, can be operably linked to a regulatory sequence that is capable of providing for expression of the nucleotide sequence, as the chosen host cell. By way of example, the present invention encompasses a vector comprising the nucleotide sequence--- of . present invention, operatively linked to such a regulatory sequence, i.e. the vector is an expression vector. The term "operably linked" refers to a juxtaposition in which the components described are in a relationship that allows them to function in any way they desire. A regulatory sequence "operably linked" to a coding sequence is linked in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. The term "regulatory sequences" includes promoters and enhancers and other signals regulating expression. The term "promoter" is used in the normal technical sense, e.g., an RNA polymerase binding site. Improved expression of the nucleotide sequence encoding the enzyme having the specific properties as defined herein can also be achieved by selection of heterologous regulatory regions, for example promoters, secretion leadership regions and terminator regions. Preferably, the nucleotide sequence of the present invention can be operably linked to at least one promoter. Examples of suitable promoters for directing transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art. CONSTRUCTS The term "construct", which is synonymous with terms such as "conjugate", "cassette" and "hybrid", includes a nucleotide sequence that encodes a polypeptide that has the specific properties as defined herein, for use in accordance with the present invention, directly or indirectly linked to a promoter. An example of an indirect bond is the provision of a spacer group convenient, such as an intron sequence, such as the Shl-intron or the ADH-intron, intermediate between the promoter and the nucleotide sequence of the present invention. The same is true of the term "fused" in relation to the present invention, which includes direct or indirect attachment. In some cases, the terms do not cover the natural combination of protein nucleotide sequence coding commonly associated with the promoter of wild-type genes and when they are both in their natural environment. The construct may even contain or express a marker that allows selection of the genetic construct. For some.-.applications, preferably the. constructor comprises at least one nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide having the specific properties as defined herein, operably linked to a promoter. HOST CELLS The term "host cell", in relation to the present invention, includes any cell that comprises either a nucleotide sequence that encodes a polypeptide having the specific properties as defined herein, or an expression vector as described above, and which is used in the recombinant production of a polypeptide having the specific properties as defined herein. Thus, a further embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence of the present invention or with a nucleotide sequence that expresses a polypeptide having the specific properties as defined herein. Cells will be chosen as they are compatible with the above mentioned vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells. Preferably, host cells. are not., human cells....... Examples of suitable bacterial host organisms are gram negative bacteria or gram positive bacteria. Depending on the nature of the nucleotide sequence encoding a polypeptide having the specific properties as defined herein, and / or the desire for further processing of the expressed protein, eukaryotic hosts such as yeast, or other fungi, may be preferred. In general, yeast cells are preferred over fungal cells because they are easier to manipulate. However, some proteins are either poorly secreted by the yeast cell, or at some cases are not processed properly (eg, hyperglycosylation, in yeast). In these cases, a different fungal host organism should be selected. The use of suitable host cells, such as yeast, fungi, and plant host cells, provides for such post-translational modifications (e.g., myristoylation, glycosylation, truncation, lapidation, and tyrosine, serine, or threonine phosphorylation) as may be necessary to confer a optimal biological activity in recombinant expression products according to the present invention. ...... The host cell can be. deficient, protease-deficient, or a strain with minimal protease. BODY The term "organism" in connection with the present invention includes any organism that can comprise a nucleotide sequence according to the present invention, or a nucleotide sequence encoding a polypeptide having the specific properties as defined herein and / or the products obtained from it. Suitable organisms may include a prokaryote, fungus, yeast, or plant. The term "transgenic organism" in relation to the present invention includes any organism that may comprise a nucleotide sequence according to the present invention or a nucleotide sequence encoding a polypeptide having the specific properties as defined herein, and / or the products obtained therefrom, and / or in which a promoter can allow the expression of the encoding of the nucleotide sequence for a polypeptide having the specific properties as defined herein, within the organism. Preferably the nucleotide sequence is incorporated into the genome of the organism. The term "transgenic organism" does not encompass sequences encoded by native nucleotides in their natural environment when they are under the control of. .your. promoter., native who is also in his natural environment. Therefore, the transgenic organism of the present invention includes an organism comprising any one of, or combinations of, a nucleotide sequence encoding a polypeptide having specific properties as defined herein, a construct as defined herein, vectors as defined herein, plasmids as defined herein, cells as defined herein, or products thereof. For example the transgenic organism may also comprise a nucleotide sequence encoding a polypeptide having specific properties, such as as defined here, under control of a promoter heterologous. TRANSFORMATION OF HOST CELLS / ORGANISM As previously indicated, the host organism can be a prokaryotic organism or a eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis. Teachings on transforming prokaryotic hosts are well documented in the art, for example, see Sambrook et al., (Molecular Cloning: A Laboratory Manual, 2 a edition, 1989, Cold Spring Harbor Laboratory .. Press). In another embodiment the transgenic organism can be a yeast. Filamentous fungal cells can be transformed using various methods known in the art, such as a process involving protoplast formation and transformation followed by cell wall regeneration in a known manner. The use of Aspergillus as a host microorganism is described in EP 0238023. Another host organism can be a plant. A review of the general techniques used for plant transformation can be found in the articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol
[1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech, March / April 1994, 17 - 27). Additional teachings for transformation of plants can be found in EP-A-0449375. General teachings for transforming fungi, yeasts and plants are presented in the following sections. TRANSFORMED FUNGUS A host organism can be a fungus, such as a... filamentous fungus. Examples of such suitable hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma and so on. Teachings for transforming filamentous fungi are reviewed in US-A-5741665 which states that standard techniques for transforming filamentous fungi and cultivating fungi are well known in the art. An extensive review of techniques such as those published on N. crassa is found, for example, in Davis and de Serres, Methods Enzymes (1971) 17A: 79 - 143. Additional teachings for transforming filamentous fungi are reviewed in US-A-5674707. In one aspect, the host organism can be of the genus Aspergillus, such as Aspergillus niger. A transgenic Aspergillus according to the present invention can also be prepared, for example, by the following teachings of Turner G. 1994 {Vectors for genetic manipulation. In: Martinelli S.D., Kinghorn J.R. (Editors) Aspergillus: 50 Years on. Progress in Industrial Microbiology, vol 29. Elsevier Amsterdam 1994. pp. 641-666). . The expression . genetics in . filamentous fungi was. reviewed in Punt et al., (2002) Trends Biotechnol, May 2002; 20(5): 200-6, Archer & Peberdy, Crit Rev Biotechnol (1997) 17(4): 273-306. TRANSFORMED YEAST In another embodiment, the transgenic organism can be a yeast. A review of the principles of heterologous gene expression in yeast is provided in, for example, Methods Mol Biol (1995), 49: 341 - 54, and Curr Opin Biotechnol (1997) October; 8(5): 554 - 60. In this sense, yeast, such as the species Saccharomyces cerevisi or Pichia pastoris (see FEMS Microbiol Rev (2000, 24(1): 45 - 66), can be used as a heterologous gene expression vehicle. A review of the principles of heterologous gene expression in Saccharomyces cerevisiae and the secretion of gene products is given by E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the expression of heterologous genes", Yeasts, Vol 5, Anthony H Rose and J Stuart Harrison, eds, 2 a edition, Academic Press Ltd.). For the transformation of yeast, several protocols have been developed. For example, a transgenic Saccharomyces according to the present invention can be prepared...,, by the following teachings of-Hinnen, et al.,,. (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929); Beggs, JD (1978, Nature, London, 275, 104); and Ito, H et al., (1983, J Bacteriology 153, 163-168). A suitable host yeast organism can be selected from the biotechnologically relevant yeast species such as, but not limited to, the yeast species selected from Pichia spp., Hansenula spp., Kluyveromyces, Yanrowiszia spp., Saccharomyces spp., including S. cerevisiae , or Schizosaccharomyce spp. including Schizosaccharomyce pombe. A strain of the methylotrophic yeast species Pichia pastoris can be used as a host organism. In one embodiment, the host organism can be a Hansenula species, such as H. polimorpha (as described in WO 01 / 39544). Transformed yeast cells can be selected using various selective markers such as auxotrophic markers and dominant antibiotic resistance markers. TRANSFORMED PLANTS OR TRANSFORMED PLANT CELLS A suitable host organism for the present invention can be a plant. A review of the general techniques can be found in the articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol
[1991] 42: 205 - 225) and Christou (Agro-Food-Industry Hi-Tech, March / April 1994 17 -27) , or in WO 01 / 16308. The transgenic plant can produce enhanced levels of phytosterol esters and phytostanol esters, for example. Accordingly, the present invention also relates to a method for producing a transgenic plant with enhanced levels of phytosterol esters and phytostanol esters, comprising the steps of transforming a plant cell with a lipid acyl transferase enzyme as defined herein (especially with an expression vector or construct comprising a lipid acyl transferase enzyme as defined herein), and growing a plant from a transformed plant cell. SECRETION Often, it is desirable for the polypeptide to be secreted from the expression host into a culture medium from which the enzyme can be more easily recovered. In accordance with the present invention, the secretion driver sequence can be selected based on the desired expression host. Hybrid signal sequences can also be used within the context of the present invention. Typical examples of heterologous secretion-driving sequences are those that originate from the fungal amyloglycosidase (AG) gene (e.g., glaA - both 18 and 24 amino acid versions of Aspergillus), the a-factor gene (yeasts, e.g. Saccharomyces, Kluyveromyces and Hansenula) or the α-amylase gene (Bacillus). DETECTION Various protocols for detecting and measuring the expression of amino acid sequences are known in the art. Examples include the adsorbed enzyme immunoassay (ELISA), radioimmunoassay (RIA) and fluorescence activated cell sorting (FACS). A wide variety of tags and conjugation techniques are known to those skilled in the art and can be used in various amino acid and nucleic acid assays. Several companies such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI), and US Biochemical Corp (Cleveland, OH) commercially supply kits and protocols for these procedures. Suitable reporter molecules or reporter markers include those radionuclides, enzymes, fluorescent agents, chemiluminescent agents or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and so on. Patents instructing the use of such markers include US-A-3,817,837; US-A-3,850,752; US-A-3,939,350; US-A-3,996,345; US-A-4,277,437; US-A-4,275,149 and US-A-4,366,241. Recombinant immunoglobulins can also be produced as shown in US-A-4,816,567. FUSION PROTEIN A polypeptide having the specific properties as defined herein can be produced as a fusion protein, for example, to aid in extraction and in its purification. Examples of fusion partner proteins include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and / or transcriptional activation domains) and β-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion partner protein and the protein sequence of interest to allow removal of the fusion protein sequences. Preferably the fusion protein will not impede the activity of the protein sequence. Gene fusion expression systems in E. coli have been reviewed in Curr. opinion Biotechnol. (1995), 6(5): 501 - 6. -....... - - In another embodiment of the invention, the amino acid sequence of a polypeptide having the specific properties as defined herein can be linked with a heterologous sequence to encode a fusion protein. For example, for screening peptide libraries for agents capable of affecting substance activity, it may be useful to encode a chimeric substance that expresses a heterologous epitope that is recognized by a commercially available antibody. The invention will now be described, by way of example only, with reference to the following Figures and Examples. Figure 1 shows a database version 6 consensus sequence PFAM00657 (SEQ ID NO: 1). Figure 2 shows an amino acid sequence (SEQ ID NO:2) obtained from the organism Aeromonas hydrophila (P10480; GI:121051). Figure 3 shows an amino acid sequence (SEQ ID NO: 3) obtained from the organism Aeromonas salmonicida (AAG098404; GI:9964017). Figure 4 shows an amino acid sequence (SEQ ID NO: 4) obtained from the organism Streptomyces coelicolor A3 (2) (Genbank accession number NP 631558). Figure 5 shows an amino acid sequence (SEQ ID NO: 5) obtained from the organism Streptomyces coelicolor A3 (2) (Genbank accession number: CAC42140). Figure 6 shows an amino acid sequence (SEQ ID NO:6) obtained from the organism Saccharomyces cerevisiae (Genbank accession number P41734). Figure 7 shows an alignment of selected sequences to the PFAM00657 consensus sequence. Figure 8 shows a paired alignment of SEQ ID NO:3 with SEQ ID NO:2 showing 93% amino acid sequence identity. The signal string is underlined. The + sign denotes differences. The GDSX theme that contains the active site serine 16, and the active sites aspartic acid 116 and histidine 291 are highlighted (see shaded regions). The numbers after the amino acid are the minus (-) sign sequence • Figure 9 shows a nucleotide sequence (SEQ ID No. 7) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Aeromonas hydrophila. Figure 10 shows a nucleotide sequence (SEQ ID No. 8) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Aeromonas salmonicida. Figure 11 shows a nucleotide sequence (SEQ ID No. 9) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Streptomyces coelicolor A3(2) (Genbank accession number NC_003888.1:8327480..8328367 ). Figure 12 shows a nucleotide sequence (SEQ ID NO: 10) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Streptomyces coelicolor A3 (2) (Genbank accession number AL939131.1:265480..266367 ). Figure 13 shows a nucleotide sequence (SEQ ID NO: 11) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Saccharomyces cerevisiae (Genbank Accession No. Z75034). Figure 14 shows an amino acid sequence (SEQ ID NO: 12) obtained from the organism Ralstonia (Genbank accession number: AL646052). Figure 15 shows a nucleotide sequence (SEQ ID NO: 13) encoding a lipid acyl transferase enzyme according to the present invention obtained from the organism Ralstonia. Figure 16 shows SEQ ID NO:20. CAB39707.1 protein Scoel NCBI accession code GI:4539178, which retained the hypothetical protein. [ Streptomyces coelicolor A3 (.2)]. ... Figure 17 shows a nucleotide sequence shown as SEQ ID NO:21, encoding the protein's NCBI accession code, CAB39707.1 GI:4539178, which conserved the hypothetical protein [Streptomyces coelicolor A3(2)]. Figure 18 shows an amino acid shown as SEQ ID NO:22. Scoe2 NCBI protein accession code CAC01477.1 GI:9716139, which retained the hypothetical protein [Streptomyces coelicolor A3(2)]. Figure 19 shows a nucleotide sequence shown as SEQ ID No. 23, encoding the access code Protein NCBI Scoe2 CAC01477.1 GI:9716139 what preserved the hypothetical protein [Streptomyces coelicolor A3(2)]. . Figure 20 shows an amino acid sequence (SEQ ID NO:24) Scoe3 NCBI accession code of the protein, CAB88833.1 GI:7635996, secreted putative protein. [Streptomyces coelicolor A3(2)]. Figure 21 shows a nucleotide sequence shown as SEQ ID NO: 25 encoding the protein's Scoe3 NCBI accession code, CAB88833.1 GI:7635996, putative secreted protein. [Streptomyces coelicolor A3(2)]. Figure 22 shows an amino acid sequence (SEQ ID. NO.....2.6).. code of. Scoe4 NCBI accession of the protein, CAB89450.1 GI: 7672261, secreted putative protein. [Streptomyces coelicolor A3(2)]. Figure 23 shows a nucleotide sequence shown as SEQ ID NO:27, encoding the protein's Scoe4 NCBI accession code, CAB89450.1 GI:7672261, putative secreted protein. [Streptomyces coelicolor A3(2)]. Figure 24 shows an amino acid sequence (SEQ ID NO:28) Scoe5 NCBI accession code of the protein, CAB62724.1 GI:6562793, putative secreted lipoprotein. [Streptomyces coelicolor A3(2)]. Figure 25 shows a nucleotide sequence shown as SEQ ID NO: 29, encoding the access code Protein NCBI Scoe5, CAB62724.1 GI:6562793, putative secreted lipoprotein. [Streptomyces coelicolor A3(2)]. Figure 26 shows an amino acid sequence (SEQ ID NO:30) Sriml NCBI accession code of the protein, AAK84028.1 GI:15082088, GDSL lipase [Streptomyces rimosus]. Figure 27 shows a nucleotide sequence shown as SEQ ID NO: 31, encoding the Sriml NCBI accession code of the protein, AAK84028.1 GI:15082088, GDSL lipase [Streptomyces rimosus]. Figure 28 shows an amino acid sequence (SEQ ID NO: 32). A lipid acyl transferase from Aeromonas hydrophila (ATCC #7965). Figure 29 shows a nucleotide sequence (SEQ ID NO: 33) encoding a lipid acyl transferase enzyme from Aeromonas hydrophila (ATCC #7965). Figure 30 shows an amino acid sequence (SEQ ID NO: 34) of a lipid acyl transferase enzyme from Aeromonas salmonicida subsp. Salmonicide (ATCC #14174). Figure 31 shows a nucleotide sequence (SEQ ID NO: 35) encoding a lipid acyl transferase enzyme from Aeromonas salmonicida subsp. Salmonicide (ATCC #14174). Figure 32 shows that homologues of Aeromonas genes can be identified using the local basic alignment search tooling service at National Center for Biotechnology Information, NIH, MD, USA and the Completed Genome Databases. The GDSX theme was used in the database search and several sequences / genes were identified that potentially encode enzymes with lipolytic activity. The genes were identified as belonging to the genus Streptomyces, Xanthomonas and Ralstonia. As in an example below, Ralstonia solanacearum was aligned to the Aeromonas salmonicida (satA) gene. The paired alignment showed 23% identity. The serine active site is present at the amino terminus and catalytic histidine and aspartic acid residues can be identified. Figure 33 shows the consensus sequence PFAM00657.il [Family 00657, database version 11] (hereinafter referred to as the PFAM consensus) and the alignment of various sequences to the PFAM consensus sequence. Arrows indicate active site residues, underlined boxes indicate three of the homology boxes indicated by [Upton C and Buckley JT (1995) Trends Biochem Sci 20; 179 - 179] . Capital letters in the PFAM consensus indicate residues conserved in many family members. 0 symbol indicates a position where the hidden Markov model, from the PFAM consensus, expected to find a residual but did not, and therefore a GAP is inserted. The symbol indicates a residue without a corresponding residue in the PFAM consensus. The sequences are the amino acid sequences listed in Figures 16, 18, 20, 22, 24, 26, 28 and 30. Figure 34 shows the PFAM consensus sequence PFAM00657.il [family 00657, database version 11] (hereinafter referred to as the PFAM consensus) and the alignment of various sequences to the PFAM consensus sequence. Arrows indicate active site residues, underlined boxes indicate three of the homology boxes indicated by [Upton C and Buckley JT (1995) Trends Biochem Sci 20; 179-179]. Capital letters in the PFAM consensus indicate conserved residues in many family members. The symbol indicates a position where the hidden Markov model, from the PFAM consensus, expected to find a residual but did not, and therefore a GAP is inserted. The symbol indicates a residue without a corresponding residue in the PFAM consensus. The sequences are the amino acid sequences listed in Figures 2, 16, 18, 20, 26, 28 and 30. All of these proteins were found to be active against lipid substrates. Figure 35 shows a pet12-AsalGCAT=pSM expression vector containing the His-tagged C-terminus of the Aeromonas salmonicida lipid acyl transferase gene. Figure 36 shows the results of testing cell extracts in a NEFA Assay Kit, which describes the activity of a recombinant, lipid acyl transferase from A. salmonicida, through lecithin. The wells from left to right indicate: a positive control, a negative control (ie, empty plasmid extracts), and samples collected after 0, 1, 2, and 3 hours of culture after IPTG induction. Figure 37 shows the growth optimization of BL21(DE3)pLysS harboring the petl2-AsalGCAT=pSM expression vector showing that cultivation at 30°C resulted in the production of enzyme with high activity for lecithin. Cell extracts were tested for phospholipase activity using the NEFA Assay kit. Wells from left to right: positive control; negative control; 20°C; 30°C. Figure 38 shows crude extracts of BL21(DE3)pLysS cells expressing lipid acyl transferase activity incubated with the substrate lecithin and the reaction mixture was analyzed using thin layer chromatography showing the presence of degradation products. Ranges: 1. No Enzyme; 2. +A. salt -10æl 37°C; 3. +A.salt-20|yl 37°C; 4. +A.salt-10|yl 24°C; 5. +A.salt-20)yl 24°C. Figure 39 shows partial purification of acyl transferase from Aeromonas salmonicida showing phospholipase activity associated with purified His-tagged protein. SE = extracts after ultrasound, His = purified with Qiagen's Ni-NTA spin-kit. Figure 40 shows the expression vector pet12-A.h.GCAT=pSMa containing the His-tagged C-terminus of the Aeromonas salmonicida Glycerolipid Acyl Transferase (GCAT) gene used to transform E. coli strain BL21(DE3)pLysS. Figure 41 shows the activity of crude extracts (5 and 10(11) containing the GCAT recombinant enzyme from Aeromonas hydrophila which was tested for lecithin using the Non-Esterified Fatty Acid (NEFA) kit (Roche, Switzerland), showing the presence of the active enzyme for the phospholipid lecithin. Figure 42 shows that the growth optimization of BL21(DE3)pLysS harboring the petl2-AsalGCAT=pSM expression vector showing that cultivation at 30°C resulted in enzyme production with the highest activity for lecithin. Cell extracts were tested for phospholipase activity using the NEFA Assay Kit. Figure 43 shows the partial purification of acyl transferases from Aeromonas hydrophila and A. salmonicida showing activity for phospholipase associated with purified His-tagged protein. SE = extracts after ultrasound, His = purified with Qiagen's Ni-NTA spin-kit. Figure 44 shows the expression of Aeromonas genes in Bacillus subtilis 163, showing the production of secreted enzyme with activity for both lecithin and DGDG. The pUB-AH= construct containing the A. hydrophila gene and the pUB-AS construct containing the A. salmonicida gene, the culture filtrate was incubated with the substrates for 60 minutes. Figure 45 and Figure 46 show a graph describing the fatty acid and the ester. of cholesterol as a function of time. The graph depicts the result obtained for the GLC analysis in the assay for measuring acyltransferase activity in a foodstuff using lecithin and cholesterol in a buffered substrate. Figure 47 shows an amino acid sequence (SEQ ID No. 36) of the fusion construct used for mutagenesis of the Aeromonas hydrophila lipid acyl transferase gene in Example 17. The underlined amino acids are the xylanase signal peptides. Figure 48 shows the nucleotide sequence (SEQ ID No. 54) encoding an Aeromonas hydrophila enzyme including the xylanase signal peptide. Figure 49 shows the structure of fatty acid and protein condensates of amino acids. Figure 50 shows a schematic representation of the reaction between the fatty acid of phosphatidyl choline when transferred to a free hydroxyl group of amino acids having free hydroxyl groups available for esterification, eg tyrosine or serine, and; Figure 51 shows the schematic representation of the reaction between DGDG and glucose when catalyzed by a lipid acyltransferase. EXAMPLES EXAMPLE 1: Cloning, sequencing and heterologous expression of a transferase from Aeromonas salmonicida subsp. salmonicidal Strains used: Aeromonas salmonicida subsp. Salmonicide (ATCC 14174) was obtained from ATCC and overnight cultivation at 30°C in Luria-Bertani (LB) medium. Cells were centrifuged and genomic DNA was isolated using Qiagen Ltd's procedures for genomic DNA isolation. Genomic DNA pool in buffer (cat. 19060), protease K (cat. 19131) and RNAse A (cat. 19101) were all obtained from Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX). The host bacterial strain BL21(DE3)pLysS (Novagen) was used for the production of recombinant Aeromonas enzymes. BL21(DE3)pLysS competent cells were used as hosts for transformation with the expression vector petl2-AsalGCAT=pSM. Transformers containing the appropriate plasmid were grown at 37°C on LB agar medium containing 100 pg ampicillin / ml. Petl2-AsalGCAT-pSM expression vector construction: For all DNA amplifications of Aeromonas transferase genes, genomic DNA (0.2 - 1 p.1) was used as a standard and pfu DNA polymerase (2.5 units) was used with 10 µl of 10x pfu buffer, 1 pl of each primer (50 pmol / pl), 200 uMdNTP in a total reaction volume of 100 µl. PCR reactions were performed in a programmable thermocycler using the following conditions: 95°C for 30 seconds, 30 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 68°C for 2 minutes. An additional extension of 5 minutes at 72 °C was applied. PCR amplification of the A. salmonicida transferase gene was performed in 2 separate PCR reactions. The first PCR reaction was performed using the primer pairs, aslUSNEW(5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3' [SEQ ID NO:36]) and asls950new(5'GTG ATG GTG GGC GAG GAA CTC GTA CTG3' [SEQ ID No. 37]). A second PCR reaction was performed to incorporate a Histidine-labeled C-terminus using the PCR product of the first reaction and the primers: aslUSNEW(5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3' [SEQ ID NO: 38]) and AHLS1001(5'TTGGATCC GAATTCAT CAATG GTG ATG GTG ATG GTG GGC3' [SEQ ID NO: 39]). The PCR product of the second reaction was purified and digested with restriction enzymes Ndel and BamHI. 2 pg of pET 12a vector DNA was also digested with restriction enzymes NdeI and BamHI and treated with phosphatase. The restriction enzyme treated pet12a and the PCR product from reaction 2 were purified and ligated using the Rapid Ligation Kit (Roche, Switzerland). The ligation mixture was used to transform E. coli TOPIO cells. Transformers were plate plated on LB agar medium containing 100 µg / ml ampicillin. The T7 promoter primer (5'TAATACGACTCACTATAG3' [SEQ ID NO:40]) and the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3' [SEQ ID NO:41]) were used to verify the sequences and orientation of the genes of the transferase cloned in the pET12a vector. DNA sequencing was performed using an ABI Prism® Sequencing Cycle Terminator Kit BigDye® with 500ng plasmid DNA as a standard and 3.2 pmol of T7 promoter and terminator primers. The constructs shown in Figure 35 were used to transform the competent host bacterial strain BL21(DE3)pLysS (Novagen) and ampicillin resistant transformers were chosen and used for expression analysis. The expression of recombinant lipid acyl transferase from Aeromonas salmonicida Quantification of enzyme activity for lecithin was determined in cell extracts using the non-esterified fatty acids (NEFA) kit (Roche, Switzerland). In Figure 36, BL21(DE3)pLysS harboring the petl2-AsalGCAT=pSM expression vector was grown in LB medium with 100 µg / ml ampicillin and incubated with shaking at 37°C until OD is achieved. 6 oo = from 0.6 to 1.0. Cultures are then induced using IPTG (0.4 mM) and incubation continued for the next 3 hours. Samples were taken at 0 hour, 1, 2, and 3 hours after IPTG induction. Enzyme Activity was tested using the NEFA kit and lecithin as substrate. Growth Optimization of producing more enzymes active The BL21(DE3)pLysS harboring the expression vector pet!2- AsalGCAT=pSM was cultured in LB medium + 100 p.g / ml of ampicillin and incubated with shaking at different growth temperatures (37°C, 30°C, and 20°C). The optimum condition for the production of the active enzyme lipid acyl transferase occurred when cultures were grown at 30°C as shown in Figure 37. Partial purification of recombinant transferase from Aeromonas sahoonicida The BL21(DE3)pLysS strain harboring the pet12-AsalGCAT=pSM expression vector was cultured at 37 °C and crude cell extracts were prepared using ultrasound. The recombinant enzyme was also purified from crude cell extracts prepared by ultrasound using Qiagen's Ni-NTA spin kit. Phospholipase activity was evaluated using the NEFA kit and lecithin as substrate. Crude cell extracts of BL21(DE3)pLysS expressing active transferase incubated with lecithin substrate and reaction mixture were analyzed using thin layer chromatography showing the presence of degradation products (see Figure 38). Partial purification of recombinant transferase from Aeromonas sahnonicidae. BL21(DE3)pLysS strain harboring the petl2-AsalGCAT=pSM expression vector was cultivated at 37 °C and crude cell extracts were prepared by ultrasound. The recombinant enzyme was also purified from crude cell extracts after ultrasound using Ni-NTA Qiagen's spin kit. Phospholipase activity was tested using the NEFA kit and lecithin as substrate (see Figure 39). EXAMPLE 2: Cloning and Expression of Aeromonas hydrophila transferase in E. coli Aeromonas hydrophila (ATCC #7965) was obtained from the ATCC and grown overnight at 30°C in Luria-Bertani medium (LB). Cells were centrifuged and genomic DNA was isolated using Qiagen Ltd's procedures for genomic DNA isolation. Genomic DNA kit in buffer (cat. 19060), protease K (cat. 19131) and RNAse A (cat. 19101) were all obtained from Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX). The host bacterial strain BL21(DE3)pLysS (Novagen) was used for the production of recombinant Aeromonas enzymes. Competent cells BL21(DE3)pLysS were used as hosts in the transformation with the petl2a-A.h.GCAT=pSMa expression vector. The transformers counting the appropriate plasmid were cultured at 37°C in LB agar medium containing 100 pg ampicillin / ml. Petl2a-A.h.GCAT-pSMa expression vector construction: For all DNA amplifications of Aeromonas transferase genes, genomic DNA (0.2 - 1 pl) was used as a standard and pfu DNA polymerase (2.5 units) was used with 10 p.1 of 10x pfu buffer, 1 pl of each primer (50 pmol / pl), 200 uMdNTP in a total reaction volume of 100 pl. PCR reactions were performed in a programmable thermocycler using the following conditions: 95°C for 30 seconds, 30 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 68°C for 2 minutes. An additional extension of 5 minutes at 72°C was applied. PCR amplification of the A. hydrophia transferase gene (ATCC #7965) was performed in 2 separate PCR reactions. The first PCR reaction was performed using primer pairs, AHUS1 (5'GTCATATGAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3', SEQ ID No. 42) and ahls950(5'ATGGTGATGGTGGGCGAGGAACTCGTACTG3', SEQ ID NO. 43). A second PCR reaction was performed to incorporate a labeled C-terminus on Histidine using the PCR product of the first reaction and the primer pairs: AHUS1 (5'GTCATATGAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3'SEQ ID No. 44,) and AHLS1001 (5'TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3' SEQ ID NO: 45). The PCR product of the second reaction was purified and digested with restriction enzymes Ndel and BamHI. 2 µg of pET 12a vector DNA was also digested with restriction enzymes NdeI and BamHI and treated with phosphatase. The restriction enzyme treated pet12a and the PCR product from reaction 2 were purified and ligated using the Rapid Ligation Kit (Roche, Switzerland). The ligation mixture was used to transform E. coli TOPIC cells. The transformers were plate plated on LB agar medium containing 100 pg / ml ampicillin. The T7 promoter primer (5'TAATACGACTCACTATAG3') and the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3') were used to verify the sequences and orientation of cloned GCAT genes in the pET12a vector. DNA sequencing was performed using an ABI Prism® BigDye® Cycle Terminator Sequencing Kit with 500ng plasmid DNA as a standard and 3.2 pmol T7 promoter and terminator primers. The construct shown in Figure 40 was used to transform the competent host bacterial strain BL21(DE3)pLysS (Novagen) and ampicillin resistant transformers were chosen and used for expression analysis. Expression of Aeromonas hydrophila transferase in BL21(DE3)pLysS E. coli strain BL21 (DE3) pLysS harboring the petl2a-A.h.GCAT=pSMa expression vector was grown in LB medium 100 µg / ml ampicillin and incubated with shaking at 37°C until OD was achieved 60 o = from 0.6 to 1.0. Cultures are then induced using ..IPT.G (0.4 mM) and the incubation is continued for the next 3 hours. Samples were collected at 0 hour, 1, 2, and 3 hours after IPTG induction. Enzyme Activity was tested using the NEFA kit and lecithin as substrate (Figure 41). Growth Optimization of producing more active enzymes BL21(DE3)pLysS harboring the petl2a-A.h.GCAT=pSMa expression vector was cultured in LB medium + 100 µg / ml ampicillin and incubated under shaking at different growth temperatures (37°C, 30°C, and 20°C). The optimum condition for the production of the active enzyme lipid acyl transferase occurred when cultures were grown at 30°C as shown in Figure 42. Partial purification of recombinant transferase (GCAT) from A. hydrophila The BL21(DE3)pLysS strain harboring the petl2a-A.h.GCAT=pSMa expression vector was cultured at 37°C and crude cell extracts were prepared by ultrasound. Recombinant enzyme was also purified from crude cell extracts after ultrasound using Qiagen's Ni-NTA spin kit. Phospholipase activity was tested using the NEFA kit and lecithin as substrate (see Figure .43) ... - . . EXAMPLE 3: Expression of Aeromonas transferases in Bacillus subtilis 163 Plasmid construction Two different Bacillus subtilis expression vectors (pUBUO and pBE5) were used for the heterologous expression of Aeromonas genes in Bacillus subtilis. The pUBUO vector contains the alpha amylase promoter while the pBE vector has the P32 promoter as the regulatory region for the expression of the fused Aeromonas genes. In pUBUO, the first amino acid of the mature Aeromonas GCAT genes was fused in-frame with the last amino acid of the Bacillus subtilis xylanase signal peptide sequence via the Nhel restriction site, creating an additional 2 amino acids in front of the mature proteins. pBE5 contains the cgtase fusion sequencing signal at the NcoI site for recombinant protein secretion into the culture filtrate. PCR reactions were performed to obtain in-frame Aeromonas gene fusion with respect to the sequencing signal of the pUBUO and pBE5 vectors. PCRs were performed using the following primer pairs for the A. hydrophila gene: PCR reaction 1: usAHncol (5'ATGCCATGGCCGACAGCCGTÇCCGCC3', SEQ ID No. 46) and IsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID No. 47). PCR reaction 2: US-Ahnhel (5'TTGCTAGCGCCGACAGCCGTCCCGCC3', SEQ ID NO:48) and IsAH (5'TTGGATCCGAATTCATCAATGGTGATG3, SEQ ID NO:49). PCRs were performed using the following primer pairs for the A. salmonicida gene: PCR reaction 3: US-Asncol (5'TTGCCATGGCCGACACTCGCCCCGCC3', SEQ ID NO: 50) and IsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO: 51). PCR reaction 4: the US-ASnhel (5'TTGCTAGCGCCGACACTCGCCCCGCC3', SEQ ID NO:52) and IsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO:53). All PCR products were cloned in blunt PCR II (TOPO vector) and sequenced with reverse and direct sequencing primers. Clones from PCR reactions 1 and 3 were cut with NcoI and BamHI and used as inserts for ligation to the pBE5 vector cut with NcoI / BamHI / phosphatase. Clones from PCR reactions 2 and 4 were cut with Nhel and Bam HI and used as inserts for ligation to the pUB vector which was cut with Nhel / BamHI / phosphatase. Expression of Aeromonas transferase genes in Bacillus subtilis and characterization of enzyme activity Acyl transferases from two Aeromonas species were successfully expressed in E. coli (results above). Bacillus pUBUO and pBE5 genetic fusion constructs were used to transform Bacillus subtilis and transformers were selected by seeding on kanamycin plates. Kanamycin resistant transformers isolated and grown in 2xYT medium are capable of heterologous expression of Aeromonas genes in Bacillus. The culture filtrates possess digalactosyl diacylglycerol (DGDG) galactolipase activity, in addition to possessing both acyl transferase and phospholipase activities. The activity for digalactosyl diacylglycerol (DGDG) was measured after 60 minutes of incubation of the supernatant culture with wheat flour DGDG substrate (obtained in the sigma form) as well as the activity for lecithin as shown in Figure 44. Bacillus produced the enzyme, after one night (20-24 hours) up to 48 hours of cultivation in culture medium , as a secreted protein. In some examples, expression of Aeromonas genes has been shown to interfere with cell viability and growth in Bacillus and E. coli, so it is necessary to carefully select expression strains and optimize growth conditions to ensure expression. For example, several strains of the Bacillus host (B.sl63, DB104 and OS 21) were transformed with the expression . of vectors by growth comparison. B.sl63 is transformable with 2 Aeromonas genes and is capable of expressing the active protein. DB104 is transformable with all constructs but only the one capable of expressing A. salmonicida transferase. EXAMPLE 4: Fermentation and Purification of Aeromonas lipid acyl transferases produced in E.coli. E. coli fermentations: microorganisms Two strains of Eschericia coli were used in this study, one containing lipid acyl transferase from Aeromonas hydrophila (Example 2) and the two containing lipid acyl transferases from Aeromonas salmonicida (Example 1). The E. coli strain that contains the A. hydrophila gene was named DIDK0124, and the E. coli strain that contains the A. salmonicida gene was named DIDK0125. Fermentation with DIDK0124 was named HYDR00303 and fermentation with DIDK0125 was named SAL0302. The protein purified from HYDR0025 was named REF#138. The protein purified from HYDR00303 was named REF#135. Culture growth medium conditions. LB-agar. LB agar plates were used to keep the strains contained: 10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 15 g / l agar-agar, 100 p.g / 1 of ampicillin and 35 mg / l of chloramphenicol. The agar-agar plates were incubated at 30°C. LB shake flasks. The LB medium (50 ml per shake flask) used for the production of inoculum material from the cultures in the bioreactor containing: 10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 100 | ig / l of ampicillin and 35 mg / l of chloramphenicol. Shake flasks are seeded from LB agar plates, and are incubated at 30°C and 200 rpm. Cultivation in the Bioreactor. The cultures in the bioreactor were carried out in a reactor with the internal volume of 6 1 filled with medium to the volume of 4 1, containing: 10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 8 g / l KH2PO4, 0 ,9 of g / 1 MgS04-7H 20.40 g / L glucose monohydrate, 0.4 ml / ADD APT® Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The Netherlands), 10 mg / L (NH 4 ) 2 Fe ( :504)2.6H 2 0.7 mg / 1 of CUSO4.5H2O, 3 mg / 1 of ZnSO4.7H 2 O.3 mg / 1 of MnSO4H 2 O, EDTA 10 mg / l, NISO4.6H2O 0.1 mg / l, COCl2 0.1 mg / l, H3BO4 0.1 mg / l, Kl 0.1 mg / l, 0.1 mg / 1 of Na 2 Mo04.2H 2 0.1 g / L of ampicillin and 35 mg / L of chloramphenicol. The bioreactors were inoculated with an amount of LB culture to ensure cessation of growth after approximately 20 hours of cultivation (calculating from the maximum specific growth rate of 0.6 h" 1 , the OD 6 oo from the LB shake flask and the OD 6 o the final in the bioreactor of approximately 20). SAL0302 was inoculated with 10 ml of the LB culture, and HYDR00303 was inoculated with 4 ml of the LB culture. The bioreactors were operated under the following conditions: temperature 30°C, stirring at 800-1000 rpm (depending on the experiment), aeration 5 1 / min, pH 6.9, pH control 8.75 % (w / v) Nl^ -water and 2 M H2SO4. Induction was performed by adding isopropyl D-thiogalactoside to a final concentration of 0.6 mM, When 0.4 moles (HYDR00303) and 0.7 moles in C0 2 were produced respectively. Harvest. 0 following procedure was used to the harvest and homogenisation of biomass: broth of fermentation of both fermentations was centrifuged in g and 4°C for 10 minutes, and the supernatant Biomass was stored at -20°C until was discarded. THE the use. The biomass was thawed and resuspended in 500 ml of NaH 2 P0 4 of 20 mM,. pH 7.4, 500..mM NaCl, Imidazole. of 10 mM. and. complete (EDTA-free) protease inhibitor (Roche, Germany). 2) The suspended biomass was homogenized at 2 kbar and 4 °C in a disruptor cell from Constant Systems Ltd (Warwick, UK). 3) Cell debris was removed by centrifugation at 10,000 x g and 4°C for 30 minutes followed by supernatant collection. 4) The supernatant was further clarified by centrifugation at 13,700x g and 4°C for 60 minutes, followed by collection of the supernatant. 5) The supernatant was filtered through 0.2 µm Vacu Cap filters (Pall Life Science, UK) and the filtrate was collected for immediate chromatographic purification. Transferase Chromatographic Purification. a column (2.5 x 10 cms) was packed with 50 ml of Chelating Sepharose ff gel. and loaded with nickel sulphate (according to the method described by the manufacturer, Amersham Biosciences). The column was equilibrated with 200 ml of NaH 2 DUST 4 20 mM, pH 7.4, 500 mM NaCl, 10 mM Imidazole. 400 ml of the raw material was applied to the column at a flow rate of 5 ml / min. The • column was then washed. with NaH 2 DUST 4 20 mM, pH 7.4, 500 mM NaCl, 10 mM Imidazole until UV 280 reached the baseline. GCAT was then eluted with 40 ml of NaH 2 20 mM P04, pH 7.4, 500 mM NaCl and 500 Imidazole EXAMPLE 5: Fermentation and Purification of acyl lipid Aeromonas transferases produced in Bacillus subtilis. Fermentations BAC0318-19, BAC0323-24. Microorganism The microorganisms used in this study originate from transformation of a strain of Bacillus subtilis host, #163 with a plasmid containing the gene that encodes the Aeromonas salmonicida transferase inserted into the pUBHOOIS vector. Gene expression is controlled by an alpha-amylase promoter and transferase secretion is mediated by the B. subtilis xylanase signal sequence (Example 3). The strains were named DIDK0138 (BAC0318-19 fermentation) and DIDK0153 (BAC0323-24 fermentation). Growth medium and culture conditions Preculture medium A shake flask (500 ml septum) was added to 100 ml of a NaCl . K 2 HP0 4 ... .... . . Soy flour Yeast Extract, BioSpringer Antifoam SIN260 pH adjusted to 7.0 before au After autoclaving, they were ad Nutriose solution 50% w / w at ca autoclaving, kanamycin was also added at a concentration of 50 mg / l. Inoculation A preculture shake flask was inoculated directly with the frozen culture of a 25% (w / v) glycerol stock. The shake flask was incubated at of total volume, with medium containing: 5g / 1 to 6 bottle. 5ml / 1 ml of is an gives 33°C and 175 rpm for a time of approximately 16 hours, during which time 50 ml was used to inoculate the fermenter. Fermentations Fermentations were carried out in self-built 6-liter fermenters. The batch medium (3 liters) contained: Saturated cereal solution (50% dw) 40 g / l BioSpringer Yeast Extract 153 (50% dw) 10 g / 1 NaCl 5 g / 1 CaCl 2 .2H 2 0 0.25 g / 1 Mn (NO3) 2 . H 2 O. .......... ... .... 0.2 g / 1 Antifoam SIN260 1ml / 1 Kanamycin (sterilized fermenter filter after autoclaving) 50 mg / L The feed contained: Glucose monohydrate 540 g / kg MgS0 4 .7H 2 0 4.8 g / kg Anti foam SIN260 1ml / 1 BioSpringer Yeast Extract 153 (50% dw)150 g / kg (autoclaved separately) Feeding in fermentation BAC0318 and BAC0323 was started based on CO accumulation 2 , according to the equations below: Feed - Flow [g / h] = 0 ; AcCO 2 < 0.15 Feeding - Flow [g / h] =2.85 + t * 1.54; AcCO 2 > 0.15 and t < 12. Feeding - Flow [g / h] = 21.3; t > 12. t: time (hours) from the point when the CO 2 accumulated (AcCO 2 ) reached 0.15 moles. Feeding in fermentation BAC0319 and BAC0324 was started based on C0 accumulation 2 , according to the equations below: Feed - Flow [g / h] = 0 ; AcCO 2 < 0.15 Feeding - Flow [g / h] = 2.0 + t * 1.08; AcCO 2 > 0.15 and t < .12. . Feeding - Flow [g / h] = 15; t > 12. t: time (hours) from the point when the CO 2 accumulated (AcCO 2 ) reached 0.15 moles. The pH was controlled at 7.0 by adding 12.5% (w / v) NH 3 -water or 2M phosphoric acid. Aeration was 3 1 / min corresponding to 1 vvm. The temperature was 33°C. The fermenter was equipped with two impellers 0 Rushton of 8 cm placed with a distance of 10 cm. Harvest The biomass was removed by centrifugation at 16,000 x g for 10 minutes at room temperature. the supernatant was sterilized by filtration, and the filtrate was used for purification and application testing. EXAMPLE 6: "Transferase in a Buffered Substrate" Assay for Measurement of Acyl Transferase Enzyme Activity The lipid acyl transferase enzyme was isolated from Aeromonas salmonicida and expressed in Bacillus subtilis. This enzyme is very efficient in transferring the fatty acid from lecithin to cholesterol during the formation of cholesterol esters. The enzyme has also been shown to have some hydrolytic activity, which is observed by free fatty acid formation. Traditional phospholipas.es (EC 3..1..1.4,,, and EC 3.1.1.32) have the hydrolyze lecithin during the formation of free fatty acids and lysolecithin, and no transferase reactions have been reported for these enzymes. We detail here an assay that is able to measure both the transferase and hydrolytic activity of the enzymes and thus identify the lipid acyltransferase enzymes according to the present invention, the assay uses a substrate that contains lecithin and cholesterol. In this work, a substrate based on phosphatidyl choline and cholesterol dispersed in a buffer was used. The quantification of the reaction products was performed by extracting the lipids of the substrate followed by the GLC analysis of the lipid components. Material Procedure L-alpha-Phosphatidyl Choline 95% (plant) Avanti no. Cholesterol: Sigma cat. C 8503. Cholesteryl Palmitate, Sigma C 6072. Cholesteryl Stearate, Sigma C 3549. HEPES buffer Sigma cat # H3375. Analytical grade chloroform Enzymes GCAT purified from A. salmonicida #178-9. TLC analysis The TLC plate was activated in a heated oven (110°C) for 1 / 2 h. 100 ml of running buffer was placed inside the lidded chromatography chamber. The chamber walls were covered with filter paper (Whatman 2) in order to saturate the chamber with solvent vapour. The TLC plate was placed in a holder and the sample was applied to the TLC plate 2 cm from the bottom. The TLC plate was then placed in the TLC chamber with the running buffer. When the running cap reached 14 cm from the bottom of the plate, the TLC plate was removed and dried on the steam plate and then placed in the oven at 110°C for 10 minutes. The TLC plate was then immersed in the developing agent and dried in an oven at 110°C for 15 minutes. running cap No. IV: Chloroform:Methanol:HaO (65:25:4) No. I: P-ether:MTBE:Acetic acid (60:40:1) Development Buffer (Vadate Buffer) 32 g of Na 2 CO 3 , with 300 ml of water (1M) 18.2 g vanadium pentoxide (V 2 0 5 ) are added and dissolved during gentle heating. Carefully add .4 60 ml 2.5M H 2 S0 4 -. (4 60 ml. H20 + 61 ml H 2 S0 4 ) . Water is added to 1000 ml. GLC analysis Perkin Elmer 9000 Capillary Gas Chromatography Autosystem equipped with WCOT fused silica column 12.5 m x 0.25 mm ID x 0.1 p 5% phenyl methyl silicon film thickness (CP Sil 8 CB from Chrompack) . Carrier gas: Helium. Injector: PSSI cold split injector (temp, initial 50 °C heated to 385 °C), volume 1.0 pl. FID detector: 395°C Oven Program: 1 2 3 Oven Temperature, °C: 90 280 350 Isothermal,time,minute: 1 0 10 Temperature Rate,“C / min : 15 4 Sample Preparation: 30 mg of sample were dissolved in 9 ml of heptane:pyridine, 2:1 containing an internal standard of heptadecane, 0.5 mg / ml. 300 µl of the sample solution was transferred to a crimping flask, 300 µl of MSTFA (N - Methyl - N - trimethylsilyl - trifluoroacetamide) was added and allowed to react for 20 minutes at 60°C. "Calculations of mono- di- and triglycerides and free fatty acids response factors were determined from standard 2 (mono-di-triglyceride) for Cholesterol, Cholesteryl palmitate and Cholesteryl stearate. Response factors were determined in the pure reference material (weighing to 1 mg of pure material). Results: Transferase assay based on phosphatidyl choline and no cholesterol as a substrate. Then the transferase activity of the transferase was tested with a substrate based on phosphatidyl choline and cholesterol according to the following procedure. 450 mg of phosphatidyl choline (>95% PC Avanti item no. 441601) and 50 mg of cholesterol were dissolved in the chloroform and evaporated to dryness under vacuum. 300 mg of cholesterol / phosphatidyl choline mixture was transferred to a Wheaton glass and 15 ml of 50 mM HEPES buffer pH 7 was added. The lipid was dispersed in the buffer while stirring. The substrate was heated to 35°C while mixing with a magnetic stirrer and 0.25 ml enzyme solution was added. This is an environment with a very high concentration of water approximately 95%. . Samples of 2 ml were taken after 0, 5, 10, 15, 25, 40 and 60 minutes of reaction time. Immediately 25 µl 4M HCl was added to acidify the free fatty acid and stop the enzyme reaction. 3.00 ml of chloroform was added, and the sample was shaken vigorously on a Whirley shaker for 30 seconds. The sample was centrifuged and 2 ml of the chloroform phase was isolated and filtered through 0.45 µm filters and transferred into 10 ml tared Dram. The chloroform was evaporated under a stream of nitrogen at 60°C, and the samples were weighed again. The extracted lipid was analyzed by GLC. The results of the GLC analysis are shown in Table 1. Results are expressed as % calculated on extracted lipid. The amount of fatty acid and cholesterol ester that formed as a function of time is illustrated in Figure 45. It can be concluded from Figure 45 that the enzyme reaction is not linear as a function of time, because initially it is observed that it follows strong in both hydrolytic and transferase activity. After approximately 10 minutes and up to approximately 60 minutes the reaction shows an almost linear response of fatty acid and cholesterol ester formation as a function of time. pp.r. that, . if. decided to see the, enzymatic... reaction..in this time interval. Table 1: Minutes 0 5 10 15 25 40 60 Cholesterol, g. o 10.064 8.943 8.577 8.656 8.102 7.856 7.809 cholesterol ester, g, 0 0.000 1.571 2.030 2.058 2.282 2.659 3.081 total FFA, 0.260 1.197 1.239 1.466 2.946 3.460 g. 0 From knowledge about the amount of lipid in the reaction mixture and the amount of enzyme added, it was possible to calculate the formation of qraxo acid and cholesterol ester expressed in, (immol / ml enzyme (Table 2 and Figure 46). Table 2: Minutes 10 15 25 40 60 µmol / ml [imo 1 / ml [imo 1 / ml [imo 1 / ml [imo 1 / ml] Total FFA 58.1 68.7 114.6 138.0 184.7 . Ester of 88.8 90.0 99, 3 115, 6 133.8 cholesterol From the results in Table 2 and the slope of the curves in Figure 46 it was possible to calculate the amount of fatty acid and cholesterol ester as a function of time and expressed in pmol / min per ml of enzyme. The calculation of hydrolytic activity and transferase activity is shown in Table 3. Relative transferase activity was determined using the protocol for determining % acyl transferase activity as described above. Table 3: Hydrolytic activity (2.52 acid [immol / min per ml enzyme fatty) Transferase activity (ester 0.94 pmol / min per ml cholesterol enzyme) Total activity 3.45 |imol / min per ml enzyme Relative transferase activity 27.1 o o Relative hydrolytic activity 72.9 o o Evaluating other enzymes with respect to transferase activity. The above-mentioned method was used to evaluate different lipolytic enzymes for transferase activity and hydrolytic activity. Enzymes were tested as shown in Table 4. Table 4: 1 2 3 4 5 Substrate ml 15 15 15 15 15 #178-9 Transferase A. ml 0.25 salmonicidal 32 PLU-7 / ml 5 % #3016, LIPOPANE F (F. ml 0.25 oxysporum) 5 %, Thermomyces lanuginosus ml 0.25 5 % Candida rugosa #2983 ml 0.25 5% Candida cylindracea #3076 ml 0.25 The substrate containing 300 mg of phosphatidyl choline / cholesterol dispersed in 50 mM HEPES buffer pH 7.0 was heated to 35°C with stirring. Enzyme solution was added and the sample was maintained at 35°C with agitation. Samples were taken at regular intervals and extracted with Chloroform. Isolated lipids were analyzed by GLC with results shown in Table 5. Table 5: Sample 1 Transferase 178-9 Minutes 0 5 10 15 25 40 60 FEA 1.216 2.516 2.983 2.62 2.894 3.448 3.911 Cholesterol 7.547 6.438 6.365 6.15 6.136 5.936 5.662 Cholesteryl Ester 44 2.58 2.851 3.331 2 Fusarium oxysporum (LIPOPAN® F) 0 5 10 15 25 40 60 FFA 1,216 1,345 1.796 1, 95 2.487 2.424 2,977 Cholesterol 7,547 7, 309 7,366 7,33 7,429 7,341 7,326 cholesterol oster 0,26 0,35 0,267 0,36 0,394 3 Thermomyces lamginosus 0 5 25 25 60 6 60 FFA 3.26 0.853 0.875 1 0.896 1,106 1,009 Cholesterol 7,547 7,384 7,639 7,63 7, 675 7,603 7,529 cholesterol osterol 0 0 0 0 0 4 Candida rough (»2938) 0 5 10 15 25 40 60 FFA 1.216 0.982 0, 987 1, 02 1, 135 1, 131 1, 15 Cholesterol 7.547 7.438 7.656 7.66 7.638 7.575 7.585 Cholesterol ester 0 0 0 0 0 0 0 5 Candida cylandracea (»3076) 0 5 10 15 25 40 60 FFA 1.216 1.032 1.097 1.07 1.203 1.131 1.43 Cholesterol 7.547 7.502 7.425 7.65 7.619 7.502 7.411 Cholesterol ester 0 0 0 0 0 0 0 From the GLC analysis it was observed that only the enzyme lipid acyl transferase (178-9) produced a significant amount of cholesterol ester and fatty acids. Phospholipase from Fusarium oxysporum also gave a constant increase in free fatty acid but only a small build-up in the initial amount of cholesterol ester was formed but no increase in cholesterol ester as a function of time was observed. Based on knowledge about the amount of lipid substrate and analyses; of GLC it was possible to calculate the relative transferase activity and the relative hydrolytic activity based on the results of time of reaction from 10 to 60 minutes. The results of Transferase 178-9 and Fusarium oxysporuma lipase are shown in Table 6. Other enzymes tested did not show any activity. Table 6: Transferase 178-9 Fusarium oxysporum Activity 1.03 0.96 hydrolytic, micro mol / minute / ml of enzyme Transferase activity, micro mol / minute / ml of enzyme 0.40 0.01 Total activity, micro mol / minute / ml of enzyme 1.43 0.98 Relative hydrolytic activity 71.8 98.7 Relative transferase activity 28.2 1.3 The result shown in Table 6 confirms a significant transferase activity of the lipid acyl transferase enzyme (experiment 178-9). It is also observed that the relative transferase activity is in good agreement with the experiment mentioned in Table 3. However, a form of activity is observed very low transferase Fusarium oxysporum phospholipase. This transferase level is so low that it is included in the analysis uncertainty. As expected, Fusarium oxysporum phospholipase has significant hydrolytic activity. Conclusion. An artificial substrate based on purified phosphatidyl choline and cholesterol was used as a substrate to measure the transferase activity of Aeromonas salmonicida. Between the reaction time of 10 minutes and 60 minutes, hydrolytic activity and transferase activity were calculated. Based on the results of the assay of the enzyme lipid acyl transferase (in this example a GCAT) from Aeromonas salmonicida on an artificial substrate of phosphatidyl choline / cholesterol in buffer it is concluded that this enzyme has very good transferase activity also in a system with a water content very high. The phosphatidyl choline / cholesterol assay in buffer can be used to measure the transferase and hydrolytic activities of an enzyme. The phosphatidyl choline / cholesterol in the buffer is linear only within a certain time limit. EXAMPLE 7: Immobilization of an acyl lipid enzyme Aeromonas salmonicida transferase. A lipid acyl transferase enzyme (in this case a GCAT) from A. salmonicida was immobilized on Celite by precipitation with acetone. 10 ml of the enzyme solution in 20 mM TEA pH 7 buffer was stirred slowly with 0.1 g of Celite 535535 (from Fluka) for 2 hours at room temperature. 50 ml ice-cold acetone was added while stirring continued. The precipitate was isolated by centrifugation at 5000 x g for 1 minute. The precipitate was washed twice with 20 ml of acetone icy. The Celite was dried at room temperature for approximately 1 hour. The enzyme was also shown to have high activity in environments with high water content (6 - 89 %), the use of transferase, and other transferases for use in the invention can therefore also be used in applications with immobilized enzyme in environments with considerable water content. Water. This allows for the exchange of solvents used by current immobilized lipases in lipid bioconversion. using transferases. EXAMPLE 8: Variants of a lipid acyl transferase enzyme from Aeromonas hydrophila (Ahyd2) (SEQ ID NO: 36 (see Figure 47)). Mutations were introduced using the "QuikChange® Multi-Site" directed mutagenesis kit from Stratagene, La Jolla, CA 92037, USA, following instructions provided by Stratagene. Variants in Tyr256 showed increased activity for phospholipids. Variants at Tyr256 and Tyr260 showed activity increased for galactolipids. Variants in Tyr265 show increased transferase activity with galactolipids as the acyl donor. Numbers indicate positions relative to the following sequence: An enzyme from Aeromonas hydrophila the amino acid sequence of which is shown as SEQ ID NO: 36 in Figure 47 (underlined amino acids show a xylanase signal peptide). The nucleotide sequence is as shown in SEQ ID NO:54 in FIGURE 48. EXAMPLE 9: "Testing in Low Water Environment" Transferase reactions of lipolytic enzymes in low water environment. Procedure Materials cholesterol cat. Sigma. C8503 L-alpha-Phosphatidylcholine 95% (Plant) Avanti #441601 Soybean oil, Aarhus United, DK. Chloroform, Analytical Grade. Enzymes #179, GCAT of A. salmonicida # 2427, Phospholipase Al from Fusarium oxysporum. LIPOPAN® F from Novozymes, Denmark. #1991, Phospholipase A2 from Pancreas, LIPOMOD 22L from Biocatalysts, UK. #2373, Candida Antarctica lipase, Novozyme 525 L from Denmark Novozymes. enzyme assay 13.1% of lecithin and 6.6% of cholesterol are dissolved in soybean oil heated to 60°C with stirring. The substrate was weighed into a 20 ml Wheaton glass bottle and heated to 46°C. Water and enzyme solution were added and the stopwatch was started. Samples of 50 mg were taken at regular intervals and transferred to a 10 ml Dram vial and frozen. Isolated lipids were analyzed by GLC. GLC analysis. For GLC analysis protocols, see Example 6. Results The experiment was designed as shown in Table 8. The soybean oil-based substrate containing 13.1% lecithin and 6.6% cholesterol was heated to 46°C. Enzyme solution was added and the stopwatch started. After 30, 60 and 120 minutes of reaction time, samples were taken for GLC analysis. Table 8: 1 2 3 4 5 Substrate grams 55555 Transferase#179- ml 0.3 C72, 56PLU-7 / ml #2427, 200 PLU-ml 0.3 7 / ml PLA pancreas 2 ml 0.3 #1991 6300 PLU / ml Novozyme 525 L, 0.3 ml #2373, 200 LIPU / ml Water ml 0.3 % of water 66 666 The results of the GLC analysis are shown in Table 9. The results are expressed as a percentage based on the total sample composition. Based on the GLC result, it was possible to calculate the amount of fatty acid and cholesterol ester produced by the enzymatic reaction in relation to the control sample without adding enzyme. in these under experimental conditions total enzyme activity was predicted as hydrolytic activity measured by free fatty acid formation and predicted transferase activity was assessed by cholesterol ester formation. From these results and with information on the molecular weight of the fatty acid and cholesterol ester, it was possible to calculate the relative molar hydrolytic activity and the relative molar transferase activity as shown in Table 10. Table 9: Enzyme Fatty Acid Cholesterol Ester Retention Time 0. *O g. cholesterol (min) 0.0 control 120 0.533 7.094 0.000 #179 30 0.770 5.761 2.229 #179 0.852 5.369 2.883 #179 120 0.876 4.900 3.667 #2427 30 3.269 7.094 0.0000 #2427 60 3.420 7.094 0. 0. 2427 120 3.710 7.094 0.0000 #1991 30 2.871 7.094 0. 1991 60 3.094 0. 1991 120 3.928 7.094 0000 #2373 30 000 #2373 #2373 #2373 #2373 #2373 #2373 #2373 #2373 #2373 120 1.915 7.094 0.000 Table 10: Enzyme Acid time Cholesteric ester o, g, or o fatty ester cholesteryl- activi- activi- reaction produc- ity used rol ity in zido produc- hydro-trans-minutes zido lytic ferase #179 30 0.238 1.334 2,229 20 80 #179 60 0.319 1.725 2.883 21 79 #179 120 0, 343 2.195 3, 667 18 82 #2427 30 2.737 0.000 100 0 #2427 60 2, 887 0, 000 0, 000 100 0 #2427 120 3.177 0.000 0.000 100 0 #1991 30 2.338 0.000 0.000 100 0 #1991 60 3.046 0.000 0.000 #1991 120 3.395 0.000 0.000 100 0 #2373 30 0.885 0.000 0.000 100 0 #2373 60 0.885 0.000 0.000 100 0 #2373 120 1.383 0.000 0.000 10 Conclusion In these experiments it was observed that all tested enzymes showed hydrolytic activity because the amount of fatty acid increased. However, the only enzyme that showed transferase activity was GCAT from A. salmonicida. Therefore, it is concluded that in an oily system with lecithin and cholesterol containing 6% water, phospholipase Al from Fusarium oxysporum, phospholipase A2 from pancreas and a lipase from Candida antarctica only showed hydrolytic activity. Example 10: Production of carbohydrate ester with immobilized lipid acyl transferase according to the present invention. Carbohydrate esters of fatty acids such as sucrose esters and glucose esters are traditionally produced by the reaction of a fatty acid or a fatty acid soap and the carbohydrate at high temperature {Journal of the American Oil Chemists' Society (1978) 55 ;4; 398 - 401). This procedure however has the disadvantage of generating side reactions and colored by-products. The fatty acid carbohydrate esters of the present invention are produced by a transferase reaction using lecithin as the fatty acid donor and a carbohydrate such as glucose as the acceptor molecule. The reaction is conducted in a flow reactor with lipid acyl transferase immobilized on a solid support. Procedure 100 grams of glucose are dissolved in 1000 ml of water and during agitation 200 grams of phosphatidyl choline are dispersed in the aqueous phase during agitation and heating to 40°C. The pH is adjusted to pH 6.5. A flux reactor is packed with 100 g of a lipid acyl transferase enzyme from A. salmonicida immobilized on a solid support. The flux reactor is placed in an oven at 40°C. The reaction mixture is pumped onto the column at 2 ml / min. 0 the reaction product is collected. The water in the reaction product is removed by thin film vacuum evaporation and the lipids are isolated. The glucose ester is separated from the other lipids fractionation in solvent. The carbohydrate ester can be used for many applications, such as efficient emulsifiers within the food and non-food industry. Example 11 - Protein ester production by lipid acyl transferase according to the present invention. In the present invention, condensates of fatty acids and amino acids, peptides or proteins are produced by a transferase reaction. In this reaction phosphatidyl choline is used as the donor for fatty acid transfer to a free hydroxyl group of amino acids (such as tyrolysine, serine or threonine) having a free hydroxyl group available for esterification. Procedure 1. 50 grams of 1-tyrolysine (or serine or threonine) are dissolved in 1000 ml of water under agitation, then 200 grams of phosphatidyl choline were dispersed in the aqueous phase during agitation and with heating at 40°C. The pH is adjusted to pH 7 and maintained at this pH with NaOH or HCl. 50 ml of the enzyme lipid acyl transferase from A. salmonicida are added and stirring is continued at 40°C. Samples are taken at regular time intervals and analyzed by TLC and HPLC. After a reaction time of 20 h the reaction has reached equilibrium and the reaction is stopped. The fatty acid tyrosine, lecithin and lysate lecithin condensate are isolated from the reaction medium by centrifugation according to standard methods (see "Centrifiges, Filtering" in Ullmann's Encyclopedia of Industrial Chemistry, (2002) by Wiley-VCH Verlag GmbH & Co. KgaA, for example). The fatty acid tyrosine condensate purified by the hydrophobic interaction chromatography column containing the fatty acid tyrosine condensate is isolated and the solvent is removed by evaporation. (see "Basic Principles of Chromatography" in Ullmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co. KGaA.). Procedure 2. Then the transferase activity of the lipid acyl transferase enzyme was tested with a substrate based on phosphatidyl choline and 1-tyrosine according to the following procedure. 450 mg of phosphatidyl choline (>95% PC Avanti item no. 441601) and 50 mg of cholesterol were dissolved in the chloroform and evaporated to dryness under vacuum. 300 mg of cholesterol / phosphatidyl choline mixture was transferred to a Wheaton glass and 15 ml of HEPES 50 buffer was added mM pH 7. The lipid was dispersed in the buffer during stirring. The substrate was heated to 35°C while mixing with a magnetic stirrer and 0.25 ml 10 PLU / ml transferase solution was added. The 2 ml samples were taken after 0, 5, 10, 15, 25, 40 and 60 minutes of reaction time. Immediately 25 µl 4M HCl was added to acidify the free fatty acid and stop the enzyme reaction. 3.00 ml of chloroform was added, and the sample was shaken vigorously on a Whirley shaker for 30 seconds. The sample was centrifuged and 2 ml of the chloroform phase was isolated and filtered through 0.45 µm filters and transferred into a tared 10 ml Dram flask. The chloroform was evaporated under a stream of nitrogen at 60°C, and the samples were weighed again. The extracted lipid was analyzed by TLC. Example 12 - Production of hydroxy acid ester (in particular lactic acid ester) with a lipid acyl transferase according to the invention. Hydroxy acid esters of fatty acids are traditionally produced by the reaction between a fatty acid and a hydroxy acid at high temperature using salts. inorganic or metallic ions as the catalyst (see for example, Bailey's Industrial Oil and Fat Products, 15 a edition, Volume 3. Edible Oil and Fat Products: Products and Application Technology, pgs. 502 - 511). This procedure however has the disadvantage of generating side reactions and colored by-products. In the present invention, hydroxy acid esters of fatty acids are produced by a transferase reaction using lecithin as the fatty acid donor and a hydroxy acid (in particular lactic acid) as the acceptor molecule. Procedure. 50 grams of lactic acid are dissolved in 1000 ml of water under agitation, then 200 grams of phosphatidyl choline are dispersed in the aqueous phase during agitation and with heating at 40°C. The pH is adjusted to pH 6.5 and maintained at this pH with NaOH or HCl. 50 ml of the enzyme lipid acyl transferase from A. salmonicida are added and stirring is continued at 40°C. Samples are removed at regular intervals and analyzed by TLC and GLC. After 20 h reaction time the reaction has reached equilibrium and is stopped. The lactic acid ester, lecithin and lysolecithin are isolated from the reaction medium by centrifugation according to standard methods (See "Centrifiges, Filtering" in Ullmann's Encyclopedia of Industrial Chemistry, (2002) by Wiley-VCH Verlag GmbH & Co. KgaA, for example). The lactic acid ester is further purified by molecular distillation and a high purity fatty acid lactic acid ester is obtained. Example 13 - Production of citric acid ester with a lipid acyl transferase according to the invention. Transferase assay based on phosphatidyl choline and citric acid as substrate. Next, the transferase activity of the lipid acyl transferase of A. salmonicida is tested on a substrate based on phosphatidyl choline and citric acid according to the following procedure. 450 mg of phosphatidyl choline (>95% PC Avanti item #441601) and 50 mg of citric acid are weighed into a Wheaton vial and 15 ml of 50 mM HEPES buffer pH 7 is added. . The substrate was heated to 35°C while mixing with a magnetic stirrer and 0.25 ml transferase solution 10 PLU / ml of A. salmonicida was added. The 2 ml samples were taken after 0, 5, 10, 15, 25, 40 and 60 minutes of reaction time. Immediately 25 µl 4M HCl was added to acidify the free fatty acid and stop the enzyme reaction. 3.00 ml of chloroform was added, and the sample was shaken vigorously on a Whirley shaker for 30 seconds. The sample was centrifuged and 2 ml of the chloroform phase was isolated and filtered through 0.45 µm filters and transferred into a tared 10 ml Dram flask. The chloroform was evaporated under a stream of nitrogen at 60°C, and the samples were weighed again. The extracted lipid was analyzed by TLC. All publications mentioned in the above specification are hereby incorporated by reference. Various modifications and variations of the described methods and system of the present invention will become apparent to those skilled in the art without departing from the scope and spirit of the present invention. While the present invention has been described with respect to preferred embodiments specifics, it should be understood what invention as claimed shall not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes of carrying out the invention, which are obvious to those skilled in biochemistry and biotechnology 5 or related fields, are understood to be within the scope of the following claims. SEQUENCE LISTING (I) Applicant data: a) DANISCO A / S b) Intellectual Capital, Langebrogade 1, P.O. Box 17, DK-1001 Copenhagen K (DK) (II) British priorities n 2 GB 0301117.8, of January 17, 2003, GB 0301118.6, of January 17, 2003, GB 0301119.4, of January 17, 2003, GB 0301120.2, of January 17, 2003, GB 0301121.0, of January 17, 2003, GB 0301122.8, of January 17, 2003, GB 0330016.7, of December 24, 2003 and American priority n 2 US 60 / 489,441, dated July 23, 2003 (III) "METHOD" (IV) 54 (V) Format for computer reading a) Microsoft® WORD document b) Pentium III with 700 MHz processor c) Windows by Microsoft® <110> Danisco A / S <120> Method <130> p015575WO AAW <140> PCT / IB2004 / 000575 <141> 2004-01-15 <150> GB0301121.0 <151> 2003-01-17 <150> GB0301122 .8 <151> 2003-01-17 <150> GB0301117.8 <151> 2003-01-17 <150> GB0301120.2 <151> 2003-01-17 <150> GB0301119.4 <151> 2003-01-17 <150> GB0301118.6 <151> 2003-01-17 <150> GB030330016.7 <151> 2003-12-24 <150> US60 / 489441 <151> 2003-07-23 <160> 54 . <170> Patent version 3.0 <210> 1 <211> 361 <212> PRT <213> Artificial <220> <223> consensus sequence <400> 1 lie Vai Ala Phe Gly Asp Ser Leu 1 5 Asp Ser Asp Gly Gly Gly Trp Gly Thr Asp Gly Glu Ala Tyr Tyr Gly 10 15 Ala Gly Leu Ala Asp Arg Leu Thr 25 30 Ala Leu Leu 35 Arg Leu Arg Ala Arg 40 Pro Arg Gly Vai Asp 45 Vai Phe Asn Arg Gly He Ser Gly Arg Thr Ser Asp Gly Arg Leu He Vai Asp Ala 50 55 60 Leu Vai Ala Leu Leu Phe Leu Ala Gin Ser Leu Gly Leu Pro Asn Leu 65 70 75 80 Pro Pro Tyr Leu Ser Gly Asp Phe Leu Arg Gly Ala Asn Phe Ala Ser 85 90 95 Ala Gly Ala Thr He Leu Pro Thr Ser Gly Pro Phe Leu He Gin Vai 100 105 HO Gin Phe Lys Asp Phe Lys Ser Gin Vai Leu Glu Leu Arg Gin Ala Leu 115 120 125 Gly Leu Leu Gin Glu Leu Leu Arg Leu Leu pro go Leu Asp Ala Lys To be Pro asp read Go Thr lie met Hey gly Thr ass asp read lie Thr Ser Ala Phe Phe Gly Pro Lys Ser Thr Glu Ser Asp Arg Asn Vai Ser Go Pro glu Phe Lys asp ass read arg Gin read Hey Lys arg read arg Ser Asn Asn Gly Ala Arg lie lie Vai Leu Ile Thr Leu Vai Ile Leu 195 200 205 Asn Leu Gly Pro Leu Gly Cys Leu Pro Leu Lys Leu Ala Leu Ala Leu 210 215 220 Ala Ser Ser Lys Asn Vai Asp Ala Ser Gly Cys Leu Glu Arg Leu Asn 225 230 235 240 Glu Ala Vai Ala Asp Phe Asn Glu Ala Leu Arg Glu Leu Ala Ile Ser 245 250 255 Lys Leu Glu Asp Gin Leu Arg Lys Asp Gly Leu Pro Asp Vai Lys Gly 260 265 270 Ala Asp Vai Pro Tyr Vai Asp Leu 280 Tyr Ser Ile Phe Gin 285 Asp Leu Asp 275 Gly Ile Gin Asn Pro Ser Ala Tyr Vai Tyr Gly Phe Glu Thr Thr Lys 290 295 300 Ala Cys Cys Gly Tyr Gly Gly Arg Tyr Asn Tyr Asn Arg Vai Cys Gly 305 310 315 320 Asn Ala Gly Leu Cys Asn Vai Thr Ala Lys Ala Cys Asn Pro Ser Ser 325 330 335 Tyr Leu Leu Ser Phe Leu Phe Trp Asp Gly Phe His Pro Ser Glu Lys 340 345 350 Gly Tyr Lys Ala Vai Ala Glu Ala Leu <210> 2 <211> 335 <212> PRT <213> Aeromonas hydrophila <400> 2 Met 1 Lys Lys Trp Phe 5 Go Cys Leu Leu Gly 10 Go Leu Ala Leu Thr 15 Go Gin Ala Ala Asp Ser Arg Pro Ala Phe Ser Arg lie Go Met Phe Gly 20 25 30 Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45 Leu Pro 50 Ser Ser Pro Pro Tyr 55 Tyr Glu Gly Arg Phe 60 Ser Asn Gly Pro Vai Trp Leu Glu Gin Leu Thr Asn Glu Phe Pro Gly Leu Thr He Ala 65 70 75 80 Asn Glu Ala Glu Gly Gly Pro Thr Ala Vai Ala Tyr Asn Lys He Ser 85 90 95 Trp Asn Pro Lys Tyr Gin Vai He Asn Asn Leu Asp Tyr Glu Vai Thr 100 105 110 Gin Phe Leu Gin Lys Asp Ser Phe Lys Pro Asp Asp Leu Vai He Leu 115 120 125 Trp Vai Gly Ala Asn Asp Ala Lys Arg Vai Vai Leu Asn Gly Ala Asp Tyr Leu Ala Tyr Gly Arg Asp Ala lie Ser Asp 150 155 Lys Glulie Leu Leu Phe Trp Asn Thr Glu Gin Wing Wing Asn Arg Met Asn Leu Pro Asp Leu gly Gin ass Pro To be Allah arg To be Gin Lys Go Go glu Allah Allah To be His Vai Ser 195 Ala Tyr His Asn Gin 200 Leu Leu Leu Asn Leu 205 Ala Arg Gin Leu Ala Pro Thr Gly Met Vai Lys Leu Phe Glu He Asp Lys Gin Phe 210 215 220 Ala Glu Met Leu Arg Asp Pro Gin Asn Phe Gly Leu Ser Asp Gin Arg 225 230 235 240 Asn Ala Cys Tyr Gly Gly Ser Tyr Vai Trp Lys Pro Phe Ala Ser Arg 245 250 255 Ser Ala Ser Thr Asp Ser Gin Leu Ser Ala Phe Asn Pro Gin Glu Arg 260 265 270 Leu Ala He Ala Gly Asn Pro Leu Leu Ala Gin Ala Vai Ala Ser Pro Met Ala Ala Arg Ser Ala Ser Thr Leu Asn Cys Glu Gly Lys Met Phe Trp 305 Asp Gin Vai His Pro 310 Thr Thr Vai Vai His 315 Ala Ala Leu Ser Glu 320 Pro Ala Ala Thr Phe He Glu Ser Gin Tyr Glu Phe Leu Ala His 325 330 335 <210> 3 <211 > 336 <212 > PRT <213 > Aeromonas salmonicida <400> 3 Met Lys Lys Trp Phe Vai Cys Leu Leu Gly Leu He Ala Leu Thr Vai 1 5 10 15 Gin Ala Ala Asp Thr Arg Pro Ala Phe Ser Arg He Vai Met Phe Gly 20 25 30 Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45 Leu Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro 50 55 60 Go Trp > Leu Glu Gin Leu Thr Lys Gin Phe Pro Gly Leu Thr He Ala 65 70 75 80 Asn Glu Ala Glu Gly 85 Gly Ala Thr Ala Vai 90 Ala Tyr Asn Lys He 95 Ser Trp Asn Pro Lys Tyr Gin Vai Tyr Asn Asn Leu Asp Tyr Glu Vai Thr 100 105 110 Gin Phe Leu Gin Lys Asp Ser Phe Lys Pro Asp Asp Leu Vai He Leu 115 120 125 Trp Vai Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr Glu Gin 130 135 140 Asp Ala Lys Arg Vai Arg Asp Ala He Ser Asp Ala Ala Asn Arg Met 145 150 155 160 Vai Leu Asn Gly Ala Lys Gin He Leu Leu Phe Asn Leu Pro Asp Le'd 165 170 175 Gly Gin Asn Pro Ser Ala Arg Ser Gin Lys Vai Vai Glu Ala Vai To be His Will Ser Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gin read Allah Pro Thr gly met Go Lys read Phe glu Hey asp Lys Gin Phe Ala Glu Met Leu Arg Asp Pro Gin Asn Phe Gly Leu Ser Asp Vai Glu Asn Pro Cys Tyr Asp 245 Gly Gly Tyr Vai Trp 250 Lys Pro Phe Ala Thr 255 Arg Ser Vai Ser Thr Asp Arg Gin Leu Ser Ala Phe Ser Pro Gin Glu Arg 260 265 270 Leu Ala Ile Ala Gly Asn Pro Leu Leu Ala Gin Ala Vai Ala Ser Pro 275 280 285 Met Ala Arg Arg Ser Ala Ser Pro Leu Asn Cys Glu Gly Lys Met Phe 290 295 300 Trp Asp Gin Vai His Pro Thr Thr Vai Vai His Ala Ala Leu Ser Glu 305 310 315 320 Arg Ála Ala Thr Phe lie Glu Thr Gin Tyr Glu Phe Leu Ala His Gly 325 330 335 <210> 4 <211> 295 <212> PRT <213> Streptomyces coelicolor <400> 4 Met Pro Lys Pro Ala Leu Arg Arg Vai Met Thr Ala Thr Vai Ala Ala 1 5 10 15 Go Gly Thr Leu Ala Leu Gly Leu Thr Asp Ala Thr Ala His Ala Ala 20 25 30 Pro Ala Gin 35 Ala Thr Pro Thr Leu 40 Asp Tyr Vai Ala Leu 45 Gly Asp Ser Tyr Ser Ala Gly Ser Gly Vai Leu Pro Vai Asp Pro Ala Asn Leu Leu 50 55 60 Cys Leu Arg Ser Thr Ala Asn Tyr Pro His Vai He Ala Asp Thr Thr 65 70 75 80 Gly Ala Arg Leu Thr Asp Vai Thr Cys Gly Ala Gin Thr Ala Asp 85 90 95 Phe Thr Arg Ala Gin Tyr Pro Gly Vai Ala Pro Gin Leu Asp Ala Leu 100 105 110 Gly Thr Gly Thr Asp Leu Vai Thr Leu Thr He Gly Gly Asn Asn Asn 115 120 125 Ser Thr Phe He Asn Ala He Thr Ala Cys Gly Thr Ala Gly Vai Leu 130 135 140 Ser Gly Gly Lys Gly Ser Pro Cys Lys Asp Arg His Gly Thr Ser Phe 145 150 155 160 Asp Asp Glu He Glu Ala Asn Thr Tyr Pro Ala Leu Lys Glu Ala Leu 165 170 175 Leu Gly Go Arg Ala Arg Ala Pro His Al a Arg Go Ala Ala Leu Gly 180 185 190 Tyr Pro Trp He Thr Pro Ala Thr Ala Asp Pro Ser Cys Phe Leu Lys 195 200 205 Leu Pro Leu Ala Ala Gly Asp Vai Pro Tyr Leu Arg Ala He Gin Ala 210 215 220 His Leu Asn Asp Ala Vai Arg Arg Ala Glu Glu Thr Gly Ala Thr 225 230 235 240 Tyr Vai Asp Phe Ser Gly Vai Ser Asp Gly His Asp Ala Cys Glu Ala 245 250 255 Pro Gly Thr Arg Trp He Glu Pro Leu Leu Phe Gly His Ser Leu Vai 260 265 270 Pro Vai His Pro Asn Ala Leu Gly Glu Arg Arg Met Ala Glu His Thr 275 280 285 Met Asp Vai Leu Gly Leu Asp 290 295 <210> 5 <211> 295 <212> PRT <213> Streptomyces coelicolor <400> 5 Met Pro Lys Pro Ala Leu Arg Arg Vai Met Thr Ala Thr Vai Ala Ala 1 5 10 15 Vai Gly Thr Leu Ala Leu Gly Leu Thr Asp Ala Thr Ala His Ala Ala 20 25 30 Pro Ala Gin Ala Thr Pro Thr Leu Asp Tyr Vai Ala Leu Gly Asp Ser Tyr Ser Ala Gly Ser Cys Leu Arg Ser Thr Gly Ala Arg Leu Thr Phe Thr Arg Ala Gin Gly Vai Leu Pro Vai Wing Asn Tyr Pro His Asp Vai Thr Cys Gly Tyr Pro Gly Vai Ala Asp Pro Wing Asn Leu Leu Vai He Ala Asp Thr Thr 75 80 Ala Ala Gin Thr Ala Asp Pro Gin Leu Asp Ala Leu Gly Thr Gly Thr Asp Leu Ser Thr Phe He Asn Ala Ser Gly Gly Lys Gly Ser 145 150 Asp Asp Glu He Glu Ala Leu Gly Vai Arg Ala Arg Go Thr Leu Thr lie lie Thr Ala Cys Gly Pro Cys Lys Asp Arg Asn Thr Tyr Pro Wing Wing Pro His Wing Arg Gly Gly Asn Asp Asn Thr Ala Gly Vai Leu His Gly Thr Ser Phe Leu Lys Glu Ala Leu Go Wing Wing Leu Gly Tyr Pro Trp 195 He Thr Pro Ala Thr 200 Ala Asp Pro Ser Cys 205 Phe Leu Lys Leu Pro Leu Ala Gly Asp Vai Pro Tyr Leu Arg Ala He Gin Ala 210 215 220 His Leu Asn Asp Ala Vai Arg Arg Ala Ala Glu Glu Thr Gly Ala Thr 225 230 235 240 Tyr Vai Asp Phe Ser Gly Vai Ser Asp Gly His Asp Ala Cys Glu Ala 245 250 255 Pro Gly Thr Arg Trp He Glu Pro Leu Leu Phe Gly His Ser Leu Vai 260 265 270 Pro Vai His Pro Asn Ala Leu Gly Glu Arg Arg Met Ala Glu His Thr 275 280 285 Met Asp Vai Leu Gly Leu Asp 290 295 <210> 6 <211> 238 <212> PRT <213> Saccharomyces cerevisiae <400> 6 Met Asp Tyr Glu Lys Phe Leu Leu Phe Gly Asp Ser lie Thr Glu Phe 15 10 15 Ala Phe Asn Thr Arg Pro lie Gly Ala Ala Leu Vai Asn Glu Arg Gly Phe Lys Gly Tyr Thr 50 55 Glulie Leu Lys His Glu Ser 65 70 Gly Ala Asn Asp Ala Cys Ser Glu Phe lie Asp Asn Lie Arg His lie Arg Pro He He lie Trp Glu Lys Glu Lys Ser Glu 130 135 Asn Glu Asn Phe Ala lie Tyr 145 150 Glu Glu Lys Vai Pro Phe Vai Asp Gly Lys Asp Gin Tyr Ala Leu 25 30 Tyr Thr Arg Lys Met Asp He Leu Gin 40 45 Ser Arg Trp Ala Leu Lys lie Leu Pro Asn lie Vai Met Ala Thr lie Phe Leu 75 80 Ala Gly Pro Gin Ser Vai Pro Leu Pro 90 95 Gin'Met Vai Ser Leu Met Lys Ser Tyr 105 110 Gly Pro Gly Leu Vai Asp Arg Glu Lys 120 125 Glu lie Ala Leu Gly Tyr Phe Arg Thr Ser Asp Ala Leu Ala Lys Leu Ala Asn 155 160 Ala Leu Asn Lys Ala Phe Gin Gin Glu Gly Gly Asp Ala Trp Gin Gin Leu Leu Thr Asp Gly Leu His Phe Ser Gly Lys Gly Tyr Thr Phe Tyr Pro Asp Trp Arg Asp <210> 7 <211> 1005 <212> DNA <213> Aeromona <400> 7 Go Read Asp Asp Lys lie Phe His Gin Tyr His Pro Asp Glu Leu Leu Lys Asn Met Gin Gly Ser Asn lie hydra ophila Lys Vai He Glu Tyr Lys Leu Lys Met ser atgaaaaaat ggcagccgac agccgtccg taccggcaag atgtacagca gggccgcttc tccaacgggc gaccatagcc ggtttgtgtg 60 ccttctccccg 120 agatgcgcgg 180 ccgtctggct tttattggga gatcgtgatg ttacctcccc ttggtcgcgc tttggccaca tccagccccc tgacagttca gcctctccga cctactatga ggagcagctg accaacgagt tcccgggcct aacgaggcgg gaatccaag tatcaggtca agacagcttc aagccggacg ctatggctgg aacacagagc caaccgcatg gtgctgaacg ccagaacccc tcggccccca ccacaaccag ctgctgctga gttcgagatc gacaagcagt cgaccagagg aacgcctgct cgccagcacc aaggggacc tcaacaacct atctggtgat aggatgccaa 480 gcgccaagga gccagaaggt acctggcacg ttgccgagat acggtggcag gaccgccgtg ggactacgag cctctgggtc gcgggtgcgc catactgctg ggtcgaggcg ccagctggct gctgcgtgat ctatgtatgg gcttacaaca gtcaccagt ggcgccaacg gacgccatca ttcaacctgc gccagccatg cccaccggca ccgcagaact aagccgtttg agatctcctg tcctgcaaaa actatctggc gcgatgcggc cggatctggg tctccgccta tggtgaagct tcggcctgag cctccccgcag gacagccagc tctccgcctt caacccgcag gagcgcctcg ccatcgccgg caaccgctg 840 ctggcccagg ccgtcgccag ccccatggct gcccgcagcg ccagcaccct caactgtgag 900 ggcaagatgt tctgggatca ggtccacccc accactgtcg tgcacgccgc cctgagcgag 960 cccgccgcca ccttcatcga gagccagtac gagttcctcg cccac <210> 8 <211> 1011 <212> DNA <213> Aeromonas salmonicida <400>8 atgaaaaaat ggtttgtttg tttattgggg ttgatcgcgc tgacagttca ggcagccgac 60 actcgccccg ccttctcccg gatcgtgatg ttcggcgaca gcctctccga taccggcaaa 120 atgtacagca agatgcgcgg ttacctcccc tccagcccgc cctactatga gggccgtttc 180 tccaacggac ccgtctggct ggagcagctg accaagcagt tcccgggtct gaccatcgcc 240 aacgaagcgg aaggcggtgc cactgccgtg gcttacaaca agatctcctg gaatcccaag 300 tatcaggtct agacagcttc aagccggacg atatggctgg aatacggagc caaccgcatg gtactgaacg ccagaaccg tcagccccca tcacaacaag ctgctgctga gttcgagatc gacaagcaat cgacgtcgag aacccctgct cgtcagcacc gaccgccagc caacccgctg ctggcacagg caactgtgag acaacaacct atctggtgat aggatgccaa gtgccaacca gtcagaaggt 600 acctggcacg ttgccgagat. aggacggcgg tctccgcctt ccgttgccag ggactacgag cctctgggtc gcgagttcgc catactgctg ggtcgaggcg ccagctggcc gctgcgtgat ctatgtgtgg cagtccgcag tcctatggcc gtcaccagt ggtgccaatg gatgccatca ttcaacctgc gtcagccatg cccaccggca ccgcagaact aagccgtttg gaacgcctcg cgccgcagcg tcttgcagaa actatctggc gcgatgcggc cggatctggg tctccgccta tggtaaagct tcggcctgag ccacccgcag ccatcgccgg ccagccccct ggcaagatgt tctgggatca ggtacacccg accactgtcg tgcacgcagc cctgagcgag 960 cgcgccgcca ccttcatcga gacccagtac gagttcctcg cccacggatg a <210> 9 <211> 888 <212> DNA <213> Streptomyces coelicolor <400> 9 atgccgaagc ctgcccttcg ccgtgtcatg accgcgacag tcgccgccgt cggcacgctc 60 gccctcggcc tcaccgacgc caccgcccac gccgcgcccg cccaggccac tccgaccctg 120 gactacgtcg ccctcggcga cagctacagc gccggctccg gcgtcctgcc cgtcgacccc 180 gccaacctgc tctgtctgcg ctcgacggcc aactaccccc acgtcatcgc ggacacgacg 240 ggcgcccgcc tcacggacgt cacctgcggc gccgcgcaga ccgccgactt cacgcgggcc 300 cagtacccgg gcgtcgcacc ccagttggac gcgctcggca ccggcacgga cctggtcacg 360 ctcaccatcg ctgcggcacg gcgggtgtcc caccctcttc gacgacgaga cggcgtccgc gccagggctc cccggccacc gccgaccgt ctacctgcgg gccatccagg cggagccacc tacgtggact cggcacccgc tggatcgaac cgccctgggc gagcggcgca gcggcaacga tcagcggcgg tcgaggccaa 540 ccccgccag cctgcttcct shit tctccggggt cgctgctctt tggccgagga caacagcacc caagggcagc cacgtacccc ggtggcggct gaagctcccc cgacgcggtc gtccgacggc cgggcacagc cacgatggac ttcatcaacg ccctgcaagg gcgctcaagg ctcggctacc ctcgccgccg cggcgggccg cacgacgcct ctcgttccg gtcctcggcc cccatcggc acaggcacgg aggcgctgct cgtggatcac gtgacgtgcc cggaggac gcgaggcccc tccaccccaa tggactga <210> <211> <212> DNA <213> Streptomyces coelicolor <400> 10 tcagtccagg ccagggcgtt ggggtggacg gggtgccggg ggcctcgcag tggctccggt ctcctcggcg gcaggtaggg cacgtcaccg tggccggggt gatccacggg ggacgccgag cagcgcctcc aggaggtgcc gtgcctgtcc tgccgcaggc ccgaggacgt ccatcgtgtg ctcggccatg ggaacgaggc tgtgcccgaa gagcagcggt gcgtcgtggc cgtcggacac ccggagaag gcccgccgga ccgcgtcgtt gaggtgtgcc gcggcgaggg ggagcttcag gaagcaggac tagccgagag ccgccaccct ggcgtgggga ttgagcgcgg ggtacgtgtt ggcctcgatc ttgcaggggc tgcccttgcc gccgctgagg cgccgctcgc tcgatccagc tccacgtagg tggatggccc gggtcggcgg gccctggcgc tcgtcgtcga acacccgccg cgtgatggcg ttgatgaagg tgctgttgtc gttgccgccg atggtgagcg tgaccaggtc 540 cgtgccggtg cccgcgtgaa gtcggcggtc tcgtgtccgc gatgacgtgg ggtcgacggg caggacgccg gggtcggagt ggcctgggcg gcgtgccgac ggcggcgact cggcgcgt tgcgcggcgc gggtagttgg gagccggcgc ggcgcggcgt gtcgcggtca ccaactgggg cgcaggtgac ccgtcgagcg tgtagctgtc gggcggtggc tgacacggcg tgcgacgccc gtccgtgagg cagacagagc gccgagggcg gtcggtgagg aagggcaggc gggtactggg cgggcgcccg aggttggcgg acgtagtcca cggggggcga ttcggcat <210> DNA <213> Saccharomyces cerevisiae atggattacg agaagtttct gttatttggg gattccatta ctgaatttgc ttttaatact 60 aggcccattg aagatggcaa agatcagtat gctcttggag ccgcattagt caacgaatat 120 aggagaaaaa atgggcgttg aaaatacttc aatatttttg ggtgccaacg atttatcgat aatattcgtc tataatagga ccggggctag agctctcgga tacttccgta actagccaat gaggaaaaag tggtgatgct tggcaacaac aatttttcat gacgaattat aaacatgcag tggatattct ctgagatttt atgcatgctc aaatggtatc tagatagaga ccaacgágáa ttcccttcgt tgctaacaga tgaaggtcat tcaaaaggg aaagcatgaa agcaggtccc tttgatgaag gaagtgggaa ctttgccatt ggctttgaat tggactgcac tgagacattc ttcaaagggt tccaatattg caaagtgtcc tcttaccata aaagaaaaat tattccgatg aaggcgtttc ttttccggaa tacccccaat acacttctag tcatggccac ccctccccga tccgtcctat ctgaagaaat ccttagcaaa aacaggagg aagggtacaa atcaccaa tacaaactga aagattggag agatgtgcta gatgatggat ctaacataat gtcttga <210> 12 <211> 347 <212> PRT <213> Ralstonia sp <400> 12 Met 1 Asn Leu Arg Gin 5 Trp Met Gly Ala Ala 10 Thr Ala Ala Leu Ala 15 Leu Gly Leu Ala Cys Gly Gly Gly Gly Thr Asp Gin Ser Gly Asn Pro 20 25 30 Asn Vai Ala Lys Vai Gin Arg Met Vai Vai Phe Gly Asp Ser Leu Ser 35 40 45 Asp lie Gly Thr Tyr Thr Pro Vai Ala Gin Ala Vai Gly Gly Gly Lys 50 55 60 Phe Thr Thr Asn Pro Gly Pro lie Trp Ala Glu Thr Vai Ala Ala Gin 65 70 75 80 Leu Gly Vai Thr Leu Thr Pro Ala Vai Met Gly Tyr Ala Thr Ser Vai 85 90 95 Gin Asn Cys Pro Lys Ala Gly Cys Phe Asp Tyr Ala Gin Gly Gly Ser 100 105 110 Arg Vai Thr Asp Pro Asn Gly lie Gly His Asn Gly Gly Ala Gly Wing 115 120 125 Leu Thr Tyr Pro Vai Gin Gin Gin Leu Ala Asn Phe Tyr Ala Ala Ser 130 135 140 Asn Asn Thr Phe Asn Gly Asn Asn Asp Vai Vai Phe Vai Leu Ala Gly 145 150 155 160 Ser Asn Asp lie Phe Phe Trp Thr Thr Ala Ala Ala Thr Ser Gly Ser 165 170 175 Gly Vai Thr Pro Ala He Ala Thr Ala Gin Vai Gin Gin Ala Ala Thr 180 185 190 Asp Leu Vai Gly Tyr Vai Lys Asp Met He Ala Lys Gly Ala Thr Gin 195 200 205 Vai Tyr 210 Vai Phe Asn Leu Pro 215 Asp Ser Ser Leu Thr 220 Pro Asp Gly Vai Ala Ser Gly Thr Thr Gly Gin Ala Leu His Ala Leu Vai Gly Thr 225 230 235 240 Phe Asn Thr Leu Gin Ser Gly Leu Ala Gly Thr Ser Ala Arg He 245 250 255 He Asp Phe Asn Ala Gin Leu Thr Ala Ala He Gin Asn Gly Ala Ser 260 265 270 Phe Gly Phe Ala Asn Thr Ser Ala Arg Ala Cys Asp Ala Thr Lys He 275 280 285 Asn Ala Leu Vai Pro Ser Ala Gly Gly Ser Ser Leu Phe Cys Ser Ala ass Thr read Go Allah To be gly Allah asp Gin To be Tyr read Phe Allah Gly Vai His Pro Thr Thr Ala Gly His Arg Leu Ile Ala Ser Asn asp Go Leu Ala Arg Leu Leu Ala Asp Asn Vai Ala His <210> 13 <211> 1044 <212> DNA <213> Rãlstoriià sp. <400> 13 atgaacctgc cttggccgcg tgcggggggcg gcagcgcatg gtggtgttcg gcaggcggtg ggcggcggca ggccgcgcaa gtcaatggat 60 gtgggaccga gcgacagcct 180 agttcaccac gggcgccgcc acggctgccc ttgccttggg ccagagcggc aatcccaatg tcgccaaggt gagcgatatc caaccccggc ggcacctaca cccccgtcgc ccgatctggg ccgagaccgt ctgggcgtga gaattgcccc aaggccggct gaacggcatc ggccacaacg cgccaacttc tacgcggcca gctggccggc agcaacgaca cgtgacgccc gccattgcca tgtcaaggac atgatcgcca cagcctgacg cggacggcg ggtgggcacg ttcaacacga cgacttcaac gcacaactga caccagcgcc cgctcacgcc ggcggtgatg gcttcgacta tgcgcagggc gcggcgcggg ggcgctgacc gcaacaacac attcaacggc ttttcttctg gaccactgcg cggcccaggt gcagcaggcc agggtgcgac gcaggtctac tggcaagcgg cacgaccggc cgctgcaaag cgggctggcc ccgcggcgat ccagaatggc ggctacgcca cctccgtgca ggctcgcgcg tgaccgatcc tacccggttc agcagcagct aataacgatg tcgtcttcgt gcggccacca gcggctccgg gcgacggacc tggtcggcta gtgttcaacc tgccccgacag caggcgctgc tgcacgcgct ggcacctcgg cgcgcatcat gcctcgttcg gcttcgccaa cgggcctgcg cagctcgctg ttctgctcgg gttcgccgac ggcgtgcacc ggcgcgcctg ctggcgggata accccaccaa ccaacacgct cgaccacggc acgtcgcgca gatcaatgcc ggtggcttcc cggccatcgc ctga ctggtgccga ggtgcggacc ctgatcgcca gcgccggcgg agagctacct gcaacgtgct <210> 14 <211> 261 <2 1 2> PRT ...... <213> Streptomyces coelicolor <400> 14 Met lie Gly Ser Tyr Vai Ala Vai Gly Asp Ser Phe Thr Glu Gly Vai 1 5 10 15 Gly Asp Pro Gly Pro Asp Gly Ala Phe Vai Gly Trp Ala Asp Arg Leu 20 25 30 Ala Vai Leu Leu Ala Asp Arg Pro Glu Gly Asp Phe Thr Tyr Thr 35 40 45 Asn Leu Ala Vai Arg Gly Arg Leu Leu Asp Gin lie Vai Ala Glu Gin 50 55 60 Vai 65 Pro Arg Vai Vai Gly 70 Leu Ala Pro Asp Leu 75 Vai Ser Phe Ala Ala 80 Gly Gly Asn Asp lie He Arg Pro Gly Thr Asp Pro Asp Glu Vai Ala 85 90 95 Glu Arg Phe Glu Leu Ala Vai Ala Ala Leu Thr Ala Ala Ala Gly Thr 100 105 110 Vai Leu Vai Thr Thr Gly Phe Asp Thr Arg Gly Vai Pro Vai Leu Lys 115 120 125 His Leu Arg Gly Lys He Ala Thr Tyr Asn Gly His Vai Arg Ala He 130 135 140 Ala Asp Arg Tyr Gly Cys Pro Vai Leu Asp Leu Trp Ser Leu Arg Ser 145 150 155 160 Go Gin Asp Arg Arg 165 Ala Trp Asp Ala Asp 170 Arg Leu His Leu Ser 175 Pro Glu Gly His Thr Arg Go Ala Leu Arg Ala Gly Gin Ala Leu Gly Leu 180 185 190 Arg Go Pro Ala Asp Pro Asp Gin Pro Trp Pro Pro Leu Pro Pro Arg 195 200 205 Gly Thr Leu Asp Go Arg Arg Asp Asp Go His Trp Ala Arg Glu Tyr 210 215 220 Leu Vai Pro Trp He Gly Arg Arg Leu Arg Gly Glu Ser Ser Gly Asp 225 230 235 240 His Vai Thr Ala Lys Gly Thr Leu Ser Pro Asp Ala He Lys Thr Arg 245 250 255 He Ala Ala Vai Ala <210> 15 <211> 786 <212> DNA <213> St rep tomyces <400> 15 coelicolor gtgatcgggt cgtacgtggc ggtggggac agcttcaccg agggcgtcgg cgaccccggc ccggacgggg cgttcgtcgg ctgggccgac cggctcgccg tactgctcgc ggacccggcgc ccggagggcg acttcacgta cacgaacctc gccgtgcgcg gcaggctcct cgaccagatc gtggcggaac aggtcccgcg ggtcgtcgga ctcgcgcccg accctgtctc gttcgcggcg ggcggcaacg acatcatccg gcccggcacc gatcccgacg aggtcgccga gcggttcgag 300 ctggcggtgg ccgcgctgac cgccgcggcc ggaaccgtcc tggtgaccac cgggttcgac 360 acccgggggg tgcccgtcct caagcacctg cgcggcaaga tcgccacgta caacgggcac 420 gtccgcgcca tcgccgaccg ctacggctgc ccggtgctcg acctgtggtc gctgcggagc 480 gtccaggacc gcagggcgtg ggacgccgac cggctgcacc tgtcgccgga ggggcacacc 540 cgggtggcgc tgcgcgcggg gcaggccctg ggcctgcgcg tcccggccga ccctgaccag 600 ccctggGcgc ecctgccgcc gcgcggcacg ctcgacgtcc ggcgcgacga cgtgcactgg 660 gcgcgcgagt acctggtgcc gtggatcggg cgccggctgc ggggcgagtc gtcgggcgac 720 cacgtgacgg ccaaggggac gctgtcgccg gacgccatca agacgcggat cgccgcggtg 780 gcctga <210> 16 <211> 260 <212> PRT <213> Streptomyces coelicolor <400> 16 Met Gin Thr Phe Thr Gin Trp Wing Asp Arg Tyr Wing Asp "Glu Gin Leu Go Gly Asn Pro 5 Ala Tyr Thr Ser Leu 10 Go Ala Go Gly Asp 15 Ser Gly Met Ser Asp Leu Pro Asp Gly Ser Tyr Arg Gly 20 25 30 Leu Leu Ala Thr Arg Met Ala Ala Arg Ser Pro Gly Phe 40 45 Asn Leu Ala Go Arg Gly Lys Leu lie Gly Gin lie Go 55 60 Go 'Asp 'Go' Ala 'Ala' Ala Met Gly Ala Asp Go lie Thr 70 75 80 Arg Go Arg Cys Glu Gin Leu Glu Arg Gly Leu 85 Asn Asp Thr Leu Arg 90 Pro Lys Cys Asp Met 95 Ala Asp Leu Leu Thr Gin Ala Vai Glu Arg Leu Ala Pro His 100 105 110 Leu Vai Leu Met Arg Ser Pro Gly Arg Gin Gly Pro Vai 120 125 Phe Arg Pro Arg Met Glu Ala Leu Phe Ala Vai He Asp 135 140 Asp Leu Ala Gly Arg His Gly Ala Vai Vai Vai Asp Leu Tyr Gly Ala 145 150 155 160 Gin Ser Leu Ala Asp Pro Arg Met Trp Asp Vai Asp Arg Leu His Leu 165 170 175 Thr Ala Glu Gly His Arg Arg Vai Ala Glu Ala Vai Trp Gin Ser Leu 180 185 190 Gly His Glu Pro Glu Asp Pro Glu Trp His Ala Pro lie Pro Ala Thr 195 200 205 Pro Pro Pro Gly Trp Vai Thr Arg Arg Thr Ala Asp Vai Arg Phe Ala 210 215 220 Arg Gin His Leu Leu Pro Trp lie Gly Arg Arg Leu Thr -Gly Arg Ser 225 230 235 240 Ser Gly Asp Gly Leu Pro Ala Lys Arg Pro Asp Leu Leu Pro Tyr Glu 245 250 255 Asp Pro Wing Arg <210> 17 <211> 783 <212> DNA <213> Streptomyces coelicolor <400> 17 atgcagacga caccgagggc atgtcggacc cgccacccgg atggcggccc gaagctgatc ggacagatcg cgtgatcacg ctggtcggcg ggtgcgggac ctgctga'ccc gctgatgcgc agtcccggtc ggccctgttc gccgtgatcg gtacggggcc cagtcgctgg cgccgagggc caccgccgggg ggacccggag accccgcgta tgctgccga gctcccccgg tcgacgagca ggctcaacga aggccgtgga gccagggtcc aggacctggc ccgaccctcg tcgcggagggc caccagtctc cggctcctac cttccggtac ggtggacgtg cacgctgcgg acggctcgcc ggtgctggag cggggcggcac gatgtgggac ggtgtggcag gtcgccgtcg cgtggctggg gccaacctgg gccgccgcca cccaagtgcg ccg'cactgcg cgcttccggc ggcgccgtgg gtggacccggc tcgctcggcc gcgactcctt ccgaccctct cggtgcgcgg tgggagccga acatggccg aggagctggt- cccgcatgga tcgtcgacct tgcacctgac aggagccga tggcacgcgc cgatcccggc gacgccgccg ccggggtggg tgacgcgcag gaccgcggac 660 gtccggttcg cccggcagca cctgctgccc tggataggcc gcaggctgac cggggcgctcg 720 tccggggacg gcctgccggc caagcgcccg gacctgctgc cctacgagga cccgcacgg 780 tga <210> 18 <211> 454 <212> PRT <213> Streptomyces coelicolor <400> 18 Met Thr Arg Gly Arg Asp Gly Gly Ala Gly Ala Pro Thr Lys His 1 5 10 15 Arg Ala Leu Leu Ala He Vai Thr Leu He Vai Ala He Ser Ala 20 25 30 Ala lie Tyr Ala Gly Ala Ser Ala Asp Asp Gly Ser Arg Asp His Ala 35 40 45 Leu Gin Ala Gly Gly Arg Leu Pro Arg Gly Asp Ala Ala Pro Ala Ser Thr 65 Gly Ala Trp Vai Gly 70 Ala Trp Ala Thr Ala 75 Pro Ala Ala Ala Glu 80 Pro Gly Thr Glu Thr Thr Gly Leu Ala Gly Arg Ser Vai Arg Asn Vai 85 90 95 Vai His Thr Ser Vai Gly Gly Thr Gly Ala Arg lie Thr Leu Ser Asn 100 105 110 Leu Tyr Gly 115 Gin Ser Pro Leu Thr 120 Vai Thr His Ala Ser 125 He Ala Leu Ala Gly Pro Asp Thr Ala Ala He Ala Asp Thr Met Arg Arg 130 135 140 Leu Thr Phe Gly Gly Ser Ala Arg Vai He Pro Ala Gly Gly Gin 145 150 155 160 Vai Met Ser Asp Thr Ala Arg Leu Ala He Pro Tyr Gly Ala Asn Vai 165 170 175 Leu Vai Thr Thr Tyr Ser Pro He Pro Ser Gly Pro Vai Thr Tyr His 180 185 190 Pro Gin Ala Arg Gin Thr Ser Tyr Leu Ala Asp Gly Asp Arg Thr Ala 195 200 205 Asp Go Thr Ala Go Ala Tyr Thr Thr Pro Thr Pro Tyr Trp Arg Tyr 210 215 220 Leu Thr Ala Leu Asp Vai Leu Ser His Glu Ala Asp Gly Thr Vai Vai Ala Phe Gly Asp Ser 245 He Thr Asp Gly Ala 250 Arg Ser Gin Ser Asp 255 Ala Asn His Arg Trp Thr Asp Vai Leu Ala Ala Arg Leu His Glu Ala Ala 260 265 270 Gly Asp Gly Arg Asp Thr Pro Arg Tyr Ser Vai Vai Asn Glu Gly He 275 280 285 Ser Gly Asn Arg Leu Leu Thr Ser Arg Pro Gly Arg Pro Ala Asp Asn 290 295 300 Pro Ser Gly Leu Ser Arg Phe Gin Arg Asp Vai Leu Glu Arg Thr Asn 305 310 315 320 Go Lys Allah Go Go Go Go read gly Go ass asp Go read ass To be Pro glu read Allah Go asp arg Allah Thr Pro Phe asp His gly arg Allah Tyr asp arg Allah gly Hey read Tyr read arg Thr Thr Go glu read arg Thr read Go gly Allah Thr Hey Allah arg glu Thr met arg gin Go Go MetArg Gly Tyr Glu Go asp phe Ser Asp Arg Wing Asn Glu Asp Lys Tyr Asp Met Gly Glu He arg be ward Leu Be Gly ward goes Arg Asp AspHis read asp gly arg for Tyr read his read ala go phe ASP Pro Pro Gly ward Leu asp Thr arg arg Asp Lys Lys Gly Wing Wing Pro Vai Lys Wing <210> 19 <211> 1365 <212> DNA <213> Streptomyces coelicolor <400> 19 atgacccgg gtcgtgacgg gggtgcgggg gcgcccccca ccaagcaccg tgccctgctc gcggcgatcg tcaccctgat agtggcgatc tccgcggcca tatacgccgg agcgtccgcg gacgacggca gcagggacca cgcgctgcag gccggaggcc gtctccccacg aggagacgcc gcccccgcgt cgcggccgag ccggggcaccg gcacacctcg gtcggcggca gccgctgacc gtcacacacg gatcgccgac accatgcgcc gggcggccag gtgatgagcg ggtcaccacg tactccccca gaccagctac ctggccgacg cccacgccc tactggcgct cacggtcgtg gcgttcggcg ccaccgctgg ccaccggtgc 240 agacgaccgg 300 cggcgcgcg cctcgatcgc ggctcacctt 480 acaccgcccg 540 tcccgtccgg gcgaccgcac acctgaccgc actccatcac ctgggtgggc cctggcgggc gatcaccctc cctggccgcc cggcggcagc cctcgccatc gccggtgacc ggcggacgtc cctcgacgtg cgacggcgcc gcctgggcca cgctccgtgc tcgaacctgt gggcccgaca gccccggtga cccctacgggg taccatccgc accgccgtcg ctgagccacg cgctcgcaga ccgcaccggc gcaacgtcgt accggcagtc ccgccgccgc tcatcccggc cgaacgtcct aggcccggca cgtacaccac aggccgacgg gcgacgccaa acccgtcc cacgccccgc tacagcgtcg gccggggcgg ccggccgaca acccaccaac gtcaaggccg ggaactcgcc gaccgcgacg cgcccgggga ctgcgggtcg caccgaggcc cgcgagacga cttcgacacg gtcgtcgact gcgctccgac tacgacagcg gggcgcggtc tcgccgcacg tcaacgaggg 900 accggagcgg tcgtcgtcgt ccatcctgac tcggcgccac tgcggcagga tcgacaaggc gcgaccacct cctgcacgag catcagcggc actgagccgg cctcggcgtc cggcctgcgc gatcacgccg ggtcaacgag cctgcgccgac gcaccccggc gcggcgggcg aaccggctcc ttccagcggg aacgacgtcc accctcgtcg ttcggcggct gagatccgct ccgtacgacc gacaaggggt acggccggga tgaccagcag acgtgctgga tgaacagccc acccggcggca acggcggct'a ccggccgggt cgcgccggat accgcgcat atcgacctgg ccgcgctgaa gggcgcggcg ccggtcaagg cgtag <210> 20 <211> 340 . <212> PRT <213> Streptomyces coelicolor <400> 20 Met 1 Thr Ser Met Ser 5 Arg Ala Arg Vai Ala 10 Arg Arg He Ala Ala 15 Gly Ala Ala Tyr Gly Gly Gly Gly He Gly Leu Ala Gly Ala Ala Ala Vai 20 25 30 Gly Leu Vai Vai Ala Glu Vai Gin Leu Ala Arg Arg Arg Vai Gly Vai 35 40 45 Gly Thr Pro Thr Arg Vai Pro Asn Ala Gin Gly Leu Tyr Gly Gly Thr 50 55 60 Leu Pro Thr Ala Gly Asp Pro Leu Arg Leu Met Met Leu Gly Asp 65 70 75 80 Ser Thr Ala Ala Gly Gin Gly Vai His Arg Ala Gly Gin Thr Pro Gly 85 90 95 Ala Leu Leu Ala Ser Gly Leu Ala Ala Vai Ala Glu Arg Pro Vai Arg 100 105 110 Leu Gly Ser Vai Ala Gin Pro Gly Ala Cys Ser Asp Asp Leu Asp Arg 115 120 125 Gin Vai Ala Leu Vai Leu Ala Glu Pro Asp Arg Vai Pro Asp lie Cys Vai 145 He Met Vai Gly Ala 150 Asn Asp Vai Thr His 155 Arg Met Pro Ala Thr 160 Arg Ser Vai Arg His Leu Ser Ser Ala Vai Arg Arg Leu Arg Thr Ala 165 170 175 Gly Ala Glu Vai Vai Vai Gly Thr Cys Pro Asp Leu Gly Thr He Glu 180 185 190 Arg Vai Arg Gin Pro Leu Arg Trp Leu Ala Arg Arg Ala Ser Arg Gin 195 200 205 Leu Ala 210 Ala Ala Gin Thr' He 215 Gly Ala Vai Glu Gin 220 Gly Gly Arg Thr Vai Ser Leu Gly Asp Leu Leu Gly Pro Glu Phe Ala Gin Asn Pro Arg 225 230 235 240 Glu Leu Phe Gly Pro Asp Asn Tyr His Pro Ser Ala Glu Gly Tyr Ala 245 250 255 Thr Ala Ala Met Ala Vai Leu Pro Ser Vai Cys Ala Ala Leu Gly Leu 260 265 270 Trp Pro Ala Asp Glu Glu His Pro Asp Ala Leu Arg Arg Glu Gly Phe 275 280 285 Leu Pro Vai Ala Arg Ala Ala Ala Glu Ala Ala Ser Glu Ala Gly Thr 290 295 300 Glu Vai Ala Ala Ala Met Pro Thr Gly Pro Arg Gly Pro Trp Ala Leu 305 310 315 320 Leu Lys Arg Arg Arg Arg Arg Arg Vai Ser Glu Ala Glu Pro Ser 325 330 335 Pro Ser Gly Vai <210> 21 <211> 1023 <212> DNA <213> Streptomyces coelico'lor <400> 21 atgacgagca ggcgtacggc ggcggcggca cgaggtgcag ctggccagac gcagggactg tacggcggca gctgggcgac tgtcgagggc 60 tcggcctggc gcagggtggg 180 ccctgccccac gagggtggcg gggaggcggcg ggtgggcacg ggccggcgac cggcggatcg gcggtcggtc ccgaccgggg ccgccgctgc cggccggcgc tggtggtggc tgccgaacgc ggctgatgat tccacggccg gctgctggcg tccgggctcg ccagccgggg gcgtgctcgg ggacccgggtg ccgacatct gccggcgacc cgctcggtgc tgcggaggtg gtggtcggca gctgcgctgg ctggcccggc cgtcgagcag ggcggggcgca gaaccgcgg gagctcttcg ggccgcgatg gcggtactgc ggaggacccg cggggcaggg cggcggtggc accactgga gcgtgatcat ggcacctgtc cetgtccgga gggcctcacg cggtgtcgct 720 gccccgacaa cctcggtgtg cgtgcaccgg ggaccggccg ccggcaggtg ggtcggcgcc ctcggcggta cctggg'cacg gcagctcgcg gggcgacctg ctaccacccc cgccgcgctc gcggggcaga gtgcggctgg gcgctggtgc aacgacgtca cggcggctgc atcgagcgg gcggcacaga ctgggtccgg tccgccgagg ggcctgtggc cgccggggcgc ggtcggtcgc tcgccgagcc cccaccggat gcacggccgg tgcggcagec ccatcggcgc agttcgcgca ggtacgccac cggccgacga gacgcgctgc ggcggcgtcc gaggcgggta ctgggcgctg ctgaagcgcc gtccggcgtt gccgcgaggg cggaggtcgc 960 ggaacggcg cttcctgccg cgccgccatg tcgggtgtcg gtggcgcgcg cctacggggc gaggcggaac cggcggcgga ctcgggggcc cgtccagccc tga <210> <211> <212> PRT <213> Streptomyces coelicolor <400> Met Gly Arg Gly Thr 1 5 Arg Vai Ala Leu Ala Ala Gly Cys Asp Ser Pro Ser Lys Arg Thr Asp Gin Arg Thr Arg Tyr Ala Leu Thr Ala Ala Vai Go Gly Gly Asp Ser Pro Arg Thr Wing Pro Wing Trp Gly Arg Arg Arg Wing Leu Gly Vai Gly Vai Ala Pro Ser Gly Ser Asp Thr Ser Pro Wing Ser 65 Vai Ala Ala Vai Gly 70 Asp Ala Vai Leu Ser Asp 85 Cys Pro Ala Lys Vai Asp 100 Ser Leu Ala Ala Glu His 115 Ser Trp Asn Tyr Leu Thr 130 Ala Gin Vai Thr Arg 135 Ala 145 Vai Met Ala Gly Ala 150 Asn Met Thr Pro Vai Ala 165 Asp Phe Thr Leu Arg Lys 180 Lys Leu Pro Pro Asp Leu 195 Lys Arg Leu Trp Lys Gin 210 Vai Trp Lys Leu Gly 215 He Thr Arg 75 Gly Phe Asp Ala Cys 80 Vai Ser Trp Ala Thr Gly Ser Ser 90 95 Arg Leu Leu Gly Lys Ala Asp Ala 105 110 Vai Thr Gly Ala Arg Met Ala Asp 125 Ala Gin Arg Glu Pro Glu Leu Vai 140 Ala Cys -Arg Ser Thr Th-r Ser Ala 155 160 Ala Gin Phe Glu Glu Ala Met Ala 170 175 Ala Gin Vai Tyr Vai Ser Ser He 185 190 Gin Gly Arg Thr Asn Pro Leu Gly 205 Cys Pro Ser Met Leu Gly Asp Ala 220 asp To be read asp To be Allah Allah Thr read arg arg ass Thr Go arg asp arg Go Allah asp Tyr ass glu Go read arg glu Go Allah Lys asp Arg Arg Cys Arg 260 Ser Asp Asp Gly Ala 265 Vai His Glu Phe Arg 270 Phe Gly Thr Asp Gin Léu Ser His Trp Asp Trp Phe His Pro Ser Vai Asp Gly 275 280 285 Gin Ala Arg Leu Ala Glulie Ala Tyr Arg Ala Vai Thr Wing Lys Asn 290 295 300 Pro <210> <211> <212> DNA <213> Streptomyces coelicolor <400> atgggtcgag ggacggacca gcggacgcgg tacggccgtc gccgggcgcg tgtcgcgctc 60 gccgccctga ccgccgccgt cctgggcgtg ggcgtggcgg gctgcgactc cgtgggcggc gactcaccg cgcctgggac accagcccgg cgacgcctgt gcggtgctgt gaaggtcgac tcgctggccg gaactacgcg gtcaccgggg gcagcgcgag cggagctgg gcctcggcg atgacgccgg cctgcgcaag aagctcccca gctctggtcc cagggccggca cccgtcgatg ctgggcgacg ggtgcgcgac ctccttccgg cgtccgtcgc cggactgccc tacggctgct cccggatggc tggcggtgat tggcggactt aggcgcaggt ccaaccgct cggactccct cagcccgtcg cgccgtggggc ggaggtgtcg ggggaaggcg ggacctgacc ggccggggcg ccggcgcag gtacgtgtcg gggcaagcag ggactcggcg aagcggacga gactccatca tggggcgaccg gacgcggccg gctcaggtga aacgacgcgt ttcgaggagg agcatcccgg gtgtggaagc gcgaccctgc ggacggcgcc cgcgcggctt gcagcagcgc agcacagctg cgcgggcggc gccggtccac cgatggccac acctcaagcg tcggcctgtg ggcgcaacac cgggtggcgg gcggtgccgc agccgacgacg ccactgggac tggttccacc ccgcgcggtc actacaacga gcgcggtgca cgagtgtgga ggtgctgcgg cgagttccgg cggccaggcc gaggtctgcg ttcggcacgg cggctggcgg cgaaggacg accagttgag agatcgccta accgcgaaga atccctga <210> 24 <211> 268 <212> PRT <213> Streptomyces rimosus <400> 24 Met 1 Arg Leu Ser Arg 5 Arg Ala Ala Thr Ala 10 Ser Ala Leu Leu Leu 15 Thr Pro Ala Leu Ala Leu Phe Gly Ala Ser Ala Ala Vai Ser Ala Pro Arg 20 25 30 He Gin Ala Thr Asp Tyr Vai Ala Leu Gly Asp Ser Tyr Ser Ser Gly 35 40 45 Go Gly Ala Gly Ser Tyr Asp Ser Ser Ser Gly Ser Cys Lys Arg Ser 50 55 60 Thr 65 Lys Ser Tyr Pro Ala 70 Leu Trp Ala Ala Ser 75 His Thr Gly Thr Arg 80 Phe Asn Phe Thr Ala Cys Ser Gly Ala Arg Thr Gly Asp Vai Leu Ala 85 90 95 Lys Gin Leu Thr Pro Vai Asn Ser Gly Thr Asp Leu Vai Ser He Thr 100 105 110 He Gly Gly Asn Asp Ala Gly Phe Ala Asp Thr Met Thr Thr Cys Asn 115 120 125 Leu Gin Gly Glu Ser Ala Cys Leu Ala Arg He Ala Lys Ala Arg Ala 130 135 140 Tyr lie Gin Gin Thr Leu Pro Ala Gin Leu Asp Gin Vai Tyr Asp Ala He Asp Ser Arg Ala 165 Pro Ala Ala Gin Vai 170 Vai Vai Leu Gly Tyr 175 Pro Arg Phe Tyr Lys Leu Gly Gly Ser Cys Ala Vai Gly Leu Ser Glu Lys 180 185 190 Ser Arg Ala Ala He Asn Ala Ala Ala Asp Asp He Asn Ala Vai Thr 195 200 205 Ala Lys Arg Ala Ala Asp His Gly Phe Ala Phe Gly Asp Vai Asn Thr 210 215 220 Thr Phe Ala Gly His Glu Leu Cys Ser Gly Ala Pro Trp Leu His Ser Go Thr read Pro Go glu ass To be Tyr His Pro Thr Wing ass gly Gin To be Lys Tyr read Pro Go read ass To be Allah Thr <210> 25 <211> 1068 <212> DNA <213> Streptomyces rimosus <400> 25 ttcatcacàa cgatgtcaca acaccggcèá tccgggtcat ccctgatcgt gggaatgggt gacaagcctt cccgtgacga aagggtcctg ctacatcaga aatgacagaa atcctgctca gggaggttcc atgagactgt ccgacgcgc ggccacggcg tccgcgctcc tcctcacccc ggcgctcgcg ctcttcggcg cgagcgccgc cgtgtccgcg ccgcgaatcc aggccaccga ctacgtggcc ctcggcgact cctactctc gggggtcggc gcgggcagct aggacagcag cagtggctcc cctcgcacac cggtacgcgg tgctggccaa gcagctgacc gcggcaacga cgcgggcttc cgtgcctggc gcggatcgcc tggaccaggt ctacgacgce gctacccgcg cttctacaag gcgcggccat caacgccgcc accacggctt cgccttcggg gcgccccctg tgtaagccca 360 ttcaacttca 420 ccggtcaact 480 gccgacacca aaggcgcgcg atcgacagcc ctgggcggca 720 gccgaccaca gacgtcaaca gcaccaagtc ccgcctgttc ccggcaccga tgaccacctg cctacatcca gggcccccgc gctgcgccgt tcaacgccgt cgaccttcgc ctacccggcc gggcgcccgc cctggtcagc caacctccag gcagacgctg agcccaggtc cggtctctcg caccgccaag cgggcacgag ctgtgggccg acaggagacg attaccatcg ggcgagagcg cccgcccagc gtcgtcctgg gagaagtccc cgcgccgccg ctgtgctccg gctgcacagc gtcacccttc ccgtggagaa ctcctaccac cccacggcca aggcagtc 900 caagggctac ctgcccgtcc tgaactccgc cacctgatct cgcggctact ccgcccctga 960 cgaagtccg cgcccgtcgc gccggtggcc cccccggggcg ccgccgtacg gggcttcgcc tgccgccgcc gtaggtgcgc cccggacgcg gtaccgccgt gtcggttc <210> 26 <211> 335 <212> PRT <213> Aeromonas hydrophila <400> 26 Met 1 Lys Lys Trp Phe 5 Vai Cys Leu Leu Gly 10 Leu Vai Ala Leu Thr 15 Vai Gin Ala Ala Asp Ser Arg Pro Ala Phe Ser Arg He Vai Met Phe Gly 20 25 30 Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45 Leu Pro Ser Ser Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro 50 55 60 Vai Trp Leu Glu Gin Leu Thr Lys Gin Phe Pro Gly Leu Thr He Ala Asn Glu Ala Glu Gly 85 Gly Ala Trp Asn Pro Lys Tyr Gin Vai 100 Gin Phe Leu Gin Lys Asp Ser 115 Trp Vai Gly Ala Asn Asp Tyr 130 135 Asp Ala Lys Arg Vai Arg Asp 145 150 Vai Leu Asn Gly Ala Lys Gin 165 Gly Gin Asn Pro Ser Ala Arg 180 His Vai Ser Ala Tyr His Asn 195 Leu Ala Pro Thr Gly Met Vai 210 215 Ala Glu Met Leu Arg Asp Pro 225 230 Ala Vai 90 Ala Tyr Asn Lys He 95 Ser Asn Asn Leu Asp Tyr Glu Vai Thr 105 110 Lys Pro Asp Leu Vai He Leu 125 Ala Tyr Gly Trp Asn Thr Glu Gin 140 lie Ser Asp Ala Ala Asn Arg Met 155 160 Leu Leu . Phe Asn Leu Pro Asp 'Leu 170 175 Gin Lys Vai Vai Glu Ala Vai Ser 185 190 Leu Leu Leu Asn Leu Ala Arg Gin 205 Leu Phe Glu lie Asp Lys Gin Phe 220 Asn Phe Gly Leu Ser Asp Vai Glu 235 240 Asn Pro Cys Tyr Asp 245 Gly Gly Tyr Vai Trp 250 Lys Pro Phe Ala Thr 255 Ser Vai Ser Thr Asp Arg Gin Leu Ser Ala Phe Ser Pro Gin Glu 260 265 270 Leu Ala He Ala Gly Asn Pro Leu Leu Ala Gin Ala Vai Ala Ser 275 280 285 Met Ala Arg Arg Ser Ala Ser Pro Leu Asn Cys Glu Gly Lys Met 290 295 300 Trp Asp Gin Vai His Pro Thr Thr Vai Vai His Ala Ala Leu Ser 305 310 315 arg arg Pro Phe glu arg Allah Thr pH lie'Ala ass Gin Tyr glu Phé read Allah His <210> 27 <211> 1008 <212> DNA <213> Aeromonas hydrophila <400> 27 atgaaaaaat ggcagccgac agtcgcccg taccggcaaa ggtttgtgtg ccttttccg tttattggga gatcgtgatg ttggtcgcgc ttcggccaca tgacagttca gcctctccga atgtacagca gggccgtttc tccaacggac gaccatcgcc aacgaagcgg gaatccaag tatcaggtca agacagcttc aagccggacg ctatggctgg agatgcgcgg ccgtctggct aaggcggtgc tcaacaacct atctggtgat ttacctcccc tccagcccgc cctactatga ggaccagctg accaaacagt tcccgggtct cactgccgtg gcttacaaca ggactacgag gtcacccagt cctctgggtc ggtgccaatg aacacggagc aggatgccaa'gcgggttcgc gatgccatca caaccgcatg 480 gtactgaacg ccagaaccg tcagctcgca tcacaaccag ctgctgctga gttcgagatc gacaagcaat cgacgtcgag gtgccaacca gtcagaaggt acctggcacg ttgccgagat gatactgctg ttcaacctgc ggtcgaggcg gtcagccatg ccagctggcc gctgcgtgat cccaccggca ccgcagaact agatctcctg tcttgcagaa actatctggc gcgatgcgg cggatctggg tctccgccta tggtaaagct tcggcctgag aacccctgct cgtcagcacc gaccgccagc caacccgctg ctggcacagg caactgtgag ggcaagatgt cctgagcgag cgcgccgcca aggacggcgg tctccgcctt ccgttgccag tctgggatca ccttcatcgc ctatgtgtgg cagtccgcag tcctatggcc ggtacaccg gaaccagtac <210> <211> aagccgtttg gaacgcctcg cgccgcagcg accactgtcg gagttcctcg ccacccgcag ccatcgccgg ccagccccct tgcacgcagc cccactga PRT <213> salmonicidal aeromonas <400> Met 1 Lys Lys Trp Phe 5 Vai Cys Leu Leu Gly 10 Leu Li Ala Leu Thr 15 Vai Gin Ala Ala Asp Thr Arg Pro Ala Phe Ser Arg He Vai Met Phe Gly 20 25 30 Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45 Leu Pro 50 Ser Ser Pro Pro Tyr 55 Tyr Glu Gly Arg Phe 60 Ser Asn Gly Pro Vai Trp Leu Glu Gin Leu Thr Lys Gin Phe Pro Gly Leu Thr He Ala 65 70 75 80 Asn Glu Ala Glu Gly Gly Gly Ala Thr Ala Vai Ala Tyr Asn Lys He Ser 85 90 95 Trp Asn Pro Lys 100 Tyr Gin Vai He Asn 105 Asn Leu Asp Tyr Glu 110 Vai Thr Gin Phe Leu Gin Lys Asp Ser Phe Lys Pro Asp Asp Leu Vai He Leu 115 120 125 Trp Vai Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr Glu Gin 130 135 140 Asp Ala Lys Arg Vai Arg Asp Ala He Ser Asp Ala Ala Asn Arg Met 145 150 155 160 Vai Leu Asn Gly Ala Lys Gin He Leu Leu Phe Asn Leu Pro Asp Leu 165 170 175 Gly Gin Asn Pro Ser Ala Arg Ser Gin Lys Vai Vai Glu Ala Vai Ser 180 185 190 His Vai Ser Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gin 195 200 205 Leu Ala Pro Thr Gly Met Vai Lys Leu Phe Glu lie Asp Lys Gin Phe 210 215 220 Ala Glu Met Leu Arg Asp Pro Gin Asn Phe Gly Leu Ser Asp Vai Glu 225 230 235 240 Asn Pro Cys Tyr Asp Gly Gly Tyr Vai Trp Lys Pro Phe Ala Thr Arg 245 250 255 Ser Vai Ser Thr Asp Arg Gin Leu Ser Ala Phe Ser Pro Gin Glu Arg 260 265 270 Leu Ala lie Ala Gly Asn Pro Leu Leu Ala Gin Ala Vai Ala Ser Pro 275 280 285 Met Ala Arg Arg Ser Ala' Ser Pro Leu Asn Cys Glu Gly Lys Met Phe 290 295 300 Trp Asp Gin Vai His Pro Thr Thr Vai His Ala Ala Leu Ser Glu 305 310 315 320 Arg Ala Ala Thr Phe lie Glu Thr Gin Tyr Glu Phe Leu Ala His Gly 325 330 335 <210> 29 <211> 1011 <212> DNA <213> Aeromonas salmonicida <400> 29 atgaaaaaat ggcagccgac actcgcccg taccggcaaa atgtacagca gggccgtttc tccaacggac gaccatcgcc aacgaagcgg gaatccaag tatcaggtca agacagcttc aagccggacg atatggctgg aatacggagc caaccgcatg gtactgaacg ccagaaccg tcagccccca tcacaacaag ggtttgtttg 60 ccttctccccg agatgcgcgg ccgtctggct aaggcggtgc tcaacaacct atctggtgat aggatgccaa gtgccaacca gtcagaaggt tttattgggg gatcgtgatg ttacctcccc ggaccagctg cactgccgtg ggactacgag cctctgggtc gcgagttcgc catactgctg ggtcgaggcg ttgatcgcgc ttcggccaca tccagcccgc accaagcagt gcttacaaca gtcaccagt ggtgccaatg gatgccatca ttcaacctgc gtcagccatg tgacagttca gcctctccga cctactatga tcccgggtct agatctcctg tcttgcagaa actatctggc gcgatgcggc cggatctggg tctccgccta ctgctgctga gttcgagatc gacaagcaat cgacgtcgag aacccctgct cgtcagcacc gaccgccagc caacccgctg ctggcacagg caactgtgag ggcaagatgt cctgagcgag cgcgccgcca acctggcacg ttgccgagat 720 aggacggcgg tctccgcctt ccgttgccag tctgggatkan ccttcatcga ccagctggcc gctgcgtgat ctatgtgtgg cagtccgcag tcctatggcc ggtaca'ccg gaccagtac cccaccggca ccgcagaact aagccgtttg gaacgcctcg cgccgcagcg accactgtcg gagttcctcg tggtaaagct tcggcctgag ccacccgcag ccatcgccgg ccagccccct tgcacgcagc cccacggatg a <210> 30 <211> 347 <212> PRT <213> Aeromonas hydrophila <400> 30 Met Phe Lys Phe Lys Lys Asn Phe Leu Vai Gly Leu Ser Ala Ala Leu 10 15 Met Ser He Ser 20 Leu Phe Ser Ala Thr 25 Ala Ser Ala Ala Ser 30 Ala Asp Ser Arg Pro Ala Phe Ser Arg lie Vai Met Phe Gly Asp Ser Leu Ser 35 40 45 Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr Leu Pro Ser Ser 50 55 60 Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro Vai Trp Leu Glu 65 70 75 80 Gin read Thr Lys Gin Phe Pro gly read Thr lie Allah ass glu Allah glu Gly Gly Ala Thr Ala Vai Ala Tyr Asn'Lys lie Ser Trp Asn Pro Lys Tyr Gin Vai 115 He Asn Asn Leu Asp 120 Tyr Glu Vai Thr Gin 125 Phe Leu Gin Lys Asp Ser Phe Lys Pro Asp Leu Vai He Leu Trp Vai Gly Ala 130 135 140 Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr Glu Gin Asp Ala Lys Arg 145 150 155 160 Vai Arg Asp Ala He Ser Asp Ala Ala Asn Arg Met Vai Leu Asn Gly Ala Lys Gin Lie Leu Leu Phe Asn Leu Pro Asp Leu Gly Gin Asn Pro Ser Wing Arg Ser Tyr His Asn Gin Gly Met Vai Lys Gin Lys Go Go Leu Leu Leu Asn Leu Phe Glulie Glu ala vai ser Leu Ala Arg Gin Asp Lys Gin Phe His Will Be Wing Read Ala Pro Thr Ala Glu Met Leu Arg Asp Pro Gin Asn Phe Gly Leu Ser Asp Vai Glu Asn Pro Cys Tyr Asp Gly Gly Tyr ValTrp'Lys Pro Phe-Ala—Thr Arg Ser Vai Ser Thr Asp Arg Gin 275 Leu Ser Ala Phe Ser 280 Pro Gin Glu Arg Leu 285 Ala He Ala Gly Asn Pro Leu Leu Ala Gin Ala Vai Ala Ser Pro Met Ala Arg Arg 290 295 300 Ser Ala Ser Pro Leu Asn Cys Glu Gly Lys Met Phe Trp Asp Gin Vai 305 310 315 320 His Pro Thr Thr Vai Vai His Ala Ala Leu Ser Glu Arg Ala Ala Thr 325 330 335 Phe He Ala Asn Gin Tyr Glu Phe Leu Ala His 340 345 <210> 31 <211> 27 <212> DNA <213> Artificial <220 <223> PCR primer <400> 31 gtgatggtgg gcgaggaact cgtactg <210> 32 - ............- <211> 35 <212> DNA <213> Artificial <220 <223> PCR primer <400> 32 agcatatgaa aaaatggttt gtttgtttat tgggg <210> 33 <211> 39 <212> DNA <213> Artificial <220> <223> PCR primer <400> 33 ttggatccga attcatcaat ggtgatggtg atggtgggc <210> 34 <211> 18 <212> DNA <213> Artificial <220 <223> Promoter primer <400> 34 taatacgact cactatag <210> 35 <211> 18 <212> DNA <213> Artificial <220 <223> Terminator primer <400> 35 ctagttattg ctcagcgg <210> 36 <211> 41 <212> DNA <213> Artificial <220 <223> PCR primer <400> 36 gtcatatgaa aaaatggttt gtgtgtttat tgggattggt c <210> 37 <211> 30 <212> DNA <213> Artificial <220> <223> PCR primer <400> 37 atggtgatgg tgggcgagga actcgtactg <210> 38 <211> 41 <212> DNA <213> Artificial <220> <223> PCR primer <400> 38 gtcatatgaa aaaatggttt gtgtgtttat tgggattggt <210> 39 <211> 39 <212> DNA <213> Artificial <220> <223> PCR primer <400> 39 ttggatccga attcatcaat ggtgatggtg atggtgggc <210> 40 <211> 26 <212> DNA <213> Artificial <220> <223> PCR primer <400> 40 atgccatggc cgacagccgt cccgcc <210> 41 <211> 27 <212> DNA <213> Artificial <220 <223> PCR primer <400> 41 ttggatccga attcatcaat ggtgatg <210> 42 <211> 26 <212> DNA <213> Artificial <220 <223> PCR primer <400> 42 ttgctagcgc cgacagccgt cccgcc <210> 43 <211> 27 <212> DNA <213> Artificial <220 <223> PCR primer <400> 43 ttggatccga attcatcaat ggtgatg <210> 44 <211> 26 <212> DNA <213> Artificial <220> <223> PCR primer <400> 44 ttgccatggc cgacactcgc cccgcc <210> 45 <211> 27 <212> DNA <213> Artificial <220> <223> PCR primer <400> 45 ttggatccga attcatcaat ggtgatg <210> 46 <211> 26 <212> DNA <213> Artificial <220 <223> PCR primer <400> 4 6 ttgctagcgc cgacactcgc cccgcc <210> 47 <211> 27 <212> DNA <213> Artificial <220> <223> PCR primer <400> 47 ttggatccga attcatcaat ggtgatg <210> 48 <211> 1047 <212> DNA <213> Aeromonas hydrophila <400> 48 atgtttaagt ttaaaaagaa tttcttagtt ggattatcgg cagctttaat gagtattagc 60 ttgttttcgg ttcccggatc gtgatgttcg gcgcggttac ctcccctcca ctggctggag cagctgacca cggtgccact gccgtggctt caacctggac tacgaggtca ggtgatcctc tgggtcggtg tgccaagcgg gttcgcgatg caagcagata ctgctgttca gaaggtggtc gaggcggtca ggcacgccag caaccgcctc tgcagctagc gccgacagcc gcgacagcct 180 gcccgcccta aacagttcc acaacaagat cccagttctt ccaatgacta ccatcaggcga acctgccgga gccatgtctc ctccgatacc ctatgagggc gggtctgacc ctcctggaat gcagaaagac tctggcctat tgcggccaac tctgggccag cgcctatcac ggcaaaatgt cgtttctcca atcgccaacg cccaagtatc agcttcaagc ggctggaaca cgcatggtac aacccgtcag aaccagctgc gtccgcctt acagcaagat acggacccgt aagcggagg aggtcatcaa cggacgatct cggagcagga tgaacggtgc ctcgcagtca tgctgaacct ctggccccca ccggcatggt aaagctgttc gagatcgaca agcaatttgc cgagatgctg cgtgatccgc agaacttcgg cctgagccgac gtcgagaacc cctgctacga cggcggctat gtgtggaagc cgtttgccac ccgcagcgtc agcaccgacc gccagctctc cgccttcagt ccgcaggaac gcctcgccat cgccggcaac ccgctgctgg cacaggccgt tgccagtcct atggccgcc gcagcgccag cccccctcaac tgtgagggca agatgttctg ggatcaggta caccgacca ctgtcgtgca - cgcagccctg.; agcgagcgcg ccgccacctt catcgcgaac cagtaccagt tcctcgccca ctgatga <210> 49 <211> 1007 <212> DNA <213> Aeromonas hydrophila (bottom strand seq 33) <400> 49 tactttttta ccaaacacac aaataaccct aaccagcgcg actgtcaagt ccgtcggctg 60 tcagcggggc ggaaaagggc ctagcactac aagccgctgt cggagaggct atggccgttt 120 tacatgtcgt cccggcaaag aggttgcctg ctggtagcgg ttgcttcgcc cttagggtta tagtccagta ctgtcgaagt tcggcctgct' atacccgacct tgtgcctcgt ttggcgtacc atgacttgcc gtcttggggca gtcgagcgtc gtgttggtcg tctacgcgcc aatggagggg aggtcgggcg ggcagaccga cctcgtcgac tggtttgtca ttccgccacg gtgacggcac cgaatgttgt gttgttggac ctgatgctcc agtgggtcaa agaccactag gagacccagc cacggttact cctacggttc gcccaagcgc tacggtagtc acggttcgtc tatgaccaca agttggacgg agtcttccac cagctccgcc agtcggtaca ggatgatact aggggccaga tctagaggac gaacgtcttt gatagaccgg gctacgccgg cctagaccg gaggcgggata accgacgactt ggaccgtgcg gtcgaccggg ggtggccgta ccatttcgac aagctctagc 660 tgttcgttaa ctgcagctct tggggacgat cagtcgtggc tggcggtcga ttgggcgacg accgtgtccg ttgacactcc cgttctacaa gactcgctcg cgcggcggtg acggctctac gctgccgccg 780 gaggcggaag gcaacggtca gaccctagtc gaagtagcgc gacgcactag wholesale tcaggcgtcc ggataccggg catgtgggct tfggtcatg'c gcgtcttgaa tcggcaaacg ttgcggagccg cggcgtcgcg ggtgacagca tcaaggaggcg gccggactcg gtgggcgtcg gtagcggccg gtcggggggag cgtgcgtcgg ggtgact <210> 50 <211> 1011 <212> DNA <213> Aeromonas salmonicida (Seq ID 35 of bottom strand) <400> 50 tactttttta ccaaacaaac aaataacccc aactagcgcg actgtcaagt ccgtcggctg 60 tgagcggggc ggaagagggc ctagcactac aagccgctgt cggagaggct atggccgttt 120 tacatgtcgt cccggcaaag aggttgcctg ctggtagcgg ttgcttcgcc cttagggttc atagtccagt tctgtcgaag ttcggcctgc tataccgacc ttatgcctcg' gttggcgtac catgacttgc ggtcttgggc agtcggggcgt agtgttgttc gacgaccact caagctctag ctgttcgtta gctgcagctc tctacgcgcc 180 ggcagaccga ttccgccacg agttgttgga 360 tagaccacta tcctacggtt cacggttcgt cagtcttcca 600 tggaccgtgc aacggctcta aatggaggggg cctcgtcgac gtgacggcac cctgatgctc ggagaccag cgctcaagcg ctatgaccgac ccagctccgc ggtcgaccgg cgacgcacta aggtcggggcg tggttcgtca cgaatgttgt cagtgggtca ccacggttac cctacggtagt aagttggacg cagtcggtac gggtggccgt ggcgtcttga ggatgatact aggggccaga tctagaggac agaacgtctt tgatagaccg cgctacgccg gcctagacc agaggcggat accattcga agccggactc ttggggacga gcagtcgtgg ctggcggtcg gttgggcgac gaccgtgtcc gttgacactc ccgttctaca ggactcgctc gcgcggcggt tgctgccgcc 780 agaggcggaa ggcaacggtc 900 agaccctagt ggaagtagct gatacacacc gtcaggcgtc aggataccgg ccatgtgggc ctgggtcatg ttcggcaaac cttgcggagc gcggcgtcgc tggtgacagc ctcaaggacc ggtgggcgtc ggtagcggcc ggtcggggga acgtgcgtcg gggtgcctac t <210> 51 <211> 35 <212> DNA <213> Artificial <220> <223> PCR primer <400> 51 agcatatgaa aaaatggttt gtttgtttat tgggg <210> 52 <211> 1047 <212> DNA <213> Aeromonas hydrophila (bottom strand seq ID 54) <400> 52 tacaaattca ctcataatcg aaaaaagcc aagggcctag cactacaagc cgcgccaatg gaggggaggt gaccgacctc gtcgactggt gccacggtga cggcaccgaa gttggacctg atgctccagt ccactaggag accagccac acggttcgcc caagcgctac gttcgtctat aatttttctt 60 gttggcggag cgctgtcgga 180 cggggcgggat 240 ttgt'caagqg tgttgttcta 360 gggtcaagaa ggttactgat 480 ggtagtcgct aaagaatcaa cctaatagcc gtcgaaatta acgtcgatcg gaggctatgg gatactccg ccgactgg gaggacctta cgtctttctg agaccgggata acgccggttg cggctgtcgg cagggcggaa ccgtttaca. tgtcgttcta gcaaagaggt tagcggttgc gggttcatag tcgaagttcg cccgaccttgt gcgtaccatg tgcctgggca ttcgccttcc tccagtagtt gcctgctaga gcctcgtcct acttgccacg gaccacaagt cttccaccag ctccgccagt ccgtgcggtc gaccgggggt gctctacgac gcactaggcg gccgccgata cacaccttcg gccgaagtca ggcgtccttg acggtcagga tacggggcgg cctagtccat gtgggctggt gtagcgcttg gtcatgctca tggacggcct agacccggtc ttgggcagtc cggtacagag gcggatagtg ttggtcgacg ggccgtacca tttcgacaag ctctagctgt tcttgaagcc ggactcgctg cagctcttgg gcaaacggtg ggcgtcgcag tcgtggctgg cggagcggta"gcggccgttg ggcgacgacc cgtcgcggtc gggggagttg acactcccgt gacagcacgt gcgtcgggac tcgctcgcgc aggagcgggt gactact gagcgtcagt aggacttgga tcgttaaacg ggacgatgct cggtcgagag gtgtccggca tctacaagac ggcggtggaa <210> 53 <211> 8 <213> Artificial <220> <223> Block 1 GDSX block (pg 27 in the report) <220> <221> NON_CONS <222> (1)..(8) <223> X is a hydrophobic residue selected from Met, Ile, Leu, Go, Ala, Gly , Cys, His, Lys, Trp, Tyr or Ph <400> 53 Xaa Xaa Xaa Xaa Gly Asp Ser Xaa 1 5 <210> 54 <211> 6 <212> PRT <213> Artificial <220> <223> Block 2 GANDY block (page 28 of the report) <220> <221> NON_CONS <222> (1)..(6) <223> X is a hydrophobic residue selected from Met, Ile, Leu Go, Ala, Gly , Cys, His, Lys, Trp, Tyr or Ph <400> 54 Xaa Gly Xaa Asn Asp Xaa 1 5
Claims
CLAIMS 1. A method for producing one or more carbohydrate esters, protein esters, protein ester subunits, or hydroxy acid esters, characterized in that the method comprises mixing an acyl donor, an acyl acceptor, and water to produce an environment with a high water concentration comprising 5% to 98% water, wherein said acyl donor is a lipid substrate selected from one or more members of a group composed of a phospholipid, a lysophospholipid, a triacylglyceride, a diglyceride, a glycolipid, or a lysoglycolipid, and said acyl acceptor is selected from one or more of the group composed of a carbohydrate, a protein, a protein subunit, or a hydroxy acid;and contacting the mixture with a lipid acyl transferase enzyme, such that said lipid acyl transferase enzyme catalyzes one or both of the following reactions: alcoholysis or transesterification, wherein the lipid acyl transferase enzyme is characterized as an enzyme possessing acyl transferase activity and comprising the amino acid sequence GDSX, wherein X is one or more of the following amino acid residues: L, A, V, I, F, Y, H, Q, T, N, M or S.
2. Method, according with claim 1, characterized by the fact that the lipid acyltransferase enzyme is immobilized.
3. Method, according to claim 1 or claim 2, characterized in that said method comprises the purification of carbohydrate ester, protein ester, protein subunit ester, and hydroxy acid ester.
4. A method, according to any of the preceding claims, characterized in that the lipid acyltransferase enzyme comprises H-309 or comprises a histidine residue at a position corresponding to His-309 in the amino acid sequence of Aeromonas hydrophila, a lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No.
32.
5. A method, according to any of the preceding claims, characterized in that the lipid acyltransferase enzyme is obtained from an organism of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, SchizoSaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.
6. Method, according to any of the claims. preceding, characterized in that the lipid acyltransferase enzyme comprises one or more of the following amino acid sequences: (i) the sequence of amino acids shown as SEQ ID No. 2; (ii) the amino acid sequence shown as SEQ ID No. 3; (iii) the amino acid sequence shown as SEQ ID No. 4; (iv) the amino acid sequence shown as SEQ ID No. 5; (v) the amino acid sequence shown as SEQ ID No. 6; (vi) the amino acid sequence shown as SEQ ID No. 12, r (VÜ) the amino acid sequence shown as SEQ ID No. 2 0, (viii) a amino acid sequence shown as SEQ ID No. 22, (ix) amino acid sequence shown as SEQ ID No. 24, (x) amino acid sequence shown as SEQ ID No. 26, (xi) amino acid sequence shown as SEQ ID No. 28, (xii) amino acid sequence shown as SEQ ID No. 30, (xiii) the amino acid sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence shown as SEQ ID No. 34, or an amino acid sequence that has 75% or more identity with one of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32 or SEQ ID No.
34.
7. Use of a lipid acyltransferase enzyme characterized in that it produces one or more of a carbohydrate ester, a protein ester, a protein subunit ester, or a hydroxy acid ester by catalyzing one or both of an alcoholysis or transesterification in a mixture of an acyl donor, an acyl acceptor, and water, the mixture comprising a water content of 5 to 98%, wherein said acyl donor is a lipid substrate selected from one or more of the group consisting of a phospholipid, a lysophospholipid, a triacylglyceride, a diglyceride, a glycolipid, or a lysoglycolipid, and said acyl acceptor is selected from one or more of the group consisting of a carbohydrate, a protein, a protein subunit, or a hydroxy acid, wherein the lipid acyltransferase enzyme is characterized as an enzyme possessing acyltransferase activity and comprising the amino acid sequence GDSX.characterized in that X is one or more of the following amino acid residues: L, A, V, I, F, Y, H, Q, T, N, M, or S.
8. Use according to claim 7, characterized in that the lipid acyltransferase enzyme is immobilized.
9. Use according to claim 7, characterized because carbohydrate ester, protein ester, A protein subunit ester or a hydroxy acid ester is purified.
10. Use, according to any of claims 7 to 9, characterized in that the lipid acyltransferase enzyme comprises H-309 or comprises a histidine residue at a position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No.
32.
11. Use, according to any of claims 7 to 10, characterized in that the lipid acyltransferase enzyme is obtained from an organism of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, SchizoSaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.
12. Use, according to any of claims 8 to 11, characterized in that the lipid acyltransferase enzyme comprises one or more of the following amino acid sequences: (i) the amino acid sequence shown as SEQ ID No. 2; (ii) the amino acid sequence shown as SEQ ID No. 3; (iii) the amino acid sequence shown as SEQ ID No. 4; (iv) the amino acid sequence shown as SED ID No. 5; (v) the amino acid sequence shown as SEQ ID No. 6; (vi) the amino acid sequence shown as SEQ ID No. 12, (vii) the amino acid sequence shown as SEQ ID No. 20, (viii) the sequence of amino acids shown as SEQ ID No. 22, (ix) the amino acid sequence shown as SEQ ID No. 24, (x) the amino acid sequence shown as SEQ ID No. 26, (xi) the sequence of amino acids shown as SEQ ID No. 28, (xii) the amino acid sequence shown as SEQ ID No. 30, (xiii) the amino acid sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence shown as SEQ ID No. 34, or an amino acid sequence that has 75% or more identity with one of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No, . 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32 or SEQ ID No.
34.
13. Carbohydrate ester characterized by being produced by a method according to any one of claims 1 to 6.
14. Protein ester characterized by being produced by a method according to any of the claims.
15. Ester of a protein subunit characterized by being produced by a method according to any one of claims 1 to 6.
16. Hydroxy acid ester characterized by being produced by a method according to any one of claims 1 to 6.
17. Immobilized lipid acyltransferase enzyme, characterized in that the lipid acyltransferase enzyme is characterized as an enzyme that possesses acyltransferase activity and that comprises the amino acid sequence GDSX, characterized in that X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.
18. Immobilized lipid acyltransferase enzyme, according to claim 17, characterized in that the lipid acyltransferase enzyme comprises H-309 or comprises a histidine residue at a position corresponding to His-309 in the amino acid sequence of Aeromonas hydrophila, a lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No.
32.
19. Immobilized lipid acyltransferase enzyme, according to any of claims 17-18, characterized in that the lipid acyltransferase enzyme is obtained from an organism of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, SchizoSaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.
20. Immobilized lipid acyltransferase enzyme, according to any one of claims 17 to 19, characterized in that the lipid acyltransferase enzyme comprises one or more of the following amino acid sequences: (i) the amino acid sequence shown as SEQ ID No. 2; (ii) the amino acid sequence shown as SEQ ID No. 3; (iii) the amino acid sequence shown as SEQ ID No. 4; (iv) the amino acid sequence shown as SEQ ID No. 5; (v) the amino acid sequence shown as SEQ ID No. 6; (vi) the amino acid sequence shown as SEQ ID No. 12; (vii) the amino acid sequence shown as SEQ ID No. 20; (viii) the sequence (ix) the amino acid sequence shown as SEQ ID No. 22, (x) the amino acid sequence shown as SEQ ID No. 24, (x) the amino acid sequence shown as SEQ ID No. 26, (xi) the sequence of amino acids shown as SEQ ID No. 28, (xii) the amino acid sequence shown as SEQ ID No. 30, (xiii) the amino acid sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence shown as SEQ ID No. 34, or an amino acid sequence that has 75% or more identity with any of the sequences shown as SEQ. ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32 or SEQ ID No. 34.