DKC1 and HIF-1α in the treatment of colorectal cancer in the application of
By inhibiting the expression or activity of DKC1 and HIF-1α, and regulating the HIF-1α/VEGF pathway, the problem of poor treatment efficacy for colorectal cancer in existing technologies has been solved, achieving effective inhibition of colorectal cancer, especially with significant effects on angiogenesis and tumor metastasis.
Patent Information
- Application Number
- CN201910655615.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-07-19
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2039-07-19
AI Technical Summary
Existing technologies have failed to effectively utilize the synergistic effect of DKC1 and HIF-1α in inhibiting colorectal cancer, resulting in poor treatment outcomes for colorectal cancer, especially in terms of insufficient inhibition of tumor metastasis and angiogenesis.
By inhibiting the expression or activity of DKC1 and HIF-1α, and using reagents such as chemicals, RNAi, and antisense oligonucleotides, the HIF-1α/VEGF pathway can be modulated to inhibit angiogenesis and tumor metastasis in colorectal cancer.
It significantly inhibits VEGF expression, suppresses angiogenesis in colorectal cancer, and reduces tumor metastasis and invasion, with better effects than using DKC1 or HIF-1α alone, providing a new strategy for the treatment of colorectal cancer.
Smart Images

Figure CN110305962B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedicine, and relates to the application of DKC1 and HIF-1α in the synergistic treatment of colorectal cancer. BACKGROUND
[0002] Colorectal cancer (CRC) is one of the most common malignant tumors in the world. The incidence of CRC ranks third in human tumors, and the mortality rate ranks second in malignant tumors. Most CRC patients are already in the late stage of initial diagnosis, and the 5-year survival rate is low. About 25% of CRC patients have liver metastasis at the first visit. Data show that about 45% of CRC patients eventually die of the disease due to drug resistance and tumor metastasis after conventional treatment, and 80%-90% of liver metastasis in patients with CRC fails to be radically resected. Therefore, the research on potential biomarkers of CRC is important for early CRC diagnosis and treatment.
[0003] The dyskerin 1 (DKC1) gene was discovered because its mutation leads to dyskeratosis congenita (DC). Dyskeratosis congenita is a rare genetic syndrome characterized by oral leukoplakia, nail dystrophy, and non-natural reticular skin pigmentation. Many studies have shown that the occurrence of DC can increase the incidence of many diseases, such as aplastic anemia, bone marrow failure syndromes (BMFSs), and pulmonary fibrosis. Dyskerin encoded by DKC1 is a nucleolar protein located at Xq28. Dyskerin is an important component of the telomerase ribonucleoprotein complex and has an important impact on the functional stability of the telomerase ribonucleoprotein complex. This phenomenon is mainly due to the involvement of DKC1 in the production of telomerase and telomerase reverse transcriptase. The telomere length of DC patients is significantly shorter than that of normal people. DKC1 also plays an important role in the processing of H / ACA small nucleolar ribonucleoprotein, which is essential for normal ribosome biosynthesis.
[0004] Hypoxic regions are formed when malignant tumors proliferate rapidly. In adapting to the hypoxic microenvironment, tumor cells activate multiple signaling pathways and produce a large number of regulatory factors, promoting tumor tolerance to hypoxia, reducing tumor metastasis ability, and reducing sensitivity to radiotherapy and chemotherapy. Hypoxia-inducible factor 1 (HIF-1) is a transcription factor activated by hypoxia. HIF-1 is composed of two subunits, α and β. The HIF-1α subunit can be regulated by oxygen concentration, and its expression is positively correlated with the degree of hypoxia. HIF-1α also plays a crucial role in tumor metastasis, proliferation, and angiogenesis. As the malignant tumor continues to grow, the hypoxic state of the solid tumor becomes severe, which increases the expression of HIF-1α. HIF-1α overexpression further induces the expression of its downstream target gene VEGF and is involved in tumor angiogenesis and metastasis. In CRC, HIF-1α expression is abnormally increased and plays an important role in the malignant progression of CRC.
[0005] The prior art has not reported that DKC1 and HIF-1α have a synergistic effect in inhibiting tumors. SUMMARY
[0006] In order to fill the gap in the prior art, the present application provides a drug target for treating colorectal cancer, which comprises DKC1, and the drug target can be used for developing a drug for treating colorectal cancer.
[0007] Further, the drug target further comprises HIF-1α or a target gene thereof.
[0008] In a specific embodiment of the present application, the target gene is VEGF.
[0009] The present application also provides a drug for treating colorectal cancer, which comprises an agent inhibiting DKC1.
[0010] The above-mentioned agent involved in the present application includes an agent inhibiting DKC1 itself or the expression or activity of molecules upstream and downstream thereof.
[0011] The above-mentioned agent involved in the present application is not limited in type, as long as it can inhibit the expression or activity of DKC1 itself or molecules upstream and downstream thereof. Such agents include chemicals, RNAi, antisense oligonucleotides, and natural extracts.
[0012] Further, the drug comprises an agent inhibiting HIF-1α or a target gene thereof. The above-mentioned agent is not limited in type, as long as it can inhibit the expression or activity of HIF-1α or a target gene thereof.
[0013] Still further, the drug comprises an agent inhibiting HIF-1α or VEGF. The above-mentioned agent is not limited in type, as long as it can inhibit the expression or activity of HIF-1α or VEGF.
[0014] The pharmaceuticals of the present application can be prepared using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the aforementioned agents as active ingredients. The adjuvants can include excipients, disintegrants, sweeteners, binders, coating agents, expanders, lubricants, glidants, flavoring agents, solubilizers, and the like. For administration, the pharmaceuticals of the present application can be preferably formulated using at least one pharmaceutical carrier in addition to the active ingredients. When the pharmaceuticals are formulated as liquid solutions, they can contain at least one pharmaceutical carrier selected from the group consisting of saline solutions, sterile water, Ringer's solution, buffered saline, injectable albumin solutions, glucose solutions, maltodextrin solutions, glycerol, ethanol, and mixtures thereof. If necessary, other conventional additives, including antioxidants, buffers, bacteriostats, and the like, can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be further added to prepare injectable formulations (e.g., aqueous solutions, suspensions, or emulsions, etc.), pills, capsules, granules, or tablets.
[0015] The pharmaceuticals of the present application can be formulated in the form of granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops, injectable liquids, or sustained-release formulations of active compounds. The pharmaceuticals of the present application can be administered according to conventional methods by intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, intranasal, inhalation, topical, rectal, oral, intraocular, or intradermal routes. An effective amount of the active ingredients of the pharmaceuticals according to the present application means an amount required for the prevention or treatment of diseases. Thus, the effective amount can be determined according to various factors, including the type of disease, the severity of the disease, the type and amount of the active ingredients and other components contained in the composition, the type of formulation, the age, weight, general health condition, sex, and diet of the patient, the time of administration, the route of administration, the secretion rate of the composition, the treatment period, and the drugs used simultaneously. For adults, the composition can be administered once or several times a day. When administered once or several times a day, the administration dose can be 0.1 ng / kg to 10 g / kg for a compound, 0.1 ng / kg to 10 g / kg for a polypeptide, protein, or antibody, and 0.01 ng / kg to 10 g / kg for an antisense nucleotide, siRNA, shRNAi, or miRNA, but the scope of the present application is not limited thereto.
[0016] The present application also provides the use of DKC1, and / or, HIF-1α or its target genes in the preparation of a medicament for the treatment of the aforementioned diseases.
[0017] Further, the target genes include VEGF.
[0018] The present application also provides a method of screening a drug for the treatment of colorectal cancer, the method comprising detecting the expression or activity of DKC1, and / or, HIF-1α or its target genes before and after treatment with the drug; preferably, the target genes include VEGF.
[0019] In particular, the present application provides a method for screening a drug for treating colorectal cancer, comprising the steps of:
[0020] In the test group, a test drug is added to a culture system of cells, and the expression level and / or activity of DKC1, and / or HIF-1a or its target genes in the colorectal cancer cells of the test group are observed; in the control group, the test drug is not added to the culture system of the same cells, and the expression and / or activity of DKC1, and / or HIF-1a or its target genes in the cells of the control group are observed.
[0021] If the expression and / or activity of DKC1, and / or HIF-1a or its target genes in the cells of the test group is less than that of the control group, it indicates that the test drug is a candidate drug for treating colorectal cancer that inhibits the expression and / or activity of DKC1, and / or HIF-1a or its target genes.
[0022] Examples of the analysis method for measuring the expression level of the gene according to the present application include, but are not limited to, reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, ribonuclease protection assay (RPA), Northern blotting, and DNA chip.
[0023] The reagent for measuring the expression level of the gene includes a primer, a probe, or an antisense nucleotide that specifically binds to the mRNA of the gene. One skilled in the art can design a primer, a probe, or an antisense nucleotide that specifically binds to the mRNA of the gene encoding the protein based on this information.
[0024] The term "primer" as used herein is a strand of a short nucleic acid sequence that recognizes a target gene sequence, which includes a pair of forward and reverse primers. In particular, the "primer" includes a pair of primers that provide specific and sensitive analysis results. Primers are considered to provide high specificity when used to amplify a target gene sequence, but do not cause amplification of non-target sequences that are not consistent or complementary to the target gene sequence.
[0025] The term "probe" as used herein refers to a substance that specifically binds to a target to be detected in a sample. By the binding, the probe can determine the presence of the target in the sample. Any probe can be used in the present disclosure as long as it is commonly used in the art. In particular, the probe can be PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA, or DNA, most preferably PNA. Specifically, the probe is a biological material that can be derived from a living organism or can be synthesized in vitro or a mimic thereof. For example, the probe can be an enzyme, a protein, an antibody, a microorganism, an animal or plant cell or organ, a neuron, DNA, or RNA. The DNA can include cDNA, genomic DNA, and oligonucleotide. Genomic RNA, mRNA, and oligonucleotide can also fall within the scope of the RNA. Examples of the protein include an antibody, an antigen, an enzyme, and a peptide.
[0026] The term "antisense nucleotide" as used herein refers to an oligomer having a sequence of nucleotide bases and a sub-sub skeleton that allows the antisense nucleotide to hybridize with a target sequence in RNA through Watson-Crick base pairing to form an RNA:nucleotide heteroduplex nucleic acid molecule in the target sequence. The nucleotide can have exact or close sequence complementarity to the target sequence.
[0027] Examples of the method for measuring the protein expression level according to the present disclosure include, but are not limited to, a protein chip assay, an immunoassay, a ligand binding assay, MALDI-TOF (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry), SELDI-TOF (surface-enhanced laser desorption / ionization time-of-flight mass spectrometry), a radioimmunoassay, a radioimmunodiffusion, a double immunodiffusion (Ouchterlony immunodiffusion), a rocket immunoelectrophoresis, an immunohistochemical staining, a complement fixation test, a 2-D electrophoresis, liquid chromatography-mass spectrometry (LC-MS), liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS), a Western blotting, and an ELISA (enzyme-linked immunosorbent assay).
[0028] The reagent for measuring the protein expression level can include an antibody, an oligopeptide, a ligand, a PNA (peptide nucleic acid), or an aptamer that can specifically bind to a protein.
[0029] The term "antibody" as used herein refers to a substance that specifically binds to an antigen to elicit an antigen-antibody reaction. For the purposes of the present disclosure, the term "antibody" means an antibody that specifically binds to a protein. Falling within the scope of the antibodies of the present disclosure are polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. These antibodies can be readily prepared using techniques well known in the art. For example, polyclonal antibodies can be prepared by injecting an animal with a CENPQ protein as an antigen and obtaining serum containing antibodies from the animal, as is well known in the art. Polyclonal antibodies can be prepared using any animal (e.g., goat, rabbit, sheep, monkey, horse, pig, cow, dog, etc.). Monoclonal antibodies can be obtained by the hybridoma method (Kohler and Milstein (1976) European Journal of Immunology 6:511-519), or phage antibody library techniques (Clackson et al., Nature, 352:624-628, 1991; Marks et al., J. Mol. Biol., 222:58, 1-597, 1991). The antibodies can be isolated and purified using gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, etc. In addition, an antibody suitable for use in the present disclosure can be a whole antibody consisting of two full-length light chains and two full-length heavy chains, or a functional fragment of a whole antibody molecule. The term "functional fragment" of an antibody molecule means a fragment that retains the binding function of an antibody, such as Fab, F(ab'), F(ab')2, and Fv.
[0030] The term "PNA (peptide nucleic acid)" as used herein refers to an artificially synthesized polymer similar to DNA or RNA, first introduced by Professors Nielsen, Egholm, Berg, and Buchardt (University of Copenhagen, Denmark) in 1991. DNA has a phosphate-ribose backbone, whereas the backbone of PNA is composed of repeating N-(2-aminoethyl)-glycine units connected by peptide bonds. Due to this structure, PNA significantly enhances the binding affinity and stability of DNA or RNA, and thus is effectively used in molecular biology research, diagnosis, and antisense therapy. For a detailed explanation of PNA, refer to the literature [Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500].
[0031] As used herein, "aptamer" is an oligonucleotide or a peptide molecule that binds to a specific target molecule. For detailed description of aptamer, refer to the literatures [Bock LC et al., Nature 355(6360):5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24):142727 (1998)].
[0032] The nucleic acid probes described in the above method can be obtained by in vitro recombination or chemical synthesis, which has been reported in the literature. In addition, the hybridization probe can be labeled by different labeling methods, such as radioisotopes, fluorescent substances, reporter system enzymes, biotin and other ligands. These detectable labels can also be coupled with optical detection substances, which can be detected by photochemical methods. The labeled and detected probes have also been reported in the literature.
[0033] As used herein, the term "RNAi" refers to RNA interference (RNAi), which is a phenomenon of highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). Since the RNAi technology can be used to specifically eliminate or close the expression of a specific gene, the technology has been widely used in the field of exploring gene function and treating infectious diseases and malignant tumors.
[0034] The RNAi agent can be a small interfering RNA molecule, usually a single-stranded deoxy oligonucleotide (shRNA) that can theoretically form a small hairpin structure, which is generally not more than 100 nucleotides in length, typically not more than 75 nucleotides; or a 15-30 bp double-stranded deoxy oligonucleotide (siRNA), most typically 20-23 bp.
[0035] In some applications, the RNAi agent can also be a template DNA encoding shRNA or siRNA. These template DNAs can exist in a vector, such as a plasmid vector or a viral vector, or can exist without a vector, as a template DNA encoding shRNA or siRNA plus a fragment of a common promoter sequence controlling its transcription.
[0036] In the present application, the RNAi inhibiting DKC1 is a small interfering RNA against DKC1; preferably, the small interfering RNA contains at least one modified nucleotide group (the modification can refer to the antisense oligonucleotide part); more preferably, the modified nucleotide group is a dimethoxy-modified nucleotide group and / or a short peptide-modified nucleotide group.
[0037] The term "test drug" as used in the screening method herein means an unknown candidate substance used in the screening to detect whether it affects the expression level of a gene or whether it affects the expression or activity of a protein.
[0038] The term "treatment" as used herein means reducing the severity and / or frequency of symptoms, eliminating symptoms and / or the underlying cause, preventing the occurrence of symptoms and / or their underlying cause, and ameliorating or eliminating damage. For example, treating a patient by administering a drug of the present application includes prophylaxis in patients predisposed to developing cancer (e.g., high risk due to genetic predisposition, environmental factors, etc.) and / or cancer survivors at risk of recurrence, as well as treating cancer patients by inhibiting or causing regression of the disorder or disease.
[0039] Advantages and benefits of the present application:
[0040] The present application first discovered that DKC1 can inhibit colorectal cancer migration and invasion by regulating the HIF-1α / VEGF pathway to inhibit colorectal cancer angiogenesis, and thus DKC1, HIF-1α, and VEGF can all be used as drug targets for treating colorectal cancer.
[0041] The present application discovered that DKC1 and HIF-1α can produce a synergistic effect, and simultaneously inhibiting the expression of both can significantly inhibit VEGF expression, inhibit colorectal cancer angiogenesis, and inhibit tumor metastasis and invasion, with better results than using either of the two alone.
[0042] The research results of the present application provide a new treatment strategy for clinical treatment of colorectal cancer. BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 A graph showing the results of detecting the effect of DKC1 expression on HIF-1α protein expression using Western blot;
[0044] Figure 2 Figure showing results of Western blot to detect the effect of DKC1 expression on HIF-1 a protein and VEGF protein expression;
[0045] Figure 3 Figure showing results of QPCR to detect the effect of DKC1 expression on HIF-1 a and VEGF mRNA expression;
[0046] Figure 4 Figure showing results of Western blot to detect the effect of HIF-1 a overexpression on VEGF expression;
[0047] Figure 5 Figure showing results of HIF-1 a overexpression on cell migration, where A: cell pictures; B: statistical graph;
[0048] Figure 6 Figure showing results of HIF-1 a overexpression on cell invasion, where A: cell pictures; B: statistical graph;
[0049] Figure 7 Figure showing results of HIF-1 a overexpression on angiogenesis, where A: cell pictures; B: statistical graph;
[0050] Figure 8 Figure showing results of DKC1 protein expression in DKC1 stable knockdown cell line;
[0051] Figure 9 Figure showing results of DKC1 knockdown on tumor weight and volume, where A: tumor pictures, B: volume statistical graph, C: weight statistical graph;
[0052] Figure 10 Figure showing results of IHC to detect HIF-1 a and VEGF protein expression in DKC1 stable knockdown cell line;
[0053] Figure 11 Figure showing results of HIF-1 a protein expression in HIF-1 a stable overexpression cell line;
[0054] Figure 12 Figure showing results of visual analysis to study the effect of HIF-1 a overexpression on tumor metastasis number, where A: cell pictures; B: statistical graph;
[0055] Figure 13 Figure showing results of HE staining to detect the effect of HIF-1 a overexpression on tumor metastasis number;
[0056] Figure 14 Figure showing results of IHC to detect the effect of HIF-1 a overexpression on VEGF expression;
[0057] Figure 15 Statistical graph showing the further interference of HIF-1a on angiogenesis after interfering DKC1;
[0058] Figure 16 Statistical graph showing the further interference of HIF-1a on migration invasion ability after interfering DKC1, wherein, Figure A: migration ability; Figure B: invasion ability;
[0059] Figure 17 Plasmid map showing overexpression of DKC1. DETAILED DESCRIPTION
[0060] The present application will be further described by the following non- limiting examples, and it is well known to those skilled in the art that many modifications can be made without departing from the spirit of the present application, and such modifications are also within the scope of the present application.
[0061] The present application can be more easily understood by referring to the following examples, which are intended to further illustrate the present application and are not meant to limit the scope of the present application.
[0062] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0063] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.
[0064] Example 1 Study on the regulatory effect of DKC1 on HIF-1a and its target gene expression
[0065] 1. Experimental methods
[0066] (1) Cell lines and cell culture conditions
[0067] Colorectal cancer cell lines DLD1 and HCT116 were obtained from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). DLD1 cells were cultured in RPMI-1640 medium, and HCT116 was cultured in DMEM medium containing 10% fetal bovine serum, 100 U / ml penicillin and 100 μg / ml streptomycin. All cell lines were cultured in a 37°C, 5% CO2 incubator.
[0068] (2) RNAi and transient transfection of cells
[0069] siRNAs against DKC1, HIF1A (siDKC1, siHIF-1a) and scrambled siRNA (siCtrl) were purchased from Shanghai Genomed Pharmaceutical Technology Co., Ltd. When the cell confluence was 30%, siLentFect TMLipofectamine (Bio-Rad Laboratories, Hercules, CA, USA) was used to transfect siRNA into cells.
[0070] The siRNA target sequences are as follows:
[0071] siCtrl: 5'-UUCUCCGAACGUGUCACGU-3' (SEQ ID NO. 1),
[0072] siDKC1#1: 5'-GCGGAUGCGGAAGUAAUUA-3' (SEQ ID NO. 2),
[0073] siDKC1#2: 5'-CCGGCUGCACAAUGCUAUU-3' (SEQ ID NO. 3),
[0074] siHIF- la: 5'-AUCCAGAGUCACUGGAACU-3' (SEQ ID NO. 4)
[0075] The shRNA target sequences are as follows:
[0076] shDKC1: 5'-CCGGCUGCACAAUGCUAUU-3' (SEQ ID NO. 5).
[0077] (3) RNA extraction and qRT-PCR
[0078] Total RNA extraction was performed using Trizol reagent (Invitrogen) according to the manufacturer's instructions. After measuring the purity of the RNA, reverse transcription reactions were performed using PrimeScript TM RT kit and gDNA Eraser (Vazyme).
[0079] The primer sequences are as follows:
[0080] HIF- la
[0081] Forward primer: 5'-TGATGACCAGCAACTTGAGG-3' (SEQ ID NO. 6),
[0082] Reverse primer: 5'-CTGGGGCATGGTAAAAGAAA-3' (SEQ ID NO. 7);
[0083] VEGF
[0084] Forward primer: 5'-GAAGGACTTTACCTTCCAGGA-3' (SEQ ID NO. 8),
[0085] Reverse primer: 5'- ATGATTCTGCCCTCCTCCTTC -3' (SEQ ID NO. 9);
[0086] GAPDH
[0087] Forward primer: 5'- AAGGTCGGAGTCAACGGATTTG -3' (SEQ ID NO. 10),
[0088] Reverse primer: 5'- CCATGGGTGGAATCATATTGGAA -3' (SEQ ID NO. 11).
[0089] qRT-PCR was performed by ABI7500 qRT-PCR system thermal cycler (Vazyme Biotech, Nanjing, China) and SYBR Green PCR Master Mix in triplicate. GAPDH mRNA was selected as an internal control. The CT method was used to calculate the target mRNA level, normalized to GAPDH.
[0090] (4) Plasmid transfection
[0091] Plasmid transfection: Cells were plated one day in advance, and the medium was changed to a double-antibody-free medium one hour before transfection. Plasmid: Lipofectamine 2000 = 1 (ug): 2 (μl). First, add 96 μl of double-antibody-free and serum-free medium to the EP tube, then add 4 μl of liposome, mix slowly, and incubate at room temperature for 5 min; add 98 μl of double-antibody-free and serum-free medium to the EP tube, then add 2 μl (2 ug) of plasmid, mix well; mix 100 μl of medium containing the plasmid into 100 μl of EP tube containing the liposome, incubate at room temperature for 20 min; add dropwise to the six-well plate; change the liquid after six hours. The plasmid map of DKC1 overexpression is shown in Figure 17 .
[0092] (5) Western blot
[0093] Western blot was performed according to the previously described method (Reference: Hou P, Li L, Chen F, Chen Y, Liu H, Li J, et al. PTBP3-Mediated Regulation of ZEB1 mRNA Stability Promotes Epithelial-Mesenchymal Transition in Breast Cancer. Cancer research 2018, 78(2):387-398) with rabbit anti-DKC1 (1:1500, ab64667, Abeam, USA), rabbit anti-HIF-1a (1:1000, ab51608, Abeam, USA), rabbit anti-VEGF (1:1000, 19003-1-AP, Proteintech, USA), mouse anti-GAPDH (1:200000, Proteintech, USA) as primary antibody; HRP-goat anti-rabbit, HRP-goat anti-mouse as secondary antibody. The density of protein bands was detected by densitometry (tanon, Shanghai, China).
[0094] 2. Statistical analysis
[0095] Statistical analysis was performed using statistical software 20.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 7. Unpaired t-test was used to determine statistical significance of differences between groups. Data are presented as mean ± standard deviation. p < 0.05 was considered statistically significant.
[0096] 3. Results
[0097] Western blot showed that downregulation of DKC1 expression in HCT116 and DLD1 cells led to inhibition of HIF-1a protein expression in normoxic (21% O2) or hypoxic (1% O2) environment (A); when DKC1 was overexpressed, HIF-1a protein level was also significantly increased (B). Western blot and QPCR results showed that when DKC1 expression was interfered, the protein and mRNA levels of HIF-1a and VEGF were significantly downregulated; when DKC1 was overexpressed, the protein and mRNA levels of HIF-1a and VEGF were significantly increased (C and D). The above data indicated that the protein and mRNA expression of HIF-1a and VEGF were positively regulated by DKC1. Figure 1 Figure 1 Figure 2 Figure 3 ). The above data indicated that the protein and mRNA expression of HIF-1a and VEGF were positively regulated by DKC1.
[0098] Example 2 Study of the effect of DKC1 and HIF-1a on tumor angiogenesis, tumor migration and invasion
[0099] 1. Experimental Methods
[0100] (1) Stable transfection cell line construction
[0101] DKC1 stable knock-out HCT116 cell line and control cell line were constructed using lentivirus packaged DKC1 shRNA vector and corresponding control vector (purchased from Shanghai Genomeditech Co., Ltd., item number: D01005 and D01002, respectively). Then DKC1 stable knock-out HCT116 cells were infected with HIF-1a overexpression lentivirus (Jikai Gene, item number: G0150) to establish HIF-1a stable overexpression cell line. The target cells were transfected with lentivirus for 48 hours, and then selected with 5 μg / ml puromycin (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) for 2 weeks.
[0102] (2) Immunohistochemistry (IHC)
[0103] Paraffin-embedded CRC tissues and corresponding para-cancer tissues were fixed on 1.5 mm diameter cores. The standard protocol of TMA immunostaining was previously described (see literature: Shi M, Cao M, Song J, Liu Q, Li H, Meng F, et al. PinX1 inhibits the invasion and metastasis of human breast cancer via suppressing NF-kappaB / MMP-9 signaling pathway. Molecular cancer 2015, 14:66). Polyclonal rabbit anti-DKC1 (1:100, ab64667; Abeam, Cambridge, MA, USA) was used as the primary antibody incubated overnight at 4°C. For other primary antibodies, anti-HIF-1a antibody (rabbit polyclonal, ab51608, Abeam, USA) was applied at 1:400 dilution, and anti-VEGF antibody (rabbit polyclonal, 19003-1-AP, Proteintech, USA) was applied at 1:100 dilution. Phosphate-buffered saline (PBS) was used instead of antibody as a negative control during the primary antibody incubation.
[0104] Immunohistochemical evaluation
[0105] DKC1 staining scores were assessed independently by two pathologists without clinical data. They discussed each discrepant core and reached a consensus. DKC1 expression scores in CRC tissues and corresponding normal tissues were assessed by evaluating the immunoreactive score (IRS), which was calculated by multiplying the DKC1 staining intensity and the percentage of DKC1 immunopositive cells. The intensity of DKC1 immunostaining was graded from 0 to 3 (0, negative; 1, weak; 2, moderate; 3, strong). The percentage of immunopositive cells was classified into four grades: 1 for 0 to 25%, 2 for 26% to 50%, 3 for 51% to 75%, and 4 for 76% to 100%. Based on the IRS, DKC1 expression levels were classified as low (IRS: 0, 1, 2, 3, 4, 6) and high (IRS: 8, 9, 12) expression.
[0106] (3) Cell migration and invasion assays
[0107] Cell migration and invasion assays were performed by using transwell chambers. Matrigel (BD Biosciences, Mississauga, Canada) was either uncoated or coated on transwell filter inserts for cell migration or cell invasion assays, respectively. 2 x 10 5 cells were resuspended in FBS-free medium and seeded in the top chamber and incubated at 37°C, 5% CO2 for 12 or 24 hours. Cells were then fixed on the membrane with 90% methanol for 20 minutes and stained with crystal violet. Cells that did not cross the membrane in the top chamber were simultaneously removed with a cotton swab. Cells that crossed the membrane were counted using an inverted microscope.
[0108] (4) Angiogenesis assay
[0109] 1 x 10 6 cells of treatment groups and respective control cells were seeded in 60 mm plates, incubated with 2 ml fresh FBS-free medium for 1 day, and then the treated medium was saved. For the angiogenesis assay, 48-well plates coated with 180 μΐ of Matrigel (BD Biosciences) were kept in a 37°C incubator for 2 hours to solidify the Matrigel. Then 200 μΐ of 4 x 10 4 cells of HUVEC suspended in the treated medium were seeded into the 48-well plates pre-coated with Matrigel and incubated for 4 hours. The angiogenesis was counted using an inverted microscope.
[0110] (5) Cell proliferation assay
[0111] Cell proliferation was detected using the CCK-8 assay protocol from the manufacturer (Dojindo). In short, 4000 cells suspended in 200 μL of complete culture medium were seeded into 96-well plates and cultured. At the specified time, 10 μL of CCK-8 solution was mixed with 100 μL of culture medium and added to the 96-well plates, then incubated at 37°C for 2 hours. The absorbance was measured at 450 nm.
[0112] (6) Subcutaneous tumor model and in vivo lung metastasis model
[0113] Animal experiments were approved by the Animal Protection Committee of Xuzhou Medical University. Female BALB / c nude mice (6-8 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and housed under specific pathogen-free conditions. Twenty female BALB / c nude mice were randomly divided into two groups: a DKC1 knockout group and a control group. DKC1 stably knocked out HCT116 cells (5 × 10⁻⁶). 6 (5 × 10⁻⁶) and control HCT116 cells (5 × 10⁻� 6 Each tumor was suspended in 200 μL of PBS and subcutaneously injected into the axilla. Six days later, the subcutaneous tumors could be visually observed. The long and wide diameters of the tumor were measured every two days, and the tumor volume was obtained by multiplying the long diameter by the wide diameter. Two weeks later, all mice were sacrificed and the tumors were removed. Each tumor was weighed and fixed with 4% paraformaldehyde for further immunohistochemical analysis. A lung metastasis model was established by tail vein injection in mice. Twenty-one female BALB / c nude mice (6-8 weeks old) were randomly divided into three groups: a control cell group, a DKC1 stably knocked-out HCT116 cell group, and a HIF-1α stably overexpressing cell group. 2 × 10⁶ cells were injected via tail vein into the mice. 6 HCT116 cells were suspended in 200 μL PBS. After 45 days, all mice were sacrificed and their lungs were removed. Each lung was fixed with 4% paraformaldehyde and further analyzed by HE staining and immunohistochemical analysis to count metastatic nodules on the surface of each lung.
[0114] 2. Results
[0115] (1) HIF-1α rescue analysis
[0116] a. In vitro analysis
[0117] A plasmid overexpressing HIF-1α and two siRNAs targeting DKC1 were co-transfected into HCT116 and DLD1 cells, respectively. The results showed that HIF-1α overexpression significantly reversed the downregulation of VEGF expression caused by interference with DKC1 expression. Figure 4 Simultaneously, HIF-1α overexpression also reversed the cells' ability to migrate, invade, and angiogenesis. Figures 5-7 ).
[0118] b. In vivo analysis
[0119] DKC1 stable knockdown cell line was established using HCT116. Western blot showed downregulation of DKC1 protein expression in DKC1 stable knockdown cell line HCT116 (Fig. 2A). DKC1 stable knockdown cell line (shDKC1) and control cell line (shCtrl) were mixed with matrigel and injected subcutaneously into BALB / c nude mice. After 6 days, the maximum length and width of subcutaneous tumors were measured every other day. After two weeks, subcutaneous tumors were excised and their weight and volume were measured (Fig. 2B). Data showed that the weight and volume of tumors inoculated with DKC1 stable knockdown cell line were significantly reduced compared to control cells (Fig. 2B-C). IHC assay showed that DKC1 stable knockdown cell line induced reduction of HIF-1a and VEGF protein expression in xenograft tumors compared to control cells (Fig. 2D). HIF1a stable overexpression cell line was established based on DKC1 stable knockdown cell line. DKC1 stable knockdown cell line or HIF1a stable overexpression cell line or control cell line was injected into the tail vein of BALB / c nude mice. After 45 days, all mice were sacrificed and lungs were excised. Visual analysis showed that HIF-1a overexpression significantly reversed the number of tumor metastasis (Fig. 3A-B). This result was further confirmed by lung HE staining (Fig. 3C). IHC assay showed that HIF-1a overexpression upregulated VEGF expression (Fig. 3D). Figure 8 Figure 9 A, Fig. 10 mice are 10 mice used in parallel experiments). Data showed that the weight and volume of tumors inoculated with DKC1 stable knockdown cell line were significantly reduced compared to control cells (Fig. 2B-C). IHC assay showed that DKC1 stable knockdown cell line induced reduction of HIF-1a and VEGF protein expression in xenograft tumors compared to control cells (Fig. 2D). HIF1a stable overexpression cell line was established based on DKC1 stable knockdown cell line. DKC1 stable knockdown cell line or HIF1a stable overexpression cell line or control cell line was injected into the tail vein of BALB / c nude mice. After 45 days, all mice were sacrificed and lungs were excised. Visual analysis showed that HIF-1a overexpression significantly reversed the number of tumor metastasis (Fig. 3A-B). This result was further confirmed by lung HE staining (Fig. 3C). IHC assay showed that HIF-1a overexpression upregulated VEGF expression (Fig. 3D). Figure 9 Figure 10 A, Fig. 10 mice are 10 mice used in parallel experiments). Data showed that the weight and volume of tumors inoculated with DKC1 stable knockdown cell line were significantly reduced compared to control cells (Fig. 2B-C). IHC assay showed that DKC1 stable knockdown cell line induced reduction of HIF-1a and VEGF protein expression in xenograft tumors compared to control cells (Fig. 2D). HIF1a stable overexpression cell line was established based on DKC1 stable knockdown cell line. DKC1 stable knockdown cell line or HIF1a stable overexpression cell line or control cell line was injected into the tail vein of BALB / c nude mice. After 45 days, all mice were sacrificed and lungs were excised. Visual analysis showed that HIF-1a overexpression significantly reversed the number of tumor metastasis (Fig. 3A-B). This result was further confirmed by lung HE staining (Fig. 3C). IHC assay showed that HIF-1a overexpression upregulated VEGF expression (Fig. 3D). Figure 11 Figure 12 A, Fig. 10 mice are 10 mice used in parallel experiments). Data showed that the weight and volume of tumors inoculated with DKC1 stable knockdown cell line were significantly reduced compared to control cells (Fig. 2B-C). IHC assay showed that DKC1 stable knockdown cell line induced reduction of HIF-1a and VEGF protein expression in xenograft tumors compared to control cells (Fig. 2D). HIF1a stable overexpression cell line was established based on DKC1 stable knockdown cell line. DKC1 stable knockdown cell line or HIF1a stable overexpression cell line or control cell line was injected into the tail vein of BALB / c nude mice. After 45 days, all mice were sacrificed and lungs were excised. Visual analysis showed that HIF-1a overexpression significantly reversed the number of tumor metastasis (Fig. 3A-B). This result was further confirmed by lung HE staining (Fig. 3C). IHC assay showed that HIF-1a overexpression upregulated VEGF expression (Fig. 3D). Figure 13 Figure 14 A, Fig. 10 mice are 10 mice used in parallel experiments). Data showed that the weight and volume of tumors inoculated with DKC1 stable knockdown cell line were significantly reduced compared to control cells (Fig. 2B-C). IHC assay showed that DKC1 stable knockdown cell line induced reduction of HIF-1a and VEGF protein expression in xenograft tumors compared to control cells (Fig. 2D). HIF1a stable overexpression cell line was established based on DKC1 stable knockdown cell line. DKC1 stable knockdown cell line or HIF1a stable overexpression cell line or control cell line was injected into the tail vein of BALB / c nude mice. After 45 days, all mice were sacrificed and lungs were excised. Visual analysis showed that HIF-1a overexpression significantly reversed the number of tumor metastasis (Fig. 3A-B). This result was further confirmed by lung HE staining (Fig. 3C). IHC assay showed that HIF-1a overexpression upregulated VEGF expression (Fig. 3D).
[0120] (2) DKC1 and HIF-1a double inhibition analysis
[0121] (1) Analysis of angiogenic ability
[0122] In HCT116 control cells and shDKC1 cells, siRNA against HIF-1a (siHIF-1a) and control siRNA (siCtrl) were transfected respectively, and then these cells were used for angiogenesis experiment analysis. It was found that interfering with the expression of HIF-1a could further inhibit the ability of angiogenesis (Fig. 4). Figure 15
[0123] (2) Analysis of migration and invasion ability
[0124] In HCT116 control cells and shDKC1 cells, siRNA (siHIF-1a) and control siCtrl against HIF-1a were transfected respectively, and then the cells were used for migration and invasion experiments. Figure 16
[0125] The scope of the application is not limited to the specific embodiments described, which are intended only to be illustrative of the individual aspects of the application, and which include methods and components that are functionally equivalent. Indeed, many modifications can be made by those skilled in the art of the present application in light of the description and the figures contained herein. Such modifications are within the scope of the appended claims. SEQUENCE LISTING <110> Xuzhou Medical University <120> Application of DKC1 and HIF-1a in the synergistic treatment of colorectal cancer <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence (Artificial Sequence) <400> 1 uucuccgaac gugucacgu 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence (Artificial Sequence) <400> 2 gcggaugcgg aaguaauua 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence (Artificial Sequence) <400> 3 ccggcugcac aaugcuauu 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <400> 4 auccagaguc acuggaacu 19 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <400> 5 ccggcugcac aaugcuauu 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tgatgaccag caacttgagg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 ctggggcatg gtaaaagaaa 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <400> 8 gaaggacttt accttccagg a 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <400> 9 atgattctgc cctcctcctt c 21 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <400> 10 aaggtcggag tcaacggatt tg 22 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <400> 11 ccatgggtgg aatcatattg gaa 23
Claims
1. A drug for treating colorectal cancer, said drug comprising an agent that inhibits the expression of the DKC1 gene and the HIF-1α gene; The reagent used to inhibit DKC1 gene expression is shDKC1, whose nucleotide sequence is shown in SEQ ID NO.5; The reagent used to inhibit HIF-1α gene expression is siHIF-1α, whose nucleotide sequence is shown in SEQ ID NO.
4.
2. Application of reagents that inhibit the expression of DKC1 and HIF-1α genes in the preparation of drugs for treating colorectal cancer; The reagent used to inhibit DKC1 gene expression is shDKC1, whose nucleotide sequence is shown in SEQ ID NO.5; The reagent used to inhibit HIF-1α gene expression is siHIF-1α, whose nucleotide sequence is shown in SEQ ID NO.4.
Citation Information
Patent Citations
Methods and compositions for altering health, well-being, and lifespan.
CN102300578A
Application of specnuezhenide in preparation of medicine for treating neovascular diseases
CN106539808A
Colorectal cancer early hepatic metastasis animal model and construction method and application thereof
CN106580512A
Molecular cardiotoxicology modeling
WO2004063334A2