Genetically engineered Escherichia coli strain with high butanol productivity, construction method thereof and application
Recombinant E. coli is constructed through genome editing technology, which inhibits unnecessary genes and enhances gene expression of butanol synthesis pathway, solves the problems of unstable genetic operation and insufficient yield in the existing technology, and achieves high yield and high yield butanol production, which is suitable for industrial applications.
Patent Information
- Application Number
- CN201610204922.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2016-04-05
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2036-04-05
AI Technical Summary
The existing butanol production strains are unstable in genetic operation, require inducers, and the yield and yield are not sufficient to meet the needs of industrial production.
Through genome site-directed editing or homologous recombination technology, recombinant E. coli is constructed to inhibit unnecessary gene expression, enhance the expression of genes in the butanol synthesis pathway, and form industrial strains with high butanol yield.
It realizes genetic operations at the chromosomal level, maintains genetic stability, improves the yield and yield of butanol, reduces the cost of separation and raw materials, and is suitable for large-scale industrial production.
Smart Images

Figure BDA0000957674120000071 
Figure BDA0000957674120000081 
Figure BDA0000957674120000111
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a genetically engineered Escherichia coli strain with high butanol productivity, and a method for constructing the same and applications thereof. Background Art
[0002] Energy and environment are the focus of attention in today's society. With the gradual depletion of fossil energy and the pollution of the natural environment, the demand for renewable energy by humans is becoming increasingly strong. Using microorganisms to convert or ferment renewable resources to efficiently produce renewable energy is the future trend of energy development. This method of producing chemicals through biological processes is sustainable and environmentally friendly.
[0003] Butanol is an important chemical product and raw material. It can be directly used as an organic solvent and is a precursor for synthesizing various ester compounds, and is widely used in various plastic and rubber products. At the same time, butanol is also an excellent biofuel that can replace gasoline. It has a calorific value and octane number comparable to gasoline, can be mixed with gasoline in any proportion; during transportation, it is not easy to corrode pipelines; compared with ethanol, it has a lower vapor pressure and higher safety, so it is a new biofuel with great potential. Currently, the annual market demand for butanol is approximately in the millions of tons range.
[0004] The biosynthesis of butanol was first discovered by Pasteur in 1861. In 1912, Weizmann discovered that a Clostridium acetobutylicum could convert starch into acetone, butanol and ethanol. After that, many studies focused on modifying Clostridium acetobutylicum in order to obtain engineering strains for industrial production of butanol. However, Clostridium acetobutylicum is a strictly anaerobic Gram-positive bacterium with a complex genetic operating system, which is not conducive to laboratory research and industrial production. In 2008, Shota Atsumi, James C. Liao et al. first achieved the synthesis of butanol in Escherichia coli (Atsumi S, Cann A F, Connor M R, et al. Metabolic engineering of Escherichia coli for 1-butanol production. Metabolic engineering, 2008, 10(6):305-311.). This research group transferred the butanol synthesis pathway in Clostridium acetobutylicum into Escherichia coli, enabling it to produce a small amount of butanol. Subsequently, the whole pathway was optimized. The butyryl-CoA dehydrogenase complex (Bcd-EtfAB complex) that uses NADH as the reducing power and catalyzes the reversible reaction of crotonyl-CoA to butyryl-CoA was replaced with the trans-enoyl-CoA reductase (Ter) from Treponema denticola that catalyzes an irreversible reaction; the enzyme that catalyzes acetyl-CoA to acetoacetyl-CoA was changed from acetoacetyl-CoA thiolase (Thl) to the more active acetyl-CoA acetyltransferase (AtoB) in Escherichia coli, thus forming the driving forces of NADH and acetyl-CoA, and the butanol production increased significantly.
[0005] Current butanol-producing strains are all based on plasmid-expressed genes and use inducible promoters, so they are not suitable for large-scale industrial production. Industrial strains suitable for large-scale butanol production require all gene operations to be carried out at the chromosomal level to maintain genetic stability, do not require inducers, and have high yields and productivities to reduce separation costs and raw material costs. Such strains have not been reported yet. Summary of the Invention
[0006] An object of the present invention is to provide a method for constructing a recombinant bacterium.
[0007] The recombinant bacterium provided by the present invention comprises the following steps:
[0008] 1) Inhibit the expression and / or activity of the pykA gene on the genome of the starting bacterium for producing butanol, and increase the expression and / or activity of the fdh gene on the genome of the starting bacterium to obtain the target bacterium A;
[0009] 2) Domesticate the target bacterium A in the M9 medium with insufficient nitrogen source to obtain the target bacterium B;
[0010] 3) Inhibit the expression and / or activity of the yieP, stpA, yqeG, and yagM genes on the genome of the target bacterium B, and increase the expression and / or activity of the ter gene and the crt gene in the target bacterium B to obtain the recombinant bacterium.
[0011] In the above method, the inhibition of the expression and / or activity of the pykA gene on the genome of the starting bacterium for producing butanol is to knockout the pykA gene on the genome of the starting bacterium;
[0012] The increase in the expression and / or activity of the fdh gene on the genome of the starting bacterium is to increase the copy number of the fdh gene in the genome of the starting bacterium;
[0013] The inhibition of the expression and / or activity of the yieP, stpA, yqeG, and yagM genes on the genome of the target bacterium B is to knockout all or partial fragments of the yieP, stpA, yqeG, and yagM genes on the genome of the starting bacterium;
[0014] The increase in the expression and / or activity of the ter gene and the crt gene in the target bacterium B is to increase the copy number of the ter gene and the crt gene in the target bacterium B.
[0015] In the above method, the increase in the copy number of the fdh gene in the genome of the starting bacterium is to integrate the fdh gene and its promoter onto the genome of the starting bacterium;
[0016] The increase in the copy number of the ter gene and the crt gene in the target bacterium B is to integrate the ter gene and its RBS and the crt gene and its RBS onto the genome of the target bacterium B.
[0017] In the above method, both the knockout and integration are carried out by genome site-directed editing or homologous recombination;
[0018] The genome site-directed editing is specifically ZFN editing, TALEN editing, or CRISPR / Cas9 editing;
[0019] The homologous recombination is specifically λ-red homologous recombination or homologous recombination mediated by sacB gene screening or homologous recombination mediated by integration plasmid.
[0020] In the above method, knocking out the pykA gene on the genome of the starting bacterium means replacing the pykA gene on the genome of the starting bacterium with FRT using the λ-red homologous recombination system;
[0021] The FRT is the 59th to 106th positions of Sequence 14;
[0022] Integrating the fdh gene and its promoter into the genome of the target bacterium A means replacing the maeB gene on the genome of the starting bacterium with Fragment 1 containing fdh and its promoter using an integration plasmid, and replacing the FRT at the mdh gene locus on the genome of the starting bacterium with Fragment 2 containing fdh and its promoter;
[0023] The FRT at the mdh gene locus means replacing the mdh gene in the initial bacterium with FRT when preparing the starting bacterium.
[0024] The nucleotide sequence of Fragment 1 containing fdh and its promoter is specifically the 941st to 2535th nucleotides of Sequence 23;
[0025] The nucleotide sequence of Fragment 2 containing fdh and its promoter is specifically the 931st to 2525th nucleotides of Sequence 24;
[0026] Knocking out partial fragments of the yieP, stpA, yqeG, and yagM genes on the genome of the starting bacterium means using the CRISPR / Cas system to knock out the 70th to 619th nucleotides of the yieP gene sequence, the 74th to 373rd nucleotides of the stpA gene sequence, the 1st to 695th nucleotides of the yqeG gene sequence, and the 121st to 855th nucleotides of the yagM gene sequence respectively;
[0027] When using the CRISPR / Cas system to knock out the yieP, stpA, yqeG, and yagM genes, the target genes are the yieP, stpA, yqeG, and yagM genes respectively;
[0028] When using the CRISPR / Cas system to knock out the yieP, stpA, yqeG, and yagM genes, the nucleotide sequences of the sgRNAs are Sequence 33, Sequence 34, Sequence 35, and Sequence 27 respectively;
[0029] Integrating the ter gene and its RBS into the genome of the target bacterium B means using the CRISPR / Cas system to replace the yciA gene on the genome of the target bacterium B with a fragment containing the ter gene and its RBS;
[0030] The nucleotide sequence of the fragment containing the ter gene and its RBS is Sequence 25;
[0031] The target gene for knocking out the yciA gene using the CRISPR / Cas system is the yciA gene;
[0032] The nucleotide sequence of the sgRNA for knocking out the yciA gene using the CRISPR / Cas system is sequence 28;
[0033] The integration of the crt gene and its RBS into the genome of the target bacterium B is to replace the poxB gene on the genome of the target bacterium B with the fragment containing the crt gene and its RBS using the CRISPR / Cas system;
[0034] The nucleotide sequence of the fragment containing the crt gene and its RBS is sequence 26;
[0035] The target gene for knocking out the poxB gene using the CRISPR / Cas system is the poxB gene;
[0036] The nucleotide sequence of the sgRNA for knocking out the poxB gene using the CRISPR / Cas system is sequence 29.
[0037] In the above method,
[0038] In step 2), the domestication of the target bacteria A in the M9 medium with insufficient nitrogen source comprises the following steps:
[0039] 2)-1, transferring and acclimating the target bacteria A in M9 medium with glucose as the carbon source to obtain a strain with a butanol production greater than 6 g / L; wherein the number of transfer and acclimation is 52 times, and the culturing time for each transfer and acclimation is 1 day;
[0040] 2)-2, transferring and acclimating the strain with a butanol yield greater than 6 g / L obtained in 2)-1 to a modified M9 medium with gluconic acid as a carbon source until a strain with a constant butanol yield is obtained; wherein the number of transfer and acclimation is 49 times, and each transfer and acclimation culture is 1 day;
[0041] 2)-3, the strain with constant butanol yield obtained in 2)-2 was transferred and domesticated in the M9 medium with glucose as the carbon source until a strain with constant butanol yield was obtained; it was named as the target strain B. The number of transfer and domestication was 14 times, and each transfer and domestication was cultured for 1 day.
[0042] In the above method,
[0043] The starting bacterium for producing butanol is Escherichia coli for producing butanol, and the Escherichia coli for producing butanol is a bacterium obtained by transferring the butanol synthesis pathway in Clostridium acetobutylicum into the initial Escherichia coli; specifically, the Escherichia coli for producing butanol is obtained by integrating atoB, hbd, crt, adhE2, ter, and fdh into the genome of the initial Escherichia coli, and the hyc-hyp gene in the initial Escherichia coli is replaced by FRT, the fdhF gene is replaced by fdh, and the mdh gene is replaced by FRT. Particularly specifically, the Escherichia coli for producing butanol is EB216 CGMCC No. 11590.
[0044] The initial Escherichia coli is specifically Escherichia coli BW25113.
[0045] The recombinant bacterium prepared by the above method is also within the scope of protection of the present invention.
[0046] The preservation number of the above recombinant bacterium EB243 is CGMCC No. 12191.
[0047] The EB243 bacterium was deposited on March 9, 2016 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviation: CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101), with the preservation number of CGMCC No. 12191, and the taxonomic name is Escherichia coli.
[0048] The application of the above method or the above recombinant bacterium in producing butanol or increasing the butanol yield is also within the scope of protection of the present invention.
[0049] Another object of the present invention is to provide a method for producing butanol.
[0050] The method provided by the present invention includes the following steps: fermenting the above recombinant bacterium to obtain butanol.
[0051] The nucleotide sequence of the pykA gene is as shown in Sequence 12 in the sequence listing;
[0052] The nucleotide sequence of the maeB gene is as shown in Sequence 30 in the sequence listing;
[0053] The nucleotide sequence of the mdh gene is as shown in Sequence 11 in the sequence listing;
[0054] The nucleotide sequence of the yieP gene is as shown in Sequence 17 in the sequence listing;
[0055] The nucleotide sequence of the stpA gene is as shown in Sequence 18 in the sequence listing;
[0056] The nucleotide sequence of the yqeG gene is as shown in Sequence 15 in the sequence listing;
[0057] The nucleotide sequence of the yagM gene is as shown in Sequence 16 in the Sequence Listing;
[0058] The nucleotide sequence of the yciA gene is as shown in Sequence 31 in the Sequence Listing;
[0059] The nucleotide sequence of the poxB gene is as shown in Sequence 32 in the Sequence Listing.
[0060] The experiments of the present invention have proved that after constructing the butanol synthesis pathway in Escherichia coli, knocking out the related by-product genes and strengthening the expression of the butanol pathway genes can greatly improve the butanol yield. The butanol yield of the butanol-producing strain obtained by screening with the Tn5 transposon and knocking out or inhibiting the screened genes and domestication is further improved. After optimizing the RBS of the key enzyme genes among them, the final engineered strain can produce butanol with high yield and high yield rate, and is the best-performing strain reported at present. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] Figure 1 Butanol production pathway in Escherichia coli for producing butanol.
[0062] Figure 2 Electrophoresis diagram of gene replacement in EB204.
[0063] Figure 3 Schematic diagram of the result of high performance liquid chromatography analysis of the fermentation broth.
[0064] Figure 4 Comparison diagram of butanol yield and yield rate of strain EB228 and the domesticated strain.
[0065] Figure 5 Comparison diagram of butanol yield of strain EB232 and Tn5 transposon mutant strains.
[0066] Figure 6 Comparison diagram of butanol yield and yield rate of strain EB234 and its mutant strains.
[0067] Figure 7 Comparison diagram of butanol yield of strains EB238, EB242, and EB243.
[0068] Figure 8 Fermentation process diagram of strain EB243. DETAILED DESCRIPTION OF THE INVENTION
[0069] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.
[0070] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.
[0071] The formula of the M9 medium with glucose as the carbon source is as follows: 17.1 g / l Na2HPO4·12H2O, 3.0 g / l KH2PO4, 0.5 g / l NaCl, 1.0 g / l NH4Cl, 0.5 mg / l vitamin B1, 22 g / l C6H 12 O6·H2O, 2 mM MgSO4·7H2O, 0.1 mM CaCl2 and water.
[0072] The modified M9 medium with gluconic acid as the carbon source is a medium obtained by replacing glucose in the M9 medium with glucose as the carbon source with gluconic acid.
[0073] The formula of the following TB medium is: 12 g / l tryptone, 24 g / l yeast extract, 4 ml / l glycerol, 2.31 g / l KH2PO4, 12.54 g / l K2HPO4, 22 g / l C6H 12 O6·H2O and water.
[0074] Example 1. Construction of the butanol-producing starting strain EB216
[0075] Escherichia coli EB216 is a bacterium obtained by integrating atoB, hbd, crt, adhE2, ter, and fdh into the genome of the initial Escherichia coli BW25113, and the hyc-hyp gene in the initial Escherichia coli is replaced with FRT, the fdhF gene is replaced with fdh, and the mdh gene is replaced with FRT. EB216 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviation: CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postcode 100101) on November 5, 2015, and the deposit number is CGMCC No. 11590, and the taxonomic name is Escherichia coli.
[0076] The specific construction method is as follows:
[0077] The following examples use the homologous recombination system mediated by the sacB gene for gene replacement or insertion on the chromosome; pSM2-P cpc560ter is described in the following literature: Zhou, Jie, et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific reports 4 (2014); pITF is described in the following literature: Dong, Hongjun, et al. Engineering Clostridium strain to accept unmethylated DNA. PLoS One 5.2 (2010): e9038;
[0078] The nucleotide sequence of the atoB gene is shown as Sequence 1 in the sequence listing;
[0079] The nucleotide sequence of the hbd gene is shown as Sequence 2 in the sequence listing;
[0080] The nucleotide sequence of the crt gene is shown as Sequence 3 in the sequence listing;
[0081] The nucleotide sequence of the adhE2 gene is shown as Sequence 4 in the sequence listing;
[0082] The nucleotide sequence of the ter gene is shown as Sequence 5 in the sequence listing;
[0083] The nucleotide sequence of the fdh gene is shown as Sequence 6 in the sequence listing.
[0084] I. Basic butanol-producing strains EB204 and EB205
[0085] A. Construction process of basic butanol-producing strains EB204 and EB205
[0086] 1. Preparation of competent cells of Escherichia coli BW25113
[0087] BW25113 competent cells: 200 ml of BW25113 bacterial solution cultured to the mid-logarithmic growth phase in a triangular flask, ice-bathed for 30 min. Centrifuged at 4°C and 3000 g for 5 min. Discard the supernatant, resuspend the cells with pre-cooled sterile 10% glycerol, and wash twice. Finally, add 1 ml of pre-cooled 10% glycerol to resuspend the cells, and aliquot 50 μl into each pre-cooled 1.5 ml sterile centrifuge tube for standby to obtain BW25113 competent cells.
[0088] 2. Transfer the butanol pathway to BW25113 to construct basic butanol-producing strains
[0089] Using the Escherichia coli BW25113 genome as a template, the butanol synthesis pathway gene atoB was amplified with primers 234-(yqhD::atoB)-3 (ATCGGGATCCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGACGGCACC) / 235-(yqhD::atoB) (GCTCGTATAATGTGTGGAATTGACGGCACCCCTACAAACAGAAGGAATATAAAATGAAA) / 236-(yqhD::atoB)-4 (ATCGTCTAGATTAATTCAACCGTTCAATCACCATCGCAAT).
[0090] Using the Clostridium acetobutylicum DSM1731 (purchased from Leibniz Institute DSMZ - German Collection of Microorganisms and Cell Cultures) genome as a template, primers 917 - miniPtac - hbd - 1
[0091] (ATCGCATATGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGAATTTAGGGAGGTCTGTTTAATGAAAAAGG) / 918 - miniPtac - hbd - 2 (ATCGTCTAGATTATTTTGAATAATCGTAGAAACCTTTTC), 940-(ackA - pta)::crt - 3a
[0092] (ATCGCATATGTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGATTTTAG) / 941-(ackA - pta)::crt - 3b
[0093] (GCTCGTATAATGTGTGGAATTGATTTTAGGAGGATTAGTCATGGAACTAAACAATGTC) / 942-(ackA - pta)::crt - 4 (ATCGTCTAGACTATCTATTTTTGAAGCCTTCAATTTTTCTTTTCTC), 225-(frdBC::adhE2)-3a
[0094] (ATCGTCTAGATGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTTATAAAG) / 226-(frdBC::adhE2)-3b
[0095] (CTCGTATAATGTGTGGAATTGTTATAAAGGAGTGTATATAAATGAAAGTTACAAATCA) / 227-(frdBC::adhE2)-4(ATCGGTCGACTTAAAATGATTTTATATAGATATCCTTAAG) was used to amplify the butanol synthesis pathway genes hbd, crt, and adhE2 respectively;
[0096] Using the plasmid pSM2-P containing the ter gene cpc560 ter as a template, primers 216-(adhE::ter)-3a(ATCGCATATGTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGGAGGTA) / 217-(adhE::ter)3b(TCGTATAATGTGTGGAATTGTGGAGGTATGATATGATTGTGAAACCCATGGTGCGCAAC) / 218-(adhE::ter)-4(ATCGTCTAGATTAAATGCGATCAAAGCGTTCCACTTCGGCTTC) were used to amplify the butanol synthesis pathway gene ter;
[0097] Using the plasmid pITF containing the fdh gene as a template, primers 975-fdh-1(ATCGGGTACCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTAAGAAGG) and 976-fdh-2(ATGTGTGGAATTGTAAGAAGGAGATATACCATGAAGATCGTTTTAGTCTTATATGGTGC) were used to amplify the butanol synthesis pathway gene fdh.
[0098] Then, using the Escherichia coli BW25113 genome as a template, the upstream and downstream fragments of the gene yqhD were amplified with primers 232-(yqhD::atoB)-1 (ATCGCTCGAGGGCCTTCATGCCGTCATGGATGATCATCATC) / 233-(yqhD::atoB)-2 (ATCGGGATCCCAGCGATTGCGCCTTTACCAAACAGAATGCG) and 237-(yqhD::atoB)-5 (ATCGTCTAGAGAGCACGGCATGACCCAACTGGGCGAAAATC) / 238-(yqhD::atoB)-6 (ATCGCTGCAGACCGGGAGAATTTGCATGTTAGCCGCCGAAC), respectively; the upstream and downstream fragments of the gene ldhA were amplified with primers 910-ldhA-1 (ATCGCTCGAGGACCATCGCTTACGGTCAATTGTTGACGAG) / 916-ldhA-2 (ATCGCATATGGTGATGTTGAATCACATTTAAGCTAC) and 919-ldhA-3 (ATCGTCTAGACTGGAAAAAGGCGAAACCTGCCCGAACG) / 915-ldhA-4 (ATCGCTGCAGTTTAGCAAATGGCTTTCTTCTGCATTTTCG), respectively; the upstream and downstream fragments of the gene ackA-pta were amplified with primers 938-(ackA-pta)::crt-1 (ATCGCTCGAGTCCATTGTTGACTCCTGTATCACTCTACTACG) / 939-(ackA-pta)::crt-2 (ATCGCATATGCAGTGAAGAACTACCGCAGTTCAGAACC) and 943-(ackA-pta)::crt-5 (ATCGTCTAGACCCGTGGCGCACTGGTTGACGATATCGTC) / 944-(ackA-pta)::crt-6 (ATCGCTGCAGAATCAGAGTGGCGATAACCCACACCACGATGC), respectively;The upstream and downstream fragments of the gene frdBC were amplified using primers 223-(frdBC::adhE2)-1(ATCGGGATCCCCGAAAAACAAATATATGGAACTGGGTC) / 224-(frdBC::adhE2)-2(ATCGTCTAGAGGTATCGACTTCCGGGTTATAGCGCACCAC) and 228-(frdBC::adhE2)-5(ATCGGTCGACCCAGAGCCAATTATCAAAAGTCTCTGGGCGG) / 229-(frdBC::adhE2)-6(ATCGAAGCTTAAACCGATACTGGAGTTGGCATACAGACGTTG), respectively; the upstream and downstream fragments of the gene adhE were amplified using primers 214-(adhE::ter)-1(ATCGCTCGAGCAACAACATAAAGCGAACAATGCAATAGCCAC) / 215-(adhE::ter)-2(ATCGCATATGCTGGGCTTTTTTTACACGCTCTACGAGTGC) and 219-(adhE::ter)-5(ATCGTCTAGAGATTATGTAGAAGGTGAAACTGCAGCGAAGA) / 220-(adhE::ter)-6(ATCGGTCGACGATGGTCGGGGGCGTTTTGTTATGAACACC), respectively; the upstream and downstream fragments of the gene eutE were amplified using primers 957-eutE::fdh-1(ATCGGAATTCCCGGAAATATTGGTTACAAAATCGCACAAC) / 958-eutE::fdh-2(ATCGGGTACCGATGTTCTGCCTTATTTGTGGAAAATTACC) and 977-eutE-arm2-1(ATCGGAGCTCCTGTGTATTAGTCGATGCGTTTCGCATTG) / 978-eutE-arm2-2(ATCGTCTAGACCGTTGCAGATTCAGGGTATCGAACGCCTG), respectively.;
[0099] Using pKD46 (GenBank: AY048746.1) as a template, a fragment of approximately 1.7 kb was amplified by PCR with primers 890-Ts-1 (CAAAGAGCTCAGGGGCTGTATGCACAAAGCATCTTCTGTTG) and 891-Ts-2 (ATCGGGATCCCATATGGAATTCCTCGAGCCCTTAACGTGAGTTTTCGTTCCACTGAGC). The plasmid pK18mobsacB (GenBank: FJ437239.1) was digested with SacI and BamHI, and a 4-kb fragment was recovered using the Omega Gel Extraction Kit. This fragment was ligated to the above-mentioned 1.7-kb fragment that had also been digested with SacI and BamHI, and the resulting new plasmid was named pKmTsSacB.
[0100] The amplified atoB gene was ligated between the upstream and downstream fragments of the yqhD gene at the BamHI and XbaI restriction sites. The resulting new fragment was then ligated into the temperature-sensitive plasmid pKmTsSacB at the XhoI and PstI restriction sites to construct a chromosomal integration plasmid. The amplified hbd and crt genes were each ligated between the upstream and downstream fragments of the ldhA and ackA-pta genes at the NdeI and XbaI restriction sites. The resulting new fragments were then each ligated into the temperature-sensitive plasmid pKmTsSacB at the XhoI and PstI restriction sites to construct chromosomal integration plasmids. The amplified adhE2 gene was ligated between the upstream and downstream fragments of the frdBC gene at the XbaI and SalI restriction sites. The resulting new fragment was then ligated into the temperature-sensitive plasmid pKmTsSacB at the BamHI and HindIII restriction sites to construct a chromosomal integration plasmid. The amplified ter gene was ligated between the upstream and downstream fragments of the adhE gene at the NdeI and XbaI restriction sites. The resulting new fragment was then ligated into the temperature-sensitive plasmid pKmTsSacB at the XhoI and SalI restriction sites to construct a chromosomal integration plasmid. The amplified fdh gene was ligated between the upstream and downstream fragments of the eutE gene at the KpnI and SacI restriction sites. The resulting new fragment was then ligated into the temperature-sensitive plasmid pKmTsSacB at the EcoRI and XbaI restriction sites to construct a chromosomal integration plasmid. Finally, all of the above chromosomal integration plasmids were electrotransformed into Escherichia coli BW25113 in sequence. The electrotransformation parameters were: voltage 2.5 kV, 25 μF, resistance 200 Ω. The process of screening mutants was to first screen for kanamycin-resistant transformants at 30 °C. The transformants were cultured overnight at 42 °C in liquid LB medium, then spread on plates containing kanamycin and sucrose and cultured at 42 °C. Colonies that grew were picked for PCR verification to screen for double-exchange mutants. The results were as Figure 2As shown (1: ΔldhA::miniPtac-hbd; 2: Δ(ackA-pta)::miniPtac-crt; 3: ΔadhE::miniPtac-ter; 4: ΔfrdBC::miniPtac-adhE2; 5: ΔyqhD::miniPtac-atoB). The verification primers for verifying and screening genes such as atoB, hbd, crt, adhE2, ter, and fdh are 239-(yqhD::atoB)-F (TTTAAACTCACGGCTAAATTGCGATGCGCTTTC) / 240-(yqhD::atoB)-R (CGAGGGGAATAAATGATTTCTGAAAAGTCCGG), 933-ldhA-F (CGTCCGCTGACCAGAGCGTTCTCAAGCCCTG) / 934-ldhA-R (CAACCGCGCCATTACCGTCAATAGTAATCATATG), 945-ackA-pta-F (AATCCGTAACCACGCTCAATAATTGTTTGCAGG) / 946-ackA-pta-R (AATCAGAGTGGCGATAACCCACACCACGATGC), 230-(frdBC::adhE2)-F (AAAAATGGCTACCGTTATCTGCAAGATTACGG) / 231-(frdBC::adhE2)-R (TCGCCTGCTCAAAACTCAAACCAGACGGCTTC), 221-(adhE::ter)-F (TGATGCCGGTCTGGCGTAAAACCCGTACCAG) / 222-(adhE::ter)-R (TATGTTTCACAGGATAACGGGTTTTTGATATC), 963-eutE-F (AAGCGCCTGCCAGCCCGCTACAGGGCAAGG) / 964-eutE-R (ATCACGAACAGATGTTTCAGCCCACGCGTTTG). The Escherichia coli strains integrated with atoB, hbd, crt, adhE2, and ter genes obtained through the above process were named EB204, and the strain integrated with the fdh gene based on EB204 was named EB205. Figure 1 is the butanol production pathway in its body.
[0101] All the above-mentioned PCRs used the EasyTaq DNA polymerase from TransGen Biotech, and the PCR program is shown in Table 1:
[0102] Table 1 is the PCR program
[0103]
[0104] B. Fermentation Tests of the Base Butanol-Producing Strains EB204 and EB205
[0105] The two strains obtained above were fermented in M9 medium and TB medium for 48 hours respectively. The fermentation products were detected by high performance liquid chromatography (HPLC). The detection was carried out using an Agilent 1260 liquid chromatograph, a refractive index detector, a BioRad Aminex HPX-87H organic acid column, with a column temperature of 15°C, a mobile phase of 5 mmol / l sulfuric acid aqueous solution, a flow rate of 0.5 ml / min, and an injection volume of 10 μl.
[0106] The specific fermentation method was as follows: The sterilized medium was dispensed into 15 ml centrifuge tubes (BD Biosciences), 10 ml in each tube. 0.5 ml of the overnight-activated seed solution was inoculated. After tightening the screw cap of the centrifuge tube, it was loosened half a turn and placed at 37°C for static fermentation for 48 hours.
[0107] The standard products for HPLC analysis were glucose and butanol, with retention times of 10.2 min and about 41.0 min respectively. Peaks also appeared in the supernatant of the fermentation broth at the corresponding times, indicating that glucose and butanol were indeed contained in the supernatant of the fermentation broth.
[0108] According to the corresponding relationship between the standard product concentration and the peak area, the calculated formula was:
[0109] Calculation formula for glucose concentration: y = 194111x, R 2 = 0.9999, where x represents the glucose concentration (g / L) and y represents the actual peak area;
[0110] Calculation formula for butanol concentration: y = 138232x, R 2 = 0.9998, where x represents the butanol concentration (g / L) and y represents the actual peak area.
[0111] The liquid chromatogram is as Figure 3 shown. The detection results are shown in Table 2. It can be seen that both strains have the ability to produce butanol, and expressing the fdh gene can significantly increase the butanol yield and productivity (butanol yield / glucose consumption).
[0112] Table 2 Butanol Yield Table of EB204 and EB205 Analyzed by HPLC
[0113]
[0114] Escherichia coli strain EB205 was deposited at the China General Microbiological Culture Collection Center (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postcode 100101) on January 11, 2016, with the deposit number CGMCC No. 11985 and the taxonomic name Escherichia coli.
[0115] II. Removal of the formic acid degradation pathway of the host of the basic butanol-producing strains EB204 and EB205
[0116] The following examples use the λ-red homologous recombination system for gene knockout, and the plasmids involved are:
[0117] pKD4 is described in the following literature: Datsenko, Kirill A., and Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences 97.12 (2000): 6640-6645;
[0118] pKD46 is described in the following literature: Datsenko, Kirill A., and Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences 97.12 (2000): 6640-6645;
[0119] pCP20 is described in the following literature: Datsenko, Kirill A., and Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences 97.12 (2000): 6640-6645;
[0120] The following examples use the homologous recombination system mediated by the integration plasmid pGFPduv8 for gene replacement or insertion on the chromosome. The construction process of the integration plasmid pGFPduv8 involved is described below;
[0121] The nucleotide sequence of the fdhF gene is as shown in Sequence 7 in the sequence listing;
[0122] The nucleotide sequence of the hyc-hyp gene is as shown in Sequence 8 in the sequence listing.
[0123] A. Construction of strains EB210, EB211, EB212, and EB215 by removing the host's own formic acid degradation pathway
[0124] 1. Preparation of competent cells of EB205 and EB205(pKD46)
[0125] The preparation of competent cells of EB205 is the same as that of competent cells of BW25113 in the above-mentioned Part I;
[0126] EB205(pKD46) recombinant bacteria: Take 1 μl of pKD46 and mix it with the above-mentioned competent cells of EB205, incubate on ice for 5 min, transfer the mixture into a 2 mm electroporation cuvette for transformation, and the electroporation parameters are the same as those in Example 1 above. After the electroporation is completed, immediately transfer the bacterial solution into 1 ml of LB, rejuvenate at 30 °C for 1 h, spread it on an LB plate containing 100 μg / ml ampicillin, and culture at 30 °C for 12 h to obtain EB205(pKD46) recombinant bacteria;
[0127] EB205(pKD46) competent cells: Transfer the colonies of EB205(pKD46) recombinant bacteria grown on the above-mentioned spread plate into liquid LB containing 100 μg / ml ampicillin, culture at 30 °C until the OD600 value is about 0.2, add arabinose with a final concentration of 10 mmol / l for induction, and prepare EB205(pKD46) competent cells according to the method of preparing EB205 for the bacteria in the mid-logarithmic growth phase.
[0128] 2. Knock out the formic acid degradation pathway in EB205
[0129] In order to prevent formic acid from being released in the form of H2 and CO2 during fermentation, resulting in insufficient supply of reducing power, the fdhF and hyc-hyp genes in the EB205 strain are knocked out.
[0130] 1). Preparation of the fdhF homologous recombination fragment
[0131] Using pKD4 as a template, PCR amplification was performed with the knockout primers 1074-fdhF-KoF (GTCGATAACGGCAAAATCGTCCGGGCGGAGGCAGCGCAGGTGTAGGCTGGAGCTGCTTC) and 1075-fdhF-KoR (GTCAATCACGTACTGCTCGGCGGCGCGCTGATCGGCGATCTGGGAATTAGCCATGGTCC) to obtain a 1574-bp PCR amplification product, which is the fdhF homologous recombination fragment. After sequencing, the nucleotide sequence of the fdhF homologous recombination fragment is Sequence 9 in the sequence listing.
[0132] The fdhF homologous recombination fragment includes the upstream homologous arm of the fdhF gene, the upstream FRT, the kanamycin resistance gene, the downstream FRT, and the downstream homologous arm of the fdhF gene; among them, the upstream homologous arm of the fdhF gene is positions 1-40 of Sequence 9, the upstream FRT is positions 59-106 of Sequence 9, the kanamycin resistance gene is positions 468-1262 of Sequence 9, the downstream FRT is positions 1453-1498 of Sequence 9, and the downstream homologous arm of the fdhF gene is positions 1535-1574 of Sequence 9.
[0133] 2), Knock out fdhF by homologous recombination
[0134] Mix 1 μl of the fdhF homologous recombination fragment prepared in 1) above with the competent cells of EB205 (pKD46) prepared above, perform transformation according to the above electroporation method, rejuvenate at 30 °C for 1.5 h, spread on an LB plate containing 50 μg / ml kanamycin, and culture at 37 °C for 24 h to obtain intermediate bacteria.
[0135] Using the intermediate bacteria as a template, PCR amplification was performed with the verification primers 1076-fdhF-1 (ATGAAAAAAGTCGTCACGGTTTGCCCCTATTG) and 1077-fdhF-2 (TTACGCCAGTGCCGCTTCGCGCAGGCGAG). Using EB205 (pKD46) as a control.
[0136] Electrophoresis detection of the above PCR products showed that the intermediate bacteria with a fragment of about 1.5 kb were the intermediate bacteria EB205△fdhF::kan in which the fdhF was replaced with a kanamycin resistance gene fragment (positions 41-1534 of Sequence 9) with FRTs at both ends; EB205 (pKD46) gave a fragment of about 2.1 kb.
[0137] The intermediate strain EB205△fdhF::kan with the above fdhF replaced by the kanamycin resistance gene was inoculated into liquid LB containing 50 μg / ml kanamycin. When it was cultured at 37 °C to the mid-logarithmic growth phase, competent cells were prepared. The plasmid pCP20 was electrotransformed into it, and it was rejuvenated at 30 °C for 1 h, then spread on an LB plate containing 30 μg / ml chloramphenicol and cultured at 30 °C for 12 h, so that the FRT on the pCP20 plasmid replaced the kanamycin resistance gene in the intermediate strain.
[0138] The colonies grown on the above-spread plate were transferred to antibiotic-free liquid LB and cultured at 42 °C. After two subcultures, it was diluted and spread on an antibiotic-free plate and cultured at 37 °C for 12 h. The temperature-sensitive plasmids pCP20 (chloramphenicol resistance) and pKD46 (ampicillin resistance) were removed after two rounds of culturing at 42 °C.
[0139] Single colonies on the above-diluted spread plate were picked and streaked successively onto a kanamycin resistance plate, a chloramphenicol resistance plate, and an antibiotic-free plate, and cultured at 37 °C for 12 h. Then, the colonies that grew only on the antibiotic-free plate and did not grow on the other two plates were the recombinant bacteria with successful fdhF gene knockout, named EB210.
[0140] EB210 was verified by the above verification primers and colony PCR. The fragment below 300 bp obtained by electrophoresis verification was the target recombinant bacterium.
[0141] EB210 was sequenced, and the result showed that this recombinant bacterium was obtained by replacing the fdhF gene on the EB205 genome with FRT (positions 59 - 106 of Sequence 9).
[0142] 3), Knock out the hyc-hyp gene to construct strain EB211
[0143] The preparation method of the recombinant bacterium with the hyc-hyp gene knocked out was basically the same as the above process of knocking out the fdhF gene, except for the knockout primers, homologous fragments, and verification primers, which are as follows:
[0144] The recombinant bacterium EB211 was obtained by replacing the hyc-hyp gene on the EB205 genome with FRT (positions 59 - 106 of Sequence 10).
[0145] The required knockout primers, homologous fragments, and verification primers are as follows:
[0146] hyc-hyp knockout primers:
[0147] 1070-Hyd-KoF: TTGATAAACGGTTTCTACCGCATCTTTAATCGGCTGGGTCTGTAGGCTGGAGCTGCTTC
[0148] 1071-Hyd-KoR: ACAGCAGGGTCGTGCGTTTCAGCCCCAGACGTTGCGCAGCTGGGAATTAGCCATGGTCC
[0149] The nucleotide sequence of the hyc-hyp homologous recombination fragment is Sequence 10, including the upstream homologous arm of the hyc-hyp gene, the upstream FRT, the kanamycin resistance gene, the downstream FRT, and the downstream homologous arm of the hyc-hyp gene; among them, the upstream homologous arm of the hyc-hyp gene is positions 1-40 of Sequence 10, the upstream FRT is positions 59-106 of Sequence 10, the kanamycin resistance gene is positions 468-1262 of Sequence 10, the downstream FRT is positions 1453-1498 of Sequence 10, and the downstream homologous arm of the hyc-hyp gene is positions 1535-1574 of Sequence 10.
[0150] hyc-hyp verification primers were used to obtain a positive intermediate bacterium of approximately 1.6 kb:
[0151] 1072-Hyd-1: CTACTCTTCTTCCACCGCTAACTGCGCGAAG
[0152] 1073-Hyd-2: TTAAATCAATGCCGATTTATCAATTCCCAGCCGC
[0153] 4), Knock out the fdhF gene on the basis of EB211 to construct EB212
[0154] Prepare EB211 and EB211(pKD46) competent cells according to the above method for preparing competent cells, and electrotransform the homologous fragment required for knocking out the fdhF gene, i.e., Sequence 9, into them. Knock out fdhF on the basis of EB211 to form EB212.
[0155] EB212 is a recombinant bacterium obtained by replacing the hyc-hyp gene on the EB205 genome with FRT (positions 59-106 of Sequence 10) and replacing the fdhF gene with FRT (positions 59-106 of Sequence 9).
[0156] 3. Integrate fdh at the fdhF locus of EB212 to construct EB215
[0157] Using the plasmid pUC57-fdhcb containing the fdh gene as a template, the butanol synthesis pathway gene fdh was amplified with primers 1107-fdhcb-1 (GCGTGATTTGATTAACTGGAGCGAGACCGATGAAGATTGTGCTGGTGCTGTACGACGC) and 1108-fdhcb-2 (GTATTACGCCAGTGCCGCTTCGCGCAGGCGATTACTTCTTGTCATGCTTGCCGTAGGCC).
[0158] The above plasmid pUC57-fdhcb was synthesized by GenScript and stored in the laboratory.
[0159] Using the Escherichia coli BW25113 genome as a template, the upstream and downstream fragments of the fdhF gene were amplified with primers 1103-fdhF-1 (ATCGCTCGAGTTCTGGCGGTCGATAAACAAATTGTTGCCG) / 1104-fdhF-2 (GCGTCGTACAGCACCAGCACAATCTTCATCGGTCTCGCTCCAGTTAATCAAATCACGC) and 1105-fdhF-3 (GGCCTACGGCAAGCATGACAAGAAGTAATCGCCTGCGCGAAGCGGCACTGGCGTAATAC) / 1106-fdhF-4 (ATCGCTGCAGGCCTGATGCGACGCTTAACGCGTCTTATC), respectively.
[0160] Using the synthesized DNA sequence 36 (Sequence 36 in the sequence listing) as a template, a miniPthl-gfpduv operon fragment of approximately 1 kb was amplified by PCR with primers 1081-GFPduv-1 (GATGCCTAGGTGTTGACAATTAATCATCGGCTCGTATAATGTG) and 1082-GFPduv-2 (ATCGGAGCTCCAGATAAAACGAAAGGCCCAGTCTTTC). This fragment was digested with AvrII and SacI enzymes together with the plasmid pKmTsSacB, and the new plasmid formed after ligation was named pGFPduv8.
[0161] Using the upstream and downstream fragments of the amplified fdh gene and fdhF gene as templates, a new fragment was amplified by fusion PCR with primers 1103-fdhF-1 (ATCGCTCGAGTTCTGGCGGTCGATAAACAAATTGTTGCCG) and 1106-fdhF-4 (ATCGCTGCAGGCCTGATGCGACGCTTAACGCGTCTTATC). This fragment was ligated into the integration plasmid pGFPduv8 at the XhoI and PstI restriction sites to form a chromosomal integration plasmid. This plasmid was electrotransformed into EB212 according to the electrotransformation method of Example 1. The screening process of the mutant was the same as that in Example 1, and the obtained double crossover strain was a recombinant bacterium in which the fdh gene replaced fdhF, and this strain was named EB215.
[0162] EB215 is a recombinant bacterium obtained by replacing the hyc-hyp gene on the genome of EB205 with FRT (positions 59-106 of Sequence 10) and replacing the fdhF gene with fdh (Sequence 6).
[0163] The DNA polymerase and PCR program used in the above PCR were the same as those described in Example 1.
[0164] B. Fermentation test of strains with the host's own formic acid degradation pathway removed
[0165] The constructed strains EB210, EB211, EB212, EB215 together with EB205 were fermented in TB medium for 48 hours according to the method described above, and detected according to the HPLC detection method described above. The results are shown in Table 3.
[0166] The retention time of the formic acid standard product analyzed by HPLC was about 16.8 min. The calculation formula for the formic acid concentration was: y = 76445x, R 2 = 0.9999, where x represents the formic acid concentration (g / L) and y represents the actual peak area.
[0167] Table 3 Formic acid and butanol production of strains with the host's own formic acid degradation pathway removed
[0168]
[0169] The results showed that compared with the starting strain EB205, knocking out the formic acid degradation pathway of Escherichia coli itself could increase the accumulation of formic acid, but the butanol production decreased. This indicated that the accumulation of formic acid inhibited cell metabolism, and further conversion of formic acid into NADH to supply the butanol synthesis pathway was needed to solve this problem.
[0170] III. Starting strain EB216
[0171] A. Construction of Starting Strain EB216
[0172] Genes in related metabolic pathways were analyzed, and it was found that malate dehydrogenase encoded by the mdh gene is responsible for catalyzing the reaction from oxaloacetate to malate, consuming the reducing power NADH and competing with the butanol synthesis pathway for reducing power. Therefore, based on EB215, the above gene was knocked out using the λ-red homologous recombination system.
[0173] The nucleotide sequence of the mdh gene is shown as Sequence 11 in the sequence listing.
[0174] The preparation method of the recombinant strain with mdh knocked out is basically the same as the process of knocking out the fdhF gene in the above item II, except for the knockout primers, homologous fragments, and verification primers, which are specifically as follows:
[0175] The recombinant strain EB216 is a recombinant strain obtained by replacing the mdh gene on the EB215 genome with FRT (positions 59 - 106 of Sequence 13).
[0176] The required knockout primers, homologous fragments, and verification primers are as follows:
[0177] mdh knockout primers:
[0178] 1032-mdh-KoF: AAAACCCAACTGCCTTCAGGTTCAGAACTCTCTCTGTATGTGTAGGCTGGAGCTGCTTC
[0179] 1033-mdh-KoR: CGTTTTTACCCAGCAGCAGCGGTTGAGAGAAGAAACGGGCTGGGAATTAGCCATGGTCC
[0180] The nucleotide sequence of the mdh homologous recombination fragment is Sequence 13, including the upstream homologous arm of the mdh gene, upstream FRT, kanamycin resistance gene, downstream FRT, and downstream homologous arm of the mdh gene; among them, the upstream homologous arm of the mdh gene is positions 1 - 40 of Sequence 13, the upstream FRT is positions 59 - 106 of Sequence 13, the kanamycin resistance gene is positions 468 - 1262 of Sequence 13, the downstream FRT is positions 1453 - 1498 of Sequence 13, and the downstream homologous arm of the mdh gene is positions 1535 - 1574 of Sequence 13.
[0181] mdh verification primers, obtaining a positive intermediate strain of approximately 1.7 kb:
[0182] 1034-mdh-1: ATGAAAGTCGCAGTCCTCGGCGCTGCTGGC
[0183] 1035-mdh-2: GTTCTGTTCAAATGCGCTCAGGGTACCGAT
[0184] B. Fermentation
[0185] The constructed strain EB216, together with EB215, was fermented in M9 medium for 72 hours according to the method described above in item 1, and detected according to the HPLC detection method described above in item 1. The results are shown in Table 4.
[0186] Table 4 Butanol production of strains constructed by knocking out genes of other metabolic pathways
[0187]
[0188] The results showed that knocking out the mdh gene could increase the butanol production and yield.
[0189] Example 2. Construction of recombinant bacterium 243
[0190] I. Obtaining recombinant bacterium EB222 by knocking out the pykA gene
[0191] A. Construction of recombinant bacterium EB222
[0192] Analysis of genes in related metabolic pathways revealed that the pykA gene could synthesize NTP using other NDPs as substrates, which might reduce the intracellular ATP level and was not conducive to cell growth. Therefore, based on EB216, the above gene was knocked out using the λ-red homologous recombination system.
[0193] The nucleotide sequence of the pykA gene is shown as sequence 12 in the sequence listing.
[0194] The preparation method of the recombinant bacterium with the pykA gene knocked out was basically the same as the process of knocking out the fdhF gene in item II of Example 1, except for the knockout primers, homologous fragments, and verification primers, which are specifically as follows:
[0195] Recombinant bacterium EB222 is a recombinant bacterium obtained by replacing the pykA gene on the EB216 genome with FRT (positions 59 - 106 of sequence 14).
[0196] The required knockout primers, homologous fragments, and verification primers are as follows:
[0197] pykA knockout primers:
[0198] pykA-KoF: CTGGGGCGTCATGTGGCTATTCTGGGTGACCTCCAGGGGCTGTAGGCTGGAGCTGCTTC
[0199] pykA-KoR: AGAGCTGATACGGGAGGTCATCAGCGCGGTACGACCCGATTGGGAATTAGCCATGGTCC
[0200] The nucleotide sequence of the pykA homologous recombination fragment is Sequence 14, including the upstream homologous arm of the pykA gene, the upstream FRT, the kanamycin resistance gene, the downstream FRT, and the downstream homologous arm of the pykA gene; among them, the upstream homologous arm of the pykA gene is positions 1-40 of Sequence 14, the upstream FRT is positions 59-106 of Sequence 14, the kanamycin resistance gene is positions 468-1262 of Sequence 14, the downstream FRT is positions 1453-1498 of Sequence 14, and the downstream homologous arm of the pykA gene is positions 1535-1574 of Sequence 14.
[0201] The pykA verification primer was used to obtain a positive intermediate strain of about 1.9 kb:
[0202] pykA-F: GATAATAATCTTGAAAAAGTTATCGCGGCG
[0203] pykA-R: TTCGCTGGCAGCTGCTACGCCGTCATTAGC
[0204] The DNA polymerase and PCR program used in the above PCR were the same as in Example 1.
[0205] B. Fermentation test of strains constructed by knocking out genes of other metabolic pathways
[0206] The above-constructed strain EB222 together with EB216 was fermented in M9 medium for 72 hours according to the method in Item 1 of Example 1, and detected according to the HPLC detection method in Item 1 of Example 1. The results are shown in Table 5.
[0207] Table 5 Butanol production of strains constructed by knocking out genes of other metabolic pathways
[0208]
[0209] The results showed that knocking out the pykA gene could increase the butanol production and yield.
[0210] II. Overexpressing the fdh gene to obtain EB223, EB225, and EB228
[0211] In the following examples, the homologous recombination system mediated by the integration plasmid pGFPduv9 was used for gene replacement or insertion on the chromosome. The construction method of pGFPduv9 is described below.
[0212] A. Constructing strains EB223, EB225, and EB228 by overexpressing the fdh gene
[0213] In order to enhance the ability to supply reducing power for butanol synthesis, it is necessary to strengthen the expression level of the fdh gene. On the basis of EB222, the promoter of the Escherichia coli ydfZ gene (PydfZ) was selected to initiate the expression of the fdh gene.
[0214] Using the plasmid pUC57-fdhcb containing the fdh gene in Example 1 as a template, after PCR amplifying DNA fragments with primers 1399-ydfZ-fdh-1 (GAAAGGATCCATTGCCATTGAGCGCAAGCAACTGGATG) / 1400-ydfZ-fdh-2 (GCGTCGTACAGCACCAGCACAATCTTCATAGGTGTTTTCTCCTTTCTGATTTACAGTCG) and 1401-ydfZ-fdh-3 (CGACTGTAAATCAGAAAGGAGAAAACACCTATGAAGATTGTGCTGGTGCTGTACGACGC) / 1335-fdhcb-2 (AGAATCTAGATTACTTCTTGTCATGCTTGCCGTAGGCCTTTG) respectively, then using these two fragments as templates, with primers 1399-ydfZ-fdh-1 (GAAAGGATCCATTGCCATTGAGCGCAAGCAACTGGATG) and 1335-fdhcb-2 (AGAATCTAGATTACTTCTTGTCATGCTTGCCGTAGGCCTTTG) to perform fusion PCR amplification to obtain the fdh gene fragment 1 containing the promoter PydfZ; using primers 1427-ydfZ-fdh-1 (ATCGGAATTCATTGCCATTGAGCGCAAGCAACTGGATG) / 1400-ydfZ-fdh-2 (GCGTCGTACAGCACCAGCACAATCTTCATAGGTGTTTTCTCCTTTCTGATTTACAGTCG) and 1401-ydfZ-fdh-3 (CGACTGTAAATCAGAAAGGAGAAAACACCTATGAAGATTGTGCTGGTGCTGTACGACGC) / 1389-fdhcb-2 (ATCGGGATCCTTACTTCTTGTCATGCTTGCCGTAGGCCTTTG) to PCR amplify DNA fragments respectively, and then using these two fragments as templates, with primers 1427-ydfZ-fdh-1 (ATCGGAATTCATTGCCATTGAGCGCAAGCAACTGGATG) / 1389-fdhcb-2 (ATCGGGATCCTTACTTCTTGTCATGCTTGCCGTAGGCCTTTG) to perform fusion PCR amplification to obtain the fdh gene fragment 2 containing the promoter PydfZ.Then, using the genome of Escherichia coli BW25113 as a template, the upstream and downstream fragments of the maeB gene were amplified using primers 1332-maeB-1 (AGGGCTCGAGCTTCCACCACATACGGGTCCATCGGCTTGCGTG) / 1333-maeB-2 (AACAGGATCCTTTCCCTGGAACTGGAAATTCATGGAAATCAAG) and 1336-maeB-3 (GTAATCTAGATTCTGGTGATGCCGAACATGGAAGCTGCCC) / 1337-maeB-4 (ATGCCTGCAGGTTAAAATATTCACCCGGCGTATCAATATCG), respectively; the upstream and downstream fragments of the mdh gene were amplified using primers 1370-mdh-1 (ATCGCTCGAGCATTTTCCCCGCCGTCAGAAACGACGGGGC) / 1371-mdh-2 (ATCGGAATTCTTATTATATTGATAAACTAAGATATGTTGC) and 1372-mdh-3 (ATCGGGATCCGTATGCTGGATACGCTGAAGAAAGATATCG) / 1373-mdh-4 (ATCGTCTAGAATCATGGATCAACGCGGTTATATCATCACC), respectively.
[0215] Using pR6Kan (purchased from Biomedal) as a template, the R6K ori fragment was amplified by PCR using primers 1222-R6K-1 (ATCGGAGCTCCAACCATCATCGATGAATTGCTTCGTTAATACAG) and 1223-R6K-2 (ATCGCTCGAGATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGAC). This fragment was digested with SacI and XhoI enzymes together with the plasmid pGFPduv8, and the new plasmid formed after ligation was named pGFPduv9.
[0216] The amplified fdh gene fragment 1 was ligated between the upstream and downstream fragments of the maeB gene at the BamHI and XbaI restriction sites. The resulting new fragment was then ligated into the pGFPduv9 integration plasmid at the XhoI and PstI restriction sites to construct the chromosomal integration plasmid 1.
[0217] After sequencing, the chromosomal integration plasmid 1 was the vector obtained by inserting the fragment shown in Sequence 23 between the XhoI and PstI restriction sites of the pGFPduv9 integration plasmid.
[0218] The fragment shown in Sequence 23 includes the upstream homologous arm of the maeB gene (nucleotides 1 - 940 of Sequence 23), the fdh gene fragment 1 containing the promoter PydfZ (nucleotides 941 - 2535 of Sequence 23), and the downstream homologous arm of the maeB gene (nucleotides 2536 - 3525 of Sequence 23).
[0219] The above - amplified fdh gene fragment 2 was ligated between the upstream and downstream fragments of the mdh gene at the EcoRI and BamHI restriction sites. The resulting new fragment was then ligated into the pGFPduv9 integration plasmid at the XhoI and XbaI restriction sites to construct the chromosomal integration plasmid 2;
[0220] After sequencing, the chromosomal integration plasmid 2 is a vector obtained by inserting the fragment shown in Sequence 24 into the XhoI and PstI restriction sites of the pGFPduv9 integration plasmid.
[0221] The fragment shown in Sequence 24 includes the upstream homologous arm of the mdh gene (nucleotides 1 - 930 of Sequence 24), the fdh gene fragment 2 containing the promoter PydfZ (nucleotides 931 - 2525 of Sequence 24), and the downstream homologous arm of the mdh gene (nucleotides 2526 - 3465 of Sequence 24).
[0222] The above chromosomal integration plasmid 1 was electro - transformed into Escherichia coli EB222. The electro - transformation parameters were: voltage 2.5 kV, 25 μF, resistance 200 Ω. Kanamycin - resistant transformants were screened at 30 °C. The transformants were cultured overnight in liquid LB medium at 42 °C, and then spread on plates containing kanamycin and sucrose and cultured at 42 °C. Colonies that grew out were picked for PCR verification to screen for double - crossover mutants. The identification primers were 1332 - maeB - 1 (AGGGCTCGAGCTTCCACCACATACGGGTCCATCGGCTTGCGTG) / 1337 - maeB - 4 (ATGCCTGCAGGTTAAAATATTCACCCGGCGTATCAATATCG). If a band of approximately 3.5 kb was obtained, it was a positive bacterium, named Escherichia coli EB223.
[0223] After sequencing, Escherichia coli EB223 is a recombinant bacterium obtained by replacing the maeB gene (nucleotide sequence is Sequence 30) in the genome of Escherichia coli EB222 with the fdh gene fragment 1 containing the promoter PydfZ (nucleotides 941 - 2535 of Sequence 23).
[0224] The chromosomal integration plasmid 2 was electrotransformed into Escherichia coli EB222 by the above method, and kanamycin-resistant transformants were screened at 30 °C. The transformants were cultured overnight at 42 °C in liquid LB medium, and then spread on plates containing kanamycin and sucrose and cultured at 42 °C. The grown colonies were picked for PCR verification to screen for double crossover mutants. The identification primers were 1370-mdh-1 (ATCGCTCGAGCATTTTCCCCGCCGTCAGAAACGACGGGGC) / 1373-mdh-4 (ATCGTCTAGAATCATGGATCAACGCGGTTATATCATCACC). If a band of approximately 3.5 kb was obtained, it was a positive bacterium, named Escherichia coli EB225.
[0225] After sequencing, Escherichia coli EB225 was a recombinant bacterium obtained by replacing FRT located at the mdh gene locus in the genome of Escherichia coli EB222 with the fdh gene fragment 2 (nucleotides 931-2525 of sequence 24) containing the promoter PydfZ.
[0226] The chromosomal integration plasmid 2 was electrotransformed into Escherichia coli EB223 by the above method, and kanamycin-resistant transformants were screened at 30 °C. The transformants were cultured overnight at 42 °C in liquid LB medium, and then spread on plates containing kanamycin and sucrose and cultured at 42 °C. The grown colonies were picked for PCR verification to screen for double crossover mutants. The identification primers were 1370-mdh-1 (ATCGCTCGAGCATTTTCCCCGCCGTCAGAAACGACGGGGC) / 1373-mdh-4 (ATCGTCTAGAATCATGGATCAACGCGGTTATATCATCACC). If a band of approximately 3.5 kb was obtained, it was a positive bacterium, named Escherichia coli EB228.
[0227] After sequencing, Escherichia coli EB228 was a recombinant bacterium obtained by replacing the mdh gene (nucleotide sequence is sequence 11) in the genome of Escherichia coli EB223 with the fdh gene fragment 2 (nucleotides 931-2525 of sequence 24) containing the promoter PydfZ.
[0228] B. Fermentation test of strains with enhanced expression of fdh gene
[0229] The above constructed strains EB223, EB225, EB228 together with EB222 were fermented in M9 medium for 72 hours according to the method of Example 1, and detected according to the HPLC detection method of Example 1. The results are shown in Table 6.
[0230] Table 6 Butanol production of strains with enhanced expression of fdh gene
[0231]
[0232]
[0233] The results showed that compared with the starting strain EB222, the butanol production of the strain with enhanced expression of the fdh gene increased significantly, but the butanol yield did not increase significantly, indicating that the supply of reducing power is the rate-limiting step in the butanol synthesis pathway. However, two copies of the fdh gene on the genome could not further increase the butanol production, indicating that there are other rate-limiting steps.
[0234] III. Domestication of the butanol-producing strain to obtain EB234
[0235] In order to enhance the butanol production capacity from a global perspective, continuous culture domestication was adopted. To obtain mutant strains with accelerated growth, so as to increase the butanol production in a shorter time, subculture domestication was carried out in M9 containing glucose as the carbon source: specifically, after the starting strain EB228 was fermented in 10 ml of M9 medium with glucose as the carbon source for 24 hours, 100 μl was transferred to fresh M9 medium and fermented for another 24 hours. After repeating this process 52 times, dilution coating was performed to obtain single colonies, and 15 clones were selected for fermentation testing in M9 medium. The strain with a butanol production of about 6 g / L after 48 hours of fermentation was named EB232.
[0236] Enhanced utilization of reducing power may promote the enhancement of butanol synthesis ability. To provide perturbations to the reducing power, mutant strains with enhanced reducing power utilization ability were expected. Strain EB232 was successively subcultured and domesticated in modified M9 medium with gluconic acid as the carbon source and M9 medium with glucose as the carbon source. Specifically, after strain EB232 was domesticated 49 times in modified M9 medium with gluconic acid as the carbon source (changing the carbon source in the M9 medium formula in Example 1 from glucose to gluconic acid), the strain with unchanged butanol production was named EB233.
[0237] EB233 was domesticated 14 times in M9 medium with glucose as the carbon source, and the strain with unchanged butanol production was named EB234.
[0238] The butanol production capacities of each domesticated strain are shown in Figure 4 , and the results showed that after the domestication process, the butanol production increased significantly, but the yield did not change significantly.
[0239] IV. Knocking out the genes at the transposon insertion sites to prepare recombinant bacteria
[0240] A. Screening genes that can promote butanol production by Tn5 transposon
[0241] In the following examples, the method of parental conjugation was used to prepare a butanol-producing Escherichia coli mutant library. The donor used in parental conjugation was Escherichia coli S17-1λpir (purchased from Biomedal, product catalog number: KT-3229) containing the pUTmini-Tn5 plasmid (kanamycin resistance, purchased from Biomedal, product catalog number: KT-3229), and the recipient was the EB234 strain containing the pACYC184 plasmid (chloramphenicol resistance).
[0242] pACYC184 is described in the following literature: Li, Jin-Kun, and Jenn Tu. Ssp RFI, a novel class-II restriction endonuclease from Synechococcus RF-1 recognizing 5'TT / CGAA-3'. Nucleic acids research 19.17 (1991): 4770-4770;
[0243] In the following examples, the λ-red homologous recombination system mediated by the CRISPR / Cas system was used for gene knockout. The plasmids involved are as follows:
[0244] pCas is described in the following literature: Jiang, Yu, et al. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology 81.7 (2015): 2506-2514;
[0245] pTargetF is described in the following literature: Jiang, Yu, et al. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology 81.7 (2015): 2506-2514;
[0246] The nucleotide sequence of the yieP gene is shown as sequence 17 in the sequence listing;
[0247] The nucleotide sequence of the stpA gene is shown as sequence 18 in the sequence listing;
[0248] The nucleotide sequence of the yqeG gene is shown as sequence 15 in the sequence listing;
[0249] The nucleotide sequence of the yagM gene is shown as Sequence 16 in the sequence listing.
[0250] 1. Preparation of mutant library
[0251] Place a 0.45 μm sterile filter membrane in the center of an LB plate containing 0.1 M citric acid. Mix the two bacteria from the above-mentioned conjugal transfer and add them onto the sterile filter membrane. After drying in a laminar flow hood, culture them in an incubator at 30 °C for 8 h. Use a sterilized toothpick to scrape the bacterial lawn on the filter membrane, wash it with a small amount of sterile water, and spread it on an LB plate containing kanamycin and chloramphenicol for selective culture. The obtained colonies are mutants.
[0252] 2. Fermentation screening of mutants
[0253] Randomly pick 4400 of the above-mentioned mutant colonies and inoculate them into 10 ml of M9 medium respectively, and perform fermentation according to the method of Example 1. Use an Agilent 1260 liquid chromatograph, a refractive index detector, a BioRad rapid acid analysis column, with a column temperature of 30 °C, a mobile phase of 5 mmol / l sulfuric acid aqueous solution, a flow rate of 0.8 ml / min, and an injection volume of 10 μl to rapidly detect butanol. The standard product for HPLC analysis is butanol, and the retention time is about 8.8 min. A peak also appears in the supernatant of the fermentation broth at the corresponding time, indicating that butanol is indeed contained in the supernatant of the fermentation broth.
[0254] According to the corresponding relationship between the standard product concentration and the peak area, the calculation formula for butanol is determined as:
[0255] y = 88162x, R 2 = 0.9997, where x represents the butanol concentration (g / L) and y represents the actual peak area.
[0256] After primary screening and re-screening, six strains with significantly increased butanol production were finally screened out. The results are shown in Figure 5 .
[0257] 3. Identification of mutation sites of mutant strains
[0258] Sequence these six strains of bacteria by next-generation sequencing technology, and five insertion sites are found. Among them, the yieP site insertion is found in both of the two strains. The specific insertion sites are shown in Table 7.
[0259] Table 7 Transposon insertion sites of Tn5 transposon mutant strains
[0260]
[0261] B. Recombinant bacteria with yieP, stpA, yqeG, and yagM genes knocked out in sequence
[0262] 1. Preparation of EB235 by knocking out the yieP gene
[0263] 1). Preparation of EB234(pCas) recombinant bacteria
[0264] Plasmid pCas was introduced into EB234 to obtain EB234(pCas). The competent cells of EB234(pCas) were prepared according to the method for preparing competent cells of EB205(pKD46) in Example 1.
[0265] 2). Construction of plasmid pTargetF - yieP and preparation of yieP homologous fragment
[0266] Using plasmid pTargetF as a template, the linear fragment was amplified by PCR with primers 1961 - yieP - target (TCCTAGGTATAATACTAGTTTCATAGATATGCTCATGCCGTTTTAGAGCTAGAAATAGC) and 1876 - pTargetF - F2 (ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG). After digesting the template plasmid with DpnI enzyme, it was electrotransformed into DH5α for self - ligation, rejuvenated at 37°C for 1 h, and spread on an LB plate containing 50 μg / ml spectinomycin and cultured at 37°C for 12 h. The grown colonies were picked and inoculated into LB liquid containing 50 μg / ml spectinomycin, cultured overnight at 37°C, and then the plasmid was extracted using the Omega plasmid extraction kit. After sequencing the plasmid, the positive plasmid containing the correct N20 sequence (TTCATAGATATGCTCATGCC, which is the upstream of the sgRNA sequence, and the sgRNA is shown in Sequence 33) was selected and named pTargetF - yieP.
[0267] Using the genome of Escherichia coli BW25113 as a template, two fragments of yieP were amplified with primers 1966-yieP-1 (GACTCACGGCAAGGGTAAAAATGCGACGCG) / 1967-yieP-2 (CTTTCGTATGTTCTGGCTGAGAAGCTGGCGATGCGATTATCCAAAGCGATGGCGACGCG) and 1968-yieP-3 (CGCGTCGCCATCGCTTTGGATAATCGCATCGCCAGCTTCTCAGCCAGAACATACGAAAG) / 1969-yieP-4 (TCTGCCGGAGTTCTCAGGAGAACCCCGCTG), respectively. Then, using these two fragments as templates, a homologous fragment of yieP (Sequence 19) was amplified by fusion PCR with primers 1966-yieP-1 (GACTCACGGCAAGGGTAAAAATGCGACGCG) and 1969-yieP-4 (TCTGCCGGAGTTCTCAGGAGAACCCCGCTG).
[0268] 3) Knockout of yieP
[0269] Mix 1 μl of the pTargetF-yieP prepared in 2) above and 1 μl of the yieP homologous fragment prepared in 2) above with the EB234 (pCas) competent cells prepared in 1) above, and perform transformation according to the electroporation method in Example 1. Rejuvenate at 30 °C for 1 h, spread on an LB plate containing 50 μg / ml kanamycin and 50 μg / ml spectinomycin, and culture at 30 °C for 24 h to obtain intermediate bacteria. Pick an appropriate amount of intermediate bacteria and perform colony PCR with primers 1966-yieP-1 (GACTCACGGCAAGGGTAAAAATGCGACGCG) and 1969-yieP-4 (TCTGCCGGAGTTCTCAGGAGAACCCCGCTG) to verify the knockout of yieP, using EB234 (pCas) as a control. The colonies with a band size of approximately 600 bp after electrophoresis were the colonies with successful yieP knockout, and the band size of the control was approximately 1.1 kb. At this time, the intermediate bacteria contained two plasmids, pCas and pTargetF-yieP.
[0270] 4) Removal of pTargetF-yieP plasmid
[0271] Pick the intermediate bacteria with successful yieP knockout in step 3) above and inoculate them into LB containing 50 μg / ml kanamycin and 0.5 mM IPTG, and activate them overnight at 30 °C. Dip a sterilized toothpick into the activated bacterial solution and streak for single colonies on an LB plate containing 50 μg / ml kanamycin, and culture at 30 °C for 12 h. Pick several grown single colonies and streak them successively on LB plates containing 50 μg / ml spectinomycin and 50 μg / ml kanamycin, and culture at 30 °C for 6 h. Screen out the colonies that do not grow on the spectinomycin-containing plate but grow on the corresponding kanamycin-containing plate, which are the intermediate bacteria with the pTargetF-yieP plasmid removed. At this time, the intermediate bacteria still contain the pCas plasmid.
[0272] 5), Removal of the pCas plasmid
[0273] Pick the intermediate bacteria obtained in step 4) above and transfer them to antibiotic-free liquid LB, culture at 42 °C, after two subcultures, dilute and spread them on an antibiotic-free plate, culture at 37 °C for 12 h, and remove the temperature-sensitive plasmid pCas after two cultures at 42 °C.
[0274] Pick the single colonies on the above dilution and spread plate and streak them successively on a kanamycin-resistant plate and an antibiotic-free plate, and culture at 37 °C for 6 h. Then, screen out the colonies that do not grow on the kanamycin-resistant plate but grow on the corresponding antibiotic-free plate, which are the recombinant bacteria with the plasmid pCas removed and the yieP gene knockout finally successful, named EB235.
[0275] EB235 is a recombinant bacterium obtained by knocking out the middle fragment (nucleotides 70-619 of sequence 17) of the yieP gene on the genome of EB234.
[0276] 2. Knock out the stpA, yqeG, and yagM genes successively
[0277] The knockout processes of stpA, yqeG, and yagM are basically the same as that of yieP. The difference lies in the upstream primers used to construct their respective pTargetF plasmids (the downstream primers are all primer 1876-pTargetF-F2 above) and the primers used to construct their respective homologous fragments. The details are listed as follows:
[0278] The upstream primer used for constructing pTargetF-stpA (the N20 sequence is TGTACGGCCCTGACCGGTCC, which is the upstream of the sgRNA sequence, and the sgRNA is shown as Sequence 34) is 1962-stpA-target (TCCTAGGTATAATACTAGTTGTACGGCCCTGACCGGTCCGTTTTAGAGCTAGAAATAGC). The primers used for constructing the stpA homologous fragment are 1970-stpA-1 (GGATTGATGGCTGGAAAAAAGCAGGATTGC) / 1971-stpA-2 (GTGCGATGGCTCGCGAATTCTCCATTGACGAAGGTAAATCTCTCGACGATTTCCTGATC) and 1972-stpA-3 (GATCAGGAAATCGTCGAGAGATTTACCTTCGTCAATGGAGAATTCGCGAGCCATCGCAC) / 1973-stpA-4 (CAGGCTTGCGGAATTAGCGAGCAGAGAGCG).
[0279] The homologous fragment of stpA is shown as Sequence 20 in the Sequence Listing.
[0280] The recombinant bacterium obtained by knocking out stpA based on EB235 was subjected to PCR (the primers were 1970-stpA-1 (GGATTGATGGCTGGAAAAAAGCAGGATTGC) / 1973-stpA-4 (CAGGCTTGCGGAATTAGCGAGCAGAGAGCG)), and a band of approximately 600 bp was obtained. The control EB235 (pCas) was approximately 800 bp. The recombinant bacterium was named EB236.
[0281] EB236 is a recombinant bacterium obtained by knocking out the middle fragment (nucleotides 74 - 373 of Sequence 18) of the stpA gene on the EB235 genome.
[0282] The upstream primer used for constructing pTargetF-yqeG (the N20 sequence is CTGTGGAGTTTCGCGCTCTA, which is the upstream of the sgRNA sequence, and the sgRNA is shown as Sequence 35) is 1963-yqeG-target (TCCTAGGTATAATACTAGTCTGTGGAGTTTCGCGCTCTAGTTTTAGAGCTAGAAATAGC). The primers used for constructing the yqeG homologous fragment are 1974-yqeG-1 (CACGGCGGAATGACCCGCTAACGCACCACG) / 1975-yqeG-2 (AGATGATGAGATAAGCGACTTTCATAATTGAACGTATCATCTACAAATTAAACAAAATG) and 1976-yqeG-3 (CATTTTGTTTAATTTGTAGATGATACGTTCAATTATGAAAGTCGCTTATCTCATCATCT) / 1977-yqeG-4 (AGCGATACCAACATAATTGATAGTGCGCGG).
[0283] The homologous fragment of yqeG is shown as Sequence 21 in the Sequence Listing.
[0284] PCR (primers are 1974-yqeG-1 (CACGGCGGAATGACCCGCTAACGCACCACG) / 1977-yqeG-4 (AGCGATACCAACATAATTGATAGTGCGCGG)) of the recombinant bacterium obtained by knocking out yqeG on the basis of EB236 yielded a band of approximately 600 bp, and the control EB236 (pCas) was approximately 1.2 kb. The recombinant bacterium was named EB237.
[0285] EB237 is a recombinant bacterium obtained by knocking out the fragment in the middle of the yqeG gene (the 1st to 695th nucleotides of Sequence 15) on the genome of EB236.
[0286] The upstream primer used for constructing pTargetF-yagM (the N20 sequence is GTTCTGCTCTCTTGTGAGTA, which is the upstream of the sgRNA sequence, and the sgRNA is shown in Sequence 27) is 1964-yagM-target (TCCTAGGTATAATACTAGTGTTCTGCTCTCTTGTGAGTAGTTTTAGAGCTAGAAATAGC). The primers used for constructing the yagM homologous fragment are 1978-yagM-1 (GTGTCCTGCCGGTTCATTTCATGATGAATC) / 1979-yagM-2 (CAGACTACTCCCATAAAAAAACACTCAGTCGAGGTAACAAAGAAGGACAAACAATTATG) and 1980-yagM-3 (CATAATTGTTTGTCCTTCTTTGTTACCTCGACTGAGTGTTTTTTTATGGGAGTAGTCTG) / 1981-yagM-4 (ACAAATCAATGGCCGCCATTACTGGTTACG).
[0287] The homologous fragment of yagM is shown in Sequence 22 of the Sequence Listing.
[0288] The recombinant bacterium obtained by knocking out yagM on the basis of EB237 was subjected to PCR (the primers were 1978-yagM-1 (GTGTCCTGCCGGTTCATTTCATGATGAATC) / 1981-yagM-4 (ACAAATCAATGGCCGCCATTACTGGTTACG)), and a band of about 600 bp was obtained. The control EB237 (pCas) was about 1.2 kb, and the recombinant bacterium was named EB238.
[0289] EB238 is a recombinant bacterium obtained by knocking out the middle fragment (nucleotides 121-855 of Sequence 16) of the yagM gene on the genome of EB237.
[0290] C. Fermentation of recombinant bacteria obtained by successively knocking out the yieP, stpA, yqeG, and yagM genes
[0291] The strains EB235, EB236, EB237, EB238 constructed in B above, together with EB234, were fermented in M9 medium for 48 hours and detected according to the HPLC detection method. The results are shown in Figure 6 . The results showed that the butanol production of strain EB238 increased by 15% compared with the starting strain.
[0292] V. Preparation of recombinant bacterium EB243 by enhancing the expression of the ter and crt genes in the butanol pathway
[0293] To further enhance the butanol synthesis ability, the relatively crucial ter and crt genes in the butanol pathway were integrated and expressed again on the chromosome of strain EB238. For the ribosome binding sites (RBSs) used for the expression of each gene, an RBS library was designed through the UTR Library Designer software to regulate the expression levels of ter and crt.
[0294] A. Construction of the RBS library for the ter gene
[0295] The untranslated region (UTR) at the front of the ter gene was designed as TGGAATTGTAAGRAKGAKATATAYM. Using the Escherichia coli BW25113 genome as a template, the upstream and downstream fragments of the yciA gene were amplified respectively with primers 2092-yciA::ter-1 (TTCGCTTTCGTAAGGTTGAGAAGATGGCCC) / 2093-yciA::ter-2 (TTCCACACATTATACGAGCCGATGATTAATTGTCAACAACGTTATGTGTTGTAGACATG) and 2096-yciA::ter-5 (GAGGTTGAACGCTTCGATCGTATCTAACTATAAAGCGACAGAAGCATTATTTAAGTATG) / 2097-yciA::ter-6 (AACCGCCAAAAGAAGCACCGGTGGTCATTG); using the plasmid pSM2-P containing the ter gene cpc560Using ter as a template, the ter gene fragment was amplified by PCR with primers 2094-yciA::ter-3 (AATTAATCATCGGCTCGTATAATGTGTGGAATGGAATTGTAAGRAKGAKATATAYMATG) and 2095-yciA::ter-4 (CATACTTAAATAATGCTTCTGTCGCTTTATAGTTAGATACGATCGAAGCGTTCAACCTC); Using the upstream and downstream fragments of the yciA gene and the ter gene fragment as templates, the upstream and downstream fragments of the yciA gene and the ter gene fragment were ligated together by fusion PCR with primers 2092-yciA::ter-1 (TTCGCTTTCGTAAGGTTGAGAAGATGGCCC) and 2097-yciA::ter-6 (AACCGCCAAAAGAAGCACCGGTGGTCATTG). In this process, the RBS library was ligated to the front end of the ter gene through primers, forming a ter gene library. Then, using the pTargetF plasmid as a template, linear pTargetF-yciA was amplified by PCR with primers 2052-pTarget-yciA (TCCTAGGTATAATACTAGTACGGTCGCGTAGTGACTGTGGTTTTAGAGCTAGAAATAGC) and 1876-pTargetF-F2 (ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG), and self-ligated to obtain the plasmid pTargetF-yciA containing the N20 sequence ACGGTCGCGTAGTGACTGTG (sgRNA, sequence 28).
[0296] The above ter gene library and pTargetF-yciA plasmid were transformed into EB238 (pCas). The grown colonies were verified and screened by PCR using primers 2092-yciA::ter-1 (TTCGCTTTCGTAAGGTTGAGAAGATGGCCC) and 2097-yciA::ter-6 (AACCGCCAAAAGAAGCACCGGTGGTCATTG), with EB238 (pCas) as a control. The recombinant bacteria obtained a band of about 1.5 kb, and the control was about 2.2 kb. Through homologous recombination, the ter gene operator was integrated into the yciA locus to obtain a mutant strain library with different expression intensities.
[0297] B. Fermentation screening of the ter gene RBS mutant library
[0298] According to the previous fermentation screening method, the ter gene mutant library was screened by HPLC, and the strain with the highest butanol production was named EB242. Compared with the control strain (EB238), the butanol production increased by 12%. The results are shown in Figure 7 .
[0299] After sequencing, EB242 was a strain obtained by integrating the fragment containing the ter gene and its RBS (sequence 25) into the yciA gene locus (sequence 31) of the EB238 genome.
[0300] The fragment containing the ter gene and its RBS includes the RBS (nucleotides 1-25 of sequence 25) and the ter gene (nucleotides 26-1219 of sequence 25).
[0301] C. Construction of the crt gene RBS library
[0302] Similarly, the UTR at the front end of the crt gene is designed as TGGAATYSTAAGAASSAKATATACC. Using the Escherichia coli BW25113 genome as a template, the upstream fragment and downstream fragment of the poxB gene were amplified using primers 2086-poxB::crt-1 (TTCACGTACCGTGATGACCTGCGGCCCGGC) / 2087-poxB::crt-2 (TTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTGCAACCGTTTGTTTCATG) and 2090-poxB::crt-5 (GATCGAGGGCTTCAAAAACCGCTAATGGCAGCGGCTATTTCCAGGAAACCCACCC) / 2091-poxB::crt-6 (TCGGGTAGAAGGCGCGGTAGGGAAATTGCG), respectively; using the Clostridium acetobutylicum DSM1731 genome as a template, the crt gene fragment was amplified by PCR using primers 2088-poxB::crt-3 (AATTAATCATCGGCTCGTATAATGTGTGGAATGGAATYSTAAGAASSAKATATACCATG) and 2089-poxB::crt-4 (GGGTGGGTTTCCTGGAAATAGCCGCTGCCATTAGCGGTTTTTGAAGCCCTCGATC); using the above-mentioned upstream and downstream fragments of the poxB gene and the crt gene fragment as templates, the upstream and downstream fragments of the poxB gene and the crt gene fragment were ligated together by fusion PCR using primers 2086-poxB::crt-1 (TTCACGTACCGTGATGACCTGCGGCCCGGC) and 2091-poxB::crt-6 (TCGGGTAGAAGGCGCGGTAGGGAAATTGCG). During this process, the RBS library was ligated to the front end of the crt gene through primers, forming a crt gene library. Then, using the pTargetF plasmid as a template, linear pTargetF-poxB was amplified by PCR using primers 2051-pTarget-poxB (TCCTAGGTATAATACTAGTGGCGCTGAAGCACAACTTAGGTTTTAGAGCTAGAAATAGC) and 1876-pTargetF-F2 (ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG), and self-ligated to obtain the plasmid pTargetF-poxB containing the N20 sequence GGCGCTGAAGCACAACTTAG (sgRNA, sequence 29).
[0303] The above crt gene library and pTargetF-poxB plasmid were transformed into EB242 (pCas). The grown colonies were screened by PCR verification using primers 2086-poxB::crt-1 (TTCACGTACCGTGATGACCTGCGGCCCGGC) and 2091-poxB::crt-6 (TCGGGTAGAAGGCGCGGTAGGGAAATTGCG), with EB242 (pCas) as the control. The recombinant bacteria yielded a 1.9 kb band, while the control was approximately 1.3 kb. Through homologous recombination, the crt gene operon was integrated into the poxB locus, obtaining a mutant strain library with different expression intensities.
[0304] D. Fermentation screening of the crt gene RBS mutant library yielded the recombinant bacterium EB243
[0305] According to the above fermentation screening method, the crt gene mutant library was screened by HPLC, and the strain with the highest butanol yield was named EB243. Compared with the control strain EB242, the butanol yield increased by 9%, and the results are shown in Figure 7 .
[0306] After sequencing, strain EB243 was obtained by integrating the fragment containing the crt gene and its RBS into the poxB gene locus (sequence 32) of the EB242 genome.
[0307] The fragment containing the crt gene and its RBS includes the RBS (nucleotides 1-25 of sequence 26) and the crt gene (nucleotides 26-811 of sequence 26).
[0308] Strain EB243 was deposited on March 9, 2016, at the General Microbiology Center of the China National Center for Culture Collection of Microorganisms (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101), with the deposit number CGMCC No. 12191 and the taxonomic name Escherichia coli.
[0309] VI. Fermentation of the recombinant bacterium EB243
[0310] To control the pH during the fermentation process and adopt a strategy of first aerobic growth to obtain a larger cell mass and then anaerobic butanol fermentation to further increase the butanol yield, a BioFlo 110 fermentation system from NBS Company was used for butanol fermentation. The volume of the fermenter was 7 L, the liquid filling volume was 3 L, the inoculation amount of the recombinant bacterium EB243 was 5%, the culture temperature in the fermenter was 37 °C, the rotation speed was 500 rpm, the pH was controlled at 6.30, and the fermentation medium was M9. Specifically: First, air was introduced at a level of 2 vvm for 12 hours to make the OD600 value reach 15 - 20, then the air was turned off, and the fermentation was carried out with stirring at 50 rpm.
[0311] The fermentation results are as Figure 8 shown, and the final butanol yield can reach 20 g / L, with a yield of 34%.
[0312] Table 8 shows all the bacteria and their construction methods
[0313]
[0314]
Claims
1. A method for constructing a recombinant bacterium, comprising the following steps: 1) Suppress the expression and / or activity of the pykA gene on the genome of the starting bacterium EB216 CGMCC No. 11590 for producing butanol, and increase the expression and / or activity of the fdh gene on the genome of the starting bacterium, to obtain the target bacterium A; 2) Domesticate the target bacterium A in an M9 medium with insufficient nitrogen source, to obtain the target bacterium B; 3) Suppress the expression and / or activity of the yieP, stpA, yqeG, and yagM genes on the genome of the target bacterium B, and increase the expression and / or activity of the ter gene and the crt gene in the target bacterium B, to obtain the recombinant bacterium; The suppression of the expression and / or activity of the pykA gene on the genome of the starting bacterium for producing butanol is to knockout the pykA gene on the genome of the starting bacterium; The increase in the expression and / or activity of the fdh gene on the genome of the starting bacterium is to increase the copy number of the fdh gene in the genome of the starting bacterium; The suppression of the expression and / or activity of the yieP, stpA, yqeG, and yagM genes on the genome of the target bacterium B is to knockout all or partial fragments of the yieP, stpA, yqeG, and yagM genes on the genome of the starting bacterium; The increase in the expression and / or activity of the ter gene and the crt gene in the target bacterium B is to increase the copy number of the ter gene and the crt gene in the target bacterium B; The increase in the copy number of the fdh gene in the genome of the starting bacterium is to integrate the fdh gene and its promoter onto the genome of the starting bacterium; The increase in the copy number of the ter gene and the crt gene in the target bacterium B is to integrate the ter gene and its RBS and the crt gene and its RBS onto the genome of the target bacterium B.
2. The method according to claim 1, wherein: Both the knockout or integration are carried out by means of genome site-directed editing or homologous recombination; The genome site-directed editing specifically refers to ZFN editing, TALEN editing or CRISPR / Cas9 editing; The homologous recombination specifically refers to λ-red homologous recombination, homologous recombination mediated by sacB gene screening or homologous recombination mediated by an integration plasmid.
3. The method according to claim 1 or 2, wherein: Knocking out the pykA gene on the genome of the starting bacterium means replacing the pykA gene on the genome of the starting bacterium with FRT by using the λ-red homologous recombination system; Integrating the fdh gene and its promoter into the genome of the target bacterium A means replacing the maeB gene on the genome of the starting bacterium with fragment 1 containing fdh and its promoter by using an integration plasmid, and replacing the FRT at the mdh gene locus on the genome of the starting bacterium with fragment 2 containing fdh and its promoter; The nucleotide sequence of fragment 1 containing fdh and its promoter is specifically the nucleotide positions 941-2535 of sequence 23; The nucleotide sequence of fragment 2 containing fdh and its promoter is specifically the nucleotide positions 931-2525 of sequence 24; Knocking out partial fragments of the yieP, stpA, yqeG and yagM genes on the genome of the starting bacterium means using the CRISPR / Cas system to knock out the nucleotide positions 70-619 of the yieP gene sequence, the nucleotide positions 74-373 of the stpA gene sequence, the nucleotide positions 1-695 of the yqeG gene sequence, and the nucleotide positions 121-855 of the yagM gene sequence respectively; The target genes for knocking out the yieP, stpA, yqeG and yagM genes by using the CRISPR / Cas system are the yieP, stpA, yqeG and yagM genes respectively; The nucleotide sequences of the sgRNAs for knocking out the yieP, stpA, yqeG and yagM genes by using the CRISPR / Cas system are sequence 33, sequence 34, sequence 35 and sequence 27 respectively; Integrating the ter gene and its RBS into the genome of the target bacterium B means using the CRISPR / Cas system to replace the yciA gene on the genome of the target bacterium B with the fragment containing the ter gene and its RBS; The nucleotide sequence of the fragment containing the ter gene and its RBS is sequence 25; The target gene for knocking out the yciA gene by using the CRISPR / Cas system is the yciA gene; The nucleotide sequence of the sgRNA for knocking out the yciA gene by using the CRISPR / Cas system is sequence 28; Integrating the crt gene and its RBS into the genome of the target bacterium B means using the CRISPR / Cas system to replace the poxB gene on the genome of the target bacterium B with the fragment containing the crt gene and its RBS; The nucleotide sequence of the fragment containing the crt gene and its RBS is sequence 26; The target gene for knocking out the poxB gene by using the CRISPR / Cas system is the poxB gene; The nucleotide sequence of the sgRNA for knocking out the poxB gene using the CRISPR / Cas system is sequence 29.
4. The method according to any one of claims 1-3, characterized in that: In step 2, the domestication of the target bacteria A in the M9 medium with insufficient nitrogen source comprises the following steps: 2)-1, transferring and acclimating the target bacteria A in M9 medium with glucose as the carbon source to obtain a strain with a butanol production greater than 6 g / L; 2)-2, transferring the strain with a butanol yield greater than 6 g / L obtained in 2)-1 to a modified M9 medium with gluconic acid as a carbon source for acclimatization until a strain with a constant butanol yield is obtained; 2)-3, the strain with unchanged butanol production obtained in 2)-2 is transferred to the M9 medium with glucose as the carbon source and domesticated until a strain with unchanged butanol production is obtained; named as target strain B.
5. A recombinant bacterium prepared by the method according to any one of claims 1-4.
6. The recombinant bacterium according to claim 5, characterized in that: The deposit number of the recombinant bacteria is CGMCC No.12191.
7. Use of the method according to any one of claims 1-4 or the recombinant bacterium according to claim 5 or 6 in the production of butanol or for increasing the butanol yield; Or a method for producing butanol, fermenting the recombinant bacterium according to claim 5 or 6 to obtain butanol.
Citation Information
Patent Citations
Recombinant escherichia coli and application thereof to 2-butanol production
CN105274041A
Butanol production by metabolically engineered yeast
WO2008080124A3
Method for constructing high-yield butanol bacterial strains and application thereof
CN105368863A