A method for genetic transformation of Schizochytrium mitogenome mediated by Agrobacterium

Abstract

The present invention provides a method for genetic transformation of Schizochytrium mediated by Agrobacterium, which comprises transforming intact Schizochytrium cells with Agrobacterium. The present invention also comprises a method for preparing transgenic Schizochytrium and a method for transferring a target gene into Schizochytrium. The present invention also comprises a culture medium of Schizochytrium for the above method. The method of the present invention avoids the preparation process of protoplasts in the disclosed electroshock transformation or Agrobacterium-mediated protoplast transformation method, and obtains a higher transformation efficiency.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to a method for carrying out gene transformation on Schizochytrium natans by using Agrobacterium-mediated method. Background Art

[0002] Schizochytrium has a strong ability to synthesize DHA. Schizochytrium sp.ATCC20888 (Schizochytrium sp.S31, US5130242-1992) can achieve a fermentation level of 221g / L biomass in glucose medium (CN01806451.5), and a biomass level of 145g / L in glycerol medium (US20090209014) and accumulate a large amount of oil in cell dry weight. With such a strong production capacity, Schizochytrium is obviously a potential host for heterologous gene recombinant expression. The classification of Schizochytrium is still incomplete. The Schizochytrium aggregatum, Schizochytrium minutum, Schizochytrium octosporum, Schizochytrium mangroei, and Schizochytrium limacinum proposed by researchers have yet to be adjusted (Yokoyama Rinka & Hona Daiske. Taxonomic rearrangement of the genus Schizochytrium sensulatobased on morphology, chemotrxonomic characteristics, and 18S rRNA gene phylogeny (Thraustochytriaceae, Labyrinthulomycetes): emendation for Schizochytrium and erection of Aurantiochytrium and Oblongichytrium gen. nov.) Mycoscience, 2007 48: 199-211). It is now determined that the genus has the species Schizochytrium aggregatum (representative strain ATCC 28209), the common ATCC 20888, and ATCC 20889, ATCC20111, FJU-512, SR21, etc. are temporarily considered independent species. Generally, 50% seawater or artificial seawater (sea salt mixed with water) is used to culture Schizochytrium, and the main salt component in the culture medium is NaCl, about 240mM. Schizochytrium ATCC20888 strain can grow specifically in non-chloride sodium salt culture medium, and can grow vigorously in Na2SO4 up to 22.7g / L (sodium ion concentration in culture medium 316mM).

[0003] There are usually methods such as gene gun, electroporation, chemical transformation, viral transformation and Agrobacterium transformation for introducing foreign genes into host cells, which are suitable for different vectors and host systems. For Schizochytrium, there are already public transformation methods such as particle bombardment (CN1556850A) and protoplast (Streptomyces greiseusprotease XIV enzymatic hydrolysis) electroporation (US 2010 / 0266546A1), and neither of the above two transformation methods mentions transformation efficiency data. However, researchers in this field are well aware that both gene gun and electroporation transformation methods cannot control the number of copies of the vector entering the host cell, and using the host's own originals to construct non-transgenic organisms is an important means to avoid food safety risks, but the above transformation methods can easily cause genetic recombination at undesirable sites, which brings troubles to certain transgenic applications. For example, in recombinant transformation applications or heterologous expression, the additional insertion of endogenous original sites will interfere with the activity of the genes at the site, thereby affecting the growth of recombinant algae. In Agrobacterium-mediated transformation, its T-DNA is generally integrated into the recipient bacteria in a single copy, so that recombinant bacteria can be produced in a controllable manner. At present, the Third Institute of Oceanography in China has published a method for transforming Schizochytrium protoplasts with Agrobacterium LBA4404 (CN102220359A). 7 More than 100 transformants can be obtained from each Schizochytrium cell. In the article published by the same author, Agrobacterium transformed Schizochytrium protoplasts, and about 60 colonies (Agrobacterium EHA105 transformation) and about 170 colonies (Agrobacterium LBA4404 transformation) were obtained per plate (Rubin Cheng, Ruijuan Ma, Ke Li, Hui Rong, Xiangzhi Lin, Zhaokai Wang, Shanjun Yang, Yong Ma, 2012 Agrobacterium tumefaciens mediated transformation of marine microalgae Schizochytrium. Microbiological Research 167: 179-186). In addition to the cost of enzymatic hydrolysis, the shortcomings of this method also include the troublesome preparation of protoplasts: shaking, centrifugation, pipetting, washing, and coating will destroy the protoplasts, fusion may occur between protoplasts, and the cell wall regeneration efficiency affects the transformation efficiency.

[0004] Therefore, there is still a need in the art for a method for transferring exogenous genes into Schizochytrium host cells with higher transformation efficiency. Summary of the invention

[0005] The present invention provides a method for genetically transforming Schizochytrium sp., which comprises the step of transforming intact Schizochytrium sp. cells using recombinant Agrobacterium containing a target gene.

[0006] The present invention provides a method for preparing recombinant Schizochytrium sp., which comprises the step of transforming intact Schizochytrium sp. cells using recombinant Agrobacterium sp. containing a target gene.

[0007] The present invention provides a method for transferring a target gene into Schizochytrium, which comprises the step of transforming intact Schizochytrium cells using a recombinant Agrobacterium containing the target gene.

[0008] Methods for transforming intact Schizochytrium cells using Agrobacterium include:

[0009] (1) Cultivating Schizochytrium cells and Agrobacterium to the logarithmic phase;

[0010] (2) mixing the logarithmic phase Schizochytrium cells obtained in step (1) with Agrobacterium, and spreading the mixture on an induction plate for incubation; and

[0011] (3) Harvest the co-incubated bacteria and spread them onto selection plates;

[0012] Thus, the transformed Schizochytrium was obtained.

[0013] In a specific embodiment, the Schizochytrium is lipid-producing Schizochytrium.

[0014] In other embodiments, the Schizochytrium is a Schizochytrium expressing an exogenous protein.

[0015] In certain embodiments, the Schizochytrium is a low-lipid producing Schizochytrium strain, which can be used, for example, to produce exogenous enzyme proteins.

[0016] In a specific embodiment, the Schizochytrium is selected from Schizochytrium sp. ATCC 20888, Schizochytrium S8 (ATCC 20889), Schizochytrium ATCC 28209, Schizochytrium SR21 (ATCC MYA-1381), Schizochytrium sp. NBRC102615, Schizochytrium sp. NBRC 102617, Schizochytrium sp. BAFCcult 3502, Schizochytrium sp. BAFCcult 3511, Schizochytrium sp. BL4, Schizochytriumsp. BR2.1.2, Schizochytrium sp. BUCAAA 032, Schizochytrium sp. BUCAAA093, Schizochytrium sp. BUCACD 152, Schizochytriumsp. BUCARA 021, Schizochytrium sp. BUCHAO 113, Schizochytrium sp. BURABQ 133, Schizochytrium sp. BURARM 801, Schizochytrium sp. BURARM 802, Schizochytriumsp. FJU-512, Schizochytrium sp. KH105, Schizochytriumsp. KR-5, Schizochytriumsp. KRT1, Schizochytrium sp. KRT2, Schizochytrium sp. PJ10.4, Schizochytriumsp. SBL1, Schizochytrium sp. SBL2, Schizochytrium sp. SBL3, Schizochytrium sp. SEK210, Schizochytriumsp. SEK 345, Schizochytrium sp. SEK 346, Schizochytriumsp. SKA10, Schizochytrium sp. SKA6, Schizochytrium sp. SR21 and Schizochytriumsp. TIO01.

[0017] In a specific embodiment, the Agrobacterium is selected from Agrobacterium tumefaciens.

[0018] In a specific embodiment, the Agrobacterium is selected from Agrobacterium tumefaciens EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707 and GV3101::pMP90.

[0019] In a specific embodiment, the transformation comprises the step of co-culturing logarithmic-phase Schizochytrium cells and logarithmic-phase Agrobacterium.

[0020] In a specific embodiment, the Schizochytrium cells in the logarithmic phase are obtained by culturing the Schizochytrium cells in a Schizochytrium culture medium having a sodium ion concentration of 0.240 mol / L or more.

[0021] In a specific embodiment, the OD of the logarithmic phase Schizochytrium cell culture is 600 It is 1.0-1.5.

[0022] In a specific embodiment, the Schizochytrium culture medium contains: glucose, monosodium L-glutamate, yeast powder, dipotassium hydrogen phosphate, sodium sulfate or sodium chloride, magnesium sulfate, potassium chloride, calcium chloride, sodium bicarbonate, trace salt stock solution and vitamin stock solution, with a pH of about 6.5-7.5, preferably about 7.0.

[0023] In one specific embodiment, the trace salt stock solution contains disodium EDTA, ferric chloride, boric acid, manganese chloride, zinc chloride, nickel sulfate, copper sulfate, and sodium manganate.

[0024] In one embodiment, the vitamin stock solution may contain VB1, biotin and / or VB 12 .

[0025] In a specific embodiment, the culture medium of Schizochytrium sphaeroides contains: 20-40 g / L glucose; 15-25 g / L monosodium L-glutamate; 0.1-0.5 g / L yeast powder; 0.3-0.7 g / L dipotassium hydrogen phosphate; 10-15 g / L sodium sulfate, or sodium chloride that can provide the same amount of sodium ions; 1.0-1.5 g / L magnesium sulfate; 0.1-0.5 g / L potassium chloride; 0.03-0.07 g / L calcium chloride; 0.05-0. 20g / L; trace salt stock solution 0.5-2ml / L, including 3-9g / L disodium EDTA, 0.1-0.4g / L ferric chloride, 5-8g / L boric acid, 0.5-1.2g / L manganese chloride, 0.03-0.09g / L zinc chloride, 0.01-0.05g / L nickel sulfate, 0.001-0.003g / L copper sulfate and 0.002-0.008g / L sodium manganate; and vitamin stock solution 0.5-2ml / L, including VB1 50-200mg / L, biotin 0.3-0.8mg / L and VB 12 0.3-0.8mg / L.

[0026] In a specific embodiment, the culture medium contains 8-30 g / L sodium sulfate.

[0027] In a specific embodiment, the Schizochytrium culture medium contains: 5-20 g / L yeast powder, 10-30 g / L peptone, 10-30 g / L glucose, 30%-70% seawater, pH 6.2-6.8.

[0028] In a specific embodiment, the OD of the Agrobacterium culture in the logarithmic phase is 600 It is 0.3-1.5.

[0029] In a specific embodiment, the co-cultivation is carried out in an induction medium containing salt stock, glycerol, water, agar, 2-morpholineethanesulfonic acid and glucose.

[0030] In a specific embodiment, the co-cultivation comprises culturing a mixture of logarithmic-phase Schizochytrium cells and logarithmic-phase Agrobacterium in an incubator at about 28° C. for 15-30 hours.

[0031] In a specific embodiment, the method further comprises: selecting Schizochytrium cells into which the gene has been transferred in a Schizochytrium culture medium containing 30-80 μg / ml of an antibiotic marker carried by the recombinant Agrobacterium vector and 100-300 μg / ml of cefotaxime.

[0032] In one embodiment, the OD of the Agrobacterium culture in logarithmic phase is 600 The induction medium does not contain acetosyringone.

[0033] The present invention also provides a culture medium for Schizochytrium sp., which contains glucose, yeast powder, dipotassium hydrogen phosphate, magnesium sulfate, potassium chloride, calcium chloride, sodium bicarbonate, trace salt stock solution, vitamin stock solution and sodium salt for providing sodium ions, and has a pH value between 6.5 and 7.5, wherein the sodium ion concentration is above 0.240 mol / L.

[0034] In a specific embodiment, the sodium salt used to provide sodium ions is selected from: Na2SO4, monosodium L-glutamate and NaCl.

[0035] In a specific embodiment, the culture medium contains: glucose 20-40 g / L; monosodium L-glutamate 15-25 g / L; yeast powder 0.1-0.5 g / L; dipotassium hydrogen phosphate 0.3-0.7 g / L; sodium sulfate 10-15 g / L, or sodium chloride that can provide the same amount of sodium ions; magnesium sulfate 1.0-1.5 g / L; potassium chloride 0.1-0.5 g / L; calcium chloride 0.03-0.07 g / L; sodium bicarbonate 0.05-0.20 g / L; trace salt stock solution 0.5-2 ml / L, including 3-9g / L disodium EDTA, 0.1-0.4g / L ferric chloride, 5-8g / L boric acid, 0.5-1.2g / L manganese chloride, 0.03-0.09g / L zinc chloride, 0.01-0.05g / L nickel sulfate, 0.001-0.003g / L copper sulfate and 0.002-0.008g / L sodium manganate; and 0.5-2ml / L vitamin stock solution, including 150-200mg / L VB, 0.3-0.8mg / L biotin and VB 12 0.3-0.8mg / L.

[0036] The present invention also provides a Schizochytrium culture medium, which contains: 5-20 g / L yeast powder, 10-30 g / L peptone, 10-30 g / L glucose, 30%-70% seawater, and pH 6.2-6.8.

[0037] The method of the present invention can use Agrobacterium to transform intact Schizochytrium cells, avoiding the protoplast preparation process in the disclosed electroporation transformation or Agrobacterium-mediated protoplast transformation method, and obtaining a higher transformation efficiency (about 10 5 More than 50 transformants can be obtained from each Schizochytrium cell, which is more than 10 transformants in the known protoplast transformation method. 5 The number of transformants per cell was 50 times higher than that of the transformants obtained from CN102220359A], and acetosyringone was not essential for the transformation of Schizochytrium. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The results of identifying recombinant Schizochytrium by PCR amplification of the GUS gene are shown. "S" is wild-type Schizochytrium; "Agrobacterium liquid" is the Agrobacterium liquid used for transformation; "Agrobacterium colony" is the Agrobacterium colony used for transformation; "Co-plating" is co-plating induction. The red box marks the positive PCR product, indicating that the sample contains the target gene.

[0039] Figure 2 The results of identifying the recombinant Schizochytrium by PCR amplification of the zeocin gene are shown. The negative control is the starting strain, and the box shows the positive PCR product, indicating that it contains the target gene.

[0040] Figure 3The results of PCR band sequencing of Schizochytrium colonies obtained by transformation with Agrobacterium tumefaciens ABH03 are shown (sequences obtained are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3).

[0041] Figure 4 The results of GUS staining are shown. 1-3 are the recombinant Schizochytrium obtained in Example 2 and the recombinant Schizochytrium obtained in Example 4 and the wild-type Schizochytrium. The wet weights of the samples used are equivalent. Specific implementation plan

[0042] The Schizochytrium transformed by the method of the present invention includes but is not limited to Schizochytrium sp. ATCC 20888, Schizochytrium S8 (ATCC 20889), Schizochytrium ATCC 28209, Schizochytrium SR21 (ATCC MYA-1381), Schizochytrium sp. NBRC102615, Schizochytrium sp. NBRC 102617, Schizochytrium sp. BAFCcult 3502, Schizochytrium sp. BAFCcult 3511, Schizochytrium sp. BL4, Schizochytriumsp. BR2.1.2, Schizochytrium sp. BUCAAA 032, Schizochytrium sp. BUCAAA093, Schizochytrium sp. BUCACD 152, Schizochytriumsp. BUCARA 021, Schizochytrium sp. BUCHAO 113, Schizochytrium sp. BURABQ 133, Schizochytrium sp. BURARM 801, Schizochytrium sp. BURARM 802, Schizochytriumsp. FJU-512, Schizochytrium sp. KH105, Schizochytriumsp. KR-5, Schizochytriumsp. KRT1, Schizochytrium sp. KRT2, Schizochytrium sp. PJ10.4, Schizochytriumsp. SBL1, Schizochytrium sp. SBL2, Schizochytrium sp. SBL3, Schizochytrium sp. SEK210, Schizochytriumsp. SEK 345, Schizochytrium sp. SEK 346, Schizochytriumsp. SKA10, Schizochytrium sp. SKA6, Schizochytrium sp. SR21, Schizochytriumsp. TIO01, etc.

[0043] Agrobacterium that can be used in the method of the present invention can be any Agrobacterium known in the art for gene transformation, including but not limited to Agrobacterium tumefaciens EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707, GV3101::pMP90, etc.

[0044] In the method of the present invention, Agrobacterium is used to transform intact Schizochytrium cells. "Intact Schizochytrium cells" means that the cell structure is intact, including the cell wall, cell membrane and other structures that Schizochytrium cells should have. More specifically, intact Schizochytrium cells are not Schizochytrium protoplasts, which are processed and do not contain cell walls.

[0045] In the present invention, Agrobacterium contains a target gene of interest. The target gene can be any deoxyribonucleic acid. The target gene can be exogenous to the Schizochytrium to be transformed, that is, the Schizochytrium itself does not exist; or it can be endogenous, that is, a nucleic acid that conforms to the genetic information of Schizochytrium itself. The target gene includes but is not limited to nucleic acids with biological activity, such as protein-coding genes, nucleic acids for regulating gene transcription, etc.; and nucleic acids without biological activity, such as nucleic acid fragments used for gene integration and knockout. In certain embodiments, the target gene encodes enzymes of interest and various functional proteins.

[0046] 1. Cultivation of logarithmic phase Schizochytrium

[0047] Conventional conditions, such as culture time, inoculation amount, temperature, etc., can be used to culture Schizochytrium to the logarithmic phase.

[0048] The culture medium for culturing Schizochytrium is preferably a culture medium containing a high concentration of sodium ions. In a preferred embodiment, the sodium ion concentration in the culture medium is 0.240 mol / L or more. In other embodiments, the sodium ion concentration in the culture medium is 0.240-1.000 mol / L, such as 0.240-0.800 mol / L, 0.240-0.700 mol / L, 0.240-0.550 mol / L, 0.240-0.450 mol / L, 0.240-0.425 mol / L, 0.240-0.420 mol / L. In other embodiments, the sodium ion concentration in the culture medium is 0.250-1.000 mol / L, for example, 0.250-0.800 mol / L, 0.300-0.800 mol / L, 0.350-0.700 mol / L, 0.250-0.425 mol / L, 0.250-0.420 mol / L.

[0049] There is no particular limitation on the source of sodium ions. For example, sodium ions can be provided by Na2SO4, NaCl, seawater, sea salt, or sodium salts (such as sodium salts of amino acids such as monosodium L-glutamate) as growth nutrients for Schizochytrium. For example, sodium salts such as Na2SO4, NaCl, etc., or mixtures thereof, can be added to the culture medium to provide sodium ions. In one embodiment, sodium ions are provided by adding seawater to the culture medium. In one embodiment, a mixture of monosodium L-glutamate and Na2SO4 is provided to provide 0.240 to 0.800 mol / L, preferably 0.240 to 0.550 mol / L, and more preferably 0.240 to 0.425 mol / L of sodium ions. In a specific embodiment, in the culture medium of Schizochytrium, Na2SO4 provides about 45-75% of the sodium ions, while monosodium L-glutamate provides about 25-55% of the sodium ions. In another specific embodiment, Na2SO4 provides about 55-75% of the sodium ions, while monosodium L-glutamate provides about 25-45% of the sodium ions. In one embodiment, NaCl provides about 55-75% of the sodium ions and monosodium L-glutamate provides about 25-45% of the sodium ions.

[0050] The Schizochytrium culture medium (hereinafter referred to as "FJS culture medium") used in the present invention contains glucose, monosodium L-glutamate, yeast powder, dipotassium hydrogen phosphate, sodium sulfate, magnesium sulfate, potassium chloride, calcium chloride, sodium bicarbonate, trace salt stock solution and vitamin stock solution, etc., with a pH of 6.5 to 7.5. In the culture medium, the sodium ion concentration is 0.240 mol / L or more.

[0051] Trace salt stocks for use in the various Schizochytrium culture media of the present invention may contain disodium EDTA, ferric chloride, boric acid, manganese chloride, zinc chloride, nickel sulfate, copper sulfate, sodium manganate, and the like.

[0052] The vitamin stock solution used in the various Schizochytrium culture media of the present invention may contain VB1, biotin and VB 12 wait.

[0053] In a specific embodiment, the FJS culture medium of the present invention contains: glucose 20-40 g / L; monosodium L-glutamate 15-25 g / L; yeast powder 0.1-0.5 g / L; dipotassium hydrogen phosphate 0.3-0.7 g / L; sodium sulfate 10-15 g / L; magnesium sulfate 1.0-1.5 g / L; potassium chloride 0.1-0.5 g / L; calcium chloride 0.03-0.07 g / L; sodium bicarbonate 0.05-0.20 g / L / L; trace salt stock solution 0.5-2ml / L (Disodium EDTA 3-9g / L; Ferric chloride 0.1-0.4g / L; Boric acid 5-8g / L; Manganese chloride 0.5-1.2g / L; Zinc chloride 0.03-0.09g / L; Nickel sulfate 0.01-0.05g / L; Copper sulfate 0.001-0.003g / L; Sodium manganate 0.002-0.008g / L); Vitamin stock solution 0.5-2ml / L (VB1 50-200mg / L; Biotin 0.3-0.8mg / L; VB 12 0.3-0.8mg / L).

[0054] In another specific embodiment, the FJS culture medium of Schizochytrium sphaeroides of the present invention contains: 30 g / L glucose; 21 g / L monosodium L-glutamate; 0.3 g / L yeast powder; 0.5 g / L dipotassium hydrogen phosphate; 12.6 g / L sodium sulfate; 1.2 g / L magnesium sulfate; 0.25 g / L potassium chloride; 0.05 g / L calcium chloride; 0.1 g / L sodium bicarbonate; 1 ml / L trace salt stock solution (6 g / L disodium EDTA; 0.2 g / L ferric chloride; 6.84 g / L boric acid; 0.86 g / L manganese chloride; 0.06 g / L zinc chloride; 0.026 g / L nickel sulfate; 0.002 g / L copper sulfate; 0.005 g / L sodium manganate); 1 ml / L vitamin stock solution (100 mg / L VB1; 0.5 mg / L biotin; VB 12 0.5mg / L); adjust the pH to 7.0 with potassium hydroxide.

[0055] Solid FJS medium can be prepared by adding an appropriate amount of agar powder (for example, adding about 1.8% agar powder).

[0056] If the FJS medium of the present invention is used as a selective medium, an appropriate amount of antibiotics and ceftriaxone sodium may be added to the FJS medium. For example, about 30-200 μg / ml of hygromycin and about 150-300 μg / ml of ceftriaxone sodium may be added.

[0057] In one embodiment, the FJS medium of the present invention contains about 8-30 g / L of sodium sulfate. In one embodiment, the Na2SO4 in the FJS medium is 22.7 g / L. In another embodiment, the Na2SO4 in the FJS medium is changed to 8.24 g / L, so that the total Na+ It is 0.24 mol / L.

[0058] Another example of a medium for culturing Schizochytrium is a medium containing the following ingredients (also referred to herein as "YPD medium"): 5-20 g / L yeast powder, 10-30 g / L peptone, 10-30 g / L glucose, 30%-70% seawater, pH 6.2-6.8. The amount of seawater is adjusted so that the sodium ion concentration meets the requirements of the present invention and reaches 0.240 mol / L or more.

[0059] In a specific embodiment, the YPD medium for Schizochytrium contains 10 g / L yeast powder, 20 g / L peptone, 20 g / L glucose, 50% seawater, and a pH of 6.2-6.8. + About 240mM.

[0060] In another embodiment, sodium chloride is used to replace sodium sulfate in FJS medium. For example, an appropriate amount of sodium chloride can be contained in FJS medium so that the sodium ion concentration meets the requirements of the present invention. In a specific embodiment, Na2SO4 in FJS medium is replaced with NaCl of equal sodium, which is 10.28 g / L.

[0061] In another embodiment, the inventors further increased Na + The results showed that Na + Concentrations of 300mM and 453mM both showed good efficiency.

[0062] Typically, the Schizochytrium is transferred from the glycerol tube to the Schizochytrium culture medium and cultured at 25-30°C and 100-300 rpm for several days (e.g., about 1-5 days) as a seed solution. The seed solution is then transferred to a fresh culture medium with Na + The concentration is preferably higher than 240 mM. The transfer volume is 5-10% (V / V) and the culture time is about 6-8 hours until the OD 600 1.0-1.5, preferably OD 600 1.0-1.2. As demonstrated in the examples of this application, when Schizochytrium OD 600 When the concentration of inducer acetosyringone is 1.0-1.2, high transformation efficiency can be achieved at a concentration ranging from 0 to 250 μM.

[0063] The Schizochytrium obtained by the culture can be used for transformation.

[0064] 2. Cultivate Agrobacterium in the logarithmic phase

[0065] Conventional conditions can be used to culture Agrobacterium to the logarithmic phase. The foreign gene can be transferred into Agrobacterium by a known method of quick freezing in liquid nitrogen followed by heat shock in a 37°C water bath.

[0066] In the present invention, Luria-Bertani medium can be used to culture Agrobacterium, and the medium contains: 3-7 g / L yeast extract; 5-15 g / L peptone; 5-15 g / L NaCl, and pH is about 7.0.

[0067] In a specific embodiment, the culture medium contains: 5 g / L yeast extract; 10 g / L peptone; 10 g / L NaCl, pH 7.0.

[0068] Usually, recombinant Agrobacterium can be inoculated from the glycerol tube into about 5 ml LB culture medium (containing 30-100 μg / ml kanamycin), cultured at 25-28°C, 100-300 rpm in a shaking incubator for about 18-32 hours, and 1-5% transferred to a new 50 ml culture medium, cultured at 25-28°C, 100-300 rpm for about 4-8 days until OD 600 About 0.3-1.5, preferably OD 600 0.3-0.6. The Agrobacterium obtained by such culture can be used to transform Schizochytrium.

[0069] 3. Mix and incubate logarithmic phase Schizochytrium and logarithmic phase Agrobacterium

[0070] Induction medium can be used to wash and resuspend the cells of Schizochytrium and Agrobacterium cultured to the logarithmic phase. Specifically, the logarithmic phase Agrobacterium can be washed with induction medium and then resuspended with induction medium. The volume after resuspension generally depends on the amount of bacterial liquid used for collection, which is generally about 1 / 20 of the original bacterial liquid volume. The logarithmic phase Schizochytrium can be washed with induction medium and then resuspended to 0.8-1.2×10 10 / ml (resuspend to 1.5-2.5ml). Usually, take equal volumes of the two suspensions and mix them. However, you can also take different volume ratios of the two suspensions and mix them.

[0071] The induction medium IM used in the present invention generally contains salt stock solution, glycerol, water, agar, MES (2-morpholineethanesulfonic acid) and glucose. IM may or may not contain acetosyringone. As demonstrated in the examples of this application, when OD 600 When the transformation is performed with Agrobacterium at a concentration of 0.3-0.6, a higher transformation rate can be obtained by using IM without acetosyringone. If the inducer acetosyringone is present, its concentration can be 200-400 μM.

[0072] In a specific embodiment, IM contains 50-100 ml of salt stock solution, 0.5-3 ml of glycerol, 50-150 ml of water, 1.0%-2.0% agar and 5-15 ml of 0.5-2 M MES, 2-10 ml of 200-700 mM glucose.

[0073] The salt stock solution used in various IMs of the present invention may contain potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium chloride, magnesium sulfate, calcium chloride, ferrous sulfate and ammonium sulfate. The content thereof may be, for example, 3-5 g / L of potassium dihydrogen phosphate, 3-7 g / L of dipotassium hydrogen phosphate, 0.1-0.5 g / L of sodium chloride, 0.8-1.8 g / L of magnesium sulfate, 0.1-0.3 g / L of calcium chloride, 0.0030-0.0090 g / L of ferrous sulfate and 0.8-1.8 g / L of ammonium sulfate.

[0074] In a specific embodiment, the salt stock solution used in various IMs of the present invention contains 3.625 g / L potassium dihydrogen phosphate; 5.125 g / L potassium hydrogen phosphate; 0.375 g / L sodium chloride; 1.25 g / L magnesium sulfate; 0.165 g / L calcium chloride; 0.0062 g / L ferrous sulfate; and 1.25 g / L ammonium sulfate.

[0075] When preparing the IM of the present invention, the salt stock solution, glycerol, water and agar can be mixed first, and then the MES solution and glucose solution sterilized by 0.22 μm filter membrane and optionally acetosyringone can be added after cooling by high pressure sterilization.

[0076] A specific IM for practicing the method of the present invention contains: 80 ml of salt stock solution (monopotassium phosphate 3.625 g / L; dipotassium phosphate 5.125 g / L; sodium chloride 0.375 g / L; magnesium sulfate 1.25 g / L; calcium chloride 0.165 g / L; ferrous sulfate 0.0062 g / L; ammonium sulfate 1.25 g / L), 1 ml of glycerol, 103 ml of water, 1.6% agar, after autoclaving and cooling, 8 ml of 1M MES, 4 ml of 500 mM glucose and 4 ml of 1.96 mg / ml acetosyringone are added.

[0077] The Schizochytrium suspension and the Agrobacterium suspension can be mixed in a conventional manner, and an appropriate amount of the mixed bacterial solution (e.g., 30-80 μl, such as 50 μl) can be applied to an induction culture plate containing an induction culture medium. The induction culture plate can be prepared by a conventional plate preparation method, and each plate can contain 15-20 ml of the induction culture medium. Then, the plate is cultured in an incubator at about 28° C. for 15-30 hours.

[0078] 4. Selection of induced Schizochytrium

[0079] After induction incubation, wash the bacterial lawn on the induction culture plate with physiological saline, resuspend it in sterile physiological saline to about 2 ml, take about 20 μl to coat FJS selection plate (containing 30-80 μg / ml Schizochytrium selection antibiotic (i.e., antibiotic marker carried by the recombinant Agrobacterium vector) and 100-300 μg / ml cefotaxime), and culture at 25-28°C for 2-3 days. Thus, Schizochytrium with exogenous genes transferred was harvested.

[0080] Various methods known in the art can be used to verify whether the exogenous gene has been transferred into Schizochytrium cells, including but not limited to resistance, PCR verification, nucleic acid hybridization, etc.

[0081] It should be understood that although the above-mentioned components and contents of the culture medium are described, those skilled in the art can make appropriate changes to the components and contents according to actual needs. The present invention will be described below in the form of specific embodiments. The reagents, reaction conditions, etc. used in the examples are, unless otherwise stated, conventional reagents and reaction conditions in the art.

[0082] Example 1: Preparation of recombinant Agrobacterium and Schizochytrium host cells

[0083] By designing primers (ZEOU:AAAACTCGAGATGGCCAAGTTGACCAGTGC; ZEOD:AAAACTCGAGTCAGTCCTGCTCCTCGGCCA, ie, SEQ ID NO:6 and 7 below), XhoI restriction sites were added to the upstream and downstream of the zeocin resistance gene, and the commercial vector pGAPZαA (purchased from Protin Biotechnology (Beijing) Co., Ltd.) was used as a template to amplify the zeocin gene and construct the PCR product into the pUCm-T vector (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.) for sequencing. The pUCm-T-zeo and pCAMBIA1301 (Cambia, catalog number CPC054) vectors were treated with XhoI restriction endonuclease to replace the hygromycin resistance gene in pCAMBIA1301 with the zeo gene. The constructed pCAMBIA1301zeo and pCAMBIA1301 vectors were transferred into Agrobacterium EHA105 (Prudin Biotechnology (Beijing) Co., Ltd.) by liquid nitrogen quick freezing and water bath heat shock:

[0084] 1. Prepare competent Agrobacterium according to the known method of treating with NaCl and CaCl2 solution (Li Minggang. Principles and Technology of Plant Gene Operation (First Edition). Tianjin: Tianjin Science and Technology Press, 2000: 180-181); 200 μl / tube, quick-freeze with liquid nitrogen and store in an ultra-low temperature refrigerator.

[0085] 2. Take competent cells, thaw on ice, add 3 μl of the above recombinant vector to each cell, mix well, and place on ice for 30 minutes.

[0086] 3. Immerse the centrifuge tube in liquid nitrogen for quick freezing for 1 minute, then immediately place it in a 37°C water bath for heat shock for 3 minutes. After an ice bath for 2 minutes, add 1 ml of YEP liquid culture medium and culture at 28°C and 180 rpm on a shaker for 3-4 hours.

[0087] 4. Spread the bacterial solution from step 3 onto a YEP plate containing 50 μg / ml rifampicin and 50 μg / ml kanamycin, and culture in a 28°C incubator for 48 hours to obtain recombinant Agrobacterium AB1301-9 containing the pCAMBIA1301 vector and recombinant Agrobacterium ABH03 containing the pCAMBIA1301zeo vector.

[0088] The Schizochytrium host cell was obtained by rescreening the ATCC20888 strain, and the rescreening steps were as follows:

[0089] 1. The original strain was diluted 10 times and plated. After culturing in a 28°C incubator for 5 days, the 36 largest colonies were picked out.

[0090] 2. The single clones obtained by single colony screening were inoculated into liquid fermentation medium for culture and transfer. The OD620 values ​​of seed liquid and final fermentation liquid were analyzed, and the growth was detected. The eight strains with the highest OD values ​​of two-generation culture liquid were selected. The dry weight of biomass was analyzed, and the strain with the largest dry weight data was selected.

[0091] 3. The obtained bacterial colonies with the largest dry biomass weight were graded diluted and spread on plates. The earliest grown colonies with larger diameter and rich oily feeling were inoculated into liquid culture medium for cultivation; the 9 bacterial strains with the largest biomass were selected;

[0092] 4. Analyze the biomass and lipid composition of the fermentation products of these 9 strains and obtain the strain with the best production performance.

[0093] Embodiment 2

[0094] The formula of FJS medium is as follows: glucose 30g / L; monosodium L-glutamate 21g / L; yeast powder 0.3g / L; dipotassium hydrogen phosphate 0.5g / L; sodium sulfate 12.6g / L; magnesium sulfate 1.2g / L; potassium chloride 0.25g / L; calcium chloride 0.05g / L; sodium bicarbonate 0.1g / L; trace salt stock solution 1ml / L (6g / L disodium EDTA; 0.2g / L ferric chloride; 6.84g / L boric acid; 0.86g / L manganese chloride; 0.06g / L zinc chloride; 0.026g / L nickel sulfate; 0.002g / L copper sulfate; 0.005g / L sodium manganate); vitamin stock solution 1ml / L (VB1100mg / L; biotin 0.5mg / L; VB 12 0.5mg / L); adjust the pH to 7.0 with potassium hydroxide.

[0095] The formula of IM medium is as follows: MES 7.8 g / L, glucose 2 g / L, ammonium sulfate 0.52 g / L, glycerol 0.5 g / L, calcium chloride 0.078 g / L, ferrous sulfate 0.0025 g / L, sodium chloride 0.15 g / L, magnesium sulfate 0.25 g / L, dipotassium hydrogen phosphate 2.28 g / L, potassium dihydrogen phosphate 1.36 g / L, pH 5.3.

[0096] 1. Inoculate 1.5 ml of Schizochytrium broth (ATCC 20888) into 50 ml of FJS culture medium (250 ml baffled flask), and culture at 28°C 200 rpm for 48 h as seed solution; then transfer 10% of the solution into a new 50 ml of FJS culture medium (250 ml baffled flask), and culture at 28°C 200 rpm for about 8 h until OD 600 About 1.5. Using a hemocytometer, the density of Schizochytrium thalli was about 600×10 6 Pieces / ml.

[0097] 2. Inoculate Agrobacterium AB1301-9 from the glycerol tube into 5 ml LB medium (add kanamycin to 50 μg / ml), and culture overnight at 28°C 200 rpm shaking; then inoculate 10% into 50 ml LB culture medium (250 ml Erlenmeyer flask, add kanamycin to 50 μg / ml), and culture at 28°C, 200 rpm shaking for 6 hours until OD 600 About 1.5.

[0098] 3. Collect Schizochytrium and Agrobacterium cells by centrifugation at 4000rpm, wash the cells with 10ml IM liquid, and resuspend each cell to 2.5ml in IM after centrifugation. Take 1ml of bacterial solution and mix well, take 50μl and spread it on the IM plate containing 250μM acetosyringone and 50μg / ml kanamycin, and culture in a 28℃ incubator for 20h. Use a glass applicator and 2ml of saline to scrape off the bacterial moss, aspirate the eluate and use saline to make up to about 2ml, take 20μl and spread it on the selection plate. The amount of coating on each plate is about 3×10 6 Schizochytrium cells.

[0099] 4. Select a plate and culture it in a 28℃ incubator for 2-3 days. The colonies on the plate are all Schizochytrium. Pick a single clone and use the corresponding primers of the GUS gene on pCAMBIA 1301 to perform colony PCR verification. The specific verification process is as follows:

[0100] Add 10 μl sterile water to a sterile PCR tube, use a sterile μl pipette tip to pick up a single colony, blow and flick it to make it a uniform bacterial solution, and use the bacterial solution to streak on a new selection plate for seeding. Heat the remaining bacterial solution in a 95°C water bath for 10 minutes, take it out of the ice bath and let it precipitate naturally for 5 minutes. Take 5 μl of the lysis supernatant as a template for PCR detection. The PCR detection target is the GUS gene on the pCAMBIA 1301 vector. The two primers are:

[0101] GUSU:ATGGTAGATCTGAGGGTAAATTTCTAGT (SEQ ID NO: 4);

[0102] GUSD: GAAACTTTATTGCCAAATGTTTGAA (SEQ ID NO: 5).

[0103] The PCR program was 95°C for 5 min; 10 cycles of touchdown PCR at 95°C for 50 s, 65°C (1°C lowering in each cycle) for 50 s, and 72°C for 90 s; 15 cycles at 95°C for 50 s, 53°C for 90 s; and 72°C for 10 min.

[0104] 5. Choose different co-incubation times: 17, 20, 49 hours; choose co-coating induction plate incubation; or static co-incubation in liquid IM; or shaking co-incubation in liquid IM.

[0105] As the incubation time increased from 17-49 h, the number of positive colonies on the plate decreased from about 6000 to about 500, indicating a transformation efficiency of 2000 / 10 6 The number of cells dropped to 200 / 10 6 Cells. Liquid static and liquid shaking co-incubation (about 3×10 cells of Schizochytrium were coated on each plate) 8 The number of positive colonies on the plates was about 2000 and 1500 respectively, which means the transformation efficiency was 6 / 10. 6 , 5 / 10 6 That is, the Schizochytrium spp. was cultured to OD 600 1.5, induction for 17 hours, the transformation efficiency can reach 2000 / 10 6 cells. Colony PCR showed ( Figure 1 ), positive rate 50%-100%, and transformation efficiency at least 1000 / 10 6 cells.

[0106] Example 3: Optimization experiment

[0107] The formula of FJS medium is as follows: glucose 30g / L; monosodium L-glutamate 21g / L; yeast powder 0.3g / L; dipotassium hydrogen phosphate 0.5g / L; sodium sulfate 12.6g / L; magnesium sulfate 1.2g / L; potassium chloride 0.25g / L; calcium chloride 0.05g / L; sodium bicarbonate 0.1g / L; trace salt stock solution 1ml / L (6g / L disodium EDTA; 0.2g / L ferric chloride; 6.84g / L boric acid; 0.86g / L manganese chloride; 0.06g / L zinc chloride; 0.026g / L nickel sulfate; 0.002g / L copper sulfate; 0.005g / L sodium manganate); vitamin stock solution 1ml / L (VB1100mg / L; biotin 0.5mg / L; VB 12 0.5mg / L); adjust the pH to 7.0 with potassium hydroxide.

[0108] Compared with FJS medium, GS and LS medium differ only in sodium sulfate content, while the other components are the same. + The concentration is 453mM, of which 328mM comes from sodium sulfate and 124mM comes from monosodium L-glutamate; the Na + The concentration is 240 mM, of which 116 mM comes from sodium sulfate and 124 mM comes from monosodium L-glutamate.

[0109] Compared with FJS medium, Cl - The culture medium had the same components except that NaCl was used instead of Na2SO4. - Na in the culture medium + The concentration is 300 mM, of which 176 mM comes from NaCl and 124 mM comes from monosodium L-glutamate.

[0110] 1. Inoculate 1.5 ml of Schizochytrium glycerol stock (ATCC 20888) into 50 ml FJS culture medium (250 ml baffled flask), and culture at 28°C, 200 rpm in a shaking incubator for 48 h as seed solution; then transfer 10% of the stock into a new 50 ml culture medium (250 ml baffled flask, using FJS (Na + Concentration 301mM, of which 177mM comes from sodium sulfate and 124mM comes from monosodium L-glutamate), GS (Na + Concentration 453mM, of which 328mM comes from sodium sulfate and 124mM comes from monosodium L-glutamate), LS (Na + Concentration 240mM, of which 116mM comes from sodium sulfate and 124mM comes from monosodium L-glutamate), Cl - (Na + The concentration is 300 mM, of which 176 mM comes from NaCl, 124 mM comes from monosodium L-glutamate) and YPD (Na+ Concentration 240mM, completely from seawater) Five kinds of culture medium, 28℃, 200rpm culture until OD 600 About 1.0-1.5. FJS, GS, and LS culture media have the same components except for the sodium sulfate content; Cl culture medium is FJS culture medium with NaCl replacing Na2SO4.

[0111] 2. Inoculate Agrobacterium AB1301-9 from the glycerol tube into 5 ml LB medium (add kanamycin to 50 μg / ml), and culture overnight at 28°C and 200 rpm. Then inoculate 1% into 50 ml LB culture medium (250 ml Erlenmeyer flask, add kanamycin to 50 μg / ml), and culture at 28°C and 200 rpm for about 6 hours until OD 600 About 0.3.

[0112] 3. Collect Schizochytrium and Agrobacterium cells by centrifugation at 4000rpm, wash the cells with 10ml IM liquid each; centrifuge again and resuspend in IM medium to 1.5-2.5ml. Take 1ml of bacterial solution each, mix well and take 50μl of the mixed bacterial solution to spread on IM plates containing 0-250μM acetosyringone and 50μg / ml kanamycin, and culture in a 28℃ incubator for 17-20h. Use a glass applicator and 2ml of saline to scrape off the bacterial moss, aspirate the eluate and make up to about 2ml, take 20μl and spread on the selection plate. It is estimated that the amount of coating on each plate is about 2-3×10 6 Schizochytrium cells.

[0113] 4. Select a plate and culture it in a 28°C incubator for 2-3 days. Microscopic examination of the colonies on the plate shows that they are all Schizochytrium. Randomly select a single clone and perform colony PCR verification using primers corresponding to the GUS gene on the pCAMBIA 1301 vector. The verification method is the same as in Example 2.

[0114] Use FJS medium to grow Schizochytrium cells to OD 600 1.0, the inducer acetosyringone concentration ranged from 0 to 250 μM, and a high transformation efficiency was obtained. The number of resistant colonies on the screening plate was about 8000 colonies / plate. The inducer concentrations did not lead to significant differences in transformation efficiency. 600At about 1.5, different inducer concentrations caused a large change in transformation efficiency. Under the induction of 0, 50, 100, 150, 200, and 150 μM acetosyringone, the number of resistant colonies on the screening plate was about 8000, 3600, 2240, 8000, 6400, and 2344, respectively. Obviously, the sensitivity of Schizochytrium after the increase of competent cell culture time is related to the concentration of the inducer, and the younger Schizochytrium has a high sensitivity under all concentrations of inducer. Compared with Example 2, reducing the Agrobacterium culture state to OD 600 0.3 is the key to transformation without the need for acetosyringone to induce Agrobacterium.

[0115] The Schizochytrium sp. was cultured in different media until OD 600 1.0, count, collect cells, wash and resuspend to a concentration of 10 as described above. 10 / ml, take 1ml and mix with 1ml of the above Agrobacterium suspension, co-culture and screen. The transformation efficiency of Schizochytrium from different pre-culture sources is different. GS (Na + 453mM)、FJS(Na + 301mM)、Cl - (Na + 300mM), YPD (Na + 240mM), LS (Na + 240mM) medium, the transformation efficiency of Schizochytrium was 6 The number of resistant colonies obtained was 1280, 1160, 1120, 185, and 120. + 453mM)、FJS(Na + 301mM) and Cl - (Na + The conversion efficiency of 300mM Na + The transformation efficiency of Schizochytrium obtained by pre-culturing with medium of ; and whether the source of sodium was Na2SO4 or NaCl was not important, because FJS and Cl obtained similar high transformation efficiencies, while YPD and LS obtained similar low transformation efficiencies.

[0116] Embodiment 4

[0117] Using the method of Example 2, Agrobacterium ABH03 was used to transform Schizochytrium obtained by culture in FJS medium, and the cells were screened on a selection plate containing 50 μg / ml zeocin. The transformation efficiency was about 10 6 700 resistant colonies were obtained from each cell. The template for colony PCR was prepared according to the method in Example 2, and PCR was performed using primers corresponding to the zeocin resistance gene. The primer sequences were:

[0118] ZEOU:AAAACTCGAGATGGCCAAGTTGACCAGTGC (SEQ ID NO:6);

[0119] ZEOD: AAAACTCGAGTCAGTCCTGCTCCTCGGCCA (SEQ ID NO:7).

[0120] The PCR program was 95℃ for 5min; 10 cycles of touchdown PCR at 95℃ for 50s, 62℃ (1℃ lowering per cycle) for 50s, and 72℃ for 90s; 15 cycles at 95℃ for 50s, 53℃ for 90s; and 72℃ for 10min. The colony PCR showed a positive rate of 100% ( Figure 2 ).

[0121] Randomly dig out three suspected bands from the gel and use ZEOU as the sequencing primer. The sequencing results of the three bands are all zeocin resistance genes ( Figure 3 ), because the 10-30 bases after the sequencing primer cannot usually be read accurately, Figure 3 The inconsistency between the sequences of the first part of the three samples tested and zeocin is understandable to practitioners in this field. Based on the transformation results, the transformation efficiency is estimated to be 7000 / 10 7 cells.

[0122] Comparative example: Control test

[0123] 1. CN102220359A does not specify the detailed parameters of the logarithmic phase. This experiment follows the OD value indicated on page 37 of US2010 / 0266564A1. 600 1.5-2.5, the actual culture time is OD 600 1.5, cell density is about 600×10 6 Pieces / ml;

[0124] 2. According to the method of CN102220359A, cellulase and snailase (purchased from Shanghai Biotechnology) were used to lyse the cells and collect the protoplasts.

[0125] 3. Cultivate Agrobacterium AB1301-9 according to the method of CN102220359A until OD 600 About 0.8, and then pre-induced in IM containing 250 μM acetosyringone for 4 h, mixed with Schizochytrium protoplasts, and induced in a water bath shaker at 28°C and 100 rpm for 16 h.

[0126] 4. Centrifuge and resuspend to 5 ml with IM, then apply 50 μl to the selection plate. The theoretical number of cells to be applied is 3×10 8 After 2-3 days of incubation at 28℃, there are about 600 colonies on the plate, so every 10 7About 20 positive clones can be obtained from each cell. Colony PCR was performed according to the method of Example 1. The results are shown in Figure 1 , the positive rate is 50%. Therefore, the efficiency of protoplast transformation of Schizochytrium ATCC20888 is 1 / 10 6 cells, which is much lower than the efficiency of the whole cell transformation method.

[0127] Embodiment 5

[0128] The inventors also used the methods of Examples 1 and 2 to transform intact Schizochytrium cells Schizochytrium sp. ATCC 20888 using Agrobacterium LBA4404 and AGL-1, and used Agrobacterium EHA105 and LBA4404 to transform Schizochytrium SR21, Schizochytrium sp. ATCC 20889, Schizochytrium sp. NBRC102615 and Schizochytrium sp. ATCC 28209, and detected the transformation efficiency, and used the corresponding protoplast transformation as a control.

[0129] The results showed that the transformation efficiency of intact Schizochytrium cells using the above Agrobacterium was as high as 300 cells / 10 6 cells, which is much higher than the efficiency of transformation using the corresponding protoplasts.

[0130] Although specific examples of the present invention have been described above, it is obvious to those skilled in the art that various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Therefore, the appended claims cover all such changes within the scope of the present invention. Sequence Listing <110> Wilmar (Shanghai) Biotechnology Research and Development Center Co., Ltd. <120> A method for genetic transformation of Schizochytrium mitogenome mediated by Agrobacterium <130> 124045 <160> 7 <170> PatentIn version 3.3 <210> 1 <211> 350 <212> DNA <213> 7-ZU <400> 1 tcgggtgcta cgcgcgcgac gtcgccggag cggtcgagtt ctggaccgac cggctcgggt 60 tctcccggga cttcgtggag gacgacttcg ccggtgtggt ccgggacgac gtgaccctgt 120 tcatcagcgc ggtccaggac caggtggtgc cggacaacac cctggcctgg gtgtgggtgc 180 gcggcctgga cgagctgtac gccgagtggt cggaggtcgt gtccacgaac ttccgggacg 240 cctccgggcc ggccatgacc gagatcggcg agcagccgtg ggggcgggag ttcgccctgc 300 gcgacccggc cggcaactgc gtgcacttcg tggccgagga gcaggactga 350 <210>2 <211>348 <212>DNA <213>51-ZU <400>2 cggtgctacg cgcgcgacgt cgccggagcg gtcgagttct ggaccgaccg gctcgggttc 60 tcccgggact tcgtggagga cgacttcgcc ggtgtggtcc gggacgacgt gaccctgttc 120 atcagcgcgg tccaggacca ggtggtgccg gacaacaccc tggcctgggt gtgggtgcgc 180 ggcctggacg agctgtacgc cgagtggtcg gaggtcgtgt ccacgaactt ccgggacgcc 240 tccgggccgg ccatgaccga gatcggcgag cagccgtggg ggcgggagtt cgccctgcgc 300 gacccggccg gcaactgcgt gcacttcgtg gccgaggagc aggactga 348 <210>3 <211>357 <212>DNA <213>63-ZU <400>3 cggaattccg gtgctcacgc gcgcgacgtc gccggagcgg tcgagttctg gaccgaccgg 60 ctcgggttct cccgggactt cgtggaggac gacttcgccg gtgtggtccg ggacgacgtg 420 accctgttca tcagcgcggt ccaggaccag gtggtgccgg acaacaccct ggcctgggtg 180 tgggtgcgcg gcctggacga gctgtacgcc gagtggtcgg aggtcgtgtc cacgaacttc 240 cgggacgcct ccgggccggc catgaccgag atcggcgagc agccgtgggg gcgggagttc 300 gccctgcgcg acccggccgg caactgcgtg cacttcgtgg ccgaggagca ggactga 357 <210>4 <211>28 <212>DNA <213>Artificial sequence <220> <223>Primer <400>4 atggtagatc tgagggtaaa tttctagt 28 <210>5 <211>25 <212>DNA <213>Artificial sequence <220> <223>Primer <400>5 gaaactttat tgccaaatgt ttgaa 25 <210>6 <211>30 <212>DNA <213> Artificial sequence <220> <223> Primers <400> 6 aaaactcgag atggccaagt tgaccagtgc 30 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 7 aaaactcgag tcagtcctgc tcctcggcca 30

Claims

1. A method for preparing transgenic Schizochytrium, characterized in that: The method comprises the steps of transforming complete logarithmic-phase Schizochytrium cells using a logarithmic-phase recombinant Agrobacterium containing a target gene, wherein the transformation comprises the steps of mixing the logarithmic-phase Schizochytrium cells and the logarithmic-phase Agrobacterium and applying the mixture to an induction plate for incubation and culture; wherein the Schizochytrium cells are cultured using a Schizochytrium culture medium having a sodium ion concentration of 0.240 mol / L or more to obtain the logarithmic-phase Schizochytrium cells; and the OD value of the logarithmic-phase Schizochytrium cell culture is 0. 600 The OD of the culture medium of Schizochytrium tumefaciens is 1.0-1.5; the culture medium of Schizochytrium tumefaciens contains: glucose, yeast powder, dipotassium hydrogen phosphate, magnesium sulfate, potassium chloride, calcium chloride, sodium bicarbonate, trace salt stock solution, vitamin stock solution and sodium salt for providing sodium ions, pH 6.5-7.5, or the culture medium of Schizochytrium tumefaciens contains: yeast powder 5-20 g / L, peptone 10-30 g / L, glucose 10-30 g / L, 30%-70% seawater, pH 6.2-6.8; wherein the OD of the Agrobacterium tumefaciens culture in the logarithmic phase is 600 The OD of the mixed co-coating induction plate incubation culture is 0.3-0.6, and the induction culture is carried out in an induction medium containing salt stock solution, glycerol, water, agar, 2-morpholineethanesulfonic acid, glucose and acetosyringone, wherein the induction medium contains 50-100 ml of salt stock solution, 0.5-3 ml of glycerol, 50-150 ml of water, 1.0%-2.0% agar, 5-15 ml of 0.5-2 M 2-morpholineethanesulfonic acid, 2-10 ml of 200-700 mM glucose and 200-400 μM acetosyringone, or the OD of the Agrobacterium culture in the logarithmic phase is 0. 600 is 0.3 and the induction medium does not contain acetosyringone; wherein the salt stock solution contains 3-5 g / L potassium dihydrogen phosphate, 3-7 g / L dipotassium hydrogen phosphate, 0.1-0.5 g / L sodium chloride, 0.8-1.8 g / L magnesium sulfate, 0.1-0.3 g / L calcium chloride, 0.0030-0.0090 g / L ferrous sulfate and 0.8-1.8 g / L ammonium sulfate.

2. The method according to claim 1, characterized in that The Schizochytrium sp. is selected from Schizochytrium sp. ATCC20888, Schizochytrium S8 ATCC 20889, Schizochytrium ATCC 28209, Schizochytrium SR21 ATCC MYA-1381, Schizochytrium sp. NBRC102615, Schizochytrium sp. NBRC102617, Schizochytrium sp. BAFCcult 3502, Schizochytrium sp. BAFCcult 3511, Schizochytrium sp. BL4, Schizochytrium sp. BR2.1.2, Schizochytrium sp. BUCAAA032, Schizochytrium sp. BUCAAA 093, Schizochytrium sp. BUCACD 152, Schizochytrium sp. BUCARA 021, Schizochytrium sp. BUCHAO 113, Schizochytrium sp. BURABQ 133, Schizochytrium sp. BURARM 801, Schizochytrium sp. BURARM 802, Schizochytrium sp. FJU-512, Schizochytrium sp. KH105, Schizochytrium sp. KR-5, Schizochytrium sp. KRT1, Schizochytrium sp. KRT2, Schizochytrium sp. PJ10.4, Schizochytrium sp. SBL1, Schizochytrium sp. SBL2, Schizochytrium sp. SBL3, Schizochytrium sp. SEK 210, Schizochytrium sp. SEK 345, Schizochytrium sp. SEK346, Schizochytrium sp. SKA10, Schizochytrium sp. SKA6, Schizochytrium sp. SR21 and Schizochytrium sp. TIO01.

3. The method according to claim 1 or 2, characterized in that The Agrobacterium is selected from Agrobacterium tumefaciens ( Agrobacterium tumefaciens ).

4. The method according to claim 3, characterized in that The Agrobacterium tumefaciens is selected from the group consisting of Agrobacterium tumefaciens EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707 and GV3101::pMP90.

5. The method according to claim 1, characterized in that The sodium ion concentration is 0.300-1 mol / L.

6. The method according to claim 1, characterized in that The sodium salt for providing sodium ions is selected from: Na2SO4, monosodium L-glutamate and NaCl; the trace salt stock solution contains disodium EDTA, ferric chloride, boric acid, manganese chloride, zinc chloride, nickel sulfate, copper sulfate and sodium manganate; the vitamin stock solution contains VB1, biotin and / or VB 12 .

7. The method according to claim 1, characterized in that The culture medium of Schizochytrium schizochytrium contains: 20-40 g / L of glucose; 15-25 g / L of monosodium L-glutamate; 0.1-0.5 g / L of yeast powder; 0.3-0.7 g / L of dipotassium hydrogen phosphate; 10-15 g / L of sodium sulfate, or sodium chloride that can provide the same amount of sodium ions; 1.0-1.5 g / L of magnesium sulfate; 0.1-0.5 g / L of potassium chloride; 0.03-0.07 g / L of calcium chloride; and 0.05-0.20 g / L of sodium bicarbonate. ; Trace salt stock solution 0.5-2ml / L, including 3-9g / L disodium EDTA, 0.1-0.4g / L ferric chloride, 5-8g / L boric acid, 0.5-1.2g / L manganese chloride, 0.03-0.09g / L zinc chloride, 0.01-0.05g / L nickel sulfate, 0.001-0.003g / L copper sulfate and 0.002-0.008g / L sodium manganate; and vitamin stock solution 0.5-2ml / L, including VB1 50-200mg / L, biotin 0.3-0.8mg / L and VB 12 0.3-0.8mg / L.

8. The method according to claim 1, characterized in that The Agrobacterium in the logarithmic phase is cultured in a culture medium containing 3-7 g / L yeast extract, 5-15 g / L peptone, and 5-15 g / L NaCl at pH 7.

0.

9. The method according to claim 1, characterized in that The mixed co-coating induction plate incubation culture comprises culturing a mixture of logarithmic-phase Schizochytrium cells and logarithmic-phase Agrobacterium in an incubator at 28° C. for 15-30 hours.

10. The method according to claim 1, characterized in that The method further comprises the step of selecting Schizochytrium cells into which the gene has been transferred in a Schizochytrium culture medium containing 30-80 μg / ml of an antibiotic marker carried by the recombinant Agrobacterium vector and 100-300 μg / ml of cefotaxime.

11. A method for transferring a target gene into Schizochytrium sp., characterized in that: The method comprises the steps of transforming complete logarithmic-phase Schizochytrium cells using a logarithmic-phase recombinant Agrobacterium containing the target gene, wherein the transformation comprises the steps of mixing the logarithmic-phase Schizochytrium cells and the logarithmic-phase Agrobacterium and applying them to an induction plate for incubation and culture; wherein the Schizochytrium cells are cultured using a Schizochytrium culture medium having a sodium ion concentration of 0.240 mol / L or more to obtain the logarithmic-phase Schizochytrium cells; and the OD value of the logarithmic-phase Schizochytrium cell culture is 600 The OD of the culture medium of Schizochytrium tumefaciens is 1.0-1.5; the culture medium of Schizochytrium tumefaciens contains: glucose, yeast powder, dipotassium hydrogen phosphate, magnesium sulfate, potassium chloride, calcium chloride, sodium bicarbonate, trace salt stock solution, vitamin stock solution and sodium salt for providing sodium ions, pH 6.5-7.5, or the culture medium of Schizochytrium tumefaciens contains: yeast powder 5-20 g / L, peptone 10-30 g / L, glucose 10-30 g / L, 30%-70% seawater, pH 6.2-6.8; wherein the OD of the Agrobacterium tumefaciens culture in the logarithmic phase is 600 The OD of the mixed co-coating induction plate is 0.3-0.6, and the mixed co-coating induction plate incubation culture is carried out in an induction medium containing salt stock solution, glycerol, water, agar, 2-morpholineethanesulfonic acid, glucose and acetosyringone, wherein the induction medium contains 50-100 ml of salt stock solution, 0.5-3 ml of glycerol, 50-150 ml of water, 1.0%-2.0% agar, 5-15 ml of 0.5-2 M 2-morpholineethanesulfonic acid, 2-10 ml of 200-700 mM glucose and 200-400 μM acetosyringone, or the OD of the Agrobacterium culture in the logarithmic phase is 0. 600 is 0.3 and the induction medium does not contain acetosyringone; wherein the salt stock solution contains 3-5 g / L potassium dihydrogen phosphate, 3-7 g / L dipotassium hydrogen phosphate, 0.1-0.5 g / L sodium chloride, 0.8-1.8 g / L magnesium sulfate, 0.1-0.3 g / L calcium chloride, 0.0030-0.0090 g / L ferrous sulfate and 0.8-1.8 g / L ammonium sulfate.

12. The method according to claim 11, characterized in that The Schizochytrium sp. is selected from Schizochytrium sp.ATCC 20888, Schizochytrium S8 ATCC 20889, Schizochytrium ATCC 28209, Schizochytrium SR21 ATCC MYA-1381, Schizochytrium sp. NBRC102615, Schizochytrium sp. NBRC 102617, Schizochytrium sp. BAFCcult 3502, Schizochytrium sp. BAFCcult 3511, Schizochytrium sp. BL4, Schizochytrium sp.BR2.1.2, Schizochytrium sp. BUCAAA 032, Schizochytrium sp. BUCAAA 093, Schizochytrium sp. BUCACD 152, Schizochytrium sp. BUCARA 021, Schizochytrium sp. BUCHAO 113, Schizochytrium sp. BURABQ 133, Schizochytrium sp. BURARM 801, Schizochytrium sp. BURARM 802, Schizochytrium sp. FJU-512, Schizochytrium sp.KH105, Schizochytrium sp. KR-5, Schizochytrium sp. KRT1, Schizochytrium sp.KRT2, Schizochytrium sp. PJ10.4, Schizochytrium sp. SBL1, Schizochytrium sp.SBL2, Schizochytrium sp. SBL3, Schizochytrium sp. SEK 210, Schizochytrium sp.SEK 345, Schizochytrium sp. SEK 346, Schizochytrium sp. SKA10, Schizochytrium sp. SKA6, Schizochytrium sp. SR21 and Schizochytrium sp. TIO01.

13. The method according to claim 11 or 12, characterized in that The Agrobacterium is selected from Agrobacterium tumefaciens ( Agrobacterium tumefaciens ).

14. The method according to claim 13, characterized in that The Agrobacterium tumefaciens is selected from the group consisting of Agrobacterium tumefaciens EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707 and GV3101::pMP90.

15. The method according to claim 11, characterized in that The sodium ion concentration is 0.300-1 mol / L.

16. The method according to claim 11, characterized in that The sodium salt for providing sodium ions is selected from: Na2SO4, monosodium L-glutamate and NaCl; the trace salt stock solution contains disodium EDTA, ferric chloride, boric acid, manganese chloride, zinc chloride, nickel sulfate, copper sulfate and sodium manganate; the vitamin stock solution contains VB1, biotin and / or VB 12 .

17. The method according to claim 11, characterized in that The culture medium of Schizochytrium schizochytrium contains: 20-40 g / L of glucose; 15-25 g / L of monosodium L-glutamate; 0.1-0.5 g / L of yeast powder; 0.3-0.7 g / L of dipotassium hydrogen phosphate; 10-15 g / L of sodium sulfate, or sodium chloride that can provide the same amount of sodium ions; 1.0-1.5 g / L of magnesium sulfate; 0.1-0.5 g / L of potassium chloride; 0.03-0.07 g / L of calcium chloride; and 0.05-0.20 g / L of sodium bicarbonate. ; Trace salt stock solution 0.5-2ml / L, including 3-9g / L disodium EDTA, 0.1-0.4g / L ferric chloride, 5-8g / L boric acid, 0.5-1.2g / L manganese chloride, 0.03-0.09g / L zinc chloride, 0.01-0.05g / L nickel sulfate, 0.001-0.003g / L copper sulfate and 0.002-0.008g / L sodium manganate; and vitamin stock solution 0.5-2ml / L, including VB1 50-200mg / L, biotin 0.3-0.8mg / L and VB 12 0.3-0.8mg / L.

18. The method according to claim 11, characterized in that The Agrobacterium in the logarithmic phase is cultured in a medium containing 3-7 g / L yeast extract, 5-15 g / L peptone, 5-15 g / L NaCl, and pH 7.

0.

19. The method according to claim 11, characterized in that The mixed co-coating induction plate incubation culture comprises culturing a mixture of logarithmic-phase Schizochytrium cells and logarithmic-phase Agrobacterium in a 28° C. incubator for 15-30 hours.

20. The method of claim 11, wherein: The method further comprises the step of selecting Schizochytrium cells into which the gene has been transferred in a Schizochytrium culture medium containing 30-80 μg / ml of an antibiotic marker carried by the recombinant Agrobacterium vector and 100-300 μg / ml of cefotaxime.

Images