Antibodies targeting il-13ra2 and uses thereof

Abstract

The present application relates to antibodies against IL-13RA2 and uses thereof. The present application discloses new antibodies specifically recognizing IL-13RA2. The antibodies of the present application can be used in the preparation of targeted anti-tumor drugs and drugs for diagnosing tumors.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of tumor immunotherapy or diagnosis, more particularly, to antibodies specifically recognizing IL-13RA2 and uses thereof. BACKGROUND

[0002] Malignant gliomas (MG), including glioblastoma multiforme and glioblastoma, are a rare disease with 20000 new cases per year in the United States. According to the statistics of the American Brain Tumor Association, as of 2010, there are 140000 people in the United States suffering from malignant brain tumors. Although MG is a rare disease, its malignancy and mortality are very high. The existing standard treatment has very limited effect, and the five-year survival rate after surgery and radiotherapy is very low. For patients who relapse after surgery, there are also very few new treatment options. Therefore, developing new targets and new treatment methods is the urgent need of the majority of patients.

[0003] Interleukin-13 Receptor subunit alpha 2 (IL-13RA2) is a tumor-specific marker specifically highly expressed on the surface of human glioma and other malignant tumor cells (Dehinski et al., (1995) Clin. Cancer Res. 1, 1253-1258). Human IL-13RA2 as a therapeutic target for human glioma has attracted the attention of the US FDA as early as 1988, and the organization has prepared IL-13-PE38 targeting human IL-13RA2 and single-chain antibody scFv-PE fusion molecules targeting human IL-13RA2. Although IL-13-PE38 has achieved therapeutic effects in the treatment of malignant tumors such as glioma, head and neck tumors, ovarian cancer, and kidney cancer, and has been approved by the US FDA for clinical treatment, but during the treatment, IL-13-PE38 not only binds to human IL-13RA2 specifically expressed on the surface of tumor cells, but also binds to IL13-RA1 expressed on the surface of normal tissue cells, damaging normal tissues and cells. Due to the lack of strict targeting, the further application of IL-13-PE38 is limited.

[0004] The purpose of the present application is to find antibodies specifically targeting IL-13RA2 and to develop immune effector cells targeting IL-13RA2. SUMMARY

[0005] The purpose of the present application is to provide antibodies against IL-13RA2 and uses thereof.

[0006] In a first aspect, the present application provides an antibody specifically recognizing IL-13RA2, which has a relative affinity EC50 50 not higher than 100 nM, preferably not higher than 10 nM, more preferably 0.01-10 nM.

[0007] In a preferred example, the processing of the relative affinity data uses GraphPad Prism 5 software (GraphPad Software, Inc).

[0008] In a specific embodiment, the antibody is selected from any one of the following:

[0009] (1) an antibody comprising a heavy chain variable region comprising HCDR1 as shown in SEQ ID NO: 9, 45, 46, 47, 48, 49, 50, 51, 63, or 64, and / or comprising HCDR2 as shown in SEQ ID NO: 10, 52, 53, 54, 55, 56, 57, 58, 65, or 66, and / or comprising HCDR3 as shown in any one of SEQ ID NO: 11 or SEQ ID NO: 12;

[0010] (2) an antibody comprising a light chain variable region comprising LCDR1 as shown in SEQ ID NO: 13, and / or comprising LCDR2 as shown in SEQ ID NO: 14, and / or comprising LCDR3 as shown in any one of SEQ ID NO: 15 or SEQ ID NO: 16;

[0011] (3) an antibody comprising the heavy chain variable region of the antibody of (1) and the light chain variable region of the antibody of (2);

[0012] (4) a variant of the antibody of any one of (1) to (3), and having the same or similar activity as the antibody of any one of (1) to (3).

[0013] In a specific embodiment, the antibody is selected from any one of the following:

[0014] (1) an antibody comprising a light chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 4, the amino acid sequence as shown in SEQ ID NO: 8, or a sequence of a variant of SEQ ID NO: 4 and SEQ ID NO: 8;

[0015] (2) an antibody comprising a heavy chain variable region having the sequence as shown in SEQ ID NO: 2, 6, 29, 31, 33, 35, 37, 39, 41, 43, 59, or 61, or a variant of the above sequence;

[0016] (3) an antibody comprising (1) a heavy chain variable region of the antibody and (2) a light chain variable region of the antibody.

[0017] In a specific embodiment, the light chain variable region of the antibody comprises LCDR1 of SEQ ID NO: 13, LCDR2 of SEQ ID NO: 14, and LCDR3 of SEQ ID NO: 15 or SEQ ID NO: 16.

[0018] In a specific embodiment, the light chain variable region of the antibody has the sequence of SEQ ID NO: 4 or 8, or a sequence that is at least 80%, for example, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% similar to any of the above sequences.

[0019] In a specific embodiment, the heavy chain variable region of the antibody comprises HCDR1 of SEQ ID NO: 9, 45, 46, 47, 48, 49, 50, 51, 63, or 64, HCDR2 of SEQ ID NO: 10, 52, 53, 54, 55, 56, 57, 58, 65, or 66, and HCDR3 of SEQ ID NO: 11 or SEQ ID NO: 12.

[0020] In a specific embodiment, the heavy chain variable region of the antibody has the sequence of SEQ ID NO: 2, 6, 29, 31, 33, 35, 37, 39, 41, 43, 59, or 61, or a sequence that is at least 80%, more preferably 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% similar to any of the above sequences.

[0021] In a specific embodiment, the CDR regions of the light chain variable region and the CDR regions of the heavy chain variable region have the following optional sequences or variants thereof:

[0022] (1) LCDR1 of SEQ ID NO: 13, LCDR2 of SEQ ID NO: 14, and LCDR3 of SEQ ID NO: 15; HCDR1 of SEQ ID NO: 9, HCDR2 of SEQ ID NO: 10, and HCDR3 of SEQ ID NO: 11;

[0023] (2) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 16; HCDR1 as set forth in SEQ ID NO: 9, HCDR2 as set forth in SEQ ID NO: 10, and HCDR3 as set forth in SEQ ID NO: 12;

[0024] (3) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 16; HCDR1 as set forth in SEQ ID NO: 64, HCDR2 as set forth in SEQ ID NO: 66, and HCDR3 as set forth in SEQ ID NO: 12;

[0025] (4) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 45, HCDR2 as set forth in SEQ ID NO: 52, and HCDR3 as set forth in SEQ ID NO: 11;

[0026] (5) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 16; HCDR1 as set forth in SEQ ID NO: 63, HCDR2 as set forth in SEQ ID NO: 65, and HCDR3 as set forth in SEQ ID NO: 12;

[0027] (6) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 50, HCDR2 as set forth in SEQ ID NO: 56, and HCDR3 as set forth in SEQ ID NO: 11;

[0028] (7) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 46, HCDR2 as set forth in SEQ ID NO: 52, and HCDR3 as set forth in SEQ ID NO: 11;

[0029] (8) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 48, HCDR2 as set forth in SEQ ID NO: 54, and HCDR3 as set forth in SEQ ID NO: 11;

[0030] (9) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 47, HCDR2 as set forth in SEQ ID NO: 53, and HCDR3 as set forth in SEQ ID NO: 11;

[0031] (10) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 49, HCDR2 as set forth in SEQ ID NO: 55, and HCDR3 as set forth in SEQ ID NO: 11;

[0032] (11) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 51, HCDR2 as set forth in SEQ ID NO: 57, and HCDR3 as set forth in SEQ ID NO: 11;

[0033] (12) LCDR1 as set forth in SEQ ID NO: 13, LCDR2 as set forth in SEQ ID NO: 14, and LCDR3 as set forth in SEQ ID NO: 15; HCDR1 as set forth in SEQ ID NO: 49, HCDR2 as set forth in SEQ ID NO: 58, and HCDR3 as set forth in SEQ ID NO: 11.

[0034] In a specific embodiment,

[0035] (1) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 2 or a variant thereof;

[0036] (2) the light chain variable region has a sequence as set forth in SEQ ID NO: 8 or a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 6 or a variant thereof;

[0037] (3) the light chain variable region has a sequence as set forth in SEQ ID NO: 8 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 61 or a sequence of a variant thereof;

[0038] (4) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 29 or a sequence of a variant thereof;

[0039] (5) the light chain variable region has a sequence as set forth in SEQ ID NO: 8 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 59 or a sequence of a variant thereof;

[0040] (6) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 39 or a sequence of a variant thereof;

[0041] (7) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 31 or a sequence of a variant thereof;

[0042] (8) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 35 or a sequence of a variant thereof;

[0043] (9) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 33 or a sequence of a variant thereof;

[0044] (10) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 37 or a sequence of a variant thereof;

[0045] (11) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 41 or a sequence of a variant thereof;

[0046] (12) the light chain variable region has a sequence as set forth in SEQ ID NO: 4 or a sequence of a variant thereof, and the heavy chain variable region has a sequence as set forth in SEQ ID NO: 43 or a sequence of a variant thereof.

[0047] In a second aspect, the present application provides an antibody which specifically recognizes IL-13RA2, which recognizes the same epitope as the antibody of the first aspect.

[0048] In a third aspect, the present application provides an antibody which specifically recognizes IL-13RA2, which competes with the antibody of the first aspect for binding to IL-13RA2.

[0049] In a fourth aspect, the present application provides a nucleic acid encoding the antibody of the first to third aspects.

[0050] In a fifth aspect, the present application provides an expression vector comprising the nucleic acid of the fourth aspect.

[0051] In a sixth aspect, the present application provides a host cell comprising the expression vector of the fifth aspect or the nucleic acid of the fourth aspect integrated in the genome.

[0052] In a seventh aspect, the present application provides a multifunctional immunoconjugate comprising:

[0053] the antibody of the first to third aspects; and

[0054] a functional molecule attached thereto; said functional molecule being selected from the group consisting of a molecule targeting a tumor surface marker, a molecule inhibiting a tumor, a molecule targeting a surface marker of an immune cell or a detectable label.

[0055] In a particular embodiment, said molecule targeting a tumor surface marker is an antibody or a ligand binding to a tumor surface marker other than IL-13RA2; or

[0056] said molecule inhibiting a tumor is an anti-tumor cytokine or an anti-tumor toxin; preferably, said cytokine is selected from the group consisting of IL-12, IL-15, type I interferon, TNF-alpha.

[0057] In a particular embodiment, said molecule targeting a surface marker of an immune cell is an antibody binding to a surface marker of an immune cell, preferably, said antibody binding to a surface marker of an immune cell is selected from the group consisting of CD3, CD16, CD28, more preferably, said antibody binding to a surface marker of an immune cell is an anti-CD3 antibody.

[0058] In a particular embodiment, said molecule targeting a surface marker of an immune cell is an antibody binding to a surface marker of a T cell, which forms a T cell engaging bifunctional antibody with the antibody of any one of the first to third aspects,

[0059] In specific embodiments, the multifunctional immunoadhesin is a fusion polypeptide, and further comprises a linker peptide between the antibody of any one of the first to third aspects and the functional molecule linked thereto.

[0060] In an eighth aspect, the present application provides a nucleic acid encoding the multifunctional immunoadhesin of the seventh aspect.

[0061] In a ninth aspect, the present application provides a chimeric antigen receptor of the antibody of the first to third aspects, characterized in that the chimeric antigen receptor comprises, in sequence: the antibody of the first to third aspects, a transmembrane region, and an intracellular signaling region.

[0062] In specific embodiments, the intracellular signaling region is selected from the functional signaling domain of the protein of CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, FcR gamma (FCER1G), FcR beta (Fc epsilon R1b), CD79a, CD79b, Fcgamma RIIa, DAP10, and DAP12, or a combination thereof.

[0063] In particular embodiments, the intracellular signaling region further has a costimulatory signaling domain comprising a functional signaling domain selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, CD4, CD8a, CD8b, IL2Rb, IL2Ry, IL7Ra, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, and NKG2D, or a combination thereof.

[0064] In particular embodiments, the chimeric antigen receptor comprises, in sequential order, an antibody, a transmembrane region, and an intracellular signaling region:

[0065] the antibody, CD8, and CD3zeta of the first through third aspects;

[0066] the antibody, CD8, CD137, and CD3zeta of the first through third aspects; or

[0067] the antibody, a transmembrane region of a CD28 molecule, an intracellular signaling region of a CD28 molecule, and CD3zeta of the first through third aspects; or

[0068] the antibody, a transmembrane region of a CD28 molecule, an intracellular signaling region of a CD28 molecule, CD137, and CD3zeta of the first through third aspects.

[0069] In a tenth aspect, the present application provides a nucleic acid encoding the chimeric antigen receptor of the ninth aspect.

[0070] In an eleventh aspect, the present application provides an expression vector comprising the nucleic acid of the tenth aspect.

[0071] In a twelfth aspect, the present application provides a virus comprising the vector of the eleventh aspect.

[0072] In a thirteenth aspect, the present application provides a chimeric antigen receptor modified immune cell, which is transduced with the nucleic acid of the tenth aspect, or the expression vector of the eleventh aspect or the virus of the twelfth aspect; or the surface of which expresses the chimeric antigen receptor of the ninth aspect.

[0073] Preferably, the immune cell is a T lymphocyte, an NK cell or an NKT lymphocyte.

[0074] In specific embodiments, the immune cell further carries a coding sequence of an exogenous cytokine; or

[0075] It further expresses another chimeric antigen receptor which does not contain CD3 zeta; or

[0076] It further expresses a chemokine receptor; preferably, the chemokine receptor comprises CCR; or

[0077] It further expresses an siRNA capable of reducing PD-1 expression or a protein blocking PD-L1; or the endogenous PD-1 in the cell is knocked out by gene editing technology; or

[0078] It further expresses a safety switch.

[0079] In a fourteenth aspect, the present application provides a pharmaceutical composition comprising:

[0080] the antibody or the nucleic acid encoding the antibody of the first to third aspects; or

[0081] the immunological conjugate or the nucleic acid encoding the conjugate of the seventh aspect; or

[0082] the chimeric antigen receptor or the nucleic acid encoding the chimeric antigen receptor of the ninth aspect; or

[0083] the chimeric antigen receptor modified immune cell of the thirteenth aspect;

[0084] and a pharmaceutically acceptable carrier or excipient.

[0085] In a fifteenth aspect, the present application provides a kit comprising:

[0086] a container, and the antibody or nucleic acid encoding the antibody of the first to third aspects; or the immunological conjugate or nucleic acid encoding the conjugate of the seventh aspect; or the chimeric antigen receptor or nucleic acid encoding the chimeric antigen receptor of the ninth aspect; or the chimeric antigen receptor modified immune cell of the thirteenth aspect; located in the container; or

[0087] a container, and the antibody or nucleic acid encoding the antibody of the first to third aspects; or the immunological conjugate or nucleic acid encoding the conjugate of the seventh aspect; or the chimeric antigen receptor or nucleic acid encoding the chimeric antigen receptor of the ninth aspect; or the chimeric antigen receptor modified immune cell of the thirteenth aspect; located in the container; or

[0088] In a sixteenth aspect, the present application provides the use of the antibody or nucleic acid encoding the antibody of the first to third aspects; or the immunological conjugate or nucleic acid encoding the conjugate of the seventh aspect; or the chimeric antigen receptor or nucleic acid encoding the chimeric antigen receptor of the ninth aspect; or the chimeric antigen receptor modified immune cell of the thirteenth aspect, for treating a tumor expressing IL-13RA2,

[0089] Preferably, the tumor expressing IL-13RA2 is brain cancer, pancreatic cancer, ovarian cancer, kidney cancer, bladder cancer, pancreatic cancer, gastric cancer, intestinal cancer, head and neck cancer, thyroid cancer, prostate cancer, Kaposi's sarcoma. More preferably, the brain cancer is selected from astrocytoma, meningioma, oligodendroglioma, glioma.

[0090] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described hereinafter (e.g. in the examples) can be combined with each other to form a new or preferred technical solution. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0091] Figure 1 SDS electrophoresis of IL-13RA2_huFc, IL13RA1_huFc (reducing condition) is shown;

[0092] Figure 2 ELISA detection of the binding of 31C2, 32H4 to IL-13RA2 and IL13Ra1 is shown;

[0093] Figure 3 ELISA detection of the binding of antibodies 31C2, 32H4 to murine IL-13RA2 is shown;

[0094] Figure 4 FACs detection of the binding of antibodies 31C2, 32H4 to U251 (IL-13RA2 positive) and 293T (IL-13RA2 negative) cells is shown;

[0095] Figure 5 Biacore determination of the affinity of antibodies 31C2, 32H4 (scFv_Fc) is shown;

[0096] Figure 6 EC50 of antibody 31C2, 32H4 binding to U215 cells as detected by FACs is shown;

[0097] Figure 7 Information of primers for affinity maturation is shown;

[0098] Figure 8 Dissociation constant Kd of 10 clones screened after affinity maturation is shown;

[0099] Figure 9A Sequence alignment of heavy chain of affinity matured clones of 31C2 is shown, Figure 9B Sequence of HCDR1 and HCDR2 of affinity matured clones of 31C2 is shown, Figure 9C Sequence alignment of heavy chain of affinity matured clones of 32H4 is shown, Figure 9D Sequence of HCDR1 and HCDR2 of affinity matured clones of 32H4 is shown;

[0100] Figure 10A Binding dissociation constant of affinity matured antibodies is shown; Figure 10B Specificity identification results of antibodies 5D7, 2C7, 5G3, 2D4, 2D3, 1B11 are shown;

[0101] Figure 11A After affinity maturation, the yield of scFv_Fc format of antibodies in 30ml expression system and the determination results of aggregation degree of purified products are shown; Figure 11B -G shows the affinity of scFv_Fc format of antibodies; Figure 11H Binding dissociation constant results of antibodies are shown;

[0102] Figure 12 EC50 of scFv_Fc format of antibodies 5D7, 2C7, 5G3, 2D4, 2D3, 1B11 binding to U251 cells is shown;

[0103] Figure 13 In vitro killing activity of different CAR-T cells is shown. DETAILED DESCRIPTION

[0104] The present inventors have obtained antibodies, including single-chain antibodies and humanized antibodies, which specifically recognize IL-13RA2 through in-depth research and screening. The antibodies of the present application can be applied to the preparation of various targeted anti-tumor drugs and drugs for diagnosing tumors.

[0105] In order to facilitate the understanding of the present application, some terms are first defined.

[0106] The term "IL-13RA2", also CD213A2, herein refers to a subunit of the interleukin-13 receptor complex. It is a transmembrane protein consisting of 380 amino acid residues (NCBI Reference Sequence: NP_000631.1). It is similar to IL-13RA1 (NCBI Reference Sequence: NP_001551.1) in that it binds IL-13 very strongly, but lacks an intracellular signaling domain.

[0107] The term "antibody" herein refers to an antigen binding protein of the immune system, including intact full-length antibodies having an antigen binding region, and also includes fragments, or single chains thereof, such as single chain variable fragments (scFv), having an "antigen binding portion" or "antigen binding region", and also variants of the antibodies provided herein. Antibody fragments include, but are not limited to: (i) a Fab fragment, consisting of VL, VH, CL, and CH1 domains, including Fab' and Fab'-SH, (ii) a Fd fragment consisting of VH and CH1 domains, (iii) a Fv fragment consisting of the VL and VH domains of a single antibody; (iv) a dAb fragment (Ward et al., 1989, Nature 341 :544-546), which consists of a single variable region; (v) a F(ab')2 fragment, a bivalent fragment comprising two linked Fab fragments; (vi) a single chain Fv molecule (scFv), (vii) a bi-specific single chain Fv dimer (PCT / US92 / 09965); (viii) a "diabody" or "triabody", multivalent or multispecific fragments constructed by gene fusion; and (ix) a scFv genetically fused to the same or a different antibody.

[0108] The term "Fc" or "Fc region" herein includes a polypeptide comprising an antibody constant region excluding the first constant region immunoglobulin domain. Thus, Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, and the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains. For IgA and IgM, Fc can include the J chain. For IgG, Fc includes immunoglobulin domains Cγ2 and Cγ3 and the hinge between Cγ1 and Cγ2. While the boundaries of the Fc region can vary, the human IgG heavy chain Fc region is usually defined to include residues C226 or P230 to its carboxyl-terminus, wherein the numbering is according to the EU index of Kabat. For human IgG1, Fc is defined herein to include residues P232 to its carboxyl-terminus, wherein the numbering is according to the EU index in Kabat. Fc can refer to this region when isolated, or this region in the context of an Fc polypeptide, e.g., an antibody. The above "hinge" includes the flexible polypeptide comprising the amino acids between the first and second constant domains of an antibody. Structurally, the IgG CH1 domain ends at position EU 220, and the IgG CH2 domain begins at residue EU 237. Thus, for IgG, the antibody hinge is defined herein to include positions 221 (D221 of IgG1 ) to 231 (A231 of IgG1 ), wherein the numbering is according to the EU index of Kabat.

[0109] The term "variant" refers to a polypeptide having one or more activities with substantially the same amino acid sequence or encoded by substantially the same nucleotide sequence as an antibody provided herein. The variant has the same or similar activity as an antibody provided in the Examples herein.

[0110] A variant has at least one amino acid modification compared to the parent antibody. In particular embodiments, a variant sequence herein preferably has at least about 80%, most preferably at least about 90%, more preferably at least about 95%, more preferably at least about 98%, most preferably at least about 99% amino acid sequence identity to the sequence of the parent antibody. A variant can refer to the antibody itself, or to a composition comprising the parent antibody. The term "amino acid modification" includes amino acid substitution, addition and / or deletion, "amino acid substitution" means replacing an amino acid at a particular position in a parent polypeptide sequence with another amino acid, "amino acid insertion" means adding an amino acid at a particular position in a parent polypeptide sequence, and "amino acid deletion" or "deletion" means removing an amino acid at a particular position in a parent polypeptide sequence.

[0111] Amino acid modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative substitutions are those substitutions that do not significantly affect the properties of the antibody. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues in a CDR region or in a framework region of an antibody of the application can be replaced with other amino acid residues of the same side chain family, and the altered antibody (variant antibody) can be tested for retained function.

[0112] The term "parent antibody" as used herein refers to an antibody provided herein or an antibody obtained by mutating, or affinity maturation, etc. of an antibody provided herein, and preferably refers to an antibody shown in the examples. The parent antibody can be a naturally occurring antibody, or a variant or engineered version of a naturally occurring antibody. The parent antibody can refer to the antibody itself, a composition comprising the parent antibody, or an amino acid sequence encoding the same.

[0113] The term "antigenic determinant" or "epitope" as used herein can consist of a contiguous sequence of the IL-13RA2 protein sequence or a non-contiguous three-dimensional structure of the IL-13RA2 protein sequence.

[0114] Antibodies against IL-13RA2

[0115] In the present disclosure, antigen binding proteins, including antibodies, with scFv-based antigen binding regions are described. ScFvs were selected from a human scFv phage display library using recombinant IL-13RA2. These molecules exhibit exquisite specificity. For example, the antibodies recognize only IL-13RA2 and not IL-13RA1. Unless otherwise specified, IL-13RA2 in the present disclosure refers to human IL-13RA2.

[0116] In some embodiments, the present application includes antibodies having scFv sequences fused to one or more heavy chain constant regions to form antibodies having human immunoglobulin Fc regions to create bivalent proteins, thereby increasing the overall avidity and stability of the antibody. In addition, the Fc portion allows for direct conjugation of other molecules, including but not limited to fluorescent dyes, cytotoxins, radioisotopes, etc., to the antibody, for example, for use in antigen quantitation studies, to immobilize the antibody for affinity measurements, for targeted delivery of therapeutic drugs, testing Fc-mediated cellular cytotoxicity using immune effector cells, and many other applications.

[0117] The results provided herein highlight the specificity, sensitivity, and utility of the antibodies of the present application when targeting IL-13RA2.

[0118] The molecules of the present application are based on the identification and selection of single chain variable fragments (scFv) using phage display, the amino acid sequences of which confer specificity to the molecules against IL-13RA2 and form the basis of all of the antigen binding proteins of the present disclosure. Thus, the scFv can be used to design a range of different "antibody" molecules, including, for example, full length antibodies, fragments thereof such as Fabs and F(ab')2, fusion proteins (including scFv_Fc), multivalent antibodies, i.e., antibodies having more than one specificity, either against the same antigen or different antigens, e.g., bispecific T cell engaging antibodies (BiTEs), triabodies, etc. (see Cuesta et al., Multivalent antibodies: when design surpasses evolution, Trends in Biotechnology 28:355-362, 2010).

[0119] In one embodiment where the antigen binding protein is a full length antibody, the heavy and light chains of the antibodies of the present application can be full length (e.g., the antibody can include at least one and preferably two complete heavy chains, and at least one and preferably two complete light chains) or can include an antigen binding portion (Fab, F(ab')2, Fv, or scFv). In other embodiments, the antibody heavy chain constant region is selected from, for example, IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgD, and IgE. The choice of antibody type will depend on the immune effector function that the designed antibody is intended to elicit. Suitable amino acid sequences of the constant regions of the various immunoglobulin isotypes and methods for producing a wide variety of antibodies are known to those skilled in the art when constructing recombinant immunoglobulins.

[0120] In a first aspect, the present application provides an antibody specifically recognizing IL-13RA2, which has a binding affinity EC50 of less than 100 nM, preferably less than 10 nM, more preferably 0.1-1 nM, most preferably 0.3-0.6 nM to U251 cells stably transfected with human IL-13RA2.

[0121] In a preferred embodiment, the antibody provided by the present application binding to IL-13RA2 comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 9, and / or a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 10, and / or a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 11 or 12. In another preferred embodiment, the antibody provided by the present application binding to IL-13RA2 comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 13, and / or a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 14, and / or a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 15 or 16. In another preferred embodiment, the antibody provided by the present application binding to IL-13RA2 comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 9, and / or a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 10, and / or a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 11 or 12, and a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 13, and / or a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 14, and / or a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 15 or 16. Preferably, the antibody provided by the present application binding to IL-13RA2 comprises a HCDR1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 10, a HCDR3 of SEQ ID NO: 11, and a LCDR1 of SEQ ID NO: 13, a LCDR2 of SEQ ID NO: 14, a LCDR3 of SEQ ID NO: 15; or a HCDR1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 10, a HCDR3 of SEQ ID NO: 12, and a LCDR1 of SEQ ID NO: 13, a LCDR2 of SEQ ID NO: 14, a LCDR3 of SEQ ID NO: 16.

[0122] More preferably, the antibody that binds IL-13RA2 comprises a HCDR1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 10, a HCDR3 of SEQ ID NO: 12, and a LCDR1 of SEQ ID NO: 13, a LCDR2 of SEQ ID NO: 14, a LCDR3 of SEQ ID NO: 16.

[0123] In another aspect, the present application provides an antibody that binds IL-13RA2, whose heavy chain variable region is selected from the sequence of SEQ ID NO: 2 or SEQ ID NO: 6, or a variant of either sequence.

[0124] In another aspect, the present application provides an antibody or fragment thereof that binds IL-13RA2, which comprises a light chain variable region sequence selected from SEQ ID NO: 4 or SEQ ID NO: 8.

[0125] Given that each of these heavy and light chain variable region sequences can bind IL-13RA2, the heavy and light chain variable region sequences can be "mixed and matched" to generate anti-IL-13RA2 binding molecules of the present application.

[0126] In another aspect, the present application provides variants of the antibodies or fragments thereof that bind IL-13RA2. Thus the present application provides antibodies or fragments thereof having a heavy chain and / or light chain variable region that is at least 80% identical to the sequence of the variable region of the heavy chain or light chain. Preferably, the amino acid sequence identity of the heavy chain and / or light chain variable region is at least 85%, more preferably at least 90%, most preferably at least 95%, especially 96%, more especially 97%, even more especially 98%, most especially 99%, including for example 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%. Variants can be obtained by methods such as yeast library screening, phage library screening, point mutagenesis, etc., using the antibodies described herein as the parent antibodies.

[0127] In another aspect, the present application provides antibodies that recognize the same epitope as the previously described anti-IL-13RA2 antibodies.

[0128] Properties of anti-IL-13RA2 antibodies

[0129] Standard assays for assessing the binding ability of antibodies, such as anti-IL-13RA2 antibodies, are known in the art, including for example ELISA, biacore, Western blot, and flow cytometry analysis. Suitable assays are described in detail in the Examples.

[0130] Nucleic acids, vectors, and host cells

[0131] The present application also provides isolated nucleic acids encoding antibodies and fragments thereof that bind IL-13RA2, vectors, and host cells comprising the nucleic acids or vectors. The nucleic acids can be in whole cells, in a cell lysate, or in a partially purified or substantially pure form.

[0132] Nucleic acids of the present application can be obtained using standard molecular biology techniques, for example, cDNAs encoding light and heavy chains of an antibody, or VH and VL segments, can be obtained by standard PCR amplification or cDNA cloning techniques. For antibodies obtained from an immunoglobulin gene library (e.g., using phage display techniques), one or more nucleic acids encoding the antibody can be recovered from the library. Methods of introducing foreign nucleic acids into host cells are generally known in the art and can vary depending on the host cell used.

[0133] Preferred nucleic acid molecules of the present application are those encoding a light chain variable region selected from SEQ ID NO: 3 or SEQ ID NO: 7, and / or a heavy chain variable region selected from SEQ ID NO: 1 or SEQ ID NO: 5. More preferred are nucleic acid molecules comprising the heavy chain sequence of SEQ ID NO: 1, and comprising the light chain sequence of SEQ ID NO: 3 or comprising the heavy chain sequence of SEQ ID NO: 5, and comprising the light chain sequence of SEQ ID NO: 7.

[0134] For expression of a protein, nucleic acids encoding antibodies of the present application can be integrated into an expression vector. A variety of expression vectors can be used for protein expression. Expression vectors can include self-replicating extra-chromosomal vectors, or vectors that integrate into the host genome. Expression vectors for use in the present application include, but are not limited to, those that enable expression of a protein in mammalian cells, bacteria, insect cells, yeast, and in vitro systems. A variety of expression vectors are commercially or otherwise available, as known in the art. Antibodies can be used in the present application for expression.

[0135] Immunoconjugates

[0136] The present application also provides multifunctional immunoconjugates comprising an antibody described herein and further comprising at least one other type of functional molecule. The functional molecule is selected from, but not limited to, a molecule targeting a tumor surface marker, a molecule inhibiting a tumor, a molecule targeting a surface marker of an immune cell, or a detectable label. The antibody and the functional molecule can form a conjugate by covalent linkage, coupling, attachment, cross-linking, or the like.

[0137] As a preferred embodiment, the immunoconjugate can comprise: an antibody of the application and at least one molecule targeting a tumor surface marker or one molecule inhibiting a tumor. The molecule inhibiting a tumor can be an anti-tumor cytokine or an anti-tumor toxin; preferably, the cytokine includes, but is not limited to: IL-2, IL-7, IL-12, IL-15, type I IFN, TNF-alpha. In a particular embodiment, the molecule targeting a tumor surface marker is a molecule targeting the same tumor surface marker as the antibody of the application. For example, the molecule targeting a tumor surface marker can be an antibody or a ligand binding to a tumor surface marker, which can synergize with the antibody of the application to more precisely target tumor cells. Alternatively,

[0138] As a preferred embodiment, the immunoconjugate can comprise: an antibody of the application and a detectable label. The detectable label includes, but is not limited to: a fluorescent label, a chromogenic label; such as: an enzyme, a prosthetic group, a fluorescent material, a luminescent material, a bioluminescent material, a radioactive material, a positron emitting metal, and a non-radioactive paramagnetic metal ion. More than one label can be included. The label used to label the antibody depends on the particular detection / assay / diagnostic technique and / or method used, such as immunohistochemical staining of tissue samples, flow cytometry, etc. Suitable labels for detection / assay / diagnostic techniques and / or methods known in the art are well known to those skilled in the art.

[0139] As a preferred embodiment, the immunoconjugate can comprise: an antibody of the application and a molecule targeting a surface marker of an immune cell. The molecule targeting a surface marker of an immune cell can be an antibody or a ligand binding to a surface marker of an immune cell, which is capable of recognizing an immune cell, which carries the antibody of the application to the immune cell, while the antibody of the application can target the immune cell to the tumor cell, thereby triggering the immune cell to specifically kill the tumor. The surface marker of the immune cell can be selected from CD3, CD16, CD28, more preferably, the antibody binding to the surface marker of the immune cell is an anti-CD3 antibody. The immune cell can be selected from T cells, NK cells, NKT cells.

[0140] As one way of chemically producing an immunoconjugate by direct or indirect (e.g. via a linker) conjugation, the immunoconjugate can be produced as a fusion protein comprising an antibody of the application and a suitable additional protein. The fusion protein can be produced recombinantly by constructing a nucleic acid molecule comprising a nucleotide sequence encoding the antibody in frame with a nucleotide sequence encoding the suitable label and subsequently expressing the nucleic acid molecule, as known in the art.

[0141] In another aspect, the present application provides nucleic acid molecules encoding at least one antibody, functional variant thereof, or immunoconjugate of the present application. Once the relevant sequences are obtained, they can be obtained in large quantities using recombinant methods. This is typically done by cloning them into vectors, which are then transferred into cells, and then isolating the relevant sequences from the propagated host cells by conventional methods.

[0142] In another aspect, the present application provides a chimeric antigen receptor comprising an extracellular binding domain, a transmembrane domain, and an intracellular domain. As used herein, the term "chimeric antigen receptor (CAR)" refers to a tumor antigen binding domain fused to an intracellular signaling domain that is capable of activating a T cell. Typically, the extracellular binding domain of a CAR is derived from a mouse or humanized or human monoclonal antibody.

[0143] The extracellular binding domain is an antibody as described herein, non-limiting examples of which include a single chain variable fragment (scFv) derived from an antibody, a fragment antigen binding region (Fab) selected from a library, a single domain fragment, or a natural ligand that engages its cognate receptor. In some embodiments, the extracellular antigen binding region can comprise a scFv, a Fab, or a natural ligand, as well as any derivatives thereof. The extracellular antigen binding region can refer to a molecule other than a whole antibody, which can comprise a portion of a whole antibody and can bind to an antigen to which a whole antibody binds. Examples of antibody fragments can include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies, linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0144] The extracellular antigen binding region, such as a scFv, a Fab, or a natural ligand, can be part of a CAR that determines antigen specificity. The extracellular antigen binding region can bind to any complementary target. The extracellular antigen binding region can be derived from an antibody of a known variable region sequence. The extracellular antigen binding region can be obtained from antibody sequences obtained from available mouse hybridomas. Alternatively, the extracellular antigen binding region can be obtained from whole-exome sequencing of tumor cells or primary cells, such as tumor infiltrating lymphocytes (TILs).

[0145] In some embodiments, the binding specificity of the extracellular antigen binding region can be determined by complementarity determining regions or CDRs, such as light chain CDRs or heavy chain CDRs. In many cases, the binding specificity can be determined by both light chain CDRs and heavy chain CDRs. A given combination of heavy chain CDRs and light chain CDRs can provide a given binding pocket that can confer greater affinity and / or specificity for an antigen compared to other reference antigens.

[0146] In certain aspects of any of the embodiments disclosed herein, the extracellular antigen binding region, e.g., scFv, can comprise light chain CDRs specific for an antigen. The light chain CDRs can be the complementarity determining regions of the light chain of an antibody, e.g., scFv. The light chain CDRs can comprise a contiguous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated by non-complementarity determining regions (e.g., framework regions). In some embodiments, the light chain CDRs can comprise two or more light chain CDRs, which can be referred to as light chain CDR-1, CDR-2, etc. In some embodiments, the light chain CDRs can comprise three light chain CDRs, which can be referred to as light chain CDR-1, light chain CDR-2, and light chain CDR-3, respectively. In some examples, a set of CDRs present on a common light chain can be collectively referred to as light chain CDRs.

[0147] In certain aspects of any of the embodiments disclosed herein, the extracellular antigen binding region, e.g., scFv, can comprise heavy chain CDRs specific for an antigen. The heavy chain CDRs can be the complementarity determining regions of the heavy chain of an antibody, e.g., scFv. The heavy chain CDRs can comprise a contiguous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated by non-complementarity determining regions (e.g., framework regions). In some embodiments, the heavy chain CDRs can comprise two or more heavy chain CDRs, which can be referred to as heavy chain CDR-1, CDR-2, etc. In some embodiments, the heavy chain CDRs can comprise three heavy chain CDRs, which can be referred to as heavy chain CDR-1, heavy chain CDR-2, and heavy chain CDR-3, respectively. In some embodiments, a set of CDRs present on a common heavy chain can be collectively referred to as heavy chain CDRs.

[0148] By using genetic engineering, the extracellular antigen binding region can be modified in various ways. In some embodiments, the extracellular antigen binding region can be mutated, such that the extracellular antigen binding region can be selected to have a higher affinity for its target. In some embodiments, the affinity of the extracellular antigen binding region for its target can be optimized for targets that can be expressed at low levels on normal tissues. This optimization can be performed to minimize potential toxicity. In other cases, a clone of the extracellular antigen binding region with a higher affinity for the membrane-bound form of the target can be preferred over its counterpart for the soluble form. This modification can be made because different levels of the soluble form of the target can also be detected, and their targeting can cause undesirable toxicity.

[0149] In some embodiments, the extracellular antigen binding region includes a hinge or spacer region. The terms hinge and spacer can be used interchangeably. The hinge can be considered a part of the CAR that serves to provide flexibility to the extracellular antigen binding region. In some embodiments, the hinge can be useful for detecting the CAR on the cell surface of a cell, particularly when the antibody that detects the extracellular antigen binding region does not work or is available. For example, the length of the hinge derived from an immunoglobulin can need to be optimized depending on where the extracellular antigen binding region targets an epitope on the target.

[0150] In some embodiments, the hinge can not be of an immunoglobulin, but of another molecule, such as the natural hinge of a CD8a molecule. The CD8a hinge can contain cysteine and proline residues known to play a role in the interaction of the CD8 co-receptor and MHC molecules. The cysteine and proline residues can affect the performance of the CAR.

[0151] The CAR hinge can be adjustable in size. This topography of the immunological synapse between the immune response cell and the target cell also defines the distance that cannot be functionally bridged by the CAR due to a membrane distal epitope on the cell surface target molecule, i.e. the synapse distance is not brought to the proximity of the signal transduction using a short-hinge CAR. Likewise, a membrane proximal CAR target antigen epitope only sees signal output in the context of a long-hinge CAR. The hinge can be adjusted depending on the extracellular antigen binding region used. The hinge can be of any length.

[0152] The transmembrane domain can anchor the CAR to the plasma membrane of the cell. The natural transmembrane portion of CD28 can be used in the CAR. In other cases, the natural transmembrane portion of CD8a can also be used in the CAR. The “CD8” can be a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity to NCBI Reference Number: NP_001759 or a fragment thereof having stimulatory activity. The “CD8 nucleic acid molecule” can be a polynucleotide encoding a CD8 polypeptide, in some cases, the transmembrane region can be the natural transmembrane portion of CD28, the “CD28” can refer to a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity to NCBI Reference Number: NP_006130 or a fragment thereof having stimulatory activity. The “CD28 nucleic acid molecule” can be a polynucleotide encoding a CD28 polypeptide. In some embodiments, the transmembrane portion can comprise a CD8a region.

[0153] The (cyto)intrinsic signaling region of a CAR can be responsible for activating at least one of the effector functions of the immune response cell into which the CAR has been placed. A CAR can induce effector functions of a T cell, for example, cytolytic activity or helper activity, including secretion of cytokines. The term cytointrinsic signaling region thus refers to the protein portion that transduces the effector function signal and directs the cell to perform a specific function. While it is generally possible to use the entire cytointrinsic signaling region, in many cases it is not necessary to use the entire chain of signaling domains. In some embodiments, truncated portions of the cytointrinsic signaling region are used. In some embodiments, the term cytointrinsic signaling region is thus intended to include any truncated portion of the cytointrinsic signaling region that is sufficient to transduce the effector function signal.

[0154] Preferred examples of signaling domains for use in a CAR can include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that synergize to initiate signal transduction upon target-receptor binding, as well as any derivative or variant sequences of these and any synthetic sequences of these sequences that have the same functionality.

[0155] In some embodiments, the cytointrinsic signaling region can contain a signal motif of a known immunoreceptor tyrosine-based activation motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include those derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. However, in preferred embodiments, the cytointrinsic signaling domain is derived from the CD3 zeta chain.

[0156] An example of a T cell signaling domain containing one or more ITAM motifs is the CD3 zeta domain, also known as T cell receptor T3 zeta chain or CD247. This domain is part of the T cell receptor-CD3 complex and plays an important role in coupling antigen recognition by several intracellular signal transduction pathways to the primary activation of T cells. As used herein, CD3 zeta primarily refers to the human CD3 zeta and its isoforms as known from Swissprot entry P20963, including proteins with essentially the same sequence. Again, as part of a chimeric antigen receptor, it is reiterated that the entire T cell receptor T3 zeta chain is not required and any derivative thereof comprising the signaling domain of the T cell receptor T3 zeta chain is suitable, including any functional equivalent thereof.

[0157] The intracellular signaling domain can be selected from any one of the domains of Table 1. In some embodiments, the domain can be modified such that the identity to the reference domain can be from about 50% to about 100%. Any one of the domains of Table 1 can be modified such that the modified form can comprise about 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, or up to about 100% identity.

[0158] The intracellular signaling region of the CAR can further comprise one or more costimulatory domains. The intracellular signaling region can comprise a single costimulatory domain, such as the zeta chain (first generation CAR) or its association with CD28 or 4-1BB (second generation CAR). In other examples, the intracellular signaling region can comprise two costimulatory domains, such as CD28 / OX40 or CD28 / 4-1BB (third generation).

[0159] These costimulatory domains, in conjunction with the intracellular signaling domain such as CD8, can produce downstream activation of kinase pathways, supporting gene transcription and functional cellular responses. The costimulatory domains of the CAR can activate proximal signaling proteins associated with CD28 (phosphatidylinositol-4,5-bisphosphate 3-kinase) or 4-1BB / OX40 (TNF-receptor associated factor adaptor protein) pathways, as well as MAPK and Akt activation.

[0160] In certain instances, the signal generated by the CAR can be combined with an accessory or costimulatory signal. For the costimulatory signal domain, the chimeric antigen receptor-like complex can be designed to include several possible costimulatory signal domains. As is well known in the art, in naive T cells, the sole engagement of the T cell receptor is insufficient to induce full activation of the T cell to a cytotoxic T cell. Complete productive T cell activation requires a second costimulatory signal. Several receptors have been reported to provide costimulation for T cell activation, including but not limited to CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. The signaling pathways used by these costimulatory molecules are all able to synergize with the primary T cell receptor activation signal. The signals provided by these costimulatory signaling regions can synergize with the primary effector activation signal derived from one or more ITAM motifs (e.g., CD3zeta signaling domain) and can fulfill the requirements for T cell activation.

[0161] In some embodiments, the addition of a costimulatory domain to the chimeric antigen receptor-like complex can enhance the efficacy and durability of the engineered cell. In other embodiments, the T cell signaling domain and the costimulatory domain are fused to one another to constitute the signaling region.

[0162] Table 4. Costimulatory domains

[0163]

[0164] Chimeric antigen receptors bind target antigens. Target antigens can be obtained or isolated from a variety of sources when assaying T cell activation in vitro or ex vivo. As used herein, a target antigen is an antigen or an immunological epitope on an antigen that is critical for immune recognition and ultimate elimination or control of a pathogenic agent or disease state in a mammal. Immune recognition can be cellular and / or humoral. In the case of intracellular pathogens and cancer, immune recognition can be, for example, a T lymphocyte response.

[0165] In some embodiments, target antigens include antigens associated with a precancerous or proliferative state. Target antigens can also be associated with or arise from cancer. For example, in some embodiments, the chimeric antigen receptors of the present application recognize and bind to tumor antigens including IL-13RA2 as previously described herein.

[0166] In some embodiments, the chimeric antigen receptors herein, when present on the plasma membrane of a cell, and when bound to and activated by its target, the cell expressing the chimeric antigen receptor can be cytotoxic to a cell bearing the target. For example, in some embodiments, the chimeric antigen receptor is present on a cytotoxic cell, such as an NK cell or a cytotoxic T cell, and upon activation by the target, can increase the toxicity of the cytotoxic cell to a target cell. In some embodiments, the chimeric antigen receptors herein can increase the effect of an immunoresponsive cell on a cell expressing IL-13RA2, such as a tumor cell. In some embodiments, a cell expressing a chimeric antigen receptor described herein has at least a 10%, at least a 15%, at least a 20%, at least a 25%, at least a 30%, at least a 35%, at least a 40%, at least a 45%, at least a 50%, at least a 55%, at least a 60%, at least a 65%, at least a 70%, at least a 75%, at least a 80%, at least a 85%, at least a 90%, at least a 95%, at least a 1-fold, at least a 1.5-fold, at least a 2-fold, at least a 2.5-fold, at least a 3-fold, at least a 3.5-fold, at least a 4-fold, at least a 4.5-fold, at least a 5-fold, at least a 6-fold, at least a 7-fold, at least a 8-fold, at least a 9-fold, or at least a 10-fold greater cytotoxic effect on a cell expressing IL-13RA2 than a cell not expressing a chimeric antigen receptor herein.

[0167] A transgene encoding a receptor or CAR for a target binding antigen can be incorporated into a cell. For example, the transgene can be incorporated into an immunoresponsive cell, such as a T cell. When inserted into a cell, the transgene can be a complementary DNA (cDNA) segment, which is a copy of messenger RNA (mRNA), or the gene itself (with or without introns) in its original region of genomic DNA.

[0168] Nucleic acids such as DNA encoding a transgene sequence can be randomly inserted into the chromosome of a cell. Random integration can result from any method of introducing nucleic acids (e.g., DNA) into a cell. For example, the method can include, but is not limited to, electroporation, sonication, use of a gene gun, lipofection, calcium phosphate transfection, use of dendrimers, microinjection, and use of viral vectors including adenovirus, AAV, and retroviral vectors, and / or type II ribozymes.

[0169] DNA encoding a transgene can also be designed to include a reporter gene, so that the presence of the transgene or its expression product can be detected by activation of the reporter gene. Any reporter gene can be used, such as those described above. Cells containing the transgene can be selected by selecting cells in cell culture in which the reporter gene has been activated.

[0170] Expression of the CAR can be verified by expression assays, such as qPCR or by measuring the level of RNA. Expression levels can also be indicative of copy number. For example, if the expression level is very high, this can indicate that more than one copy of the CAR was integrated into the genome. Alternatively, high expression can indicate that the transgene was integrated in a highly transcribed region, such as near a highly expressed promoter. Expression can also be verified by measuring protein levels, such as by Western blot.

[0171] In some embodiments, the immunoresponsive cells of the application can comprise one or more transgenes. The one or more transgenes can express a CAR protein that recognizes and binds to at least one epitope on an antigen or to a mutated epitope on an antigen. The CAR can be a functional CAR. In some embodiments the immunoresponsive cells of the application can comprise one or more CARs, or it can comprise a single CAR and a secondary engineered receptor.

[0172] In some embodiments, the transgene can encode a suicide gene. CAR immune responsive cells cause tumor regression but can be accompanied by toxicity, as evidenced by many effective treatments of cancer patients. In some embodiments, when the target antigen is shared in normal tissues and tumor cells, CAR immune responsive cells can not be able to distinguish between tumor and normal tissue ("on-target / off- target toxicity"). In other cases, systemic perturbations of the immune system can occur, known as cytokine release syndrome (CRS). The CRS can include systemic inflammatory response syndrome or cytokine storm, which can be a consequence of the rapid expansion of CAR immune responsive cells in vivo. CRS is a condition characterized by fever and hypotension, which can lead to multiple organ failure in severe cases. In most cases, the toxicity is associated with the in vivo expansion of infused CAR immune responsive cells, which can cause overall perturbations of the immune system, as well as the release of high levels of pro-inflammatory cytokines, such as TNFa and IL-6. A suicide gene can induce elimination of CAR immune responsive cells. A suicide gene can be any gene that induces apoptosis in the CAR immune responsive cells. The suicide gene can be encoded in the viral vector along with the antigen-binding receptor. Encoding a suicide gene allows for the mitigation or complete abrogation of toxicity caused by the in vivo expansion of infused CAR immune responsive cells in specific situations.

[0173] In some embodiments, CAR immune responsive cells to antigens present in normal tissues can be generated such that they transiently express the CAR, for example, after electroporation of mRNA encoding the receptor. Furthermore, the significant effort to further enhance CAR immune responsive cells by including a safety switch, in the case of severe on-target toxicity, can greatly eliminate CAR immune responsive cells.

[0174] In some embodiments, the vector encoding the CAR can be combined with a safety switch such as an inducible caspase-9 gene (activated by a dimeric chemical inducer) or a truncated form of the EGF receptor R (activated by the monoclonal antibody cetuximab) or RQR8.

[0175] One or more transgenes used herein can be from different species. For example, one or more transgenes can comprise a human gene, a mouse gene, a rat gene, a pig gene, a cow gene, a dog gene, a cat gene, a monkey gene, a chimpanzee gene, or any combination thereof. For example, the transgene can be from a human having human genetic sequences. One or more transgenes can comprise a human gene. In some cases, one or more transgenes are not adenoviral genes.

[0176] As described above, the transgene can be inserted into the genome of the immunoresponsive cell in a random or site-specific manner. For example, the transgene can be inserted into a random site in the genome of the immune cell. These transgenes can be functional, e.g., fully functional when inserted anywhere in the genome. For example, the transgene can encode its own promoter, or can be inserted into a position that is under the control of an internal promoter. Alternatively, the transgene can be inserted into a gene, e.g., an intron of a gene or an exon, promoter, or non-coding region of a gene. The transgene can be inserted such that the insertion disrupts a gene, e.g., an endogenous immune checkpoint.

[0177] In some embodiments, more than one copy of the transgene can be inserted into multiple random sites within the genome. For example, multiple copies can be inserted into random sites in the genome. This can result in increased overall expression compared to a single random insertion of the transgene. Alternatively, one copy of the transgene can be inserted into a gene, and another copy of the transgene can be inserted into a different gene. The transgene can be targeted such that it can be inserted into a specific site in the genome of the immunoresponsive cell.

[0178] In some embodiments, the polynucleic acid comprising a sequence encoding a receptor that binds an antigen can be in the form of a plasmid vector. The plasmid vector can comprise a promoter. In some cases, the promoter can be constitutive. In some embodiments, the promoter is inducible. The promoter can be or can be derived from CMV, U6, MND, or EF1a. In some embodiments, the promoter can be adjacent to the CAR sequence. In some embodiments, the plasmid vector further comprises a splice acceptor. In some embodiments, the splice acceptor can be adjacent to the CAR sequence. The promoter sequence can be a PKG or MND promoter. The MND promoter can be a synthetic promoter containing the U3 region of the MoMuLV LTR modified with the myeloblastosis-associated virus enhancer.

[0179] In some embodiments, the polynucleic acid encoding the receptor of interest can be designed for delivery to a cell by non-viral techniques. In some cases, the polynucleic acid can be a good manufacturing practice (GMP) compatible reagent.

[0180] Expression of the polynucleic acid encoding the receptor or CAR that binds an antigen of interest can be controlled by one or more promoters. The promoter can be ubiquitous, constitutive (unrestricted promoter, allowing continuous transcription of the associated gene), tissue-specific, or inducible. Expression of a transgene inserted adjacent to or proximal to a promoter can be regulated. For example, the transgene can be inserted near or next to a ubiquitous promoter. Some ubiquitous promoters can be a CAGGS promoter, a hCMV promoter, a PGK promoter, a SV40 promoter, or a ROSA26 promoter.

[0181] The promoter can be endogenous or exogenous. For example, one or more transgenes can be inserted adjacent to or proximal to an endogenous or exogenous ROSA26 promoter. Further, the promoter can be specific for an immunoresponsive cell. For example, one or more transgenes can be inserted adjacent to or proximal to a pig ROSA26 promoter.

[0182] A tissue-specific promoter or a cell-specific promoter can be used to control the location of expression. For example, one or more transgenes can be inserted adjacent to or proximal to a tissue-specific promoter. The tissue-specific promoter can be a FABP promoter, a Lck promoter, a CamKII promoter, a CD19 promoter, a keratin promoter, an albumin promoter, an aP2 promoter, an insulin promoter, an MCK promoter, a MyHC promoter, a WAP promoter, or a Col2A promoter.

[0183] Inducible promoters can also be used. If desired, these inducible promoters can be turned on and off by the addition or removal of an inducer. It is contemplated that the inducible promoter can be, but is not limited to, Lac, tac, trc, trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx, and / or Trex.

[0184] The term "inducible promoter" as used herein is a controlled promoter that does not express or expresses at a low level a gene operably linked thereto until desired conditions are met, and expresses or expresses at a high level a gene operably linked thereto when the desired conditions are met.

[0185] Further, although not necessary for expression, the transgene sequence can also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals.

[0186] In some embodiments, the transgene encodes a receptor or CAR that targets a binding antigen, wherein the transgene is inserted into a safe harbor such that the binding antigen- expressing receptor is expressed. In some embodiments, the transgene is inserted into the PD1 and / or CTLA-4 locus. In other cases, the transgene is inserted randomly into the cell with lentiviral delivery, while the PD1- or CTLA-4 specific nucleases can be provided as mRNA. In some embodiments, the transgene is delivered by a viral vector system such as retrovirus, AAV, or adenovirus, and mRNA encoding a nuclease specific for the safe harbor (e.g., AAVS1, CCR5, albumin, or HPRT). The cells can also be treated with mRNA encoding a PD1- and / or CTLA-4 specific nuclease. In some embodiments, the polynucleotide encoding a CAR is provided with a viral delivery system along with mRNA encoding a HPRT specific nuclease and a PD1- or CTLA-4 specific nuclease. CARs that can be used with the methods and compositions disclosed herein can include all types of these chimeric proteins.

[0187] In some embodiments, a retroviral vector (gamma-retroviral or lentiviral vector) can be used to introduce the transgene into the immunoresponsive cell. For example, a transgene encoding a CAR or any receptor that targets a binding antigen or a variant or fragment thereof can be cloned into a retroviral vector and can be driven by its endogenous promoter, the retroviral long terminal repeat, or a promoter specific to the target cell type. Non-viral vectors can also be used. Non-viral vector delivery systems can include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers.

[0188] A number of viral-based systems have been developed for the transfer of genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. Vectors derived from retroviruses such as lentivirus are suitable tools to achieve long-term gene transfer as they allow long-term stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from retroviruses such as murine leukemia virus in that they can transduce non-proliferating cells. They also have the added advantage of low immunogenicity. An advantage of adenoviral vectors is that they do not integrate into the genome of the target cell, thereby bypassing negative integration-related events.

[0189] The cells can be transfected with a transgene encoding the antigen-binding receptor. The transgene concentration can be from about 100 picograms to about 50 micrograms. In some embodiments, the amount of nucleic acid (e.g., ssDNA, dsDNA, or RNA) introduced into the cells can be varied to optimize transfection efficiency and / or cell viability. For example, 1 microgram of dsDNA can be added to each cell sample for electroporation. In some embodiments, the amount of nucleic acid (e.g., double stranded DNA) required for optimal transfection efficiency and / or cell viability varies depending on the cell type. In some embodiments, the amount of nucleic acid (e.g., dsDNA) used for each sample can directly correspond to the transfection efficiency and / or cell viability. For example, a range of transfection concentrations. The transgene encoded by the vector can integrate into the cell genome. In some embodiments, the transgene encoded by the vector integrates in the forward direction. In other cases, the transgene encoded by the vector integrates in the reverse direction.

[0190] Delivery of vectors to an individual patient in vivo is typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local application, as described below. Alternatively, vectors can be delivered to cells ex vivo, e.g., cells removed from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and the cells are then typically reimplanted into the patient after selection of cells that have incorporated the vector. Cells can be expanded before or after selection.

[0191] Suitable immunoresponsive cells for expressing the antigen-binding receptor can be cells that are autologous or non-autologous to the individual in need.

[0192] Suitable sources of immunoresponsive cells can be obtained from an individual. In some cases, T cells can be obtained. The T cells can be obtained from a number of sources, including PBMCs, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some cases, T cells can be obtained from blood collected from the individual using any number of techniques known to those of skill in the art, such as Ficoll™ separation. In some embodiments, cells from the circulating blood of an individual are obtained by apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In some embodiments, the cells collected by apheresis can be washed to remove the plasma fraction and place the cells in a suitable buffer or medium for subsequent processing steps.

[0193] Alternatively, cells can be derived from a healthy donor, from a patient diagnosed with cancer or a patient diagnosed as infected. In some embodiments, the cells can be part of a mixed cell population having different phenotypic characteristics. Cell lines can also be obtained from transformed T cells according to the aforementioned methods. Cells can also be obtained from a cell therapy bank. Modified cells resistant to immunosuppressive therapy can be obtained by any of the methods described herein. Suitable cell populations can also be selected prior to modification. Engineered cell populations can also be selected after modification. The engineered cells can be used for autologous transplantation. Alternatively, the cells can be used for allogeneic transplantation. In some embodiments, the cells are administered to the same patient as the sample used to identify cancer-related target sequences. In other cases, the cells are administered to a different patient than the patient from which the sample used to identify cancer-related target sequences was obtained.

[0194] In some embodiments, suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subpopulations such as, but not limited to, T cells, natural killer cells, monocytes, natural killer T cells, monocyte precursor cells, hematopoietic stem cells, or non-pluripotent stem cells. In some embodiments, the cells can be any immune cell, including any T cell such as a tumor infiltrating cell (TIL), such as a CD3+ T cell, a CD4+ T cell, a CD8+ T cell, or any other type of T cell. The T cells can also include memory T cells, memory stem T cells, or effector T cells. The T cells can also be selected from a bulk population, for example, from whole blood. The T cells can also be expanded from a bulk population. The T cells can also be biased toward a particular population and phenotype. For example, the T cells can be biased toward a phenotype comprising CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Ra(+). Suitable cells can comprise one or more markers selected from the following list: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Ra(+). Suitable cells also include stem cells, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, and mesenchymal stem cells. Suitable cells can comprise any number of primary cells, for example, human cells, non-human cells, and / or mouse cells. Suitable cells can be progenitor cells. Suitable cells can be derived from a subject (e.g., a patient) to be treated.

[0195] The amount of therapeutically effective cells needed in a patient can vary depending on the viability of the cells and the efficiency of the genetic modification of the cells (e.g., the efficiency of integration of the transgene into one or more cells, or the level of expression of a protein encoded by the transgene). In some embodiments, the product of the viability of the cells after genetic modification (e.g., fold increase) and the efficiency of integration of the transgene can correspond to the therapeutic amount of cells that can be used to administer to a subject. In some embodiments, the increase in the viability of the cells after genetic modification can correspond to a reduction in the amount of cells needed to be administered to a patient for a treatment to be effective. In some embodiments, the increase in the efficiency of integration of the transgene into one or more cells can correspond to a reduction in the amount of cells needed to be administered to a patient for a treatment to be effective. In some embodiments, determining the amount of therapeutically effective cells needed can comprise determining a function related to the change in cells over time. In some embodiments, determining the amount of therapeutically effective cells needed can comprise determining a function corresponding to the change in the efficiency of integration of the transgene into one or more cells as a function of a variable related to time (e.g., time in cell culture, time of electroporation, time of cell stimulation). In some embodiments, a therapeutically effective cell can be a cell population comprising expression of about 30% to about 100% of receptors that bind an antigen on the surface of the cell. In some embodiments, a therapeutically effective cell can express about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than about 99.9% of the receptors that bind an antigen on the surface of the cell, as measured by flow cytometry.

[0196] According to one aspect of the present application, the present application also includes nucleic acids encoding the receptors that bind an antigen. The present application also relates to variants of the above polynucleotides, which encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as the present application.

[0197] The present application also provides vectors comprising the above nucleic acids encoding receptor proteins that bind an antigen expressed on the surface of an immunoresponsive cell.

[0198] The present application also includes viruses comprising the above vectors. Viruses of the present application include packaged, infective viruses, as well as viruses to be packaged comprising the necessary components for packaging into infective viruses. Other viruses known in the art that can be used to transduce foreign genes into immunoresponsive cells and their corresponding plasmid vectors can also be used in the present application.

[0199] In another aspect, provided herein are host cells comprising an antibody or chimeric antigen receptor described herein, and optionally, a Type I interferon. In another aspect, provided herein are host cells comprising a nucleic acid encoding an antibody or chimeric antigen receptor described herein, and optionally, a Type I interferon.

[0200] In some embodiments, the host cell is an immunoresponsive cell. In some embodiments, the immunoresponsive cell is a T cell, a natural killer cell, a cytotoxic T lymphocyte, a natural killer T cell, a DNT cell, and / or a regulatory T cell. In some embodiments, the host cell is an NK92 cell.

[0201] The immunoresponsive cell described herein can further harbor an exogenous sequence encoding a cytokine; the cytokine includes, but is not limited to, IL-12, IL-15, or IL-21, etc. These cytokines have further immunomodulatory or anti-tumor activities, which can enhance the function of effector T cells and activated NK cells, or directly exert anti-tumor effects. Therefore, one skilled in the art can understand that the use of these cytokines helps the immunoresponsive cell to better function.

[0202] The immunoresponsive cell described herein can further express another receptor that binds an antigen other than the receptor described above.

[0203] The immunoresponsive cell described herein can further express a chemokine receptor; the chemokine receptor includes, but is not limited to, CCR2. One skilled in the art can understand that the CCR2 chemokine receptor can compete with CCR2 in vivo, which is advantageous for blocking tumor metastasis.

[0204] The immunoresponsive cell described herein can further express an siRNA that reduces PD-1 expression or a protein that blocks PD-L1. One skilled in the art can understand that competitive blocking of the interaction between PD-L1 and its receptor PD-1 is advantageous for restoring anti-tumor T cell responses, thereby inhibiting tumor growth.

[0205] The immunoresponsive cell described herein can further express a safety switch; preferably, the safety switch includes iCaspase-9, Truncated EGFR, or RQR8.

[0206] In some embodiments, the immunoresponsive cell of the present application does not express a costimulatory ligand such as 4-1BBL.

[0207] Accordingly, in another aspect, also provided herein is a method of producing an antibody or chimeric antigen receptor described herein, or a composition comprising the same, comprising culturing a host cell described herein under suitable conditions. In some embodiments, the method comprises isolating and obtaining the expression product of the host cell.

[0208] In another aspect, provided herein is a composition comprising an antibody, chimeric antigen receptor, or nucleic acid described herein. In some embodiments, the composition is a pharmaceutical composition comprising the antibody, chimeric antigen receptor, or nucleic acid. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0209] In another aspect, provided herein is a pharmaceutical composition comprising a host cell described herein and a pharmaceutically acceptable carrier.

[0210] The term "pharmaceutically acceptable" means that the molecule as such and the composition are suitable for use in animals, or humans, without resulting in adverse, allergic, or other untoward reactions.

[0211] In some embodiments, the composition comprises another therapeutic agent. In some embodiments, the other therapeutic agent is a chemotherapeutic agent, such as those described in US20140271820 and / or pharmaceutically acceptable salts or analogs thereof. In some embodiments, the therapeutic agent includes, but is not limited to, mitotic inhibitors (vinca alkaloids), including vincristine, vinblastine, vindesine, and novobiene (nab-paclitaxel, 5'-dehydrogenated hydrogenated), topoisomerase I inhibitors, such as camptothecin compounds, including Camptosar™ (irinotecan HCL), Hycamtin™ (topotecan HCL), and other compounds derived from camptothecin and analogs thereof, podophyllotoxin derivatives, such as etoposide, teniposide, and mivobezide, alkylating agents cisplatin, cyclophosphamide, mechlorethamine, trimethylenethanimidamide, carmustine, busulfan, chlorambucil, bleomycin, uracil mustard, chlorophenoxamide, and dacarbazine, antimetabolites, including cytarabine, 5-fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine, antibiotics, including, but not limited to, doxorubicin, bleomycin, dactinomycin, daunorubicin, plicamycin, mitomycin, mitomycin C, and daunomycin, and other chemotherapeutic drugs, including, but not limited to, anti-tumor antibodies, dacarbazine, azacitidine, amrubicin, melphalan, ifosfamide, and mitoxantrone. In some embodiments, the additional therapeutic agent is selected from one or more of epirubicin, oxaliplatin, and 5-fluorouracil. In some embodiments, the additional therapeutic agent includes, but is not limited to, anti-angiogenic agents, including anti-VEGF antibodies (including humanized and chimeric antibodies, anti-VEGF aptamers, and antisense oligonucleotides) and other angiogenesis inhibitors, such as angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta) interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinases 1 and 2, and the like.

[0212] Specific examples of some substances which can serve as pharmaceutically acceptable carriers or components thereof are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose; powdered tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as the Tween®; wetting agents, such sodium lauryl sulfate; coloring agents; flavoring agents; tableting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline; phosphate buffer solutions and the like.

[0213] The pharmaceutical compositions described herein can comprise one or more pharmaceutically acceptable salts. "Pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see, e.g., Berge, S.M. et al., 1977, J. Pharm. Sci. 66: 1-19). Examples of such salts include acid addition salts and base addition salts.

[0214] Acid addition salts include salts derived from inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous, and the like, as well as salts derived from nontoxic organic acids, such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and

[0215] The pharmaceutical compositions described herein can also include an antioxidant. Examples of antioxidants include, but are not limited to, water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0216] The compositions of the present application can be formulated into various dosage forms as desired and can be administered to patients in a dose determined by a physician to be beneficial to the patient, taking into account the patient's species, age, body weight, and general medical condition, mode of administration, and the like. The mode of administration can be, for example, parenteral (e.g., injection) or other therapeutic modalities.

[0217] "Parenteral" administration of an immunogenic composition includes, for example, subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection or infusion techniques.

[0218] A preparation comprising an immunoresponsive cell population administered to an individual comprises a plurality of immunoresponsive cells effective to treat and / or prevent a particular indication or disease. Thus, a therapeutically effective population of immunoresponsive cells can be administered to an individual. Typically, a preparation comprising about 1 x 10 4 to about 1 x 10 10 immunoresponsive cells will be administered. In most cases, the preparation will comprise about 1 x 10 5 to about 1 x 10 9 immunoresponsive cells, about 5 x 10 5 to about 5 x 108 about 1 x 105 6 about 1 x 105 7 about 1 x 105 However, the number of CAR-immunoreactive cells administered to an individual will vary within a wide range depending on the location, origin, identity, extent and severity of the cancer, the age and physical condition of the individual to be treated, and the like. The physician will ultimately determine the appropriate dosage to be used.

[0219] In some embodiments, the chimeric antigen receptor is used to stimulate an immune cell-mediated immune response. For example, a T cell-mediated immune response is an immune response involving T cell activation. Activated antigen-specific cytotoxic T cells are capable of inducing apoptosis in target cells displaying an exogenous antigen epitope on the surface, such as cancer cells displaying a tumor antigen. In other embodiments, the chimeric antigen receptor is used to provide an anti-tumor immunity in a mammal. As a result of the T cell-mediated immune response, the subject will develop an anti-tumor immunity.

[0220] In certain instances, a method of treating a subject having a cancer can involve administering to a subject in need of treatment one or more of the immunoresponsive cells described herein. The immunoresponsive cells can bind to a tumor target molecule and induce cancer cell death. As described previously, the present application also provides a method of treating a pathogen infection in an individual, comprising administering to the individual a therapeutically effective amount of the immunoresponsive cells of the present application.

[0221] The frequency of administration of the immunoresponsive cells of the present application will depend on factors including the disease being treated, the elements of the particular immunoresponsive cell, and the mode of administration. For example, the administration can be 4 times daily, 3 times daily, 2 times daily, or once daily, every other day, every third day, every fourth day, every fifth day, every sixth day, once a week, every eighth day, every ninth day, every tenth day, once a week, or twice a month. As described herein, because the immunoresponsive cells of the present application have improved viability, they can be administered not only at a lower therapeutically effective amount than similar immunoresponsive cells that do not express an exogenous Type I interferon, but also at a lower frequency to achieve at least similar, and preferably more significant, therapeutic effects.

[0222] In some embodiments, the compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and tears. Desired isotonicity of the compositions of the present application can be achieved using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. If desired, the viscosity of the compositions can be maintained at a selected level using pharmaceutically acceptable thickeners. Suitable thickeners include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, and the like. The preferred concentration of the thickener will depend on the agent selected. Obviously, the selection of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage forms.

[0223] The present application also provides kits comprising an antibody, chimeric antigen receptor, nucleic acid, or immunoresponsive cell described herein. In some embodiments, the kit can include a therapeutic or prophylactic composition comprising an effective amount of an antibody, chimeric antigen receptor, nucleic acid, or immunoresponsive cell described herein in one or more unit dosage forms. In some embodiments, the kit comprises a sterile container that can contain a therapeutic or prophylactic composition; such container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a blister pack, or other suitable container form known in the art. Such container can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments. In some embodiments, the kit comprises an antibody, chimeric antigen receptor, nucleic acid, or immunoresponsive cell described herein, and instructions for administering the antibody, chimeric antigen receptor, nucleic acid, or immunoresponsive cell described herein to an individual. The instructions typically include a method of using the antibody, chimeric antigen receptor, nucleic acid, or immunoresponsive cell described herein to treat or prevent a cancer or tumor. In some embodiments, the kit comprises a host cell described herein, and can include about 1 x 10 4 6 5 6 7 7 7 7 7 7 7 8 8 8 8 ​​​​​​​​​​​​​​about 5 x 10 8 about 6 x 10 8 about 6 x 10 8 about 8 x 10 8 about 9 x 10 8 about 1 x 10 9 about 2 x 10 9 about 3 x 10 9 about 4 x 10 9 about 5 x 10 9 about 6 x 10 9 about 8 x 10 9 about 9 x 10 9 about 1 x 10 10 about 2 x 10 10 about 3 x 10 10 about 4 x 10 10 about 5 x 10 10 about 6 x 10 10 about 7 x 10 10 about 8 x 10 10 about 9 x 10 10 about 1 x 10 11 about 2 x 10 11 about 3 x 10 11 about 4 x 10 11 about 5 x 10 11 about 8 x 10 11 about 9 x 10 11 about 1 x 10 12 about 2 x 10 10 about 5 x 10 6 about 3 x 10 10 about 5 x 10 and administered to a subject.

[0224] In some embodiments, the kit can include allogeneic cells. In some embodiments, the kit can include cells that can include a genomic modification. In some embodiments, the kit can include "off-the-shelf" cells. In some embodiments, the kit can include cells that can be expanded for clinical use. In certain instances, the kit can include contents for research purposes.

[0225] In some embodiments, the instructions include at least one of the following: a description of the therapeutic agent; a dosage regimen and administration for treating or preventing a tumor or symptoms thereof; precautions, warnings, contraindications, overdose information, adverse reactions, animal pharmacology, clinical studies, and / or bibliographic references. The instructions can be printed directly on the container, or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. In some embodiments, the instructions provide a method of administering the immunoresponsive cells described herein for treating or preventing a tumor. In certain cases, the instructions provide a method of administering the immunoresponsive cells of the application prior to, after, or concurrently with a chemotherapeutic agent.

[0226] In another aspect, also provided herein is a method of inducing cell death comprising IL-13RA2, the method comprising contacting the cell with an antibody described herein, a chimeric antigen receptor described herein, a composition described herein, or a host cell described herein. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is in vivo.

[0227] In some embodiments, the cell is a tumor cell. In some embodiments, the cell is a brain tumor, more specifically, a astrocytoma, meningioma, glioma.

[0228] In another aspect, provided herein is a method of treating a tumor in an individual in need thereof, the method comprising administering to the individual an effective amount of an antibody, chimeric antigen receptor, composition, vector, or host cell described herein.

[0229] In some embodiments, the subject can be administered immune-responsive cells, where the immune-responsive cells that can be administered can be about 1 to about 35 days old. For example, the cells administered can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or up to about 40 days old. The age of the CAR immune-responsive cells can be calculated from the time of stimulation. The age of the immune-responsive cells can be calculated from the time of blood collection. The age of the immune-responsive cells can be calculated from the time of transduction. In some embodiments, the immune-responsive cells that can be administered to the subject are about 10 to about 14 or about 20 days old. In some embodiments, the "age" of the immune-responsive cells can be determined by telomere length. For example, "young" immune-responsive cells can have a longer telomere length than "exhausted" or "old" immune-responsive cells. Without being bound by a particular theory, it is believed that immune-responsive cells lose an estimated telomere length of about 0.8 kb per week in culture, and a young immune-responsive cell culture can have a telomere that is about 1.4 kb longer than an immune-responsive cell that is about 44 days old. Without being bound by a particular theory, it is believed that longer telomere length can be associated with positive objective clinical responses in patients and persistence of cells in vivo.

[0230] The cells (e.g., engineered cells or engineered primary T cells) can be functional before, after, and / or during transplantation. For example, the transplanted cells can be functional for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 6, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 days after transplantation. The transplanted cells can be functional for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months after transplantation. The transplanted cells can be functional for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 years after transplantation. In some embodiments, the transplanted cells can be functional for the lifetime of the recipient.

[0231] In addition, the transplanted cells can function at 100% of their normal expected function. The transplanted cells can also function at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to about 100% of their normal expected function.

[0232] The transplanted cells can also function at more than 100% of their normal expected function. For example, the transplanted cells can function at about 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or up to about 5000% of their normal expected function.

[0233] The transplant can be by any type of transplant. The local can include, but is not limited to, subcapsular space of the liver, subcapsular space of the spleen, subcapsular space of the kidney, omentum, submucosa of the stomach or intestine, segment of small intestine blood vessels, venous capsule, testis, brain, spleen, or cornea. For example, the transplant can be a subcapsular transplant. The transplant can also be an intramuscular transplant. The transplant can be a portal vein transplant.

[0234] The transplant rejection can be improved following treatment with the immunoresponsive cells of the application compared to when one or more wild-type cells are transplanted into a recipient. For example, the transplant rejection can be hyperacute rejection. The transplant rejection can also be acute rejection. Other types of rejection can include chronic rejection. The transplant rejection can also be a cell-mediated rejection or a T cell-mediated rejection. The transplant rejection can also be a natural killer cell-mediated rejection.

[0235] Improving the transplant can mean reducing, mitigating, or lessening the hyperacute rejection, which can include reducing, mitigating, or lessening an adverse effect or symptom. The transplant can refer to adoptive transplantation of a cell product.

[0236] Another indication of successful engraftment can be the number of days the recipient does not require immunosuppressive therapy. For example, after providing the immunoresponsive cells of the application, the recipient can not require immunosuppressive therapy for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days. This can indicate that the engraftment was successful. This can also indicate that the transplanted cells, tissues, and / or organs are not being rejected.

[0237] In some embodiments, the antibodies, chimeric antigen receptors, compositions, vectors, or host cells described herein can be administered in combination with another therapeutic agent. In some embodiments, the other therapeutic agent is a chemotherapeutic agent, such as those described in US20140271820. Chemotherapeutic drugs that can be used in combination with the immunoresponsive cells of the application include, but are not limited to, mitotic inhibitors (vinca alkaloids) including vincristine, vinblastine, vindesine, and novobiocin (vinorelbine, 5'-dehydrothiohydrogenated), topoisomerase I inhibitors such as camptothecin compounds including Camptosar TM (Irinotecan HCL), Hycamtin TM (topotecan HCL), and other compounds derived from camptothecin and analogs thereof; podophyllotoxin derivatives such as etoposide, teniposide, and mivobezide; alkylating agents cisplatin, cyclophosphamide, mechlorethamine, trimethylolomethane, carmustine, busulfan, chlorambucil, bleomycin, uracil mustard, chlorozotocin, and dacarbazine; antimetabolites including cytarabine, 5-fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine; antibiotics including, but not limited to, doxorubicin, bleomycin, dactinomycin, daunorubicin, plicamycin, mitomycin, mitomycin C, and daunomycin; and other chemotherapeutic drugs including, but not limited to, anti-tumor antibodies, dacarbazine, azacitidine, amrubicin, melphalan, ifosfamide, and mitoxantrone. In some embodiments, the additional therapeutic agent is selected from one or more of epirubicin, oxaliplatin, and 5-fluorouracil.

[0238] In some embodiments, chemotherapeutic drugs that can be used in combination with the immunoresponsive cells of the application include, but are not limited to, anti-angiogenic agents including anti-VEGF antibodies (including humanized and chimeric antibodies, anti-VEGF aptamers, and antisense oligonucleotides) and other angiogenesis inhibitors such as angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta) interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinases -1 and -2.

[0239] The present application also relates to vectors comprising the appropriate DNA sequences described above and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to enable them to express proteins. The host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells.

[0240] The present application is further described in conjunction with the following specific examples. It should be understood that these examples are only intended to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods in the following examples, for which specific conditions are not indicated, are generally performed according to conventional conditions, such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, 2002, or according to the conditions recommended by the manufacturers.

[0241] Example 1. Preparation of IL-13RA2 and IL-13RA1 recombinant proteins

[0242] a. Construction of IL-13RA2_huFc and IL-13RA1_huFc expression plasmids

[0243] The extracellular segment Asp27-Arg343 (SEQ ID NO: 18) gene of human IL-13RA2 (SEQ ID NO: 17) is synthesized in vitro and inserted into a eukaryotic expression plasmid containing the Fc segment Asp104-Lys330 of human IgG1 heavy chain constant region, with a "GS" linker in between, to form the fusion expression protein IL-13RA2_huFc (SEQ ID NO: 22), and the corresponding gene sequence is shown in SEQ ID NO: 11. Alternatively, the IL-13RA1 extracellular segment gene (SEQ ID NO: 19) is inserted into a eukaryotic expression plasmid containing the Fc segment Asp104-Lys330 of human IgG1 heavy chain constant region, with a "GS" linker in between, to form the fusion expression protein IL-13RA1_huFc (SEQ ID NO: 24), and the corresponding gene sequence is shown in SEQ ID NO: 23.

[0244] b. Transient transfection of IL-13RA2_huFc and IL-13RA1_huFc

[0245] 1) One day before transfection, 6-7 x 10 5 / ml 293F cells were inoculated into 125 ml culture flasks

[0246] 2) On the day of transfection, 3 x 10 7 cells were adjusted to 28 ml FreeStyle™ 293 expression medium

[0247] 3) Preparation of lipid-DNA complexes according to the following procedure:

[0248] Dilute 30 ug DNA with Opti-MEM I to a final volume of 1 ml, mix well

[0249] Dilute 60 ul 293fectin™ with Opti-MEM I to a final volume of 1 ml, mix well

[0250] Incubate at room temperature for 5 minutes,

[0251] 4) Mix diluted DNA with 293fectin™, incubate for 20 minutes

[0252] 5) Add 2 ml of DNA-293fectin complex to 28 ml of cells, incubate at 37°C, 8% CO2, 125 rpm for 3-4 days, collect supernatant

[0253] c. Purification of IL-13RA2_huFc, IL-13RA1_huFc

[0254] 1) Centrifuge the culture supernatant at 13000 rpm for 15 min

[0255] 2) Affinity purification using protein A packing, according to the following procedure:

[0256] Equilibration: equilibrate the protein A packing with 10 column volumes of equilibration buffer.

[0257] Loading: load the sample treated with 0.45 μm filter.

[0258] Washing: wash with 20 column volumes of equilibration buffer until no material flows through.

[0259] Elution: elute the target protein with 10 column volumes of elution buffer (add 6% neutralization buffer to the collection tube in advance).

[0260] Solution Formulation

[0261] Equilibration buffer: PBS pH 7.4

[0262] Elution buffer: 0.1 M glycine pH 2.6

[0263] Neutralization buffer: 1 M Tris

[0264] 3) After filtration with 0.22um membrane, use millipore ultrafiltration tube with 10KD cut-off to concentrate the sample to 1ml or less, use PD-Midi desalting column to desalt the sample, collect 1.5ml sample. Measure the protein concentration by OD280 / 1.47

[0265] Take 2ug to run SDS-PAGE, the result is shown in Figure 1

[0266] Example 2. Screening of scFv specific to IL-13RA2 using full human phage display library

[0267] The phage display library used in this application is a full human natural scFv phage library constructed by our company, with a library capacity of 1E+11. The scFv fragment specific to IL-13RA2 was obtained by using screening method known to those skilled in the art. Briefly, coat 10ug / ml of antigen IL-13RA2_huFc and IL-13RA1_huFc in the immunotube respectively. In order to screen the antibody specific to IL-13RA2, add the phage library to the immunotube coated with IL-13RA1_huFc and bind for 1 hour. Take the supernatant and add to the immunotube coated with IL-13RA2_huFc and bind for 1.5 hours, then wash away the non-specific phage, elute the bound phage and infect the logarithmic phase E. coli TG1. Enlarge the culture of the eluted phage and use PEG / NaCl precipitation to purify the enlarged phage library for the next round of screening. Perform 3-4 cycles of panning to enrich the scFv phage clones specific to IL-13RA2. Determine the positive clones by standard ELISA method against IL-13RA2_huFc. Use IL-13RA1_huFc as irrelevant antigen in ELISA to verify the specificity of the antibody. A total of 3420 clones were screened, of which 44 clones specifically bound to IL-13RA2_huFc and did not bind to IL-13RA1_huFc in ELISA experiment. After sequencing, 5 single sequences were obtained. Express and purify the 5 clones, of which only 2 specifically bind to U251 cells expressing IL13RA2 (purchased from Chinese Academy of Sciences Cell Bank) Figure 2 、 4 ), with clone names 31C2, 32H4.

[0268] ​The amino acid sequence of the heavy chain variable region of 31C2 is shown as SEQ ID NO: 2, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO: 4; the amino acid sequence of the heavy chain variable region of 32H4 is shown as SEQ ID NO: 6, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO: 8. The amino acid sequence of HDCR1 of 31C2 is shown as SEQ ID NO: 9, the amino acid sequence of HDCR2 is shown as SEQ ID NO: 10, the amino acid sequence of HDCR3 is shown as SEQ ID NO: 11, the amino acid sequence of LDCR1 is shown as SEQ ID NO: 13, the amino acid sequence of LDCR2 is shown as SEQ ID NO: 14, and the amino acid sequence of LDCR3 is shown as SEQ ID NO: 15; the amino acid sequence of HDCR1 of 32H4 is shown as SEQ ID NO: 9, the amino acid sequence of HDCR2 is shown as SEQ ID NO: 10, the amino acid sequence of HDCR3 is shown as SEQ ID NO: 12, the amino acid sequence of LDCR1 is shown as SEQ ID NO: 13, the amino acid sequence of LDCR2 is shown as SEQ ID NO: 14, and the amino acid sequence of LDCR3 is shown as SEQ ID NO: 16.

[0269] Example 3. ELISA binding assay

[0270] The species specificity of antibodies 31C2, 32H4 was tested by standard ELISA. Murine IL-13RA2 was purchased from SinoBiological Inc. 5ug / ml, 100ul / well of murine IL-13RA2 was coated on ELISA plates at 4 degrees overnight. The coated ELISA plates were washed with PBS for three times. 200ul / well of 2% skim milk in PBS was added to block for 1 hour at room temperature. Washed with PBS for three times. Gradient dilution of antibodies was added, starting concentration of 10ug / ml, 3-fold dilution, incubated for 1 hour at room temperature. Washed with PBST for three times, and PBS for three times. HRP labeled goat anti-human Fc was added, incubated for 1 hour at room temperature. Washed with PBST for three times, and PBS for three times. TMB was added for color development for 15 minutes, and sulfuric acid was added to stop the reaction and read on a microplate reader. The results are shown in Figure 3 Figure 2. Antibody 31C2 can bind to murine IL-13RA2, and 32H4 cannot bind to murine IL-13RA2.

[0271] Example 4. Construction of anti-IL-13RA2 scFv_Fc fusion antibodies and their transient expression, purification and activity identification in eukaryotic cells

[0272] The primers were designed for the VH and VL fragments of 31C2 and 32H4, respectively, to introduce a linker composed of 15 flexible amino acids (GGGGSGGGGSGGGGS) to form scFv; introduce appropriate enzyme cutting sites and protection bases upstream of VH and downstream of VL. The PCR products were analyzed by 1% agarose gel electrophoresis and purified for recovery. After enzyme cutting, the appropriate eukaryotic expression vector was connected. 293fectin TM Transfection reagent (Invitrogen, 12347-019) or polyethyleneimine (PEI) (Sigma-Aldrich, 408727) was used to transiently transfect 293F cells in logarithmic growth phase. After 5-7 days of transfection, the culture supernatant was collected and affinity purified by Protein A.

[0273] The binding of the antibodies to U251 cells endogenously expressing IL-13RA2 was tested by flow cytometry, with 293T cells as negative cell controls. The specific method for FACs detection is as follows: the cells were harvested, washed once with growth medium, resuspended in PBS, and the cell concentration was adjusted to 4E+5 cells / ml. The diluted scFv_Fc fusion antibody was incubated with the cells on ice for 30 minutes, and the concentration of the antibody was 111 nM. Then it was incubated with a FITC-labeled anti-human IgG secondary antibody. After two washing steps, Guava easyCyte™ HT System instrument was used for detection. Figure 4 The binding of antibodies 31C2, 32H4 scFv_Fc fusion forms to U251 and 293T cells is shown. Both antibodies specifically bind to U251 cells endogenously expressing IL-13RA2, and do not bind to negative cells 293T.

[0274] Example 5. Determination of the affinity of the antibodies using surface plasmon resonance technology (SPR)

[0275] The affinity of different antibodies to IL-13RA2 was determined using biacoreT200. The specific method is as follows:

[0276] IL-13RA2_huFc was coated on a CM5 chip by amino coupling, coated to about 500 RU, and gradient-diluted antibodies were used as the mobile phase to pass through the channel coated with the antigen at a flow rate of 30 ul / min. The running buffer was HBS-N, and the temperature was 25 degrees. The experimental data was analyzed by BIAevaluation3.2, and the kinetic curve was fitted using a 1:1 langmuir model. The KD of 31C2 (scFv_Fc) was 1.79 nM, and the KD of 32H4 (scFv_Fc) was 3.76 nM (seeFigure 5 ).

[0277] Example 6. Determination of EC50 of antibody binding to U251 cells using FACs

[0278] Cells were harvested, washed once with growth media, resuspended in PBS and adjusted to a cell concentration of 4E+5 cells / ml. The gradient dilution of scFv_Fc fusion antibodies were incubated with cells on ice for 30 minutes, starting concentration of antibody was 500nM, 5-fold dilution, 8 gradients. Then incubated with FITC labeled anti-human IgG secondary antibody. After two washing steps, detected using Guava easyCyte™ HT System instrument. The results were shown in Figure 6, where both antibodies have concentration gradient dependent binding to U251 cells, EC50 of 31C2 (ScFv_Fc) is 2.8nM, EC50 of 32H4 (ScFv_Fc) is 1nM. Figure 6

[0279] Example 7. Affinity maturation of antibodies

[0280] Affinity maturation was performed using phage display technology.

[0281] Two phage libraries were constructed using 31C2 and 32H4 as parental antibodies, one randomizing CDR1 and CDR2 of light chain, the other randomizing CDR2 and CDR2 of heavy chain. Then panned against antigen, high affinity antibodies, i.e. variants of 31C2 and 32H4, were selected by SPR technology, etc. Primer information was shown in Table 2. Figure 7

[0282] ​​Firstly, a template plasmid was constructed based on antibody 31C2 (scFv) (amino acid sequence SEQ ID NO: 25, nucleic acid sequence SEQ ID NO: 26). For the phage library with CDR1 and CDR2 of light chain randomized, fragment 1 was amplified by PCR using primers LMF and IL1R; fragment 2 was amplified by PCR using primers IL2F and FdR; then the full length of scFv containing randomized sequences was obtained by bridge PCR connecting fragment 1 and fragment 2, and then the full length fragment was digested with Ncol and Notl, and ligated into the same digested template plasmid by T4 ligase, and then electrotransformed into TG1 competent cells, with a library capacity of 1.68E+9. For the phage library with CDR1 and CDR2 of heavy chain randomized, fragment 3 was amplified by PCR using primers LMF and BH1R; fragment 4 was amplified by PCR using primers BH2F and FdR; then the full length of scFv containing randomized sequences was obtained by bridge PCR connecting fragment 3 and fragment 4, and then the full length fragment was digested with Ncol and Notl, and ligated into the same digested template plasmid by T4 ligase, and then electrotransformed into TG1 competent cells, with a library capacity of 1.75E+9.

[0283] The construction of antibody 32H4 affinity maturation library was similar to 31C2, a template plasmid was constructed based on antibody 32H4 (scFv) (amino acid sequence SEQ ID NO: 27, nucleic acid sequence SEQ ID NO: 28). The CDR1 and CDR2 of light chain were randomized using the same primers as 31C2, and the obtained phage library had a library capacity of 2.1E+9. Similarly, the CDR1 and CDR2 of heavy chain were randomized using the same primers as 31C2, and the obtained phage library had a library capacity of 1.5E+9.

[0284] Example 8. Screening of phage library

[0285] The method in Example 2 of the present patent was referred to. The starting concentration of antigen IL13RA2_huFc was 50 nM, and 2-fold gradient dilution was performed for the next round of screening. The panning was performed for 2-3 cycles to enrich the scFv phage clones specifically binding to IL13RA2_huFc. The positive clones were determined by standard ELISA method against IL13RA2_huFc. The specificity of the antibodies was verified by ELISA using human IL13RA1_huFc fragment as irrelevant antigen. A total of 111 ELISA positive clones were picked, and after re-induction, the dissociation constant Kd of the induced supernatant was determined by biacore. The dissociation constant Kd of 10 clones was more than 10 times lower than that of the parent clone, as shown in Table 1. Figure 8

[0286] ​The light chains of clones 2C7, 2D3, 1D11, 1B11, 2A5, 2D4, 1H7, 1D8 were sequenced and were the same as 31C2 (amino acid sequence SEQ ID NO: 4, nucleic acid sequence SEQ ID NO: 3). Figure 9A The heavy chain amino acid sequences of clones 2C7 (amino acid sequence SEQ ID NO: 29, nucleic acid sequence SEQ ID NO: 30), 2D3 (amino acid sequence SEQ ID NO: 31, nucleic acid sequence SEQ ID NO: 32), 1D11 (amino acid sequence SEQ ID NO: 33, nucleic acid sequence SEQ ID NO: 34), 1B11 (amino acid sequence SEQ ID NO: 35, nucleic acid sequence SEQ ID NO: 36), 2A5 (amino acid sequence SEQ ID NO: 37, nucleic acid sequence SEQ ID NO: 38), 2D4 (amino acid sequence SEQ ID NO: 39, nucleic acid sequence SEQ ID NO: 40), 1H7 (amino acid sequence SEQ ID NO: 41, nucleic acid sequence SEQ ID NO: 42), 1D8 (amino acid sequence SEQ ID NO: 43, nucleic acid sequence SEQ ID NO: 44) and 31C2 (amino acid sequence SEQ ID NO: 2, nucleic acid sequence SEQ ID NO: 1) were compared.

[0287] The sequences of HCDR1 of the affinity matured clones of 31C2 are shown in SEQ ID NOs: 45-51, respectively, and the sequences of HCDR2 are shown in SEQ ID NOs: 52-58, respectively, as shown in Table 1 below. Figure 9B .

[0288] Compared with the VH of the parent antibody 31C2, 2C7 has 4 sites of mutation, with a similarity of 96.7%; 2D3 has 5 sites of mutation, with a similarity of 95.8%; 1D11 has 6 sites of mutation, with a similarity of 95%; 1B11 has 5 sites of mutation, with a similarity of 95.8%; 2A5 has 4 sites of mutation, with a similarity of 96.7%; 2D4 has 5 sites of mutation, with a similarity of 95.8%; 1H7 has 4 sites of mutation, with a similarity of 96.7%; and 1D8 has 4 sites of mutation, with a similarity of 96.7%.

[0289] The light chains of clones 5G3, 5D7 were sequenced and were the same as 32H4 (amino acid sequence SEQ ID NO: 8, nucleic acid sequence SEQ ID NO: 7). Figure 9CThe heavy chain amino acid sequences of clones 5G3 (amino acid sequence SEQ ID NO: 59, nucleic acid sequence SEQ ID NO: 60), 5D7 (amino acid sequence SEQ ID NO: 61, nucleic acid sequence SEQ ID NO: 62) and 32H4 (amino acid sequence SEQ ID NO: 6, nucleic acid sequence SEQ ID NO: 5) were compared.

[0290] The sequences of HCDR1 of the affinity matured clones of 32H4 are shown in SEQ ID NO: 63, 64, respectively, and the sequences of HCDR2 are shown in SEQ ID NO: 65, 66, respectively, as follows: Figure 9D .

[0291] Compared with the VH of the parent antibody 32H4, 5G3 has 5 sites of mutation, with a similarity of 95.7%; 2D3 has 5 sites of mutation, with a similarity of 95.8%; 5D7 has 8 sites of mutation, with a similarity of 95%; and 1B11 has 5 sites of mutation, with a similarity of 93.2%.

[0292] Example 9. Expression and purification of scFv

[0293] The TG1 containing the antibody gene was streaked and inoculated into 2xTY-Amp-5% Glucose medium to pick single clones, which were cultured at 37°C, 220 rpm, until the OD600 nM = 0.8-0.9, and 1 mM IPTG was added to induce the expression of scFv, and the culture was incubated at 25°C, 220 rpm, overnight.

[0294] The bacterial cells were collected by centrifugation, suspended in 30 mM Tris HCl, 20% sucrose, 1 mM EDTA pH 8.0 (80 ml per gram of bacterial cells), and then ice-bathed, centrifuged at 4°C, 8000 g, and the supernatant A was taken. The precipitate was suspended in 5 mM MgSO4 8 ml, ice-bathed, gently shaken for 10 minutes, centrifuged at 4°C, 8000 g, and the supernatant B was taken. The supernatant A and the supernatant B were combined, centrifuged at 12000 g for 15 minutes, and the supernatant was the cold osmotic shock fluid.

[0295] The nickel column was used for affinity purification, the biacore T200 was used to determine the affinity, and the binding dissociation constant of the affinity matured antibody is shown in Figure 10A .

[0296] The specificities of antibodies 5D7, 2C7, 5G3, 2D4, 2D3, and 1B11 were detected by standard ELISA according to the method of Example 3. The results are shown in Figure 10BThe clones 1B11, 2C7, 2D3, 2D4 from the parent antibody 31C2 are specific to bind human IL13RA2, not human IL13RA1, and cross-react with murine IL13RA2. The clones 5D7, 5G3 from the parent antibody 32H4 are specific to bind human IL13RA2, not human IL13RA1, not murine IL13RA2.

[0297] Example 10. Expression of scFv_Fc format of antibodies and affinity determination

[0298] The six antibodies 5D7, 2C7, 5G3, 2D4, 2D3, 1B11 with higher affinity were chosen to construct the scFv_Fc fusion format.

[0299] The PCR products were analyzed by 1% agarose gel electrophoresis and purified. The PCR products were digested and ligated into the eukaryotic expression vector V152 containing human Fc segment (purchased from Shanghai Ruikeng Biotechnology Co., Ltd.). The ligated products were transfected into 293F cells by 293Fectin and expressed. The culture supernatant was collected after 5-7 days of transfection and affinity purified by Protein A. The aggregation of the antibodies was analyzed by SEC. The results are shown in Figure 11.

[0300] The affinity was determined by biacore T200 according to the method of Example 5, and the results are shown in Figure 12. The affinity of the antibodies after affinity maturation was improved by 3-10 times compared with the parent antibodies. The antibody binding dissociation constant is shown in Figure 13. Figures 11B-11G Figure 11F

[0301] Example 11. Determination of the EC50 of the scFv_Fc format of antibodies binding to U251 cells

[0302] According to the method of Example 6, the cells were harvested, washed once with growth medium, resuspended in PBS, and the cell concentration was adjusted to 4E+5 cells / ml. The gradient-diluted scFv_Fc fusion antibodies were incubated with the cells on ice for 30 minutes, and the starting concentration of the antibodies was 2000 nM, 5-fold dilution, 11 gradients. Then, the FITC-labeled anti-human IgG secondary antibody was incubated. After two washing steps, the Guava easyCyte™ HT System instrument was used for detection. The results are shown in Figure 14. Figure 12 ​​The scFv_Fc forms of antibodies 5D7, 2C7, 5G3, 2D4, 2D3, 1B11 showed binding EC50 to U251 cells of 0.56 nM, 0.57 nM, 0.53 nM, 0.37 nM, 0.33 nM, 0.47 nM, respectively. There was also a 2-8 fold improvement compared to the parental antibodies.

[0303] Example 12. Preparation of CAR-T cells

[0304] 2D4 and 5G3 were selected for CAR-T cell preparation and anti-tumor activity study.

[0305] 1. Construction of lentivirus packaging plasmid pRRL-hu8E3-28Z

[0306] Using PRRLSIN-cPPT.EF-1a as a vector, lentivirus plasmids expressing chimeric antigen receptors of antibodies 2D4 and 5G3 were constructed, including PRRLSIN-cPPT.EF-1a-2D4-28Z, PRRLSIN-cPPT.EF-1a-2D4-BBZ, PRRLSIN-cPPT.EF-1a-2D4-28BBZ, and PRRLSIN-cPPT.EF-1a-5G3-28Z, PRRLSIN-cPPT.EF-1a-5G3-BBZ, PRRLSIN-cPPT.EF-1a-5G3-28BBZ.

[0307] The 2D4-28Z sequence consists of CD8a signal peptide (SEQ ID NO: 68), 2D4 scFv (SEQ ID NO: 67), CD8 hinge (SEQ ID NO: 69), CD28 transmembrane region (SEQ ID NO: 70), and intracellular signaling domain (SEQ ID NO: 71), and the intracellular segment CD3ξ of CD3 (SEQ ID NO: 72).

[0308] The 2D4-BBZ sequence consists of CD8a signal peptide (SEQ ID NO: 68), 2D4 scFv (SEQ ID NO: 67), CD8 hinge (SEQ ID NO: 69), CD8 transmembrane region (SEQ ID NO: 73), intracellular signaling domain of CD137 (SEQ ID NO: 74), and the intracellular segment CD3ξ of CD3 (SEQ ID NO: 72).

[0309] 2D4-28BBZ sequence consists of CD8a signal peptide (SEQ ID NO: 68), 2D4 scFv (SEQ ID NO: 67), CD8 hinge (SEQ ID NO: 69), CD28 transmembrane region (SEQ ID NO: 70) and intracellular signaling domain (SEQ ID NO: 71), intracellular signaling domain of CD137 (SEQ ID NO: 74), and intracellular segment of CD3 CD3xi (SEQ ID NO: 72).

[0310] 5G3-28Z sequence consists of CD8a signal peptide (SEQ ID NO: 68), 5G3 scFv (SEQ ID NO: 75), CD8 hinge (SEQ ID NO: 69), CD28 transmembrane region (SEQ ID NO: 70) and intracellular signaling domain (SEQ ID NO: 71), and intracellular segment of CD3 CD3xi (SEQ ID NO: 72).

[0311] 5G3-BBZ sequence consists of CD8a signal peptide (SEQ ID NO: 68), 5G3 scFv (SEQ ID NO: 75), CD8 hinge (SEQ ID NO: 69), CD8 transmembrane region (SEQ ID NO: 73), intracellular signaling domain of CD137 (SEQ ID NO: 74), and intracellular segment of CD3 CD3xi (SEQ ID NO: 72).

[0312] 5G3-28BBZ sequence consists of CD8a signal peptide (SEQ ID NO: 68), 5G3 scFv (SEQ ID NO: 75), CD8 hinge (SEQ ID NO: 69), CD28 transmembrane region (SEQ ID NO: 70) and intracellular signaling domain (SEQ ID NO: 71), intracellular signaling domain of CD137 (SEQ ID NO: 74), and intracellular segment of CD3 CD3xi (SEQ ID NO: 72).

[0313] 2. Lentivirus packaging, virus concentration, and titer determination of IL13Ra2 CAR lentivirus vector

[0314] At 1.7 x 10 7293T cells were seeded in 15 cm dishes at a density of 1.5 x 107cells per dish in DMEM containing 10% fetal bovine serum (BioWest). The plasmids PRRLSIN-2D4-28Z, PRRLSIN-2D4-BBZ, PRRLSIN-2D4-28BBZ, PRRLSIN-5G3-28Z, PRRLSIN-5G3-BBZ, PRRLSIN-5G3-28BBZ, 13.73 μg each, were mixed with the packaging plasmids pRsv-REV 16.4 μg, RRE-PMDLg 16.4 μg, Vsvg 6.4 μg in 2048 μL of DMEM without serum. The mixture was incubated at room temperature for 20 min.

[0315] 158.4 μg of PEI (1 μg / μl) was dissolved in 2048 μl of DMEM without serum and incubated at room temperature. The plasmid mixture was added to the PEI mixture and incubated at room temperature for 20 min. The transfection complex 4.096 ml was added to 20 ml of DMEM in a 15 cm dish and incubated at 37°C for 4-5 h. The transfected 293T cells were washed with DMEM containing 10% FBS and incubated at 37°C for 72 h. The virus supernatant was collected and concentrated, and the virus titer was determined. The virus titers of the concentrated virus were:

[0316] 2D4-28Z: 3.89E x 1010 8 U / ml

[0317] 2D4-BBZ: 3.08E x 1010 8 U / ml

[0318] 2D4-28BBZ: 2.72E x 1010 8 U / ml

[0319] 5G3-28Z: 3.7E x 1010 8 U / ml

[0320] 5G3-BBZ: 1.88E x 1010 8 U / ml

[0321] 5G3-28BBZ: 3.11E x 1010 8 U / ml

[0322] 3. Lentivirus transduced T lymphocytes - Preparation of CAR positive T lymphocytes

[0323] T lymphocyte activation: about 5 x 107T lymphocytes were activated with 5 ng / ml of anti-CD3 antibody (OKT3) and 1000 U / ml of recombinant human IL-2 for 3 days. 5 / mL density of lymphocyte culture medium liquid culture, and according to the magnetic beads: cell ratio of 2:1, magnetic beads (Invitrogen) coated with anti-CD3 and CD28 antibodies and recombinant human IL-2 (Shanghai Huaxin Biological High-tech Co., Ltd.) with a final concentration of 500 U / mL were added to stimulate the culture for 24-48 h;

[0324] Retronectin-coated 24-well plates: add 380 μl of 5 μg / ml retronectin solution (PBS) to each well, incubate at 4°C overnight. Discard the retronectin solution (PBS) in the 24-well plate, wash twice with 1 ml of PBS, and wash once with the medium (keep the well wet); inoculate the cells into the retronectin-coated 24-well plate, with 5×10 5 4, the volume of the culture medium is 500 μl; add the concentrated lentivirus to the PBMC cells according to MOI = 15, centrifuge at 32°C, 1200g for 60 min, then transfer to the cell culture box, and after 24 h of infection, change the liquid by low-speed centrifugation (300 rpm, 10 min, large centrifuge). The magnetic beads can be removed 3-4 days after infection.

[0325] 4. T lymphocyte chimeric antigen receptor expression

[0326] On the 7th day of lentivirus-infected T lymphocyte culture, 1×10 6 of T cells were taken, divided into two, centrifuged at 4°C, 5000 rpm for 5 min, the supernatant was discarded, and PBS was washed twice. The control group of cells was added with 50 μl of PE-SA (1:200 dilution) antibody and incubated on ice for 45 min, and then washed twice with PBS (2% NBS), and resuspended as a control; the detection group of cells was added with 50 μl of 1:50 dilution of biotin-Goat anti-human IgG, F(ab')2 antibody, and incubated on ice for 45 min; washed twice with PBS (2% NBS); added with 50 μl of PE-SA (1:200 dilution) antibody and incubated on ice for 45 min; added with 2 ml of PBS (2% NBS) to resuspend the cells, centrifuged at 4°C, 5000 rpm / min for 5 min, and the supernatant was discarded; repeated twice; and the proportion of CAR-positive T cells was detected by flow cytometry.

[0327] 5. Cytotoxicity assay of IL13Ra2 CAR T cells

[0328] The infection positive rates of the six CAR T cells were 66.0%, 26.3%, 34.8%, 59.9%, 35.5% and 23.8% respectively when comparing the in vitro killing activities of UTD, 2D4-28Z, 2D4-BBZ, 2D4-28BBZ, 5G3-28Z, 5G3-BBZ and 5G3-28BBZ CAR T cells.

[0329] Three pieces of E-Plate 16 were added with 50ul of RMPI+10% fetal bovine serum (Gibco)+double antibody respectively, and placed on a real-time monitor to adjust the baseline.

[0330] Target cells: 50ul of 1×10 4 / mL of U251 cells were inoculated in the E-Plate 16 plate respectively, and placed for 30-40min, and placed on a real-time monitor to start monitoring;

[0331] Effector cells: 18 hours later, UTD and CAR T cells expressing different chimeric antigen receptors were added according to the effector-target ratio of 3:1, 1:1 or 1:3;

[0332] Each group had two duplicate holes, and the average value of the two duplicate holes was taken. The detection time was 38h.

[0333] Among them, each experimental group and each control group is as follows:

[0334] Each experimental group: each target cell+CAR T expressing different chimeric antigen receptors;

[0335] Control group 1: target cell

[0336] Control group 2: blank medium;

[0337] The cytotoxicity calculation formula is: % cytotoxicity = [(experimental group-effector cell spontaneous group-target cell spontaneous group) / (target cell maximum-target cell spontaneous)]*100

[0338] The experimental results are shown in Figure 13 Each CAR T expressing different chimeric antigen receptors has significant in vitro killing activity on IL13Ra2 positive cells.

[0339] All the documents mentioned in the present application are cited as references in the present application, just as each document is cited as a reference individually. In addition, it should be understood that those skilled in the art can make various modifications or changes to the present application after reading the above teaching of the present application, and these equivalent forms also fall within the scope defined by the appended claims of the present application. SEQUENCE LISTING <110> KIZI BIOMEDICAL (SHANGHAI) CO., LTD. <120> Antibodies targeting IL-13RA2 and uses thereof <130> P2017-2623 <150> 201710087299.2 <151> 2017-02-17 <160> 75 <170> PatentIn version 3.5 <210> 1 <211> 363 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agttatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 2 <211> 121 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 2 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val [[ID=]14]50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105​​​​​​​​​​​​​​​​​atcacttgcc gtgccagtca gagtattagt agctggttgg cctggtatca gcagaaacca 120 gggaaagccc ctaagctcct gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180 cgtttcagcg gcagtggatc cgggacagaa ttcactctca ccatcagcag cttgcagcct 240 gatgattttg caacttatta ctgccaacag tacgatacct acccaccaat cacgtttggc 300 cagggcacca aagtcgagat caag 324 <210> 4 <211> 108<00​​​​​​​​​​​​​​​​​​​​​​​​​​Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp Thr Tyr Pro Pro 85 90 95 Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 5 <211> 354 <212> DNA <213> Artificial Sequence <400> 5 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agttatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gcgtgttgca 300 ttctctggtt ctttcgacta ctggggccaa ggaaccctgg tcaccgtctc gagt 354 <210> 6 <211> 118 <212> PRT <213> Artificial Sequence <400> 6 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala He Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Phe Ser Gly Ser Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 7 <211> 321 <212> DNA <213> Artificial Sequence <400> 7 gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga ccgtgtcacc 60 atcacttgcc gtgccagtca gagtattagt agctggttgg cctggtatca gcagaaacca 120 GACATCCAGA TGACCCAGTC TCCTTCCACC CTGTCTGCA TCTGTAGGAG ACCGTGTCAC C 60 ATCACTTGCC GTGCCAGTCA GAGTATTAGT AGCTGGTTGG CCTGGTATCA GCAGAAACCA 120gggaaagccc ctaagctcct gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180 cgtttcagcg gcagtggatc cgggacagaa ttcactctca ccatcagcag cttgcagcct 240 gatgattttg caacttatta ctgccaacag agaaacagat acccaccaac gtttggccag 300 ggcaccaaag tcgagatcaa g 321 <210> 8 <211> 107 <212> PRT <213> Artificial Sequence <400> 8 Asp Ile Gin Met Thr Gin Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gin Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Ser Leu Gin Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Gin Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gin Gin Arg Asn Arg Tyr Pro Pro 85 90 95 Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys 100 105 <210> 9 <211> 5 <212> PRT <213> Artificial Sequence <400> 9 Ser Tyr Ala Met Ser 1 5 <210> 10 <211> 17 <212> PRT <213> Artificial Sequence <400> 10 Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 11 <211> 12 <212> PRT <213> Artificial Sequence <400> 11 Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr 1 5 10 <210> 12 <211> 9 <212> PRT <213> Artificial Sequence <400> 12 Val Ala Phe Ser Gly Ser Phe Asp Tyr 1 5 <210> 13 <211> 11 <212> PRT <213> Artificial Sequence <400> 13 Arg Ala Ser Gin Ser lie Ser Ser Trp Leu Ala 1 5 10 <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <400> 14 Asp Ala Ser Ser Leu Gin Ser 1 5 <210> 15 <211> 10 <212> PRT <213> Artificial Sequence <400> 15 Gin Gin Tyr Asp Thr Tyr Pro Pro lie Thr 1 5 10 <210> 16 <211> 9 <212> PRT <213> Artificial Sequence <400> 16 Gin Gin Arg Asn Arg Tyr Pro Pro Thr 1 5 <210> 17 <211> 951 <212> DNA <213> Artificial Sequence <400> 17 gacaccgaga taaaagttaa ccctcctcag gattttgaga tagtggatcc cggatactta 60 ggttatctct atttgcaatg gcaaccccca ctgtctctgg atcattttaa ggaatgcaca 120 gtggaatatg aactaaaata ccgaaacatt ggtagtgaaa catggaagac catcattact 180 aagaatctac attacaaaga tgggtttgat cttaacaagg gcattgaagc gaagatacac 240 acgcttttac catggcaatg cacaaatgga tcagaagttc aaagttcctg ggcagaaact 300 acttattgga tatcaccaca aggaattcca gaaactaaag ttcaggatat ggattgcgta 360 tattacaatt ggcaatattt actctgttct tggaaacctg gcataggtgt acttcttgat 420 accaattaca acttgtttta ctggtatgag ggcttggatc atgcattaca gtgtgttgat 480 tacatcaagg ctgatggaca aaatatagga tgcagatttc cctatttgga ggcatcagac 540 tataaagatt tctatatttg tgttaatgga tcatcagaga acaagcctat cagatccagt 600 tatttcactt ttcagcttca aaatatagtt aaacctttgc cgccagtcta tcttactttt 660 actcgggaga gttcatgtga aattaagctg aaatggagca tacctttggg acctattcca 720 gcaaggtgtt ttgattatga aattgagatc agagaagatg atactacctt ggtgactgct 780 acagttgaaa atgaaacata caccttgaaa acaacaaatg aaacccgaca attatgcttt 840 GTAAGAAAGC AAAGTGAATT ATTGATTGCT CAGATGACGG AATTTCGGAG TGAGTGGAGT 900 GTAAGAAAGC AAAGTGAATT ATTGATTGCT CAGATGACGG AATTTCGGAG TGAGTGGAGT 900 <210> 18 <211> 317 <212> PRT <213> Artificial Sequence <400> 18 Asp Thr Glu lie Lys Val Asn Pro Pro Gin Asp Phe Glu lie Val Asp 1 5 10 15 Pro Gly Tyr Leu Gly Tyr Leu Tyr Leu Gin Trp Gin Pro Pro Leu Ser 20 25 30 Leu Asp His Phe Lys Glu Cys Thr Val Glu Tyr Glu Leu Lys Tyr Arg 35 40 45 Asn lie Gly Ser Glu Thr Trp Lys Thr lie lie Thr Lys Asn Leu His 50 55 60 Tyr Lys Asp Gly Phe Asp Leu Asn Lys Gly lie Glu Ala Lys lie His 65 70 75 80 Thr Leu Leu Pro Trp Gin Cys Thr Asn Gly Ser Glu Val Gin Ser Ser 85 90 95 Trp Ala Glu Thr Thr Tyr Trp lie Ser Pro Gin Gly lie Pro Glu Thr 100 105 110 Lys Val Gin Asp Met Asp Cys Val Tyr Tyr Asn Trp Gin Tyr Leu Leu 115 120 125 Cys Ser Trp Lys Pro Gly He Gly Val Leu Leu Asp Thr Asn Tyr Asn 130 135 140 Leu Phe Tyr Trp Tyr Glu Gly Leu Asp His Ala Leu Gin Cys Val Asp 145 150 155 160 Tyr He Lys Ala Asp Gly Gin Asn He Gly Cys Arg Phe Pro Tyr Leu 165 170 175 Glu Ala Ser Asp Tyr Lys Asp Phe Tyr He Cys Val Asn Gly Ser Ser 180 185 190 Glu Asn Lys Pro He Arg Ser Ser Tyr Phe Thr Phe Gin Leu Gin Asn 195 200 205 He Val Lys Pro Leu Pro Pro Val Tyr Leu Thr Phe Thr Arg Glu Ser 210 215 220 Ser Cys Glu He Lys Leu Lys Trp Ser He Pro Leu Gly Pro He Pro 225 230 235 240 Ala Arg Cys Phe Asp Tyr Glu He Glu He Arg Glu Asp Asp Thr Thr 245 250 255 Leu Val Thr Ala Thr Val Glu Asn Glu Thr Tyr Thr Leu Lys Thr Thr 260 265 270 Asn Glu Thr Arg Gin Leu Cys Phe Val Val Arg Ser Lys Val Asn lie 275 280 285 Tyr Cys Ser Asp Asp Gly He Trp Ser Glu Trp Ser Asp Lys Gin Cys 290 295 300 Trp Glu Gly Glu Asp Leu Ser Lys Lys Thr Leu Leu Arg 305 310 315 <210> 19 <211> 964 <212> DNA <213> Artificial Sequence <400> 19 gggcgggggc gccgcgccta cggaaactca gccacctgtg acaaatttga gtgtctctgt 60 tgaaaacctc tgcacagtaa tatggacatg gaatccaccc gagggagcca gctcaaattg 120 tagtctatgg tattttagtc attttggcga caaacaagat aagaaaatag ctccggaaac 180 tcgtcgttca atagaagtac ccctgaatga gaggatttgt ctgcaagtgg ggtcccagtg 240 tagcaccaat gagagtgaga agcctagcat tttggttgaa aaatgcatct cacccccaga 300 aggtgatcct gagtctgctg tgactgagct tcaatgcatt tggcacaacc tgagctacat 360 gaagtgttct tggctccctg gaaggaatac cagtcccgac actaactata ctctctacta 420 ttggcacaga agcctggaaa aaattcatca atgtgaaaac atctttagag aaggccaata 480 ctttggttgt tcctttgatc tgaccaaagt gaaggattcc agttttgaac aacacagtgt 540 ccaaataatg gtcaaggata atgcaggaaa aattaaacca tccttcaata tagtgccttt 600 aacttcccgt gtgaaacctg atcctccaca tattaaaaac ctctccttcc acaatgatga 660 cctatatgtg caatgggaga atccacagaa ttttattagc agatgcctat tttatgaagt 720 agaagtcaat aacagccaaa ctgagacaca taatgttttc tacgtccaag aggctaaatg 780 tgagaatcca gaatttgaga gaaatgtgga gaatacatct tgtttcatgg tccctggtgt 840 tcttcctgat actttgaaca cagtcagaat aagagtcaaa acaaataagt tatgctatga 900 ggatgacaaa ctctggagta attggagcca agaaatgagt ataggtaaga agcgcaattc 960 caca 964 <210> 20 <211> 322 <212> PRT <213> Artificial Sequence <400> 20 Gly Gly Gly Gly Ala Ala Pro Thr Glu Thr Gln Pro Pro Val Thr Asn 1 5 10 15 Leu Ser Val Ser Val Glu Asn Leu Cys Thr Val Ile Trp Thr Trp Asn 20 25 30 Pro Pro Glu Gly Ala Ser Ser Asn Cys Ser Leu Trp Tyr Phe Ser His 35 40 45 Phe Gly Asp Lys Gln Asp Lys Lys Ile Ala Pro Glu Thr Arg Arg Ser 50 55 60 Ile Glu Val Pro Leu Asn Glu Arg Ile Cys Leu Gln Val Gly Ser Gln 65 70 75 80 Cys Ser Thr Asn Glu Ser Glu Lys Pro Ser Ile Leu Val Glu Lys Cys 85 90 95 Ile Ser Pro Pro Glu Gly Asp Pro Glu Ser Ala Val Thr Glu Leu Gln 100 105 110 Cys Ile Trp His Asn Leu Ser Tyr Met Lys Cys Ser Trp Leu Pro Gly 115 120 125 Arg Asn Thr Ser Pro Asp Thr Asn Tyr Thr Leu Tyr Tyr Trp His Arg 130 135 140 Ser Leu Glu Lys Ile His Gln Cys Glu Asn Ile Phe Arg Glu Gly Gln 145 150 155 160 Tyr Phe Gly Cys Ser Phe Asp Leu Thr Lys Val Lys Asp Ser Ser Phe 165 170 175 Glu Gln His Ser Val Gin lie Met Val Lys Asp Asn Ala Gly Lys lie 180 185 190 Lys Pro Ser Phe Asn lie Val Pro Leu Thr Ser Arg Val Lys Pro Asp 195 200 205 Pro Pro His lie Lys Asn Leu Ser Phe His Asn Asp Asp Leu Tyr Val 210 215 220 Gln Trp Glu Asn Pro Gin Asn Phe lie Ser Arg Cys Leu Phe Tyr Glu 225 230 235 240 Val Glu Val Asn Asn Ser Gin Thr Glu Thr His Asn Val Phe Tyr Val 245 250 255 Gln Glu Ala Lys Cys Glu Asn Pro Glu Phe Glu Arg Asn Val Glu Asn 260 265 270 Thr Ser Cys Phe Met Val Pro Gly Val Leu Pro Asp Thr Leu Asn Thr 275 280 285 Val Arg lie Arg Val Lys Thr Asn Lys Leu Cys Tyr Glu Asp Asp Lys 290 295 300 Leu Trp Ser Asn Trp Ser Gin Glu Met Ser lie Gly Lys Lys Arg Asn 305 310 315 320 Ser Thr <210> 21 <211> 1638 <212> DNA <213> Artificial Sequence <400> 21 gacaccgaga taaaagttaa ccctcctcag gattttgaga tagtggatcc cggatactta 60 ggttatctct atttgcaatg gcaaccccca ctgtctctgg atcattttaa ggaatgcaca 120 gtggaatatg aactaaaata ccgaaacatt ggtagtgaaa catggaagac catcattact 180 aagaatctac attacaaaga tgggtttgat cttaacaagg gcattgaagc gaagatacac 240 acgcttttac catggcaatg cacaaatgga tcagaagttc aaagttcctg ggcagaaact 300 acttattgga tatcaccaca aggaattcca gaaactaaag ttcaggatat ggattgcgta 360 tattacaatt ggcaatattt actctgttct tggaaacctg gcataggtgt acttcttgat 420 accaattaca acttgtttta ctggtatgag ggcttggatc atgcattaca gtgtgttgat 480 tacatcaagg ctgatggaca aaatatagga tgcagatttc cctatttgga ggcatcagac 540 tataaagatt tctatatttg tgttaatgga tcatcagaga acaagcctat cagatccagt 600 tatttcactt ttcagcttca aaatatagtt aaacctttgc cgccagtcta tcttactttt 660 actcgggaga gttcatgtga aattaagctg aaatggagca tacctttggg acctattcca 720 gcaaggtgtt ttgattatga aattgagatc agagaagatg atactacctt ggtgactgct 780 acagttgaaa atgaaacata caccttgaaa acaacaaatg aaacccgaca attatgcttt 840 gtagtaagaa gcaaagtgaa tatttattgc tcagatgacg gaatttggag tgagtggagt 900 gataaacaat gctgggaagg tgaagaccta tcgaagaaaa ctttgctacg tggatccgac 960 aaaactcaca catgcccacc gtgcccagca cctgaactcc tggggggacc gtcagtcttc 1020 ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacatgc 1080 gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta cgtggacggc 1140 gtggaggtgc ataatgccaa gacaaagccg cgggaggagc agtacaacag cacgtaccgt 1200 gtggtcagcg tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc 1260 aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa agccaaaggg 1320 cagccccgag aaccacaggt gtacaccctg cccccatccc gggatgagct gaccaagaac 1380 CAGGTCAAGCTGACCTGCCTGGTCAAAGGCTTCTATCCCCTGCACATCGCCGTGGAGTGG 1440 GAGAGCAATGGGCAGCCGGAGAACAAC TAC AAGACCACGCCTCCC GTGCTGGACTCCGAC 1500 GGCTCCTTCTTCCTCTATAGCAAGCTCACC GTGGACAAGAGCAGGTGGCAGCAGGGGAAC 1560 GTCTTCTCATGCTCCGTGATGCA TGAGGCTCTGCACAACC ACTACACGCA GAAGAGCCTC 1620 TCCCTGTCTCCGGGTA AA 1638 <210> 22 <211> 546 <212> PRT <213> Artificial Sequence <400> 22 Asp Thr Glu lie Lys Val Asn Pro Pro Gin Asp Phe Glu lie Val Asp 1 5 10 15 Pro Gly Tyr Leu Gly Tyr Leu Tyr Leu Gin Trp Gin Pro Pro Leu Ser 20 25 30 Leu Asp His Phe Lys Glu Cys Thr Val Glu Tyr Glu Leu Lys Tyr Arg 35 40 45 Asn lie Gly Ser Glu Thr Trp Lys Thr lie lie Thr Lys Asn Leu His 50 55 60 Tyr Lys Asp Gly Phe Asp Leu Asn Lys Gly lie Glu Ala Lys lie His 65 70 75 80 Thr Leu Leu Pro Trp Gin Cys Thr Asn Gly Ser Glu Val Gin Ser Ser 85 90 95 Trp Ala Glu Thr Thr Tyr Trp lie Ser Pro Gin Gly lie Pro Glu Thr 100 105 110 Lys Val Gin Asp Met Asp Cys Val Tyr Tyr Asn Trp Gin Tyr Leu Leu 115 120 125 Cys Ser Trp Lys Pro Gly lie Gly Val Leu Leu Asp Thr Asn Tyr Asn 130 135 140 Leu Phe Tyr Trp Tyr Gin Gly Leu Asp His Ala Leu Gin Cys Val Asp 145 150 155 160 Tyr lie Lys Ala Asp Gly Gin Asn lie Gly Cys Arg Phe Pro Tyr Leu 165 170 175 Glu Ala Ser Asp Tyr Lys Asp Phe Tyr lie Cys Val Asn Gly Ser Ser 180 185 190 Glu Asn Lys Pro lie Arg Ser Ser Tyr Phe Thr Phe Gin Leu Gin Asn 195 200 205 Ile Val Lys Pro Leu Pro Pro Val Tyr Leu Thr Phe Thr Arg Glu Ser 210 215 220 Ser Cys Glu lie Lys Leu Lys Trp Ser lie Pro Leu Gly Pro lie Pro 225 230 235 240 Ala Arg Cys Phe Asp Tyr Glu Ile Glu Ile Arg Glu Asp Asp Thr Thr 245 250 255 Leu Val Thr Ala Thr Val Glu Asn Glu Thr Tyr Thr Leu Lys Thr Thr 260 265 270 Asn Glu Thr Arg Gln Leu Cys Phe Val Val Arg Ser Lys Val Asn Ile 275 280 285 Tyr Cys Ser Asp Asp Gly Ile Trp Ser Glu Trp Ser Asp Lys Gln Cys 290 295 300 Trp Glu Gly Glu Asp Leu Ser Lys Lys Thr Leu Leu Arg Gly Ser Asp 305 310 315 320 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 325 330 335 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 340 345 350 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 355 360 365 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 370 375 380 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 385 390 395 400 Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys 405 410 415 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 420 425 430 Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr 435 440 445 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser Leu 450 455 460 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 465 470 475 480 Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 485 490 495 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 500 505 510 Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met His 515 520 525 Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro 530 535 540 Gly Lys 545 <210> 23 <211> 1653 <212> DNA <213> Artificial Sequence <400> 23 gggggcgggg gcgccgcgcc tacggaaact cagccacctg tgacaaattt gagtgtctct 60 gttgaaaacc tctgcacagt aatatggaca tggaatccac ccgagggagc cagctcaaat 120 tgtagtctat ggtattttag tcattttggc gacaaacaag ataagaaaat agctccggaa 180 actcgtcgtt caatagaagt acccctgaat gagaggattt gtctgcaagt ggggtcccag 240 tgtagcacca atgagagtga gaagcctagc attttggttg aaaaatgcat ctcaccccca 300 gaaggtgatc ctgagtctgc tgtgactgag cttcaatgca tttggcacaa cctgagctac 360 atgaagtgtt cttggctccc tggaaggaat accagtcccg acactaacta tactctctac 420 tattggcaca gaagcctgga aaaaattcat caatgtgaaa acatctttag agaaggccaa 480 tactttggtt gttcctttga tctgaccaaa gtgaaggatt ccagttttga acaacacagt 540 gtccaaataa tggtcaagga taatgcagga aaaattaaac catccttcaa tatagtgcct 600 ttaacttccc gtgtgaaacc tgatcctcca catattaaaa acctctcctt ccacaatgat 660 gacctatatg tgcaatggga gaatccacag aattttatta gcagatgcct attttatgaa 720 gtagaagtca ataacagcca aactgagaca cataatgttt tctacgtcca agaggctaaa 780 tgtgagaatc cagaatttga gagaaatgtg gagaatacat cttgtttcat ggtccctggt 840 gttcttcctg atactttgaa cacagtcaga ataagagtca aaacaaataa gttatgctat 900 gaggatgaca aactctggag taattggagc caagaaatga gtataggtaa gaagcgcaat 960 tccacaggat ccgacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 1020 ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 1080 cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 1140 tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 1200 aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 1260 aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 1320 tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggat 1380 GAGCTGACC AAGAACCAAGT CAGCCTGACC TGCCTGGTCA AAGGCTTCTA TCCCAGCGAC 1440 ATCGCCGTGG AGTGGGAGAG CAATGGGCAG CCGGAGAACA ACTACAAGAC CACGCCTCCC 1500 GTGCTGGACT CCGACGGCTC CTTCTTCCTC TATAGCAAGC TCACCCTGGA CAAGAGCAGG 1560 TGGCAGCAGG GGAACGTCTT CTCTGGTGGT GATGCTGAGG CTCTGCACAA CCACACAC 1620 ACGCAGAAGA GCCTCTCCCT GTCTCCGGGT AAA 1653 <210> 24 <211> 551 <212> PRT <213> Artificial Sequence <400> 24 Gly Gly Gly Gly Ala Ala Pro Thr Glu Thr Gln Pro Pro Val Thr Asn 1 5 10 15 Leu Ser Val Ser Val Glu Asn Leu Cys Thr Val Ile Trp Thr Trp Asn 20 25 30 Pro Pro Glu Gly Ala Ser Ser Asn Cys Ser Leu Trp Tyr Phe Ser His 35 40 45 Phe Gly Asp Lys Gln Asp Lys Lys Ile Ala Pro Glu Thr Arg Arg Ser 50 55 60 Ile Glu Val Pro Leu Asn Glu Arg Ile Cys Leu Gln Val Gly Ser Gln 65 70 75 80 Cys Ser Thr Asn Glu Ser Glu Lys Pro Ser lie Leu Val Glu Lys Cys 85 90 95 Ile Ser Pro Pro Glu Gly Asp Pro Glu Ser Ala Val Thr Glu Leu Gin 100 105 110 Cys lie Trp His Asn Leu Ser Tyr Met Lys Cys Ser Trp Leu Pro Gly 115 120 125 Arg Asn Thr Ser Pro Asp Thr Asn Tyr Thr Leu Tyr Tyr Trp His Arg 130 135 140 Ser Leu Glu Lys lie His Gin Cys Glu Asn lie Phe Arg Glu Gly Gin 145 150 155 160 Tyr Phe Gly Cys Ser Phe Asp Leu Thr Lys Val Lys Asp Ser Ser Phe 165 170 175 Glu Gin His Ser Val Gin lie Met Val Lys Asp Asn Ala Gly Lys lie 180 185 190 Lys Pro Ser Phe Asn lie Val Pro Leu Thr Ser Arg Val Lys Pro Asp 195 200 205 Pro Pro His lie Lys Asn Leu Ser Phe His Asn Asp Asp Leu Tyr Val 210 215 220 Gln Trp Glu Asn Pro Gin Asn Phe lie Ser Arg Cys Leu Phe Tyr Glu 225 230 235 240 Val Glu Val Asn Asn Ser Gin Thr Glu Thr His Asn Val Phe Tyr Val 245 250 255 Gln Glu Ala Lys Cys Glu Asn Pro Glu Phe Glu Arg Asn Val Glu Asn 260 265 270 Thr Ser Cys Phe Met Val Pro Gly Val Leu Pro Asp Thr Leu Asn Thr 275 280 285 Val Arg Ile Arg Val Lys Thr Asn Lys Leu Cys Tyr Glu Asp Asp Lys 290 295 300 Leu Trp Ser Asn Trp Ser Gin Glu Met Ser Ile Gly Lys Lys Arg Asn 305 310 315 320 Ser Thr Gly Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 325 330 335 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 340 345 350 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 355 360 365 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 370 375 380 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr 385 390 395 400 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp 405 410 415 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 420 425 430 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg 435 440 445 Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 450 455 460 Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 465 470 475 480 Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 485 490 495 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 500 505 510 Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser 515 520 525 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser 530 535 540 Leu Ser Leu Ser Pro Gly Lys 545 550 <210> 25 <211> 245 <212> PRT <213> Artificial Sequence <400> 25 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp lie Gin Met Thr Gin Ser Pro 130 135 140 Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg 145 150 155 160 Ala Ser Gln Ser Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln Lys Pro 165 170 175 Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Ser Leu Glu Ser 180 185 190 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr 195 200 205 Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys 210 215 220 Gln Gln Tyr Asp Thr Tyr Pro Pro Ile Thr Phe Gly Gln Gly Thr Lys 225 230 235 240 Val Glu Ile Lys Arg 245 <210> 26 <211> 735 <212> DNA <213> Artificial Sequence <400> 26 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agttatgcca tgagctgggt ccgccaggct 120 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48<210> 27 <211> 241 <212> PRT <213> Artificial Sequence <400> 27 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala He Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Phe Ser Gly Ser Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ser Asp He Gin Met Thr Gin Ser Pro Ser Thr Leu 130 135 140 Ser Ala Ser Val Gly Asp Arg Val Thr He Thr Cys Arg Ala Ser Gin 145 150 155 160 Ser lie Ser Ser Trp Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Ala 165 170 175 Pro Lys Leu Leu lie Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro 180 185 190 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr lie 195 200 205 Ser Ser Leu Gin Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gin Gin Arg 210 215 220 Asn Arg Tyr Pro Pro Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys 225 230 235 240 Arg <210> 28 <211> 723 <212> DNA <213> Artificial Sequence <400> 28 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agttatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 GAGGTGGAGGTGGATGGTTTCGGCGGTTTCGGATGTTCCCGATGACCCAGTCT 60 TTCTCTGGTTCTTTCGACTACTGGGGCCAAAGGAACCCTGGTCACCCTCTCGAGTGGTGGA 360 GGCGGTTTCAGGCAGAGGTGGTTCTGGCGGTGGCGGATCGGACATCCAGATGACCCAGTCT 420 CCTTCCACCCCTGTCTGATCTGTAAGGAGACCCTGTTCACCATCCTTGCCGTGCCAGTCAG 480 AGTATTAGTAGCTGGTTGGCCTGTTATCAGCAGAAACCAAGGAAAGCCCCTAAGCTCCTG 540 ATCTATGATGCCTCCAGTTTGGAAAGTGGGGTCCTATCACGTTTCAGCGGCAATGGATCC 600 GGGACAGAATTCACCTCTCACCATCAGCAGCTTGCAGCCTGATGATTTTGCAACTTATTAC 660 TGCCAACAGAGAAACAGATACCCACCAACGTTTGGCCAGGGCACCAAAGTCGAGATCAAG 720 Cgt 723 <210> 29 <211> 121 <212> PRT <213> Artificial Sequence <400> 29 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Lys Leu Pro 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala He Thr Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 30 <211> 363 <212> DNA <213> Artificial Sequence <400> 30 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttaaa ctgccggcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagca attactggta gtggtggtag cacatactac 180 GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATG GAC ATGgcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 31 <211> 121 <212> PRT <213> Artificial Sequence <400> 31 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Pro 20 25 30 Ala Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Thr Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Val Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 32 <211> 363 <212> DNA <213> Artificial Sequence <400> 32 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttcgc agacctgcca tgacatgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagca attacaggta gtggtggtag tacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgt gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 33 <211> 121 <212> PRT <213> Artificial Sequence <400> 33 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Ile 20 25 30 Pro Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ser Ile Ser Gly Ser Ala Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 34 <211> 363 <212> DNA <213> Artificial Sequence <400> 34 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Glytcctgtgcag cctccggatt cacctttgga acaattccca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcatcc attagtggta gtgctggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 35 <211> 121 <212> PRT <213> Artificial Sequence <4​​​​​​​​​​​​​​​​​Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 36 <211> 363 <212> DNA <213> Artificial Sequence <400> 36 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agggatgctt tgaactgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacattttac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 37 <211> 121 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 37 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30 Ala Met Asn Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala lie Ser Ala Ser Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 38 <211> 363 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 38 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser LeuSer Gly lie Ser Gly Ser Val Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 40 <211> 363 <212> DNA <213> Artificial Sequence <400> 40 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttcgc aagtatgcca tgggctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcaggt attagtggta gtgttggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 ​​​​​tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 41 <211> 121 <212> PRT <213> Artificial Sequence <400> 41 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly He Ser Gly Ser Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 42 <211> 363 <212> DNA <213> Artificial Sequence <400> 42 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttcgt cgctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcaggt attagcggga gtggtggtgg gacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 43 <211> 121 <212> PRT <213> Artificial Sequence <400> 43 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30 Ala Met Asn Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala He Asn Ala Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 44 <211> 363 <212> DNA <213> Artificial Sequence <400> 44 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agatacgcca tgaactgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagct attaatgcaa gtggaggtag cacatactac 180 Glu Ala Ser Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Ser Gin Gin Sergcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtatattactgtgc gaaagttcgt 300 tacggttggg gtgcaggtgc attcgactac tggggccaag gaaccctggt caccgtctcg 360 agt 363 <210> 45 <211> 6 <212> PRT <213> Artificial Sequence <400> 45 Lys Leu Pro Ala Met Ser 1 5 <210> 46 <211> 6 <212> PRT <213> Artificial Sequence <400> 46 Arg Arg Pro Ala Met Thr 1 5 <210> 47 <211> 6 <212> PRT <213> Artificial Sequence <400> 47 Gly Thr Ile Pro Met Ser 1 5 <210> 48 <211> 6 <212> PRT <213> Artificial Sequence <400> 48 Ser Arg Asp Ala Leu Asn 1 5 <210> 49 <211> 6 <212> PRT <213> Artificial Sequence <400> 49 Arg Lys Tyr Ala Met Gly 1 5 <210> 50 <211> 6 <212> PRT <213> Artificial Sequence <400> 50 Arg Arg Tyr Ala Met Ser 1 5 <210> 51 <211> 6 <212> PRT <213> Artificial Sequence <400> 51 Ala Ile Thr Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 52 <211> 17 <212> PRT <213> Artificial Sequence <400> 52 Ser Ile Ser Gly Ser Ala Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 53 <211> 17 <212> PRT <213> Artificial Sequence <400> 53 Arg Lys Tyr Ala Met Gly 1 5Gly <210> 54 <211> 17 <212> PRT <213> Artificial Sequence <400> 54 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 55 <211> 17 <212> PRT <213> Artificial Sequence <400> 55 Ala Ile Ser Ala Ser Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 56 <211> 17 <212> PRT <213> Artificial Sequence <400> 56 Gly Ile Ser Gly Ser Val Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 57 <211> 17 <212> PRT <213> Artificial Sequence <400> 57 Gly Ile Ser Gly Ser Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 58 <211> 17 <212> PRT <213> Artificial Sequence <400> 58 Ala Ile Asn Ala Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 59 <211> 118 <212> PRT <213> Artificial Sequence <400> 59 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Val Leu Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Arg Gly Ser Ala Gly Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Phe Ser Gly Ser Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 60 <211> 354 <212> DNA <213> Artificial Sequence <400> 60 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc agttacgtcc tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagca attaggggta gtgctggtaa cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gcgtgttgca 300 ttctctggtt ctttcgacta ctggggccaa ggaaccctgg tcaccgtctc gagt 354 <210> 61 <211> 118 <212> PRT <213> Artificial Sequence <400> 61 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly He Arg Ser Ser Gly Gly Arg Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Phe Ser Gly Ser Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 62 <211> 354 <212> DNA <213> Artificial Sequence <400> 62 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttagc aactatgcaa tgagctgggt ccgccaggct 120 TCCTGTGCAG CCTCCGGATT CACCTTTAGC AACTATGCAA TGAGCTGGGT CCGCCAGGCT 120GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 <210> 63 <211> 6 <212> PRT <213> Artificial Sequence <400> 63 Ser Ser Tyr Val Leu Ser 1 5 <210> 64 <211> 6 <212> PRT <213> Artificial Sequence <400> 64 Ser Asn Tyr Ala Met Ser 1 5 <210> 65 <211> 17 <212> PRT <213> Artificial Sequence <400> 65 Ala Ile Arg Gly Ser Ala Gly Asn Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 66 <211> 17 <212> PRT <213> Artificial Sequence<213> Artificial Sequence <400> 66 Gly Ile Arg Ser Ser Gly Gly Arg Thr Phe Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 67 <211> 245 <212> PRT <213> Artificial Sequence <400> 67 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr 20 25 30 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Val Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Arg Tyr Gly Trp Gly Ala Gly Ala Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp lie Gin Met Thr Gin Ser Pro 130 135 140 Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr lie Thr Cys Arg 145 150 155 160 Ala Ser Gin Ser lie Ser Ser Trp Leu Ala Trp Tyr Gin Gin Lys Pro 165 170 175 Gly Lys Ala Pro Lys Leu Leu lie Tyr Asp Ala Ser Ser Leu Glu Ser 180 185 190 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr 195 200 205 Leu Thr lie Ser Ser Leu Gin Pro Asp Asp Phe Ala Thr Tyr Tyr Cys 210 215 220 Gln Gin Tyr Asp Thr Tyr Pro Pro lie Thr Phe Gly Gin Gly Thr Lys 225 230 235 240 Val Glu lie Lys Arg 245 <210> 68 <211> 63 <212> DNA <213> Artificial Sequence <400> 68 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 63 <210> 69 <211> 135 <212> DNA <213> Artificial Sequence <400> 69 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgat 135 <210> 70 <211> 81 <212> DNA <213> Artificial Sequence <400> 70 ttttgggtgc tggtggtggt tggtggagtc ctggcttgct atagcttgct agtaacagtg 60 gcctttatta ttttctgggt g 81 <210> 71 <211> 123 <212> DNA <213> Artificial Sequence <400> 71 aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60 gggccaaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120 tcc 123 <210> 72 <211> 339 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 72 agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgcag agaaggaaga accctcagga aggcctgtac 180 aatgaactgc agaaagataa gatggcggag gcctacagtg agattgggat gaaaggcgag 240 cgccggaggg gcaaggggca cgatggcctt taccagggtc tcagtacagc caccaaggac 300 acctacgacg cccttcacat gcaggccctg ccccctcgc 339 <210> 73 <211> 63 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 73 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 acc 63 <210> 74 <211> 126 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 74 aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa 60 actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 120 gaactg 126 <210> 75 <211> 241 <212> PRT <213> Artificial Sequence <400> 75 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Val Leu Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Arg Gly Ser Ala Gly Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Phe Ser Gly Ser Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ser Asp lie Gin Met Thr Gin Ser Pro Ser Thr Leu 130 135 140 Ser Ala Ser Val Gly Asp Arg Val Thr lie Thr Cys Arg Ala Ser Gin 145 150 155 160 Ser lie Ser Ser Trp Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Ala 165 170 175 Pro Lys Leu Leu lie Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro 180 185 190 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr lie 195 200 205 Ser Ser Leu Gin Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gin Gin Arg 210 215 220 Asn Arg Tyr Pro Pro Thr Phe Gly Gin Gly Thr Lys Val Glu lie Lys 225 230 235 240 Arg

Claims

1. An antibody which specifically recognizes IL-13RA2, characterized in that, The CDRs of the light chain variable region and the CDRs of the heavy chain variable region of the antibody are selected from any one of the following groups: (1) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 9, HCDR2 as shown in SEQ ID NO: 10, and HCDR3 as shown in SEQ ID NO: 11; (2) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 16; HCDR1 as shown in SEQ ID NO: 9, HCDR2 as shown in SEQ ID NO: 10, and HCDR3 as shown in SEQ ID NO: 12; (3) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 16; HCDR1 as shown in SEQ ID NO: 64, HCDR2 as shown in SEQ ID NO: 66, and HCDR3 as shown in SEQ ID NO: 12; (4) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 45, HCDR2 as shown in SEQ ID NO: 52, and HCDR3 as shown in SEQ ID NO: 11; (5) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 16; HCDR1 as shown in SEQ ID NO: 63, HCDR2 as shown in SEQ ID NO: 65, and HCDR3 as shown in SEQ ID NO: 12; (6) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 50, HCDR2 as shown in SEQ ID NO: 56, and HCDR3 as shown in SEQ ID NO: 11; (7) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 46, HCDR2 as shown in SEQ ID NO: 52, and HCDR3 as shown in SEQ ID NO: 11; (8) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 48, HCDR2 as shown in SEQ ID NO: 54, and HCDR3 as shown in SEQ ID NO: 11; (9) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 47, HCDR2 as shown in SEQ ID NO: 53, and HCDR3 as shown in SEQ ID NO: 11; (10) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 49, HCDR2 as shown in SEQ ID NO: 55, and HCDR3 as shown in SEQ ID NO: 11; (11) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 51, HCDR2 as shown in SEQ ID NO: 57, and HCDR3 as shown in SEQ ID NO: 11; (12) LCDR1 as shown in SEQ ID NO: 13, LCDR2 as shown in SEQ ID NO: 14, and LCDR3 as shown in SEQ ID NO: 15; HCDR1 as shown in SEQ ID NO: 49, HCDR2 as shown in SEQ ID NO: 58, and HCDR3 as shown in SEQ ID NO:

11.

2. The antibody of claim 1, wherein, (1) the light chain variable region has the sequence shown in SEQ ID NO: 4 and the heavy chain variable region has the sequence shown in SEQ ID NO: 2; (2) the light chain variable region has the sequence shown in SEQ ID NO: 8 and the heavy chain variable region has the sequence shown in SEQ ID NO: 6; (3) the light chain variable region has the sequence shown in SEQ ID NO: 8 and the heavy chain variable region has the sequence shown in SEQ ID NO: 61; (4) the light chain variable region has the sequence shown in SEQ ID NO: 4 and the heavy chain variable region has the sequence shown in SEQ ID NO: 29; (5) the light chain variable region has the sequence shown in SEQ ID NO: 8 and the heavy chain variable region has the sequence shown in SEQ ID NO: 59; (6) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 39; (7) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 31; (8) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 35; (9) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 33; (10) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 37; (11) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO: 41; (12) the light chain variable region has the sequence set forth in SEQ ID NO: 4 and the heavy chain variable region has the sequence set forth in SEQ ID NO:

43.

3. The antibody according to claim 1 or 2, characterized in that the antibody is a scFv having the sequence set forth in SEQ ID NO: 25, 27, 67 or 75.

4. A nucleic acid encoding the antibody of any one of claims 1-3.

5. An expression vector comprising the nucleic acid of claim 4.

6. A host cell comprising the expression vector of claim 5 or having integrated into its genome the nucleic acid of claim 4.

7. A multifunctional immunoconjugate, characterized in that, the multifunctional immunoconjugate comprises: the antibody of any one of claims 1-3; and a functional molecule linked thereto; the functional molecule is selected from the group consisting of a molecule targeting a tumor surface marker, a molecule inhibiting a tumor, a molecule targeting a surface marker of an immune cell or a detectable label; the molecule inhibiting a tumor is an anti-tumor cytokine or an anti-tumor toxin.

8. The multifunctional immunoconjugate of claim 7, wherein, the molecule targeting a tumor surface marker is an antibody or a ligand binding to a tumor surface marker other than IL-13RA2.

9. The multifunctional immunoconjugate of claim 8, wherein, the cytokine is selected from the group consisting of IL-12, IL-15, type I interferon, TNF-alpha.

10. The multifunctional immunoconjugate of claim 7, wherein the molecule targeting a surface marker of an immune cell is an antibody binding to a surface marker of an immune cell.

11. The multifunctional immunoconjugate of claim 10, wherein the binding to a surface marker of an immune cell is selected from the group consisting of CD3, CD16, CD28.

12. The multifunctional immunoconjugate of claim 11, wherein, the antibody binding to a surface marker of an immune cell is an anti-CD3 antibody.

13. The multifunctional immunoconjugate of claim 10, wherein the molecule targeting a surface marker of an immune cell is an antibody binding to a T cell surface marker, which forms a T cell engaging bifunctional antibody with the antibody of any one of claims 1-3.

14. The multifunctional immunoconjugate of claim 10, wherein it is a fusion polypeptide, further comprising a linker peptide between the antibody of any one of claims 1-3 and the functional molecule linked thereto.

15. A nucleic acid encoding the multifunctional immunoconjugate of any one of claims 7-14.

16. A chimeric antigen receptor comprising the antibody of any one of claims 1-3, characterized in that, The chimeric antigen receptor comprises, in sequential linkage: the antibody of any one of claims 1-3, a transmembrane region, and an intracellular signaling region.

17. The chimeric antigen receptor of claim 16, wherein The intracellular signaling region is selected from the group consisting of a functional signaling domain of a protein of CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, FcR gamma (FCER1G), FcR beta (FcsR1b), CD79a, CD79b, FcgRIIa, DAP10, and DAP12, or combinations thereof.

18. The chimeric antigen receptor of claim 17, wherein, The intracellular signaling region further has a costimulatory signaling domain comprising a functional signaling domain selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, CD4, CD8a, CD8b, IL2Rb, IL2Ry, IL7Ra, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, and NKG2D, or combinations thereof.

19. The chimeric antigen receptor of claim 16, wherein, The chimeric antigen receptor comprises, in sequential linkage: the antibody of any one of claims 1-3, a transmembrane region, and an intracellular signaling region. The chimeric antigen receptor comprises, in sequential linkage: the antibody of any one of claims 1-3, a transmembrane region, and an intracellular signaling region. The chimeric antigen receptor comprises, in sequential linkage: the antibody of any one of claims 1-3, a transmembrane region, and an intracellular signaling region. The chimeric antigen receptor comprises, in sequential linkage: the antibody of any one of claims 1-3, a transmembrane region, and an intracellular signaling region. The antibody, the transmembrane region of CD28 molecule, the intracellular signaling region of CD28 molecule, the intracellular signaling region of CD137, and the intracellular signaling region of CD3ζ of claim 1 or 2.

20. The chimeric antigen receptor of claim 19, wherein, The CD8 transmembrane region has an amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO: 73, the CD28 transmembrane region has an amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO: 70, the CD28 intracellular signaling region has an amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO: 71, the CD137 intracellular signaling region has an amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO: 74, and the CD3ζ intracellular signaling region has an amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO:

72.

21. A nucleic acid encoding the chimeric antigen receptor of any one of claims 16-20.

22. An expression vector comprising the nucleic acid of claim 21. It comprises the nucleic acid of claim 21.

23. A virus, characterized in that, The virus comprises the vector of claim 22.

24. A chimeric antigen receptor-modified immune cell, characterized in that, It is transduced with the nucleic acid of claim 21, or the expression vector of claim 22 or the virus of claim 23; or it expresses on its surface the chimeric antigen receptor of any one of claims 16-20.

25. The chimeric antigen receptor modified immune cell of claim 24, wherein, The immune cell is a T lymphocyte, an NK cell, or an NKT lymphocyte.

26. The immune cell of claim 24 or 25, wherein It further carries a coding sequence of an exogenous cytokine; or It further expresses another chimeric antigen receptor that does not contain CD3ζ; or It further expresses a chemokine receptor; or It further expresses an siRNA that reduces the expression of PD-1 or a protein that blocks PD-L1; or the endogenous PD-1 in its cells is knocked out by gene editing technology; or It further expresses a safety switch.

27. The immune cell of claim 26, wherein, The chemokine receptor is CCR.

28. A pharmaceutical composition, characterized by, It comprises: The antibody or the nucleic acid encoding the antibody of any one of claims 1-3; or The immunoconjugate or the nucleic acid encoding the conjugate of any one of claims 7-14; or The chimeric antigen receptor or the nucleic acid encoding the chimeric antigen receptor of any one of claims 16-20; or The chimeric antigen receptor modified immune cell of any one of claims 24-27; and a pharmaceutically acceptable carrier or excipient.

29. A kit characterized in that, It comprises: A container, and the pharmaceutical composition of claim 28 in the container; or A container, and the antibody or the nucleic acid encoding the antibody of any one of claims 1-3; or the immunoconjugate or the nucleic acid encoding the conjugate of any one of claims 7-14; or the chimeric antigen receptor or the nucleic acid encoding the chimeric antigen receptor of any one of claims 16-20; or the chimeric antigen receptor modified immune cell of any one of claims 24-27 in the container.

30. Use of the antibody of any one of claims 1-3 or a nucleic acid encoding the antibody; or the immunoconjugate of any one of claims 7-14 or a nucleic acid encoding the conjugate; or the chimeric antigen receptor of any one of claims 16-20 or a nucleic acid encoding the chimeric antigen receptor; or the chimeric antigen receptor modified immune cell of any one of claims 24-27 for the manufacture of a medicament for the treatment of a tumor expressing IL-13RA2. The tumor expressing IL-13RA2 is a brain cancer, a pancreatic cancer, an ovarian cancer, a renal cancer, a bladder cancer, a pancreatic cancer, a gastric cancer, an intestinal cancer, a head and neck cancer, a thyroid cancer, a prostate cancer or a Kaposi's sarcoma.

31. The use of claim 30, wherein, The brain cancer is selected from a astrocytoma, a meningioma, an oligodendroglioma or a glioma.

Images