Primer ACY of a Ty-3 molecular marker and a labeling method thereof
By designing the Ty-3 molecular marker primer ACY, the problem of controlling tomato yellow leaf curl virus disease was solved, the accurate screening of disease-resistant varieties was achieved, false positives were avoided, the breeding process was simplified, and the breeding efficiency was improved.
Patent Information
- Application Number
- CN201711129426.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2017-11-15
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2037-11-15
AI Technical Summary
In the current technology, the control measures for tomato yellow leaf curl virus disease are not ideal. Traditional physical and chemical control measures are difficult to effectively control the spread of the disease, and molecular markers are prone to false positives in breeding, resulting in inaccurate disease resistance identification.
A specific molecular marker primer ACY for the tomato yellow leaf curl disease resistance gene Ty-3 was designed. Through PCR amplification and polyacrylamide gel electrophoresis, resistant and susceptible varieties were accurately distinguished, avoiding false positives and simplifying the breeding process.
This method enables accurate and efficient screening of tomato yellow leaf curl virus, simplifies the breeding process, reduces costs and time, and ensures the reliability of identification results.
Smart Images

Figure CN107794310B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a Ty-3 molecularly labeled primer ACY and its indexing method, belonging to the field of bioengineering technology. Background Technology
[0002] Tomato yellow leaf curl disease (TYLCD) is a devastating disease of tomato (S. lycopersicum) caused by tomato yellow leaf curl virus (TYLCV) of the Geminidaceae family. TYLCD was first reported in Israel in the late 1930s. In the 1960s, the disease caused a major outbreak in tomatoes in the Mediterranean Basin (Antignus et al. 1994), subsequently spreading to Africa, Europe, Asia, the Caribbean, and North America. The disease often causes enormous yield losses in tomatoes, sometimes reaching 100% (Antignus et al. 1994; Pico et al. 1996; Czosnek et al. 1997; Polston et al. 1997; Delatte et al. 2005). Tomato yellow leaf curl virus (TYLCD) was first discovered in Nanning, Guangxi Province in 1998 (Liu Yule et al., 1998), and subsequently occurred in different tomato-growing areas across China. For a long time, TYLCD has been controlled by managing whitefly populations. However, due to the highly efficient reproduction and transmission of whiteflies, traditional physical and chemical control measures have not been very effective. Furthermore, while chemical reagents can reduce some yield losses in tomatoes, they easily lead to whitefly resistance and exacerbate environmental pollution (Cahill et al. 1996a, 1996b; Elbert and Nauen 2000; Picó et al. 1996; McCauley et al. 2006; Chowdhury et al. 2013). Therefore, the most economical, effective, and environmentally friendly measure to solve this disease is to cultivate disease-resistant varieties to fundamentally control tomato yellow leaf curl virus.
[0003] To date, the Ty resistance genes identified from wild tomatoes include Ty-1, Ty-2, Ty-3, Ty-3a, Ty-4, and Ty-6. Ty-1, in particular, from Chilean tomatoes, was considered the primary source of disease resistance genes for tomato breeding and was subsequently shown to be an allele of Ty-3 (Verlaan et al. 2011, 2013). With the development of molecular biology, molecular markers have been widely used in marker-assisted selection breeding of tomatoes, including CAPS, SNP, and SCAR markers. Many Ty-1 / Ty-3 related molecular markers have been designed. However, most molecular markers are some distance from the resistance genes, leading to false positives during the marker-assisted selection process due to the exchange of linked markers with the resistance genes (Ji et al., 2007, 2012). Furthermore, some markers, such as the CAPS marker, require two lengthy steps in practical applications: PCR amplification and restriction enzyme digestion of the amplified product. This makes their genotyping time-consuming and costly. Summary of the Invention
[0004] The technical problem this invention aims to solve is to provide a stable, accurate, and efficient functional marker primer ACY specific to the Ty-3 gene. This marker primer ACY avoids false positives caused by crossover in practical applications, making the detection results more accurate and reliable. It can be widely used in Ty-resistant tomato breeding and can more effectively prevent the occurrence of yellow leaf curl virus disease.
[0005] The technical solution adopted by this invention to solve its technical problem is: a primer ACY for a molecular marker of the tomato yellow leaf curl disease resistance gene Ty-3, wherein the specific marker primer sequence for the tomato Ty-3 resistance gene is as follows:
[0006] The forward primer sequence is F: 5'-CCTTATGATGTCTCGTGAAAGG-3'
[0007] The reverse primer sequence is R: 5'-GAAGCACAGATTGAAGAAAACC-3'.
[0008] Furthermore, the marker primer ACY amplified a 132bp fragment for resistant varieties and a 123bp fragment for susceptible varieties using the molecular marker.
[0009] A method for labeling the tomato yellow leaf curl disease resistance gene Ty-3 involves using the aforementioned primers ACY to perform PCR amplification on the DNA of the target material, and detecting the amplification product. If a 132bp amplified fragment is amplified, it indicates that the hybrid offspring contains the tomato yellow leaf curl disease resistance gene Ty-3; otherwise, it indicates that the offspring does not contain the tomato yellow leaf curl disease resistance gene Ty-3.
[0010] Furthermore, the PCR amplification reaction system is 25 μL, including 12.5 μL 2×Taq MasterMix, 1 μL DNA extract, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL ddH2O. The reaction program is as follows: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 2 min, and then the reaction is maintained at 4℃.
[0011] Furthermore, the amplified products are separated into PCR amplified fragments by 8% polyacrylamide gel electrophoresis, silver stained, and the amplified DNA bands are displayed under white light.
[0012] Furthermore, it also includes detecting the quality and concentration of the target material's DNA using agarose gel electrophoresis and spectrophotometry.
[0013] The application of the molecular marker primer ACY in screening tomato varieties resistant to yellow leaf curl virus (YFFV) was demonstrated. By using primer ACY, tomato varieties resistant to YFFV can be screened reliably and stably, thus preventing the occurrence of the disease.
[0014] The beneficial effects of this invention are that PCR amplification of genomic DNA from tomato leaves of both resistant and susceptible to tomato yellow leaf curl virus (TYLCV) yields accurate and efficient molecular markers that distinguish between resistant and susceptible varieties. These markers are stable and reliable, facilitating marker-assisted selection (MAS) breeding of tomatoes. The Ty-3-specific molecular marker primers designed in this invention amplify a 132 bp band in resistant varieties and a 123 bp band in susceptible varieties. The bands are clear, and because the primers are designed within the gene region, false positives due to crossover do not occur, ensuring the accuracy and reliability of the identification results. The identification results are completely consistent with the field phenotypes of the materials used. Using this molecular marker-assisted selection of resistant varieties is simple to operate, saving time and costs. With this invention, only simple extraction of tomato leaf genomic DNA, followed by PCR amplification and polyacrylamide gel electrophoresis, is needed to effectively identify whether tomato materials are resistant to Ty-3 and select resistant varieties. This not only avoids the cumbersome screening process of conventional breeding methods but, more importantly, avoids false positives due to crossover in practical applications of linked markers, making the disease resistance identification results more accurate, reliable, and efficient. Before amplification, the concentration of the target material DNA was detected by agarose gel electrophoresis and spectrophotometry to ensure the quality of the DNA used for amplification and further ensure the labeling results. Attached Figure Description
[0015] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0016] Figure 1 . Design of new ACY primers and DNA sequence diagram.
[0017] Figure 2 Sequencing results of four commercial tomato varieties.
[0018] Figure 3 The ACY function is used to filter the results.
[0019] Figure 4 .Linkage marker P6-25 screening results.
[0020] Figure 5 Results of F2 population amplification in polyacrylamide gel. Detailed Implementation
[0021] The present invention will now be described in further detail with reference to the accompanying drawings. These drawings are simplified schematic diagrams, illustrating only the basic structure of the invention, and therefore only show the components relevant to the invention.
[0022] Example 1:
[0023] This embodiment uses the BLAST tool in the NCBI database to perform sequence alignment of the Ty-3 candidate gene Solyc06g051170 with the genome sequences of wild tomato (Solanum pennellii) and cultivated tomato (Solanum lycopersicum). Sequences of single bases, 2 bases, 3 bases, 4 bases, and even 9 and 10 bases were found. Based on the 9 and 10 base deletions, primers were designed, and PCR amplification was performed on 6 resistant and 6 susceptible commercial varieties. The primers designed based on the 10 bp deletion showed that they could effectively distinguish between resistant and susceptible varieties, with clear and distinct banding patterns. The amplified band size of the resistant variety was 132 bp, while the fragment size of the susceptible variety was 123 bp. The InDel marker is predicted to be located on chromosome 6 of tomato, at the position of the 4th intron of the Ty-3 candidate gene solyc06g051170 fragment. Figure 1 As shown in A, B, and C, A represents the preliminary mapping position of the ACY marker on tomato chromosome 6; B represents the predicted structure of the Ty-3 gene locus Solyc06g051170 (consisting of 12 exons and 11 introns), with the InDel deletion located at the position of the 4th intron; and C represents the 10bp insertion / deletion alignment between wild tomato and cultivated tomato gene sequences.
[0024] Since the gene fragment amplified by this marker is approximately 130 bp in size, to facilitate sequencing via vector conjugation, we designed new primers Seq-F and Seq-R before and after the marker, such as... Figure 1As shown in Figure D, D represents a schematic diagram of primer design, where X represents the InDel insertion / deletion position; a represents the DNA fragment amplified by primer pairs ACY-F and ACY-R (132 or 123 bp); b represents the DNA fragment amplified by Seq-F and Seq-R (630 bp) for sequencing.
[0025] Using two disease-resistant varieties, Fengman 7 and Fengman 4, and two susceptible varieties, Hi-techo1 and Hi-techo2, PCR amplification was performed, followed by ligation into a T-vector and sequencing. The results showed that compared to the resistant varieties Fengman 7 and Fengman 4, the susceptible varieties Hi-techo1 and Hi-techo2 did indeed have a 10bp deletion. Figure 2 As shown.
[0026] PCR amplification was performed on 36 commercially available varieties with known resistance using the functional marker ACY. All resistant varieties amplified a 132 bp band, while all susceptible varieties amplified a 123 bp band. Figure 3 As shown. The PCR results were consistent with the field identification results, indicating that this marker can fully identify the resistance to tomato yellow leaf curl disease. In addition, PCR amplification was performed on 36 commercial varieties using the linkage marker P6-25 (F: GGTAGTGGAAATGATGCTGCTC, R: GCTCTGCCTATTGTCCC ATATATAACC) of the tomato Ty-3 gene. It was found that the molecular marker results in three varieties—Aiji 115, Dongfeng 601, and Nongbo Fenba 1510—were inconsistent with the field phenotype. This may be because the linkage marker P6-25 is some distance from the resistance gene Ty-3. Figure 4 As shown. Among them, Figure 3 In this study, the functional marker ACY is based on molecular screening using polyacrylamide gel electrophoresis, where M represents a 500bp marker. Figure 4In the data, the linkage marker P6-25 was determined based on molecular screening results using agarose gel electrophoresis, with M representing a 2000 bp marker; * indicates an exchange between the disease resistance gene and the linkage marker; 1=PinkBebe, 2=Millennium, 3=HuangRong, 4=JiaXina (74-112), 5=Manxina (73-47), 6=Fortes 72-152, 7=Mantian 2025, 8=Hi-techo1, 9= Hi-techo2, 10=Yuyi Liangjingjing, 11=Aomei No.1, 12=Oudun, 13=Aiji 112, 14=Aiji 115, 15=Aiji 158, 16=Aiji 1330, 17=Fengman No.7, 18=Fengman No.4, 19=Dongfeng 601, 20=Nongbo Fenba 1510, 21=Zhonghua Lvbao, 22=Jingfan 102, 23=Duoxi 13-1, 24=Nongqing 12-7, 25=Jinpeng M703, 26=Tianbao 326, 27=Yabao, 28=Luola, 29=Beiying, 30=Qidali, 31=Fengshou 74-560, 32=Aiji 208, 33=Mantian 2218, 34=Mantian 2199, 35=Jingfan 502, 36=Hongshuangxi (4224).
[0027] The labeling method and validation results of the marker primer ACY used in this implementation are as follows:
[0028] (I) Materials and Methods
[0029] 1. Plant materials
[0030] This study used 36 known resistant tomato commercial varieties (Table 1) and 111 tomato F2 segregating populations. The commercial varieties included 29 Ty-resistant varieties and 7 susceptible varieties from different regions of China, while the F2 segregating populations were provided by Jiangsu Lvgang Modern Agricultural Development Co., Ltd. (Lvgang). Sowing, transplanting, and field management were conducted according to Lvgang's experimental methods. To screen for the TYLCV phenotype, tomatoes were grown in a greenhouse to meet the critical period for whitefly invasion.
[0031] 2. DNA Extraction and Detection
[0032] Tomato genomic DNA was extracted from fresh plant leaves at 30 days old using a plant genomic DNA kit (CWO531M) (Beijing Kangwei Century Biotechnology Co., Ltd.).
[0033] DNA quality and concentration were determined by agarose gel electrophoresis and spectrophotometry.
[0034] 3. Primer design
[0035] Based on the genomic sequence of the Ty-3 candidate gene solyc06g051170, the sequences of cultivated and wild tomatoes were compared using the BLAST tool in the NCBI database. The results predicted that the resistance allele sequence originated from wild-type tomatoes, while the susceptibility allele sequence originated from cultivated tomatoes. Utilizing the differences between the resistance and susceptibility sequences, a Ty-3 gene-specific functional marker was developed, and primers were designed using Primer 5.0 software. The new marker ACY amplified a 132 bp polymorphic DNA fragment in resistant varieties and a 123 bp fragment in susceptible varieties.
[0036] The forward primer sequence is F: 5'-CCTTATGATGTCTCGTGAAAGG-3'
[0037] The reverse primer sequence is R: 5'-GAAGCACAGATTGAAGAAAACC-3'
[0038] 4. PCR amplification and detection
[0039] PCR amplification was performed on a LY96G Thermocycler™ instrument from Huasheng Technology Co., Ltd. The reaction volume was 25 μL, including 12.5 μL 2×Taq MasterMix, 1 μL DNA extract, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL ddH2O. The reaction program was: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, followed by a 72℃ extension for 2 min, and then holding the reaction at 4℃. The PCR-amplified fragments were separated by 8% polyacrylamide gel electrophoresis, silver-stained, and visualized under white light.
[0040] 5. Single-plant verification
[0041] By planting 36 commercial tomato varieties and 111 F2 segregating populations, the disease was identified through inoculation at the seedling stage with greenhouse whitefly infection. The field disease grading standard was based on Hutton and Scott (2014). Genomic DNA was extracted from each material and amplified using the new marker ACY. The field identification results were compared with the molecular marker results to complete single-plant verification.
[0042] (II) Results and Analysis
[0043] 1. Detection and analysis of genomic DNA from selected materials
[0044] The concentration of genomic DNA extracted from 147 tomato leaves in this study was determined using a DeNovix DS-11 ultra-micro UV-Vis spectrophotometer. The results showed that the extracted DNA concentrations were all above 100 ng / μl, and the OD260 / OD280 ratios were generally between 1.8 and 2.0. Different concentrations of DNA were analyzed by 2% agarose gel electrophoresis. The electrophoretic images were clear and bright, without obvious tailing, indicating good DNA quality. Therefore, the high-quality tomato leaf genomic DNA extracted is suitable for biological experiments involving molecular markers such as PCR amplification and SSR.
[0045] 2. PCR amplification and field validation
[0046] The tomato Ty-3 gene-specific markers F:5'-CCTTATGATGTCTCGTGAAAGG-3' and R:5'-GAAGCACAGATTGAAGAAAACC-3' of this invention were used to amplify 36 commercial tomato varieties. The results are shown in the figure. Figure 3 As can be clearly seen in the figure, a 123bp band was amplified in the susceptible varieties, while a 132bp fragment was amplified in the resistant varieties, and the field phenotype was completely consistent with the molecular marker results (Table 1).
[0047]
[0048] In 2017, an F2 generation segregating population of 111 individual plants was planted. Greenhouse whitefly infestation identification was used. The results showed that among the 111 F2 plants investigated, 75 plants were resistant (60 showing type 0, 10 showing type 1, and 5 showing type 2), and 36 plants were susceptible (25 showing type 3 and 11 showing type 4), as shown in Table 2. Chi-square tests confirmed that the segregation ratio of the F2 segregating population was 3:1 (X2=3.26, X2=0.05, I=3.84).
[0049]
[0050] Note: R: number of resistant plants; S: number of susceptible plants; The chi-square test showed that at a confidence level of 0.05, the chi-square values were all less than chi-square 0.05 (3.84), and the resistance-susceptibility ratio of the F2 generation segregating population did not deviate from the expected value (3:1).
[0051] Electrophoresis results of the F2 generation segregating population are shown below. Figure 5As clearly shown in the figure, 75 plants (0DSL~2DSL) amplified a 132bp band indicating resistance, while 36 plants (3DSL~4DSL) amplified a 123bp band indicating susceptibility. The molecular marker results are consistent with the field assessment. The clear separation of the bands indicating resistance and susceptibility demonstrates that this marker pair can accurately and reliably detect resistant and susceptible varieties. Figure 5 In this diagram, M represents a 500bp marker; 0DSL indicates a field phenotype of level 0; 1DSL indicates a field phenotype of level 1; 2DSL indicates a field phenotype of level 2; 3DSL indicates a field phenotype of level 3; and 4DSL indicates a field phenotype of level 4.
[0052] Therefore, by using the primer ACY of this invention, tomato varieties resistant to yellow leaf curl virus can be screened very accurately, thus preventing the occurrence of the disease.
[0053] Based on the above-described preferred embodiments of the present invention, and through the foregoing description, those skilled in the art can make various changes and modifications without departing from the inventive concept. The technical scope of this invention is not limited to the contents of the specification, but must be determined according to the scope of the claims.
[0054] <110>
[0055] <120> A Ty-3 molecularly labeled primer ACY and its indexing method
[0056] <160> 2
[0057] <170> Primer 5.0
[0058] <210> 1
[0059] <211> twenty two
[0060] <212> DNA
[0061] <213> Artificial sequence
[0062] <223> ACY (forward primer sequence)
[0063] <400> 1
[0064] CCTTATGATGTCTCGTGAAAGG 22
[0065] <210> 2
[0066] <211> twenty two
[0067] <212> DNA
[0068] <213> Artificial sequence
[0069] <223> ACY (reverse primer sequence)
[0070] <223> 2
[0071] GAAGCACAGATTGAAGAAAACC 22 sequence list <110> Jiangsu Lvgang Modern Agriculture Development Co., Ltd. <120> A Ty-3 molecularly labeled primer ACY and its indexing method <160> 2 <170> Primer 5.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <223> ACY (forward primer sequence) <400> 1 CCTTATGATGTCTCGTGAAAGG 22 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence <223> ACY (reverse primer sequence) <400> 2 GAAGCACAGATTGAAGAAAACC 22
Claims
1. A primer ACY for a molecular marker of the tomato yellow leaf curl disease resistance gene Ty-3, characterized in that, The primer sequence for the tomato Ty-3 resistance gene specific marker is as follows: The forward primer sequence is F: 5'-CCTTATGATGTCTCGTGAAAGG-3' The reverse primer sequence is R: 5'-GAAGCACAGATTGAAGAAAACC-3'; The tomato Ty-3 resistance gene-specific marker is located at the position of the fourth intron of the Ty-3 candidate gene solyc06g051170 fragment on tomato chromosome 6.
2. The primer ACY for the Ty-3 molecular marker of tomato yellow leaf curl disease resistance gene according to claim 1, characterized in that, The marker primer ACY amplified a 132bp fragment for resistant varieties and a 123bp fragment for susceptible varieties.
3. A method for labeling the Ty-3 gene, a resistance gene to tomato yellow leaf curl disease, characterized in that, The DNA of the target material was amplified by PCR using the primer ACY as described in claim 1. The amplification product was then detected. If a 132bp amplification fragment was amplified, it indicated that the hybrid offspring contained the tomato yellow leaf curl resistance gene Ty-3; otherwise, it indicated that the offspring did not contain the tomato yellow leaf curl resistance gene Ty-3.
4. The method for labeling the tomato yellow leaf curl disease resistance gene Ty-3 according to claim 3, characterized in that, The PCR amplification reaction system was 25 μL, including 12.5 μL 2×Taq MasterMix, 1 μL DNA extract, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL ddH2O. The reaction program was 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 2 min, and then the reaction was maintained at 4℃.
5. The method for labeling the tomato yellow leaf curl disease resistance gene Ty-3 according to claim 3, characterized in that, The amplified products were separated into PCR amplified fragments by 8% polyacrylamide gel electrophoresis, silver stained, and the amplified DNA bands were displayed under white light. The concentration of the target material DNA was detected by agarose gel electrophoresis and spectrophotometry before amplification.
6. The application of the molecular marker primer ACY as described in claim 1 in screening tomato varieties resistant to yellow leaf curl virus, wherein the method of application is as follows: The tomato DNA was amplified using the primer ACY, which is the molecular marker. The amplified product was then tested. If a 132bp amplified fragment was obtained, it indicates that the tomato is a tomato variety resistant to yellow leaf curl virus.
Citation Information
Patent Citations
Molecular marker method linked with tomato yellow leaf curl disease resistance gene Ty-2
CN102604941A
Molecular marker method for identifying tomato yellow leaf curl virus resistance gene Ty-1
CN104726602A
InDel molecular marker based on TYLCV (tomato yellow leaf curl virus) resistance gene Ty-3
CN105647920A