Bacteriocins for controlling salmonella in the gut

Abstract

The present invention relates to a bacteriocin (salmonin) for controlling Salmonella enterica. The bacteriocin is derived from Salmonella enterica. The salmonin can be expressed in plants and can be used in a method for preventing or reducing Salmonella enterica infection or contamination of a target.

Description

TECHNICAL FIELD

[0001] The present invention provides proteins capable of exerting cytotoxic effects on Salmonella, termed salmocins. The invention also provides compositions, including pharmaceutical compositions, comprising one or more of the proteins. Methods of preventing or reducing infection or contamination of a target by Salmonella, methods of treating Salmonella infection in a subject or patient in need thereof, and methods of producing compositions comprising the proteins are also provided. BACKGROUND

[0002] Salmonella is a rod-shaped, Gram-negative bacterium of the family Enterobacteriaceae. Salmonella enterica is the typical species and is further divided into 6 subspecies, of which Salmonella enterica ssp. enterica is subspecies I, which includes over 2500 serovars. Salmonella infection is common and can result in a wide range of clinical manifestations, from an asymptomatic state to very severe illness. It is estimated that 1 million people in the United States are infected with Salmonella enterica each year, resulting in approximately 19,000 hospitalizations and 380 deaths. In the past 5 years, 46 Salmonella outbreaks have been recorded in the United States, most of which were food poisoning due to contaminated poultry or vegetables, as well as red meat and fish (CDC website).

[0003] Preventing Salmonella infection or reducing contamination of food by Salmonella requires control measures at all stages of the food chain, from agricultural production on the farm to food processing, manufacturing and preparation in commercial establishments and home kitchens. Good hygiene practices reduce contamination of food by Salmonella, but do not guarantee that the product is free of Salmonella. Preventive measures taken at home against Salmonella are similar to those taken against other foodborne bacteria. Basic food hygiene practices, such as "cooking", are recommended as a preventive measure against salmonellosis, see WHO www.who.int / mediacentre / factsheets / fs139 / en / .

[0004] Antibacterial therapy can be used to treat humans or animals infected with Salmonella. However, antimicrobial resistance is a global public health concern, and Salmonella is one of the microorganisms for which some resistant serovars have emerged, affecting the food chain.

[0005] Most of the above-mentioned methods for preventing or treating Salmonella infection or reducing Salmonella contamination are methods that are essentially independent of a specific pathogenic bacteria or a specific serovar of Salmonella. This has the advantage that there is little need for prior knowledge of the specific Salmonella strain or enterica Salmonella serovar involved before taking countermeasures. However, the above-mentioned methods for preventing Salmonella infection or reducing Salmonella contamination, such as heating, are not always applicable or change the treated commodity or food product in an undesirable way. Other methods can not be effective for a specific patient. Therefore, there is a need for other methods for preventing or treating Salmonella infection or contamination, or for reducing or preventing contamination of a target, in particular a food product, with Salmonella, in particular with enterica Salmonella enterica subsp.

[0006] It is an object of the present application to provide methods for preventing or treating Salmonella infection, such as foodborne Salmonella infection. It is a further object to provide methods for preventing or reducing contamination of a target, in particular a food product, with Salmonella. It is a further object of the present application to provide methods for preventing or treating Salmonella infection and / or for reducing contamination of a target with Salmonella, which are effective against a broad range of Salmonella serogroups. Furthermore, compounds, reagents and compositions for use in these methods are desirable. SUMMARY

[0007] Thus, the present application provides:

[0008] (1) A protein, preferably capable of exerting a cytotoxic effect on Salmonella, comprising at least any one of the following amino acid sequence segments (a-i) to (a-vi) or (b-i) to (b-vi), (c-i) to (c-vi) or (d-i) to (d-vi) or a derivative thereof as defined in any one of the following:

[0009] (a-i) a segment from amino acid residues 316 to 449 of ScoIE2 (SEQ ID NO: 1),

[0010] (a-ii) a segment from amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0011] (a-iii) a segment from amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0012] (a-iv) a segment from amino acid residues 174 to 297 of ScoIEla (SEQ ID NO: 4),

[0013] (a-v) a segment from amino acid residues 198 to 322 of ScolElb (SEQ ID NO: 5), or

[0014] (a-vi) a segment comprising at least 200 consecutive amino acid residues of Spst of SEQ ID NO: 6; or

[0015] (bi) a segment having at least 75% sequence identity to the segment of amino acid residues 316 to 449 from ScoIE2 (SEQ ID NO: 1),

[0016] (b-ii) a segment having at least 70% sequence identity to the segment from amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0017] (b-iii) a segment having at least 77% sequence identity to the segment from amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0018] (b-iv) a segment having at least 70% sequence identity to the segment from amino acid residues 174 to 297 of ScoIE1a (SEQ ID NO: 4),

[0019] (bv) a segment having at least 70% sequence identity to a segment from amino acid residues 198 to 322 of ScoIE1b (SEQ ID NO: 5), or

[0020] (b-vi) a segment having at least 70% sequence identity to a segment of at least 200 consecutive amino acid residues comprising Spst of SEQ ID NO: 6;

[0021] or

[0022] (ci) a segment having at least 85% sequence similarity to the segment from amino acid residues 316 to 449 of ScoIE2 (SEQ ID NO: 1),

[0023] (c-ii) a segment having at least 80% sequence similarity to the segment from amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0024] (c-iii) a segment having at least 85% sequence similarity to the segment from amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0025] (c-iv) a segment having at least 80% sequence similarity to the segment from amino acid residues 174 to 297 of ScoIE1a (SEQ ID NO: 4),

[0026] (cv) a segment having at least 80% sequence similarity to the segment from amino acid residues 198 to 322 of ScoIE1b (SEQ ID NO: 5), or

[0027] (c-vi) a segment having at least 80% sequence similarity to a segment of at least 200 consecutive amino acid residues comprising Spst of SEQ ID NO: 6;

[0028] or

[0029] (di) a segment having 1 to 25 amino acid substitutions, additions, insertions or deletions compared to the segment of amino acid residues 316 to 449 from ScoIE2 (SEQ ID NO: 1),

[0030] (d-ii) a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions compared to the segment of amino acid residues 315 to 483 from ScoIE3 (SEQ ID NO: 2),

[0031] (d-iii) a segment having 1 to 30 amino acid substitutions, additions, insertions or deletions compared to the segment of amino acid residues 318 to 451 from ScoIE7 (SEQ ID NO: 3),

[0032] (d-iv) a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions compared to the segment of amino acid residues 174 to 297 from ScoIE1a (SEQ ID NO: 4),

[0033] (dv) a segment having 1 to 40 amino acid substitutions, additions, insertions or deletions compared to the segment of amino acid residues 198 to 322 of ScoIE1b (SEQ ID NO: 5), or

[0034] (d-vi) A segment having 1 to 40 amino acid substitutions, additions, insertions or deletions compared to a segment of at least 200 consecutive amino acid residues of Spst comprising SEQ ID NO: 6.

[0035] (2) The protein according to (1), which comprises a cytotoxic or catalytic domain having any one or more of the following activities: membrane pore-forming activity, DNA enzyme activity, RNA enzyme activity or cell wall degradation activity such as lysozyme activity.

[0036] (3) The protein according to (1) or (2), which comprises a cytotoxic or catalytic domain, wherein the cytotoxic or catalytic domain comprises or consists of the following amino acid sequence segments (ai)' to (a-vi)' or derivatives thereof, or any one of the amino acid sequence segments defined by (bi)' to (b-vi)', (ci)' to (c-vi)' or (di)' to (d-vi)':

[0037] (ai)' a segment from amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0038] (a-ii)'a segment from amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0039] (a-iii)'a segment from amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0040] (a-iv)' a segment from amino acid residues 306 to 478 of ScoIE1a (SEQ ID NO: 4),

[0041] (av)' a segment from amino acid residues 350 to 522 of ScoIE1b (SEQ ID NO: 5), or

[0042] (a-vi)'a segment from amino acid residues 112 to 288 of Spst (SEQ ID NO: 6);

[0043] or

[0044] (bi)' a segment having at least 70% sequence identity to the segment from amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0045] (b-ii) a segment having at least 70% sequence identity to the segment of amino acid residues 501 to 584 from ScoIE3 (SEQ ID NO: 2),

[0046] (b-iii) a segment having at least 70% sequence identity to the segment from amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0047] (b-iv)' a segment having at least 70% sequence identity to the segment from amino acid residues 306 to 478 of ScoIE1a (SEQ ID NO: 4),

[0048] (b-v)' a segment having at least 70% sequence identity to a segment from amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0049] (b-vi)' a segment having at least 70% sequence identity to a segment from amino acid residues 112 to 288 of Spst (SEQ ID NO: 6);

[0050] or

[0051] (c-i)' a segment having at least 80% sequence similarity to a segment from amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0052] (c-ii)' a segment having at least 80% sequence similarity to a segment from amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0053] (c-iii)' a segment having at least 80% sequence similarity to a segment from amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0054] (c-iv)' a segment having at least 80% sequence similarity to a segment from amino acid residues 306 to 478 of ScoIEla (SEQ ID NO: 4),

[0055] (c-v)' a segment having at least 80% sequence similarity to a segment from amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0056] (c-vi)' a segment having at least 80% sequence similarity to a segment from amino acid residues 112 to 288 of Spst (SEQ ID NO: 6);

[0057] or

[0058] (d-i)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0059] (d-ii)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0060] (d-iii)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0061] (d-iv)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 306 to 478 of ScoIEla (SEQ ID NO: 4),

[0062] (d-v)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0063] (d-vi)' a segment having 1 to 20 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 112 to 288 of Spst (SEQ ID NO: 6).

[0064] (4) The protein according to any one of (1), (2), or (3), comprising a translocation domain comprising (or consisting of) any one of the following amino acid segments (a-i)” to (a-v)” or a derivative thereof (or amino acid sequence segment) defined by (b-i”) to (b-v”), (c-i”) to (c-v”), or (d-i”) to (d-v”):

[0065] (a-i)” a segment from amino acid residues 43 to 313 of ScoIE2 (SEQ ID NO: 1),

[0066] (a-ii)” a segment from amino acid residues 35 to 315 of ScoIE3 (SEQ ID NO: 2),

[0067] (a-iii)” a segment from amino acid residues 43 to 316 of ScoIE7 (SEQ ID NO: 3);

[0068] (a-iv)” a segment from amino acid residues 1 to 170 of ScoIEla (SEQ ID NO: 4); or

[0069] (a-v)” a segment from amino acid residues 1 to 195 of ScoIElb (SEQ ID NO: 5);

[0070] or

[0071] (b-i) "a segment having at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to a segment from amino acid residues 43 to 313 of ScoIE2 (SEQ ID NO: 1),

[0072] (b-ii) "a segment having at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to a segment from amino acid residues 35 to 315 of ScoIE3 (SEQ ID NO: 2),

[0073] (b-iii) "a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to a segment from amino acid residues 43 to 316 of ScoIE7 (SEQ ID NO: 3);

[0074] (b-iv) "a segment having at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to a segment from amino acid residues 1 to 170 of ScoIEla (SEQ ID NO: 4); or

[0075] (b-v) "a segment having at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to a segment from amino acid residues 1 to 195 of ScoIElb (SEQ ID NO: 5);

[0076] or

[0077] (c-i) "a segment having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity to a segment from amino acid residues 43 to 313 of ScoIE2 (SEQ ID NO: 1),

[0078] (c-ii) "a segment having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity to a segment from amino acid residues 35 to 315 of ScoIE3 (SEQ ID NO: 2),

[0079] (c-iii) "a segment having at least 90%, preferably at least 95% sequence similarity to a segment from amino acid residues 43 to 316 of ScoIE7 (SEQ ID NO: 3);

[0080] (c-iv) "a segment having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to a segment from amino acid residues 1 to 170 of ScoIEla (SEQ ID NO: 4); or

[0081] (cv)" a segment having at least 80%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment from amino acid residues 1 to 195 of ScoIE1b (SEQ ID NO: 5);

[0082] or

[0083] (di)" has 1 to 50, preferably 1 to 40, more preferably 1 to 30, even more preferably 1 to 20, most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions with the segment of amino acid residues 43 to 313 from ScoIE2 (SEQ ID NO: 1),

[0084] (d-ii) "a segment having 1 to 50, preferably 1 to 40, more preferably 1 to 30, even more preferably 1 to 20, most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions with the segment of amino acid residues 35 to 315 from ScoIE3 (SEQ ID NO: 2),

[0085] (d-iii) "a segment having 1 to 30, preferably 1 to 20, and most preferably 1 to 10, amino acid substitutions, additions, insertions or deletions relative to a segment of amino acid residues 43 to 316 of ScoIE7 (SEQ ID NO: 3); an amino acid substitution, addition, insertion or deletion relative to a segment of amino acid residues 35 to 315;

[0086] (d-iv) "a segment having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions from a segment of amino acid residues 1 to 170 of ScoIE1a (SEQ ID NO: 4) or an amino acid substitution, addition, insertion or deletion from a segment of amino acid residues 35 to 315; or

[0087] (dv)" has 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions or deletions with a segment of amino acid residues 1 to 195 of ScoIE1b (SEQ ID NO: 5), or an amino acid substitution, addition, insertion or deletion with a segment of amino acid residues 35 to 315.

[0088] (5) The protein according to any one of (1) to (4), for use in a method for treating infection or contamination with Salmonella, such as Salmonella enterica, preferably Salmonella enterica subspecies enterica.

[0089] (6) The protein according to any one of (1) to (5), wherein the protein of (1), in particular the protein of the class (b) to (d) in (1), has a toxicity against Salmonella enterica such that, after spotting 5 microliters of a protein solution of the protein of (1), in particular the protein of the class (b) to (d) in (1), and of SEQ ID NO: 1 on a soft agar overlayed plate and subsequently incubating the agar plate at 37°C for 12 hours, the protein of SEQ ID NO: 1 produces a plaque of live bacteria of the same diameter as the plaque of live bacteria of Salmonella enterica subsp. enterica serovar Newport strain 6962 TM* of the sensitive Salmonella enterica strain at 0.14 mL per cm 2 1 x 10 7 cfu / mL, wherein the concentration of the protein of the class (b) to (d) is at most 5 times the concentration of the corresponding solution of the protein of SEQ ID NO: 1.

[0090] (7) A composition comprising one or more proteins as defined in any one of (1) to (6).

[0091] (8) The composition according to (7), wherein the one or more proteins are or comprise ScoIEla or ScoIElb, or a derivative of ScoIEla or ScoIElb.

[0092] (9) The composition according to (7) or (8), comprising two or more proteins selected from at least two different classes (i) to (vi) as defined in (1).

[0093] (10) The composition according to (9), comprising at least a protein of the sub-class (i) (any of the classes (a) to (d)) and a protein of the sub-class (V) (any of the classes (a) to (d))

[0094] (11) The composition according to any one of (7) to (10) for use in a method of treating a Salmonella, preferably Salmonella enterica, more preferably Salmonella enterica subsp. enterica infection.

[0095] (12) The composition according to any one of (7) to (11), wherein the composition is a plant matter or an extract thereof, wherein the plant matter is a matter from a plant having the protein expressed, preferably a comestible plant having the protein expressed.

[0096] (13) The composition according to (12), wherein the plant matter is a matter of a plant selected from the group consisting of spinach, lambsquarters, beetroot, carrot, sugar beet, mangold, amaranth, tobacco, and / or the plant matter is one or more leaves, roots, tubers or seeds, or a crushed, ground or comminuted product of the leaves, roots, tubers or seeds.

[0097] (14) The composition according to any one of (7) to (13), wherein the composition is an aqueous solution containing the protein.

[0098] (15) The composition according to (14), wherein the concentration of the protein in the aqueous solution, or if the composition contains two or more different proteins, the concentration of the two or more proteins, is 0.0001 to 1 mg / ml, preferably 0.001 to 0.1 mg / ml, more preferably 0.005 to 0.05 mg / ml; or 0.1 to 15 mg / kg food, preferably 0.5 to 10 mg / kg food, more preferably 0.1 to 5 mg / kg food.

[0099] (16) The composition according to any one of (7) to (15), comprising ScoIEla and / or a derivative thereof or ScoIEla or a derivative thereof; or comprising a protein according to item (A-iv), (B-iv), (C-iv), (D-iv) or (E-iv), and / or a protein according to item (A-v), (B-v), (C-v), (D-v) or (E-v) as defined below; or comprising a protein according to item (A-iv), (B-iv), (D-iv) or (E-iv), and / or a protein according to item (A-v), (B-v), (D-v) or (E-v) as defined below; or comprising a protein according to item (A-iv), (B-iv), (D-iv) or (E-iv), and a protein according to item (A-v), (B-v), (D-v) or (E-v) as defined below; wherein the preferred embodiments defined herein can be combined with the embodiments defined in this item (16).

[0100] (17) A method of preventing or reducing Salmonella infection or contamination of a target, comprising contacting the target with a protein as defined in any one of (1) to (6) or a composition as defined in any one of (7) to (16).

[0101] (18) The method according to (17), wherein the target is sprayed with the aqueous solution or the target is immersed into the aqueous solution.

[0102] (19) The method according to (17) to (18), wherein the target is immersed into the aqueous solution of the protein for at least 10 seconds, preferably at least 1 minute, preferably at least 5 minutes.

[0103] (20) The method according to any one of (17) to (19), wherein the target is a food or an animal feed.

[0104] (21) The method according to (20), wherein the food is a whole animal carcass, meat, egg, raw fruit or vegetable, preferably the food is meat, raw fruit or vegetable, more preferably the food is meat.

[0105] (22) A method of treating a Salmonella infection in a subject in need thereof, comprising administering to the subject a protein as defined in any one of (1) to (6) or a composition as defined in any one of (7) to (16).

[0106] (23) The method according to any one of (17) to (22), wherein the Salmonella is Salmonella enterica, preferably Salmonella enterica subsp. enterica.

[0107] (24) A method of producing a composition comprising a protein as defined in any one of (1) to (6), the method comprising the steps of:

[0108] (i) expressing the protein in a plant, preferably an edible plant or tobacco,

[0109] (ii) harvesting plant material containing the expressed protein from the plant,

[0110] (iii) extracting the protein from the plant material with an aqueous buffer to obtain a composition containing the protein,

[0111] (iv) optionally removing unwanted contaminants from the composition.

[0112] Salmonella bacteriocins, referred to herein together with their derivatives as "salmonins", are natural non-antibiotic antimicrobial proteins produced by certain Salmonella strains that kill or inhibit the growth of other Salmonella strains. Unlike the relatively well-studied analogues of E. coli proteins known as colicins, salmonins have received little attention. There are many Salmonella sequences in publicly available genomic databases that resemble colicin sequences, most of which show high identity to colicins M, la, lb, 5 and 10. The present inventors have identified salmonins that are similar to but different from colicins, which can be used to prevent or reduce infection or contamination by Salmonella, in particular Salmonella enterica subsp. enterica.

[0113] The inventors found that all tested salmosins can be expressed efficiently in plants. The expression method used in this study has reached GMP compliant level and is currently used as manufacturing method in different clinical trials. Most salmosins are expressed in high yield (up to 1.7 g active protein per kg fresh green biomass), which means low commercially viable manufacturing costs. Especially tobacco and edible plants such as sugar beet or spinach can be used for production. Among the different salmosins, salmosin Ela (ScoIEla) and Elb (ScoIElb) or their derivatives are preferred because they were found to have the broadest antibacterial activity against the major pathogenic Salmonella strains. Each of these two salmosins also showed very high activity against all 36 tested major pathogenic strains. In the used assays, treatment with low amounts of colimycin (e.g. less than 10 mg colimycin per kg of food product treated) reduced the bacterial load of different pathogenic strains by 3 to >6 logs. In spike experiments with poultry meat spiked with 2 to 4 pathogen serotypes, colimycin (colimycin M, la and 5) effectively reduced the titers of pathogenic bacteria. Therefore, it is expected that the above mentioned salmosins with higher antibacterial activity against the serotypes of Salmonella enterica ssp. enterica than the mentioned colimycins can more effectively reduce the titers of Salmonella contamination of poultry.

[0114] The experimental data of the present invention show that non-antibiotic antibacterial salmosins can be expressed in plants such as Nicotiana benthamiana (standard production host for many biopharmaceuticals currently in clinical trials) at very high levels and the plant expressed proteins apparently have full activity. In most cases, the expression levels reached 37% of total soluble protein or 1.74 g / kg fresh leaf biomass without process optimization, which means that salmosins are not toxic to plants and an optimized transfection or induction industrial procedure in a cheap transgenic host can be developed. In contrast, attempts to express bacteriocin proteins at high levels in bacterial hosts usually encounter the general toxicity of this class of bacteriocins, even in species other than the homologous bacteria (e.g. Medina et al., PLoS One, 2011; 6(8): e23055; Diaz et al., 1994). Therefore, plants are an excellent host for the production of salmosins.

[0115] The data of the present invention show that under realistic exposure modeling, salmosin can effectively control most or all of the major pathogenic serotypes of Salmonella enterica ssp. enterica in the gut. Salmosins are produced by Salmonella in limited variety. The salmosins studied have considerable diversity within the general tri-domain (translocation, receptor, and cytotoxic domain) structure, similar to the more studied E. coli colicins. Surprisingly, virtually all of the salmosins and colicins tested, alone or with antitoxin (immunizing protein), were very well expressed in plants. This can be explained by the low toxicity of salmosins and colicins to plant cells, and the likely lack of unusual requirements of these bacteriocin proteins (classic representatives of "intrinsically disordered proteins" (a feature necessary for the ability to unfold / refold during translocation across bacterial cell walls and membranes)) on the translational and post-translational machinery of plant cells.

[0116] To our knowledge, the present invention includes the first study on the inhibitory efficacy of salmosins against major enteropathogenic strains of Salmonella. Unlike the FDA, which defined a list of major E. coli strains based on historical analysis of food poisoning caused by E. coli, regulatory agencies have not yet defined a list of major foodborne Salmonella strains, mainly due to the higher diversity of pathogenic variants causing outbreaks. In the face of the lack of guidance in the prior art, the inventors decided to concentrate on three existing major studies that rank pathogenic variants based on their prevalence and severity of intoxication. In our study, we chose to analyze 36 serotypes reported to the Centers for Disease Control and Prevention (National Entitical Disease Surveillance: Salmonella Annual Report, 2013 (CDC, June 2016): laboratory-confirmed human Salmonella infections (US) reported to CDC 2003-2012) in 2003-2012, of which 29 caused at least 100 cases of illness, including 17 of the most notorious pathogenic variants on the CDC's top 20 list; this number is 5 times higher than the number of E. coli pathogenic strains defined by the FDA (7).

[0117] The data provided in this patent application show that the five different salmosins of Salmonella can be divided into three groups based on their ability to control major pathogenic Salmonella strains. Salmonella salmosins Ela and Elb proved to be universally active, being able to kill all the pathogenic variants tested and showing the highest average activity. The average activity of the two salmosins on all the strains tested was more than 10 7 AU / μg. For example, the individual activity of salmosin Ela was: 35 out of 36 strains > 10 3AU / μg, 24 of 36 strains >10 4 AU / μg, 13 of 36 strains >10 6 AU / μg. The remaining Salmonellins were divided into two groups, where Salmonellins E2 and E7 inhibited more than 80% of strains, but with low average activity (less than 10 5 AU / μg), while Salmonellin E3 inhibited approximately 60% of strains with lower average activity (about 10 2 AU / μg).

[0118] These results were unexpected, as Colicin (a Salmonellin analogue produced by E. coli cells) showed a very narrow antibacterial activity spectrum against the seven E. coli pathovars and mixtures of two to five Colicins had to be used preferentially to effectively inhibit all seven STEC serotypes defined by the FDA. Colicin also exhibited a much lower average activity (average <10 3 AU / μg) against the "Big Seven" STEC strains, although much higher activity was observed on strain H104:H4 (>10 5 AU / μg) (which caused a major outbreak in Europe in 2011) and the common laboratory strain.

[0119] The analysis of the cross-specific activity of Salmonellins and Colicins against E. coli and Salmonella by the inventors, respectively, revealed low activity against bacteria of different genera / species. In particular, the activity of Salmonellins against the "Big Seven" STEC strains was low (less than 10 2 AU / μg), although some Salmonellins (e.g. E2, E7 and E1 b, but surprisingly not E1 a) had comparable activity on H104:H4 (10 3 AU / μg) and the laboratory strain DH10B (10 5 AU / μg). Similarly, the activity of Colicins on Salmonella pathovars was found to be low, where Colicins la and lb had activity on more than 80% of strains, but only Colicin la had an average activity higher than 3x10 3 AU / μg (or 3-4 orders of magnitude lower than Salmonellin E1 a / b). From these studies, the inventors concluded that a mixture of Colicins and Salmonellins had to be used in order to combat both pathogenic species. These results also seem partially inconsistent with recent studies on the ecological efficacy of Colicin-like proteins in competition between different genera of bacteria (Nedianova et al., PLoS Pathog. 2014 Jan; 10(1): e1003844).

[0120] The present invention provides new agents and compositions for controlling Salmonella. The Salmonellin of the present invention has the advantage that it can be granted marketing authorization in a simple manner. For example, the FDA recently approved the GRAS (generally recognized as safe) status of plant-produced colistin (GRN573, FDA website). Since the need for natural, non-antibiotic antibacterial agents for Salmonella control is unmet, the present inventors conceived to develop a Salmonella bacteriocin ("Salmonellin"). Thus, the present invention was completed. BRIEF DESCRIPTION OF DRAWINGS

[0121] Figure 1 schematically shows the viral vectors used in the examples for expressing Salmonellin and the corresponding immunoprotein. The constructs for expressing Salmonellin were based on Tobacco Mosaic Virus (TMV), while the constructs for expressing the immunoprotein were based on Potato Virus X (PVX).

[0122] The Salmonellin expression vectors include pNMD28161, pNMD28151 and pNMD28172 for expressing Salmonellin ScoIE2, ScoIE3 and ScoIE7, respectively Figure 1A ), including pNMD28191, pNMD28204 and pNMD28182 for expressing Salmonellin ScolEla, ScolElb and Spst, respectively Figure 1B

[0123] ​RB and LB indicate the right and left borders of the T-DNA of the binary vector. Pact2: promoter of the Arabidopsis actin 2 gene; o: 5' end from TVCV (turnip vein clearing virus); RdRp: RNA-dependent RNA polymerase open reading frame (ORF) from cr-TMV (tobacco mosaic virus that infects cruciferous plants); MP: movement protein ORF from cr-TMV; ScoIE2: salmonella typhimurium ScoIE2 coding sequence; ScoIE3: salmonella typhimurium ScoIE3 coding sequence; ScoIE7: salmonella typhimurium ScoIE7 coding sequence; ScoIE1a: salmonella typhimurium ScoIE1a coding sequence; ScoIE1b: salmonella typhimurium ScoIE1b coding sequence; Spst: salmonella typhimurium Spst coding sequence; N: 3'-untranslated region from cr-TMV; T: Agrobacterium nopaline synthase terminator; between RdRp and MP The white segments interrupting the grey segments in the ORFs represent introns inserted into these ORFs to increase the likelihood of RNA replicon formation in the cytoplasm of plant cells, as described in detail in WO 2005049839. In order to prevent the cytotoxic effects of these proteins on E. coli cells used for plasmid cloning, introns were also inserted into the ScoIE2, ScoIE3 and ScoIE7 ORFs.

[0124] PVX-based vectors for expressing immune proteins include pNMD28222 and pNMD28232, which are used to express Salmonella typhimurium ScoIE2 and ScoIE7 immune proteins, respectively ( Figure 1A P35S: Cauliflower mosaic virus 35S promoter; PVX-Pol: RNA-dependent RNA polymerase from PVX; CP: coat protein ORF; 25K, 12K, and 8K together represent the 25 kDa, 12 kDa, and 8 kDa three-gene block module from PVX; N: 3'-untranslated region from PVX. SImmE2 and SImmE7 represent the coding sequences of the salmonellin ScoIE2 and ScoIE7 immunity proteins, respectively.

[0125] Figure 2A comparative SDS-PAGE analysis of Salmonetin expression is shown after infiltration of Nicotiana benthamiana plants with Agrobacterium carrying the viral vectors. Plant leaf material was extracted with 5 volumes of buffer containing 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20 and 300 mM NaCl. Protein extracts were resolved in 12% polyacrylamide gels. For gel loading, aliquots containing the volume of extract equivalent to 0.4 mg of fresh weight of plant tissue were used. Prior to gel loading, aliquots of protein extracts were mixed with 2x Laemmli buffer in a 1 : 1 ratio and incubated at 95 °C for 10 min. Numbers on the gel lanes represent protein extracts from plant tissue expressing the following recombinant proteins: 1 - Salmonetin ScolE2; 2 - Salmonetin ScolE3; 3 - Salmonetin ScolE7; 4 - Salmonetin ScolEla; 5 - Salmonetin ScolElb; 6 - Salmonetin Spst. Number 7 corresponds to the extract of uninfected leaf tissue used as negative control. L-PageRuler TM Pre-stained protein ladder (ThermoFisher Scientific Inc. (Waltham, USA), #SM0671). Arrows indicate specific protein bands corresponding to expressed recombinant Salmonetins.

[0126] Figure 3 A semi-quantitative assessment of specific antibacterial activity of Salmonetin-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antibacterial activity was detected by spot-on-lawn-method using radial diffusion assays. The percentage of Salmonella strains sensitive to Salmonetins (average of 3 independent experiments) is given for: 1 - Salmonetin ScolE2; 2 - Salmonetin ScolE3; 3 - Salmonetin ScolE7; 4 - Salmonetin ScolEla; 5 - Salmonetin ScolElb; 6 - Salmonetin Spst.

[0127] Figure 4Shown is a semi-quantitative assessment of the average antimicrobial activity of plant extracts containing salmonellins against 36 Salmonella enterica subsp. enterica strains listed in Tables 5A and 5B. Antimicrobial activity was detected by spotting using a radial diffusion assay and calculated as arbitrary units (AU) per mg of fresh weight (FW) of plant biomass expressing recombinant salmonellins (average of 3 independent experiments). Therefore, it reflects the yield of a specific active agent per unit biomass, i.e., the specific production capacity of the host. Arbitrary units are calculated as the dilution factor of the highest dilution of the protein extract that causes a detectable clearance effect in the radial diffusion assay. The recombinant salmonellins tested are given as: 1-Salmonellin ScoIE2; 2-Salmonellin ScoIE3; 3-Salmonellin ScoIE7; 4-Salmonellin ScoIE1a; 5-Salmonellin ScoIE1b; 6-Salmonellin Spst.

[0128] Figure 5 A semi-quantitative evaluation of the average antimicrobial activity of salmonellins-containing plant extracts against 36 strains of Salmonella enterica subsp. enterica listed in Tables 5A and 5B is shown. Antimicrobial activity was determined by spotting using a radial diffusion assay and calculated as arbitrary units (AU) per μg of recombinant salmonellin (average of 3 independent experiments), which reflects the specific activity of salmonellins against specific strains; i.e., the specific antimicrobial potency of salmonellins was evaluated. The recombinant salmonellins tested are given as: 1-Salmonellin ScoIE2; 2-Salmonellin ScoIE3; 3-Salmonellin ScoIE7; 4-Salmonellin ScoIE1a; 5-Salmonellin ScoIE1b; 6-Salmonellin Spst.

[0129] Figure 6 Shown is a semi-quantitative evaluation of the average antimicrobial activity ratios of plant extracts containing salmonella ScolE2 against 36 Salmonella enterica subsp. enterica strains listed in Tables 5A and 5B. Antimicrobial activity was determined by spotting using a radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (mean of 3 independent experiments).

[0130] Figure 7 Shown is a semi-quantitative evaluation of the mean specific antibacterial activity of plant extracts containing salmonellin ScolE2 against 36 Salmonella enterica subsp. enterica strains listed in Tables 5A and 5B. Antibacterial activity was determined by spotting using a radial diffusion assay and calculated as arbitrary units (AU) per μg of recombinant salmonellin (mean of 3 independent experiments).

[0131] Figure 8Semi-quantitative assessment of the average antimicrobial specific activity of ScolE3-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0132] Figure 9 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE3-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0133] Figure 10 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE7-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0134] Figure 11 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE7-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0135] Figure 12 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE1 a-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0136] Figure 13 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE7-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0137] Figure 14Semi-quantitative assessment of the average antimicrobial specific activity of ScolE1 b-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0138] Figure 15 Semi-quantitative assessment of the average antimicrobial specific activity of ScolE1 b-containing plant extracts against 36 Salmonella enterica ssp. enterica strains listed in Tables 5A and 5B is shown. Antimicrobial activity was detected by spot method using radial diffusion assay and calculated as arbitrary units (AU) per mg FW plant biomass (average of 3 independent experiments).

[0139] Figure 16 A tobacco mosaic virus (TMV)-based viral vector for expression of E. coli bacteriocins used in the Examples is schematically shown. The E. coli bacteriocin expression vectors include pNMD25856, pNMD15311, pNMD25848, pNMD19141, pNMD25861 and pNMD102221 for expression of E. coli bacteriocins colS4, col5, col10, colla, collb and colM, respectively.

[0140] RB and LB represent the right and left borders of the T-DNA of the binary vector. Pact2: promoter of the Arabidopsis actin 2 gene; o: 5' end from TVCV (Tymovirus of Turnip Vein Clearing); RdRp: RNA-dependent RNA polymerase open reading frame (ORF) from cr-TMV (tobamovirus infecting crucifers); MP: movement protein ORF from cr-TMV; ColS4: E. coli bacteriocin S4 coding sequence; ColS5: E. coli bacteriocin 5 coding sequence; ColS10: E. coli bacteriocin 10 coding sequence; ColIa: E. coli bacteriocin Ia coding sequence; ColIb: E. coli bacteriocin Ib coding sequence; ColM: E. coli bacteriocin M coding sequence; N: 3'-untranslated region from cr-TMV; T: Agrobacterium nopaline synthase terminator; the white segments interrupting the grey segments in the RdRp and MP ORFs represent introns inserted in these ORFs for increasing the likelihood of RNA replicon formation in the cytoplasm of plant cells, which are described in detail in WO2005049839.

[0141] Figure 17A semi-quantitative assessment of the average antibacterial specific activity of the Salmonelin-containing plant extract against 35 Salmonella enterica subsp. enterica strains (Nos. 1 to 35) listed in Tables 5A and 5B is shown. The antibacterial activity was detected by spot method using a radial diffusion assay. The percentage of colistin-sensitive Salmonella strains for colistin (average of 3 independent experiments) is given: 1 - Colistin S4; 2 - Colistin 5; 3 - Colistin 10; 4 - Colistin la; 5 - Colistin lb; 6 - Colistin M.

[0142] Figure 18 Reduction of Salmonella enterica subsp. enterica cell population in contaminated chicken breast fillets treated with a three-component colistin mixture comprising Colistin M, Colistin la and Colistin 5 is shown. The meat was contaminated with a two-strain mixture of Salmonella enterica subsp. enterica strains of serotypes Muria and Enteritidis 14028 TM* and 13076 TM* The asterisks indicate a statistically significant difference in bacterial numbers.

[0143] Figure 19 Reduction of Salmonella enterica subsp. enterica cell population in contaminated chicken breast fillets treated with a three-component colistin mixture comprising Colistin M, Colistin la and Colistin 5 is shown. The meat was contaminated with a four-strain mixture of Salmonella enterica subsp. enterica strains of serotypes Muria, Enteritidis, Anatum and Newport 14028 TM* , 13076 TM* , 9270 TM* and 6962 TM* The asterisks indicate a statistically significant difference in bacterial numbers.

[0144] Figure 20A- C shows a multiple sequence alignment of Salmonella amino acid sequences generated using the Clustal Omega tool (Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega (201 1 Oct 1 1 ) Molecular Systems Biology 7:539). ScoIE2, ScoIE3, ScoIE7, ScoIEla, ScoIElb and Spst refer to SEQ ID NOs: 1 -6 respectively. The color code indicates the nature of the amino acid residue (red residues are AVFPMILW (small, hydrophobic and aromatic - Y); blue residues are DE (acidic); magenta residues are RK (basic) and green residues are STYHCNGQ (hydroxyl, sulfhydryl, amine and G)). The consensus symbols * (asterisk) indicate positions in the alignment that have a single, perfectly conserved residue, : (colon) indicates conservation between groups with strongly similar properties and. (period) indicates conservation between groups with weakly similar properties.

[0145] Figure 21Schematic representation of the T-DNA region of the ScoIE1b-encoding plasmid construct (pNMD35541) used for stable plant transformation. The T-DNA region consists of four expression cassettes for: 1) constitutive expression of a kanamycin-resistant transgenic plant selectable marker; 2) constitutive expression of the alcR transcriptional activator; 3) ethanol-inducible expression of the salmonin ScoIE1b; and 4) ethanol-inducible expression of TMV MP. ​​Arrows indicate the orientation of the expression cassettes. In order to strictly control the activation of the viral replicon in the non-induced state, the viral vector is disassembled into two components: the replicon and the MP (expression cassettes 3 and 4) (Werner et al. Proc. Natl. Acad. Sci. USA 108, 14061-14066 (2011). LB and RB, left and right borders of the binary vector, respectively; Tnos and Pnos, terminator and promoter of the Agrobacterium nopaline synthase gene; NPTII, neomycin phosphotransferase II; Pstls, promoter of the potato ST-LS1 gene; alcR, Aspergillus nidulans alcR ORF; Tact2, Arabidopsis actin 2 terminator; T35S, CaMV35S terminator; 3′TMV, 3′ untranslated region of TMV; RdRp, RNA-dependent RNA polymerase; pAIcA, ScoIE1b, coding sequence of salmonellin E1b (ScoIE1b); Aspergillus nidulans alcohol dehydrogenase (aIcA) promoter; MP, motor protein; Tocs terminator of the Agrobacterium tumefaciens octopine synthase gene; [ ] Deletion of MP in expression cassette 3.

[0146] Figure 22 Results are shown for inducible expression of the salmonella typhimurium ScoIE1b in stable transgenic Nicotiana benthamiana plants. Crude extracts were loaded with 3 mg of FW extracted with 2× Laemmli buffer from uninduced plant material (lanes 1, 3, 5, 7) or ethanol-induced plant material (lanes 2, 4, 6, 8) at 4 dp. (Lanes 1, 2) N. benthamiana wild-type (WT) plants, (lanes 3, 4) (lanes 5, 6) and (lanes 7, 8) various transgenic plants (ScoIE1b#4, 12, 37) representing candidates for single-copy T-DNA insertion in the T0 generation. Arrows mark recombinant proteins.

[0147] Figure 23Results of the transient expression of Salmonins in Spinacia oleracea cv are shown. Plants were syringe infiltrated with Agrobacterium carrying TMV or TMV and PVX vectors. TSP extracts were loaded with equivalent to 3 mg FW plant material extracted with 5 volumes of 150 mM NaCl. (a) Plant material was harvested at 5 dpi (days post infiltration) for ScoIElb, at 6 dpi for ScoIE3, ScoIE7 and ScoIEla or at 7 dpi for ScoIE2 or (b) plant material was harvested at 4 dpi for ScoIElb, at 5 dpi for ScolE3, ScolE7 and ScolEla, at 6 dpi for ScolE2 or (d) plant material was harvested at 8 dpi for ScoIE2, ScoIE3, ScoIE7, ScoIEla and ScoIElb. Extracts analyzed in (a, b, d) were prepared from plant material expressing ScoIE2 (lane 1), ScoIE3 (lane 2), ScoIE7 (lane 3), ScoIEla (lane 4) and ScoIElb (lane 5) or from (WT) untransfected leaf tissue. ScoIE2 and ScoIE7 were co-expressed with their respective immunizing proteins. Arrows mark recombinant proteins.

[0148] Figure 24 Bacteriocin activity profiles of Salmonins and Colicins against Salmonella enterica subsp. enterica and E. coli O157 STEC serotypes. Semi-quantitative evaluation of the antibacterial specific activity of plant extracts containing (a, c, e, g) Salmonins and (b, d, f, h) Colicins against 36 (a, e) or 35 (b, f) Salmonella enterica subsp. enterica strains listed in Table 9 or 7 E. coli O157 STEC strains (c, d, g, h) listed in Table 10 by spot method through radial diffusion assay. Mean values and STDV of N=3 and N=2 independent experiments are given in (a, b, e, f) and (c, d, g, h) respectively for the percentage of bacteriocin sensitive strains (e, f, g, h) and for the bacteriocin specific activity of all tested strains calculated in arbitrary units (AU) per pg of recombinant protein (a, b, c, d). 1 - ScolE2 (a, c, e, g) or colS4 (b, d, f, h); 2 - ScoIE3 (a, c, e, g) or col5 (b, d, f, h); 3 - ScoIE7 (a, c, e, g) or col10 (b, d, f, h); 4 - ScoIEla (a, c, e, g) or colIa (b, d, f, h); 5 - ScoIElb (a, c, e, g) or colIb (b, d, f, h); 6 - colM (b, d, f, h).

[0149] Figure 25Salmonin reduced the contamination of fresh chicken breast fillets by Salmonella enterica ssp. enterica. (a) Bacterial populations recovered from the meat after storage at 10°C for different times after contaminated meat was treated by spraying with salmin (0h black bar, initial contamination level; white bar, carrier treatment; at 1h, 24h, 48h and 72h: light grey bar, bacteriocin treatment ScolEla at a concentration of 3 mg / kg meat; grey bar, bacteriocin treatment ScolEla + ScolE1b + ScolE2 + ScolE7 at a concentration of 3+1+1+1 mg / kg meat; dark grey bar, bacteriocin treatment ScolEla + ScolE1b + ScolE2 + ScolE7 at a concentration of 0.3+0.1+0.1+0.1 mg / kg meat). Error bars represent standard deviation of biological replicates, N=4. (b) Chicken breast fillets used in (a) trimmed. DETAILED DESCRIPTION

[0150] The proteins of the application are proteins having a cytotoxic effect on Salmonella, herein referred to as "salmonins". Salmonins typically have at least one binding domain (also referred to as "receptor binding domain") which allows the salmonin to bind to a surface receptor structure of the target Salmonella cell. Salmonins also have a cytotoxic domain, which can be a catalytic domain or a pore-forming domain. Catalytic domains can have RNase or DNase catalytic activity, inhibitory activity against cell wall peptidoglycan (murein) biosynthesis, or can degrade cell wall structures of Salmonella. In addition, salmonins can have a translocation domain, which can interact with a cell membrane protein of the target Salmonella, thereby allowing the salmonin to translocate to a compartment in which the salmonin can exert its cytotoxic function.

[0151] The binding domain is important for the specificity for Salmonella and distinguishes (among others) the Salmonins from other similar Colicins. Therefore, the proteins of the present application can be defined as having at least one binding domain comprising or consisting of any of the amino acid sequence segments as defined in item (1) above. Items (a-i) to (a-v) of item (1) define the binding domains of Salmonins ScoIE2, ScoIE3, ScoIE7, ScoIEla and ScoIElb, respectively. The binding domain of Spst is comprised in the amino acid sequence segment defined in item (a-vi) of item (1). The amino acid sequences of Salmonins ScoIE2, ScoIE3, ScoIE7, ScoIEla, ScoIElb and Spst are given in SEQ ID NOs: 1 to 6, respectively. Items (b) to (d) of item (1) above define derivatives of ScoIE2, ScoIE3, ScoIE7, ScoIEla, ScoIElb and Spst, which have or contain a derivative binding domain (or amino acid sequence segment). Similarly, items (b) to (d), (B) to (E) and (a) to (d) defined below define derivatives of ScoIE2, ScoIE3, ScoIE7, ScoIEla, ScoIElb and Spst. The derivatives of ScoIE2, ScoIE3, ScoIE7, ScoIEla, ScoIElb and Spst are preferably capable of producing a cytotoxic effect on Salmonella. In the present application, Salmonins ScoIEla and ScoIElb and derivatives thereof as defined herein are preferred.

[0152] Herein, an amino acid sequence segment (or simply segment) refers to a plurality of consecutive amino acid residues of a protein or polypeptide having a number of amino acid residues which is larger than the segment. A domain is also referred to herein as "amino acid sequence segment" or simply "segment".

[0153] The proteins of the present application comprise at least a binding domain. Items (i) to (v) of each of the following items (b) to (d) define preferred binding domains. Item (vi) of each of the following items (b) to (d) (i.e. sub-items (b-vi), (c-vi) and (d-vi)) defines a preferred amino acid sequence segment which contains a binding domain and is a derivative of Salmonin Spst. The proteins of the present application preferably comprise any one of the following amino acid sequence segments:

[0154] (b-i) a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity with the segment of amino acid residues 316 to 449 of ScolE2 (SEQ ID NO: 1),

[0155] (b-ii) a segment having at least 75%, preferably 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0156] (b-iii) a segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0157] (b-iv) a segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity with the segment of amino acid residues 174 to 297 of ScoIE1a (SEQ ID NO: 4),

[0158] (bv) a segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the segment of amino acid residues 198 to 322 of ScoIE1b (SEQ ID NO: 5), or

[0159] (b-vi) a segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to a segment of at least 200 consecutive amino acid residues of Spst comprising SEQ ID NO: 6: In one embodiment, a segment having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to a segment of at least 250 consecutive amino acid residues of Spst comprising SEQ ID NO: 6; In another embodiment; In another embodiment, the protein comprises or consists of an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity to the (entire) amino acid sequence of SEQ ID NO: 6;

[0160] or (ci) a segment having at least 90%, preferably at least 95%, sequence similarity to the segment of amino acid residues 316 to 449 of ScoIE2 (SEQ ID NO: 1),

[0161] (c-ii) a segment having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity to the segment of amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0162] (c-iii) a stretch having at least 90%, preferably at least 95% sequence similarity to a stretch of amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0163] (c-iv) a stretch having at least 90%, preferably at least 95% sequence similarity to a stretch of amino acid residues 174 to 297 of ScoIE1 a (SEQ ID NO: 4),

[0164] (c-v) a stretch having at least 90%, preferably at least 95% sequence similarity to a stretch of amino acid residues 198 to 322 of ScoIE1 b (SEQ ID NO: 5), or

[0165] (c-vi) a stretch having at least 90%, preferably at least 95% sequence similarity to a stretch of at least 200 consecutive amino acid residues of Spst comprising SEQ ID NO: 6: in one embodiment, a stretch having at least 90%, preferably at least 95% sequence similarity to a stretch of at least 250 consecutive amino acid residues of Spst comprising SEQ ID NO: 6; in another embodiment, the protein comprises or consists of an amino acid sequence having at least 80%, preferably at least 90%, most preferably at least 95% sequence similarity to the (entire) amino acid sequence of SEQ ID NO: 6;

[0166] or

[0167] (d-i) a stretch having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to a stretch of amino acid residues 316 to 449 of ScoIE2 (SEQ ID NO: 1),

[0168] (d-ii) a stretch having 1 to 30, preferably 1 to 29, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to a stretch of amino acid residues 315 to 483 of ScoIE3 (SEQ ID NO: 2),

[0169] (d-iii) a stretch having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to a stretch of amino acid residues 318 to 451 of ScoIE7 (SEQ ID NO: 3),

[0170] (d-iv) a stretch having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to a stretch of amino acid residues 174 to 297 of ScoIE1 a (SEQ ID NO: 4),

[0171] (d-vi) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to a segment of at least 200 consecutive amino acid residues of Spst comprising SEQ ID NO: 6: in one embodiment, 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to a segment of at least 250 consecutive amino acid residues of Spst comprising SEQ ID NO: 6; in another embodiment, the protein comprises or consists of an amino acid sequence having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to (all) the amino acid residues of SEQ ID NO: 6.

[0172] (d-vi) a segment having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to a segment of at least 200 consecutive amino acid residues of Spst comprising SEQ ID NO: 6: in one embodiment, 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to a segment of at least 250 consecutive amino acid residues of Spst comprising SEQ ID NO: 6; in another embodiment, the protein comprises or consists of an amino acid sequence having 1 to 30, preferably 1 to 20, more preferably 1 to 15, even more preferably 1 to 10 amino acid substitutions, additions, insertions or deletions to (all) the amino acid residues of SEQ ID NO: 6.

[0173] In another embodiment, the present application provides a protein, preferably capable of a cytotoxic effect on Salmonella, wherein the amino acid sequence of the protein is as defined in any one of (a-i) to (a-vi), (b-i) to (b-vi), (c-i) to (c-vi) or (d-i) to (d-vi) above.

[0174] wherein the protein is defined herein by the number or range of numbers of amino acid substitutions, additions, insertions or deletions, which can be combined, but the given number or range of numbers refers to the total of all amino acid substitutions, additions, insertions and deletions. In the amino acid substitutions, additions, insertions or deletions, amino acid substitutions, additions and deletions are preferred. The term "insertion" refers to an insertion within the amino acid sequence of the reference sequence, i.e. excluding additions at the C- or N-terminus. The term addition refers to an addition at the C- or N-terminus of the amino acid sequence of the reference sequence. Deletion can be a deletion of terminal or internal amino acid residues of the reference sequence. Herein, the protein or any of its domains is defined by the number or range of numbers of amino acid substitutions, additions, insertions or deletions relative to the segment of the amino acid sequence shown, which in further embodiments can have 1 to several amino acid substitutions, additions, insertions or deletions relative to the segment of the amino acid sequence shown.

[0175] The cytotoxic or catalytic domain of the protein of the application can be as defined under item (3) above. In a preferred embodiment, the protein of the application comprises a cytotoxic or catalytic domain comprising or consisting of any one of the following segments of amino acid sequences:

[0176] (b-i)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0177] (b-ii)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0178] (b-iii)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0179] (b-iv)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 306 to 478 of ScoIEla (SEQ ID NO: 4),

[0180] (b-v)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0181] (b-vi)' a segment having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to the segment of amino acid residues 112 to 288 of Spst (SEQ ID NO: 6);

[0182] or

[0183] (c-i)' a segment having at least 90%, preferably at least 95% sequence similarity to the segment of amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0184] (c-ii)' a segment having at least 90%, preferably at least 95% sequence similarity to the segment of amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0185] (c-iii)' a stretch having at least 90%, preferably at least 95% sequence similarity to the stretch of amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0186] (c-iv)' a stretch having at least 90%, preferably at least 95% sequence similarity to the stretch of amino acid residues 306 to 478 of ScoIEla (SEQ ID NO: 4),

[0187] (c-v)' a stretch having at least 90%, preferably at least 95% sequence similarity to the stretch of amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0188] (c-vi)' a stretch having at least 90%, preferably at least 95% sequence similarity to the stretch of amino acid residues 112 to 288 of Spst (SEQ ID NO: 6);

[0189] (d-i)' a stretch having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to the stretch of amino acid residues 453 to 582 of ScoIE2 (SEQ ID NO: 1),

[0190] (d-ii)' a stretch having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to the stretch of amino acid residues 501 to 584 of ScoIE3 (SEQ ID NO: 2),

[0191] (d-iii)' a stretch having 1 to 20, preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to the stretch of amino acid residues 455 to 584 of ScoIE7 (SEQ ID NO: 3),

[0192] (d-iv)' a stretch having 1 to 30, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to the stretch of amino acid residues 306 to 478 of ScoIEla (SEQ ID NO: 4),

[0193] (d-v)' a stretch having 1 to 30, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions to the stretch of amino acid residues 350 to 522 of ScoIElb (SEQ ID NO: 5), or

[0194] (d-vi)' a segment having 1 to 20, preferably 1 to 15, more preferably 1 to 10, amino acid substitutions, additions, insertions, or deletions to a segment of amino acid residues 112 to 288 of Spst (SEQ ID NO: 6).

[0195] Herein, in any of the (x-y)' terms, the prime'indicates a catalytic domain or segment. The (x-y) terms lacking the prime indicate a binding domain or segment. The (x-y) terms carrying the double prime " indicate a translocation domain or segment. In the (a) to (d) terms, those of (a), (b), and (d) are preferred, and those of (a) and (d) are more preferred. Similarly, in the (a)' to (d)' terms, those of (a)', (b)', and (d)' are preferred, and those of (a)', (d)' are more preferred. Similarly, in the (a)" to (d)" terms, those of (a"), (b"), and (d") are preferred, and those of (a") and (d") are more preferred:

[0196] When the protein of the application comprises a binding domain as defined herein and a catalytic domain as defined herein, any binding domain (or segment) as defined above can be combined with any catalytic domain (or segment). In preferred embodiments, the binding domain of any of the sub-terms (i) to (vi) is combined with the catalytic domain of the sub-terms (i)' to (vi)', respectively, whereby the catalytic domain can be on the C-terminal side of the protein. In one embodiment, the binding domain of any of the terms (a) to (d) is combined with the catalytic domain of the terms (a)' to (d)', respectively, whereby the catalytic domain can be on the C-terminal side of the protein.

[0197] In certain embodiments, the protein of the application is capable of cytotoxic effects on Salmonella, and the protein comprises at least a combination of any one of the following segments of amino acid sequences, preferably in the order given from N-terminus to C-terminus of the protein:

[0198] (a-i) a segment of amino acid residues 316 to 449 from SEQ ID NO: 1 and a segment of amino acid residues 453 to 582 from SEQ ID NO: 1,

[0199] (a-ii) a segment of amino acid residues 315 to 483 from ScoIE3 of SEQ ID NO: 2 and a segment of amino acid residues 501 to 584 from SEQ ID NO: 2,

[0200] (a-iii) a segment of amino acid residues 318 to 451 from SEQ ID NO: 3 and a segment of amino acid residues 455 to 584 from SEQ ID NO: 3,

[0201] (a-iv) a segment from the segment of amino acid residues 174 to 297 of SEQ ID NO: 4 and a segment from the segment of amino acid residues 306 to 478 of SEQ ID NO: 4,

[0202] (a-v) a segment from the segment of amino acid residues 198 to 322 of SEQ ID NO: 5 and a segment from the segment of amino acid residues 350 to 522 of SEQ ID NO: 5, or

[0203] (a-vi) a segment comprising at least 200 contiguous amino acids of SEQ ID NO: 6 including the segment from the segment of amino acid residues 112 to 288 of SEQ ID NO: 6;

[0204] or (β-i) a segment having at least 75% sequence identity to the segment of amino acid residues 316 to 449 of SEQ ID NO: 1 and a segment having at least 70% sequence identity to the segment of amino acid residues 453 to 582 of SEQ ID NO: 1,

[0205] (β-ii) a segment having at least 70% sequence identity to the segment of amino acid residues 315 to 483 of SEQ ID NO: 2 and a segment having at least 70% sequence identity to the segment of amino acid residues 501 to 584 of SEQ ID NO: 2,

[0206] (β-iii) a segment having at least 77% sequence identity to the segment of amino acid residues 318 to 451 of SEQ ID NO: 3 and a segment having at least 70% sequence identity to the segment of amino acid residues 455 to 584 of SEQ ID NO: 3,

[0207] (β-iv) a segment having at least 70% sequence identity to the segment of amino acid residues 174 to 297 of SEQ ID NO: 4 and a segment having at least 70% sequence identity to the segment of amino acid residues 306 to 478 of SEQ ID NO: 4,

[0208] (β-v) a segment having at least 70% sequence identity to the segment of amino acid residues 198 to 322 of SEQ ID NO: 5 and a segment having at least 70% sequence identity to the segment of amino acid residues 350 to 522 of SEQ ID NO: 5, or

[0209] (β-vi) a segment having at least 70% sequence identity to a segment comprising at least 200 contiguous amino acid residues of SEQ ID NO: 6 including the segment having at least 70% sequence identity to the segment of amino acid residues 112 to 288 of SEQ ID NO: 6;

[0210] or

[0211] (xi) a segment having at least 85% sequence similarity to a segment from amino acid residues 316 to 449 of SEQ ID NO: 1 and a segment having at least 80% sequence similarity to a segment from amino acid residues 453 to 582 of SEQ ID NO: 1,

[0212] (xii) a segment having at least 80% sequence similarity to a segment from amino acid residues 315 to 483 of SEQ ID NO: 2 and a segment having at least 80% sequence similarity to a segment from amino acid residues 501 to 584 of SEQ ID NO: 2,

[0213] (xiii) a segment having at least 85% sequence similarity to a segment from amino acid residues 318 to 451 of SEQ ID NO: 3 and a segment having at least 80% sequence similarity to a segment from amino acid residues 455 to 584 of SEQ ID NO: 3,

[0214] (xiv) a segment having at least 80% sequence similarity to a segment from amino acid residues 174 to 297 of SEQ ID NO: 4 and a segment having at least 80% sequence similarity to a segment from amino acid residues 306 to 478 of SEQ ID NO: 4,

[0215] (xv) a segment having at least 80% sequence similarity to a segment from amino acid residues 198 to 322 of SEQ ID NO: 5 and a segment having at least 80% sequence similarity to a segment from amino acid residues 350 to 522 of SEQ ID NO: 5, or

[0216] (xvi) a segment having at least 80% sequence similarity to a segment comprising at least 200 contiguous amino acid residues of SEQ ID NO: 6 including a segment having at least 80% sequence similarity to a segment from amino acid residues 112 to 288 of SEQ ID NO: 6;

[0217] or

[0218] (d-i) a segment having 1 to 25 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 316 to 449 of SEQ ID NO: 1 and a segment having 1 to 30 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 453 to 582 of SEQ ID NO: 1,

[0219] (d-ii) a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 315 to 483 of SEQ ID NO: 2 and a segment having 1 to 30 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 501 to 584 of SEQ ID NO: 2,

[0220] (d-iii) a segment having 1 to 30 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 318 to 451 of SEQ ID NO: 3 and a segment having 1 to 30 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 455 to 584 of SEQ ID NO: 3,

[0221] (d-iv) a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 174 to 297 of SEQ ID NO: 4 and a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 306 to 478 of SEQ ID NO: 4,

[0222] (d-v) a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 198 to 332 of SEQ ID NO: 5 and a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 350 to 522 of SEQ ID NO: 5, or

[0223] (d-vi) a segment having 1 to 40 amino acid substitutions, additions, insertions, or deletions to a segment comprising at least 200 contiguous amino acid residues of SEQ ID NO: 6 including 1 to 30 amino acid substitutions, additions, insertions, or deletions to a segment from amino acid residues 112 to 288 of SEQ ID NO: 6.

[0224] All of these embodiments can be combined with the preferred values of the minimum sequence identity or similarity or the preferred combinations of amino acid substitutions, additions, insertions, or deletions to the respective segments defined herein.

[0225] Item (4) above defines the translocation domain of ScoIE2, ScoIE3, ScoIE7, ScoIEla, and ScoIEb and derivatives thereof. The definition of the translocation domain and derivatives thereof can be combined with the definition of the cytotoxic and binding domain or derivatives thereof. The definition of the translocation domain and derivatives thereof can be combined with the definition of the proteins defined specifically below.

[0226] The proteins of the application can have a binding domain (or binding segment) according to any of (a-i) to (a-vi) or according to any of the derivatives of (b-i) to (b-vi), (c-i) to (c-vi) or (d-i) to (d-vi). Any such binding domain can be combined with a catalytic / cytotoxic domain according to any of (a-i)' to (a-vi)', (b-i)' to (b-vi)', (c-i)' to (c-vi)' or (d-i)' to (d-vi)'. The domain structure of the Salmonins allows for the establishment of artificially synthesized Salmonins, wherein domains from different Salmonins of the application or derivatives thereof as defined herein are combined to form a new Salmonin (chimeric Salmonin). In such chimeric Salmonins, the natural Salmonin domain sequence of the translocation domain (if present), the binding domain and the catalytic or active domain N- to C-terminally can or can not be maintained; preferably, it is maintained. Thus, the proteins of the application comprise from N- to C-terminally a binding domain according to any of (a-i) to (a-vi) or according to any of the derivatives of (b-i) to (b-vi), (c-i) to (c-vi) or (d-i) to (d-vi) and a catalytic domain (segment) according to any of (a-i)' to (a-vi)', (b-i)' to (b-vi)', (c-i)' to (c-vi)' or (d-i)' to (d-vi)'. In a preferred embodiment, the proteins of the application comprise from N- to C-terminally a translocation domain according to any of (a-i)" to (a-v)", (b-i)" to (b-v)", (c-i)" to (c-v)" or (d-i)" to (d-v)", a binding domain according to any of (a-i) to (a-vi) or according to any of the derivatives of (b-i) to (b-vi), (c-i) to (c-vi) or (d-i) to (d-vi) and a catalytic domain (segment) according to any of (a-i)' to (a-vi)', (b-i)' to (b-vi)', (c-i)' to (c-vi)' or (d-i)' to (d-v)'.

[0227] Among the three cytotoxic activities of the Salmonellin nucleases, the pore-forming enzymes and the lysozymes (Table 1), the domains are preferably exchanged between Salmonellins having the same type of cytotoxic activity. For example, a new Salmonellin having the RNAse type of cytotoxicity can be formed from the translocation and binding domains of ScoIE2 or ScoIE7 (or derivatives of these domains) and the cytotoxic domain of ScoIE3. Preferably, however, the binding domains of sub-items (i) to (vi) are combined with the catalytic domains of sub-items (i)' to (vi)', respectively, to increase the similarity to the native Salmonellins, preferably the similarity of each of items (a) to (d). More preferably, however, the binding domains of sub-items (i) to (v) are combined with the catalytic domains of sub-items (i)' to (v)', respectively, and with the translocation domains of sub-items (i)" to (v)", respectively, preferably of any of items (a) to (d), to increase the similarity to the native Salmonellins.

[0228] The present application also provides a protein, preferably capable of a cytotoxic effect on Salmonella, comprising or consisting of the following amino acid sequence:

[0229] (A-i) SEQ ID NO: 1,

[0230] (A-ii) SEQ ID NO: 2,

[0231] (A-iii) SEQ ID NO: 3,

[0232] (A-iv) SEQ ID NO: 4,

[0233] (A-v) SEQ ID NO: 5, or

[0234] (A-vi) SEQ ID NO: 6;

[0235] or

[0236] (B-i) an amino acid sequence having at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 1,

[0237] (B-ii) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 93%, even more preferably at least 96% sequence identity with the amino acid sequence of SEQ ID NO: 2,

[0238] (B-iii) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 3,

[0239] (B-iv) an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, yet more preferably at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 4,

[0240] (B-v) an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, yet more preferably at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 5, or

[0241] (B-vi) an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, yet more preferably at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 6;

[0242] or (C-i) an amino acid sequence having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 1,

[0243] (C-ii) an amino acid sequence having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 2,

[0244] (C-iii) an amino acid sequence having at least 85%, preferably at least 90%, more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 3,

[0245] (C-iv) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 4,

[0246] (C-v) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 5, or

[0247] (C-vi) an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence similarity with the amino acid sequence of SEQ ID NO: 6; or

[0248] (D-i) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 1,

[0249] (D-ii) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 2,

[0250] (D-iii) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 3,

[0251] (D-iv) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 4,

[0252] (D-v) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 5, or

[0253] (D-vi) an amino acid sequence having 1 to 40, preferably 1 to 30, more preferably 1 to 20, and most preferably 1 to 10 amino acid substitutions, additions, insertions, or deletions, compared to the amino acid sequence of SEQ ID NO: 6,

[0254] or

[0255] (E-i) an amino acid sequence comprising or consisting of at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues of SEQ ID NO: 1,

[0256] (E-ii) an amino acid sequence comprising or consisting of at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues of SEQ ID NO: 2,

[0257] (E-iii) an amino acid sequence comprising or consisting of at least 470, preferably at least 525, more preferably at least 555 consecutive amino acid residues of SEQ ID NO: 3,

[0258] (E-iv) an amino acid sequence comprising or consisting of at least 390, preferably at least 435, more preferably at least 460 consecutive amino acid residues of SEQ ID NO: 4,

[0259] (E-v) an amino acid sequence comprising or consisting of at least 425, preferably at least 475, more preferably at least 500 consecutive amino acid residues of SEQ ID NO: 5, or

[0260] (E-vi) an amino acid sequence comprising or consisting of at least 250, preferably at least 270, more preferably at least 282 consecutive amino acid residues of SEQ ID NO: 6.

[0261] In another embodiment, the present application provides a protein, preferably capable of a cytotoxic effect on Salmonella, wherein the amino acid sequence of said protein is as defined in any one of the items (A-i) to (A-vi), (B-i) to (B-vi), (C-i) to (C-vi), (D-i) to (D-vi) or (E-i) to (E-vi).

[0262] The above definitions of proteins with respect to the complete sequences of SEQ ID NO 1 to 6 can be combined with the above protein definitions based on one or more specific domains, such as binding and / or catalytic or cytotoxic domains and / or translocation domains, if applicable.

[0263] Here, the sequence identity and similarity was determined using Align Sequence Protein BLAST (BLASTP 2.6.1+) (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: 3389-3402.).

[0264] Derivatives of the domains and / or proteins of the present application as defined above in items (b) to (d), (b)' to (d)', (b)" to (d)", or (B) to (D) or (E), although the above defined embodiments allow for sequence variations, still retain the amino acid residues as defined below. In preferred embodiments, the amino acid residues correspond to:

[0265] residue 125 of SEQ ID NO: 4 is Asn or Ser;

[0266] residue 145 of SEQ ID NO: 4 is Lys or Arg;

[0267] residue 151 of SEQ ID NO: 4 is Ala or Gly;

[0268] Residue 154 of SEQ ID NO: 4 is Ala, Ser, or Gly;

[0269] Residue 155 of SEQ ID NO: 4 is Phe, Leu, or lie;

[0270] Residue 158 of SEQ ID NO: 4 is Ala or Gly;

[0271] Residue 163 of SEQ ID NO: 4 is Glu, Asp, or Ser;

[0272] Residue 165 of SEQ ID NO: 4 is Ala, Thr, or Val;

[0273] Residue 167 of SEQ ID NO: 4 is Arg;

[0274] Residue 172 of SEQ ID NO: 4 is Thr, Ala, or Ser;

[0275] Residue 175 of SEQ ID NO: 4 is Gin;

[0276] Residue 176 of SEQ ID NO: 4 is Val or Leu;

[0277] Residue 178 of SEQ ID NO: 4 is Gin;

[0278] Residue 181 of SEQ ID NO: 4 is Glu or Asp, preferably Glu;

[0279] Residue 184 of SEQ ID NO: 4 is Arg or Gin, preferably Arg;

[0280] Residue 192 of SEQ ID NO: 4 is Ala or Thr;

[0281] Residue 195 of SEQ ID NO: 4 is Ala or Val;

[0282] Residue 196 of SEQ ID NO: 4 is Glu or Gin, preferably Glu;

[0283] Residue 198 of SEQ ID NO: 4 is Ala or Thr;

[0284] Residue 209 of SEQ ID NO: 4 is Leu or lie, preferably Leu;

[0285] Residue 273 of SEQ ID NO: 4 is Leu or lie;

[0286] Residue 280 of SEQ ID NO: 4 is Arg;

[0287] Residue 283 of SEQ ID NO: 4 is Lys;

[0288] Residue 286 of SEQ ID NO: 4 is Gin or Lys;

[0289] Residue 290 of SEQ ID NO: 4 is Ala or Thr;

[0290] Residue 299 of SEQ ID NO: 1 is Asp, Asn or Glu;

[0291] Residue 301 of SEQ ID NO: 4 is Leu;

[0292] Residue 302 of SEQ ID NO: 4 is Asn or Asp;

[0293] Residue 346 of SEQ ID NO: 4 is Asn, Asp or Glu;

[0294] Residue 363 of SEQ ID NO: 4 is Lys or Asn; or

[0295] Residue 364 of SEQ ID NO: 4 is Lys or Gin.

[0296] The term "amino acid residue corresponding to the amino acid residue of..." refers to Figure 20A the alignment indicated by the -C, and refers to the amino acid residue of SEQ ID NO: 4 or the amino acid residue of SEQ ID NOs: 1-3, 5 or 6 having the same position (i.e. written above each other) as the alignment described in the amino acid residue of SEQ ID NO: 4.

[0297] In the derivatives of ScoIE1a and ScoIE1b, and / or in the derivative domains of ScoIE1a and ScoIE1b, the same corresponding amino acid residues as in the alignment of ScoIE1a and ScoIE1b of Figure 20 can be identical to the amino acid residues in ScoIE1a and ScoIE1b; and / or corresponding to the amino acid residues that differ between ScoIE1a and ScoIE1b, some or all of these different amino acid residues can be the amino acid residues in ScoIE1a or ScoIE1b (but not the other).

[0298] In derivatives of ScoIE2 and ScoIE7, and / or in derived domains of ScoIE2 and ScoIE7, the corresponding amino acid residues that are identical to those in the alignment of ScoIE2 and ScoIE7 in Figure 20 may be the same amino acid residues in ScoIE2 or ScoIE7; and / or corresponding to the amino acid residues that are different between ScoIE2 and ScoIE7, some or all of these different amino acid residues may be amino acid residues in ScoIE2 or ScoIE7 (but not other amino acid residues).

[0299] Salmonella according to the invention may comprise additional N- or C-terminal amino acid stretches, such as purification tags, eg His tags of 6 or more consecutive histidine residues; preferably, the derivatives have no added N-terminal amino acid residues.

[0300] The protein (salmonin) of the present invention is preferably capable of producing a cytotoxic effect on Salmonella, particularly Salmonella enterica, more preferably Salmonella enterica subspecies enterica. Whether this condition is met can be tested by a radial diffusion assay using a spot method. The cytotoxicity of the test protein to Salmonella enterica is such that after spotting 5 μl of a solution of the test protein and the protein of SEQ ID NO: 1 on a soft agar plate and then incubating the agar plate at 37°C for 12 hours, the protein of SEQ ID NO: 1 produces a cytotoxic effect of the same diameter on Salmonella enterica subspecies enterica, serotype Newport strain 6962, which is not present. TM* For the spots of live bacteria, the soft agar-covered plates were plated with 0.14 ml per cm 2 1×10 7 cfu / mL of a bacterial solution of a susceptible Salmonella enterica strain, wherein the concentration of the test protein is at most 5 times that of a comparable solution of the protein of SEQ ID NO: 1. In a preferred embodiment, under otherwise identical conditions, the reference point is not the protein of SEQ ID NO: 1 but rather the protein of SEQ ID NO: 4 or 5.

[0301] The composition of the present invention comprises a protein (Salmonella) as described above and optionally other components, such as a carrier, as needed. The composition preferably comprises ScoIE1a and / or ScoIE1b or derivatives thereof as described above, and optionally other components, such as a carrier, as needed. The composition may comprise one or more different proteins (Salmonella) as defined herein, such as two, three, or four different proteins (Salmonella) as defined herein. "Different" means that the proteins differ in at least one amino acid residue. The composition may comprise two, three, or more Salmonella from the same class represented by any one of items (i) to (vi) above, or preferably, Salmonella from different classes represented by any one of items (i) to (vi) above. The composition may comprise at least a protein of class (i) and a protein of class (iv) or (v). The composition may also comprise one or more E. coli colicins or derivatives thereof, such as those described in EP3097783A1, for example, for concomitantly controlling pathogenic E. coli such as EHEC.

[0302] Since the protein of the present invention is preferably produced by expression in a plant or its cell, the composition can be a plant material or an extract thereof, wherein the plant material is from a plant with the expressed protein, preferably tobacco or an edible plant with the expressed protein. A plant material extract is an aqueous solution containing water-soluble protein, which includes the salmonellin of the present invention present or expressed in the plant material, or a dried product of this aqueous solution. The extract preferably has water-insoluble components of the plant material removed, for example, by filtration or centrifugation. The plant material can be a material of a plant selected from the group consisting of spinach, leaf beet, beetroot, carrot, beet, leafy beet, amaranth, tobacco, and / or the plant material is one or more leaves, roots, tubers or seeds, or a crushed, ground or pulverized product of the leaves, roots, tubers or seeds.

[0303] The composition or the extract from the plant material may be a solid or liquid composition, such as a solution or dispersion, containing the salmonellin. The liquid composition may be aqueous, such as an aqueous solution. The concentration of the protein in the aqueous dispersion or solution may be 0.0001-1 mg / ml, preferably 0.001-0.1 mg / ml, and more preferably 0.005-0.05 mg / ml. If more than one salmonellin capable of producing a cytotoxic effect against Salmonella is used, these concentrations are relative to the total concentration of all of these salmonellins.

[0304] In addition to the one or more salmonellins, the aqueous solution may also contain a buffer. The buffer may be an inorganic or organic acid or a salt thereof. Examples of inorganic acids are phosphoric acid or a salt thereof. Examples of organic acids are HEPES, acetic acid, succinic acid, tartaric acid, malic acid, benzoic acid, cinnamic acid, glycolic acid, lactic acid, citric acid, and ascorbic acid. Preferred organic acids are malic acid, lactic acid, citric acid, and ascorbic acid. The pH of the solution may generally be between 4 and 8, preferably between 5 and 8, and more preferably between 6.0 and 7.5. If the target of the composition is meat, the pH of the solution may generally be between 4 and 8, preferably between 4.5 and 7, more preferably between 5.0 and 6.5, and even more preferably between 5.0 and 6.0. In addition, the solution may contain an isotonic agent such as glycerol or a salt. The preferred salt used is sodium chloride. The aqueous solution containing the one or more salmonellins may be a buffered aqueous solution, which may contain additional solutes, for example, salts such as 50-400 mM NaCl, preferably 100-200 mM NaCl. The aqueous solution may further contain a sulfhydryl compound, such as dithiothreitol (DTT), dithioerythritol, thioethanol or glutathione, preferably DTT. The concentration of the total sulfhydryl compound in the aqueous solution may be 1-50 mM, preferably 2-20 mM, more preferably 4-10 mM.

[0305] If the composition of the present invention is a solid composition, it can be a powder, for example a freeze-dried solid composition obtained by freeze-drying the extract or solution described above. The powder may contain additional solid components, such as those mentioned above for the aqueous solution. Before use, it can be reconstituted with a suitable liquid such as water or a buffer. The solid composition may contain a buffer, salt or other ingredients as described above so that the concentrations given above are achieved when the solid composition is reconstituted or dissolved.

[0306] Examples of carriers for the compositions are solvents such as water or aqueous buffers (as described above), salts, sugars such as monosaccharides and disaccharides, sugar alcohols, and other carriers such as those known in pharmaceutical compositions. Examples of the latter are starch, cellulose, and other proteins such as albumin. Examples of sugars are glucose, fructose, lactose, sucrose, and maltose.

[0307] Based on the gross weight of protein in the composition, the composition of the present invention can contain at least 10 wt %, preferably at least 20 wt %, more preferably at least 30 wt %, even more preferably at least 50 wt %, even more preferably at least 75 wt % of one or more salmonellins of the present invention. The content of salmonellins in the composition can be measured by carrying out SDS-PAGE and analyzing the gel obtained after dyeing the composition, by measuring the band intensity on the gel. Therefore, the band intensity attributable to salmonellins can be determined relative to the sum of the band intensities attributable to all proteins in the composition. The total protein content in the composition can be measured using the known Bradford protein assay.

[0308] In one embodiment, the composition of the application is a pharmaceutical composition. In addition to one or more salmonellins of the application, the pharmaceutical composition can optionally contain an E. coli colicin, and / or one or more suitable pharmaceutically acceptable excipients.

[0309] The present application provides a method of preventing or reducing contamination of a target by Salmonella, comprising contacting the target with one or more proteins (salmonellins) as described above or a composition as described above. The target can be any inorganic or organic target such as the surface of a food. Contaminating a target with Salmonella means that viable Salmonella cells adhere to the target. Reducing Salmonella contamination means reducing the number of viable Salmonella cells adhering to the target. Determining contamination of a target by Salmonella is part of common general knowledge. For example, dilution plating of a solution or dispersion of homogenised food or rinsing liquid of other targets as done in the examples, followed by counting of bacterial colonies can be used. Preferably, the target is a food or animal feed. The food can be meat, such as whole carcasses of poultry, raw meat, cooked meat, minced meat, eggs such as raw eggs, whole eggs, peeled cooked eggs, scrambled eggs, raw fruit, or raw or cooked vegetables.

[0310] To treat or contact a target with a protein or composition, typically a solution of a protein as described above or a liquid composition is brought into contact with the target. For example, the target is sprayed with an aqueous solution or immersed in an aqueous solution as a composition of the application. The target is immersed in the aqueous solution for at least 10 seconds, preferably at least 1 minute, preferably at least 5 minutes. Contacting the target with a liquid composition facilitates distribution of the composition over the surface of the target. When a sufficiently even distribution can be achieved, the target can be contacted with a solid composition according to the application, for example when meat is ground.

[0311] The present invention also provides a method for treating a Salmonella infection in a subject in need thereof, comprising administering to the subject one or more proteins (salmonella) as described above or compositions as described above. The subject may be a human or a mammal, such as a farm animal. Examples of farm animals are poultry and cattle. Typically, a liquid or solid pharmaceutical composition containing the salmonella and, optionally, other ingredients as described above, is prepared for administration to an animal or human. The liquid composition may be an aqueous solution as described above. The solid composition may be a powder containing at least one salmonella, such as a lyophilized powder, or a tablet obtained from such a powder, or a capsule filled with such a powder. Administration may be oral. In this case, the pharmaceutical formulation is one that allows passage through the stomach without being attacked by the acidic media in the stomach. The salmonella should then be released from the pharmaceutical formulation in the intestine. Such pharmaceutical formulations are known in the art. Examples are tablets and capsules that are resistant to the acidic media in the stomach. Alternatively, biological substances, such as Escherichia coli or plant substances, containing expressed salmonella can be administered orally to the patient. Salmonella can be administered to adults in an amount of 1mg to 1000mg every day, preferably 10mg to 250mg every day. Such amount can also be administered to animals. In the probiotic method, the patient can be treated by administering a genetically modified microorganism expressing at least one salmonella. The genetically modified microorganism can be a genetically modified non-pathogenic Escherichia coli or a lactic acid-producing microorganism generally used for dairy fermentation. The example of a lactic acid-producing microorganism is a bacterium from the genus Lactobacillus, such as Lactobacillus lactis, and a bacterium from the genus Bifidobacterium, such as Bifidobacterium bifidum or Bifidobacterium breve. Another route of administration is by being injected into the patient's bloodstream to prevent salmonella infection. For this reason, salmonella can be dissolved in normal saline, and the solution is sterilized.

[0312] In the above method, the Salmonella is Salmonella enterica, preferably Salmonella enterica subspecies enterica.

[0313] Salmonelin ScoIEla and ScoIElb have a particularly broad activity against Salmonella, in particular Salmonella enterica, preferably Salmonella enterica subsp. enterica, of many different serovars, as demonstrated in the following examples. Thus, ScoIEla and ScoIElb or derivatives thereof are preferably used for the treatment of an infection with or for the prevention or reduction of contamination with any Salmonella enterica, preferably Salmonella enterica subsp. enterica. Salmonelin E2, E3, E7 and Spst also have a broad activity against the target Salmonella. However, ScolE2 and derivatives thereof can preferably be used against strains 1, 3, 4, 15, 20, 22 to 30 as defined in Tables 5A and 5B. ScoIE3 and derivatives thereof can preferably be used against strains 1, 3, 4, 17 and 20 to 25 as defined in Tables 5A and 5B. ScoIE7 and derivatives thereof can preferably be used against strains 1, 3, 4, 5, 15, 20, 22 to 30 and 32 as defined in Tables 5A and 5B.

[0314] The Salmonelins according to the present application can be produced in standard expression systems by known protein expression methods. For the production of a Salmonelin, the nucleotide sequence encoding it can be expressed in a suitable host organism. Methods useful for the production and purification of a protein of interest are described in the prior art and any such method can be used. For example, an E. coli expression system as known in the art can be used. If a eukaryotic expression system is used, one or more introns can be inserted into the coding sequence of the Salmonelin to prevent toxicity to the bacterial organism used for cloning.

[0315] Particularly effective expression methods are plant expression systems also known in the art. Plant expression systems that can be used to express salmonellins according to the present invention are described in the embodiments. A possible way to achieve expression of the target nucleotide sequence in plants is to use a self-replicating (virus) replicon containing the nucleotide sequence encoding salmonellins. The coding sequence of salmonellins can be codon-optimized for expression in plants or in specific plants used as expression hosts. Plant virus expression systems have been described in many publications, for example, in WO2012019660, WO2008028661, WO2006003018, WO2005071090, WO2005049839, WO2006012906, WO02101006, WO2007137788 or WO02068664, and more publications are cited in these documents. Various methods are known to be able to introduce nucleic acid molecules such as DNA molecules into plants or plant parts for transient expression. Agrobacterium can be used to transfect plants with nucleic acid molecules (vectors) or nucleic acid constructs, for example by infiltration with Agrobacterium or spraying with an Agrobacterium suspension. For reference, see WO2012019660, WO2014187571 or WO2013149726.

[0316] In the embodiment of the strong expression of salmonellin as the target protein, the nucleic acid construct containing the nucleotide sequence encoding salmonellin can be codified to replicate in the plant cell to form a viral vector replicon. In order to replicate, the viral vector and replicon can contain a replication origin, which can be recognized by the nucleic acid polymerase present in the plant cell, for example, by the viral polymerase recognition expressed by the replicon. In the case of RNA viral vectors (called "RNA replicons"), after the DNA construct is imported into the plant cell nucleus, the replicon can be transcribed from the DNA construct under the control of an active promoter in the plant cell. In the case of DNA replicons, the replicon can be formed by reorganizing between two recombination sites of the sequence flanks encoding the viral replicon in the DNA construct, for example, as described in WO00 / 17365 and WO99 / 22003. If the replicon is encoded by the DNA construct, the RNA replicon is preferably used. For many years, the use of DNA and RNA viral vectors (DNA or RNA replicons) has been widely described in the literature. Some examples are the following patent publications: WO2008028661, WO2007137788, WO2006003018, WO2005071090, WO2005049839, WO02097080, WO02088369, WO02068664. Examples of DNA viral vectors are those based on geminiviruses. For the present invention, viral vectors or replicons based on plant RNA viruses may be preferably used, particularly those based on positive-sense single-stranded RNA viruses. Thus, the viral replicon may be a positive-sense single-stranded RNA replicon. Examples of such viral vectors are those based on tobacco mosaic virus (TMV) and potexvirus X (PVX). "Based on" means that the viral vector utilizes a replication system, such as a replicase and / or other proteins involved in the replication of these viruses. Potexvirus-based viral vectors and expression systems are described in EP2061890 or WO2008 / 028661.

[0317] Salmonella can be expressed in multicellular plants or parts thereof, particularly higher plants or parts thereof. Monocotyledonous and dicotyledonous (crop) plants can be used. Common plants that can be used for expressing target protein include Nicotiana benthamiana, tobacco (Nicotiana tabacum), spinach, rape (Brassica campestris), mustard (B.juncea), beet (beet (Beta vulgaris)), celery, field mustard, mustard, strawberry, head shape quinoa (Chenopodium capitatum), lettuce, sunflower, cucumber, Chinese cabbage, cabbage, carrot, green onion, onion, radish, lettuce, pea, cauliflower, burdock, turnip, tomato, eggplant, pumpkin, watermelon, prince melon and muskmelon. Preferred plants are spinach, Swiss chard, beetroot, carrot, beet, tobacco and Nicotiana benthamiana. Expression in edible plants can be used to prevent salmonella from contaminating plants or the food prepared therefrom. In one embodiment, use a plant that does not usually enter the human or animal food chain, for example Nicotiana species, for example tobacco and Nicotiana benthamiana.

[0318] Typically, the target protein, Salmonella, is expressed in the cytoplasm of cells of a plant or plant part. In this case, no signal peptide is added to the protein to direct the target protein to a specific compartment. Alternatively, the target protein can be expressed in or targeted to plant chloroplasts; in the latter case, an N-terminal presequence, commonly referred to as a plastid transit peptide or chloroplast targeting peptide, is added to the N-terminus or C-terminus, preferably the N-terminus, of the target protein.

[0319] As described in the experimental section, salmonellins can be co-expressed with immunity proteins, especially if the salmonellin has nuclease activity, in order to prevent toxicity to plant tissues. Suitable immunity proteins that can be co-expressed are those given in Table 2 below.

[0320] In a method of producing a composition comprising at least one salmosin, in a first step, the salmosin is expressed in a plant or plant cell, such as an edible plant. In a next step, plant material containing the expressed salmosin is harvested from the plant having the expressed salmosin. The plant material can be, for example, leaves, roots, tubers or seeds, or a crushed, ground or pulverized product of leaves, roots, tubers or seeds. In step (iii), the salmosin is extracted from the plant material using an aqueous buffer. This can include homogenization of the plant material, and insoluble material can be removed by centrifugation or filtration. The soluble fraction comprising the salmosin will be extracted into the aqueous buffer to produce a salmosin solution in the aqueous buffer. The aqueous buffer can contain an inorganic or organic acid or a salt thereof, and can have a pH as defined above for the aqueous solution as a composition of the application. In addition, the aqueous buffer can contain a salt and / or a thiol compound, also as described above for the aqueous solution as a composition of the application. If a relatively pure salmosin composition is desired, the salmosin solution in the aqueous buffer can be further purified by removing unwanted components in step (iv) according to known protein purification methods.

[0321] Thus, the present application provides a method of producing a composition comprising a protein according to the present application, said method comprising the steps of:

[0322] (i) expressing said protein in a plant as described above, preferably an edible plant or tobacco,

[0323] (ii) harvesting from said plant plant material containing the expressed protein,

[0324] (iii) extracting said protein from said plant material with an aqueous buffer to obtain a composition containing said protein,

[0325] optionally removing unwanted contaminants from said composition.

[0326] If a salmosin is expressed in a plant, the plant or a tissue thereof having the expressed protein can be harvested, the tissue can be homogenized, and insoluble material can be removed by centrifugation or filtration. If a relatively pure salmosin is desired, the salmosin can be further purified by commonly known protein purification methods, for example other host cell proteins and plant metabolites such as alkaloids and polyphenols can be removed by chromatographic methods. The purified salmosin solution can be concentrated and / or lyophilized.

[0327] If a salmosin is expressed in an edible plant, a crude protein extract or a semi-purified concentrate from the edible plant can be used to prevent or reduce contamination of a target such as food by Salmonella.

[0328] Example

[0329] Example 1: Plasmid constructs (salmocins)

[0330] Six salmocins representing the four active groups were selected (Table 1)

[0331] Table 1. List of Salmonella bacteriocins (salmocins) used in the examples

[0332]

[0333] The list contains salmocins ScoIE2, ScoIE3, ScoIE7, ScoI la, ScoI lb and Spst. The respective amino acid sequences were retrieved from GenBank; the corresponding nucleotide sequences with codon usage optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. In the case of salmocins ScoIE2, ScoIE3 and ScoIE7, the coding sequence was interrupted by insertion of a cat 1 intron (first intron from the Ricinus communis cat 1 gene (GenBank: D21161.1, nucleotide positions between 679 and 867) of the catalase CAT1) to prevent cytotoxicity in E. coli cells used for cloning. The salmocin coding sequences were inserted into the TMV-based assembly virus vector pNMD035 (described in detail in WO2012 / 019660) resulting in Figure 1A - the plasmid constructs indicated in B.

[0334] In preliminary expression studies, bacteriocins with nuclease (RNase and DNase) activity were found to be generally highly toxic to the plant tissue in which they were expressed. Their expression resulted in tissue necrosis and poor accumulation of the recombinant proteins. However, co-expression with an appropriate immunizing protein reduced the toxic effect and significantly increased the accumulation of these bacteriocins. The salmocin immunizing proteins used in our studies are listed in Table 2.

[0335] Table 2. List of immunizing proteins used in the examples

[0336] No. Immune protein Specificity Accession number SEQ ID NO: 1 SImmE2 ScolE2 (DNase) KTM78571.1 7 2 SImmE7 ScolE7 (DNase) KSU39546.1 8

[0337] The immunizing proteins SImmE2 and SImmE7 were used for salmocins ScoIE2 and ScoIE7, respectively. The amino acid sequences of the immunizing proteins were retrieved from GenBank; the corresponding nucleotide sequences with codon usage optimized for Nicotiana benthamiana were synthesized by Thermo Fisher Scientific Inc. and subcloned into the PVX-based assembly virus vector pNMD670 as described in WO2012 / 019660. The resulting plasmid constructs are indicated in Figure 1A .

[0338] Example 2: Salmonicin expression screening

[0339] Diluted Agrobacterium tumefaciens cultures carrying TMV-based assembly vectors were infiltrated into six-week-old N. benthamiana plants using a needleless syringe for cytosolic salmonicin expression. In the case of salmonicins ScoIE2 and ScoIE7, Agrobacterium cultures carrying TMV-based vectors for salmonicin expression were mixed with equal proportions of other cultures carrying PVX-based vectors for expression of the corresponding immunoprotein. Each overnight culture was adjusted to OD 600 = 1.5 and further diluted 1 : 100 with infiltration buffer containing 10 mM MES, pH 5.5 and 10 mM MgS04. The plasmid constructs used in this experiment are summarized in Table 3. To determine the optimal harvest time point, plant material was harvested at several time points post-infiltration and used for protein extraction with 5 volumes of buffer containing 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20 and 300 mM NaCl. Total soluble protein (TSP) concentration was determined using the Bradford assay and TSP extracts were analyzed using SDS-PAGE with Coomassie staining. In our experiments, all tested salmonicins were expressed at fairly high levels, varying between 1.2 and 1.8 mg recombinant salmonicin / g FW or between 18-47% TSP as determined by comparison with bovine serum albumin (BSA) protein (Table 4).

[0340] Table 3. Salmonicin expression screening summary

[0341] No. Salmonelin Construct Construct (characteristics) 1 ScolE2 / SImmE2 pNMD28161 / pNMD28222 TMV / PVX 2 ScolE3 pNMD28151 TMV 3 ScolE7 / SImmE7 pNMD28172 / pNMD28232 TMV 4 ScolEla pNMD28191 TMV / PVX 5 ScolE1b pNMD28204 TMV / PVX 6 Spst pNMD28182 TMV

[0342] Table 4. Yield of recombinant salmonicins expressed in N. benthamiana plants. FW stands for fresh weight, TSP indicates total soluble protein, dpi denotes days post infiltration, AV stands for average value, SD for standard deviation, N for number of independent experiments.

[0343]

[0344] Example 3: Salmonicin activity screening

[0345] We analyzed the antibacterial activity of plant-produced recombinant salmonicins against 36 strains of 33 different serotypes of the enterica subspecies of Salmonella enterica. Detailed information on the strains used in the experiments is given in Tables 5A and 5B.

[0346] Table 5A. Salmonella enterica subsp. enterica strains used for antimicrobial activity screening.

[0347]

[0348]

[0349] Table 5B. Salmonella enterica subsp. enterica strains used for antimicrobial activity screening.

[0350]

[0351]

[0352] The antimicrobial activity of plant extracts containing recombinant salmonellins was tested by the spot method in a radial diffusion assay. To this end, we prepared agar plates covered with soft agar containing cells of the tested Salmonella strain. 15-20 ml of LB agar medium (1.5% w / v agar) was poured into a 10×10 cm quadratic Petri dish. LB soft agar medium (0.8% (w / v) agar) was melted and 20 ml aliquots were transferred to 50 ml plastic tubes and their temperature was adjusted to 50 to 55° C. The LB medium was adjusted to an OD of 1. 600 = 1.0 overnight culture of Salmonella was added to soft agar medium at a ratio of 1:100 to obtain a final OD 600 = 0.01 or approximately 1 × 10 7 1×10 cells / ml, and 20 ml of LB soft agar containing the test strain of Salmonella was poured onto the pre-cast LB plate to obtain 0.14 mL of 1×10 cells / ml per square centimeter. 7 cfu / mL of bacterial solution.

[0353] Plant leaf material was extracted as described in Example 2. We prepared 1:1 dilutions of the plant extracts starting with the undiluted samples using the same extraction buffer. 5 μl aliquots of the TSP dilution series were applied to agar plates; the plates were incubated overnight at 37°C. Antimicrobial activity was assessed based on the clearing zone.

[0354] Among the six salmonellins tested, one showed narrow antimicrobial activity (Spst – 12% of the strains were inhibited), one salmonellin had a moderate spectrum of activity (ScoIE3 – 60% of the strains were inhibited), and the other four had broad spectrums of activity: ScoIE2 and ScoIE7 – inhibited approximately 90% of the strains and ScoIEla and ScoIElb – inhibited 100% of the strains ( Figure 3 ).

[0355] Salmonicins ScoIE1 and ScoIE1 b show not only a broad but also a very high activity against the tested Salmonella strains Figure 4 , 5 ).

[0356] For semi-quantitative comparison we show the relative antibacterial activity in arbitrary units (AU) of the recombinant colicins, calculated as the dilution factor of the highest dilution of the protein extract that causes a detectable clearing effect in a radial diffusion assay. In Figure 6 , 8 , 10, 12 and 14 show the salmonicin antibacterial activity against Salmonella strains of ScoIE2, ScoIE3, ScoIE7, ScoIE1 a and ScoIE1 b, respectively, calculated in AU / mg FW plant tissue. Thus, the production of a specific active agent per unit of biomass; i.e. reflects the specific production capacity of the host.

[0357] Figure 7 , 9 , 11, 13 and 15 show the same activity calculated in AU per pg of the recombinant salmonicins ScoIE2, ScoIE3, ScoIE7, ScoIE1 a and ScoIE1 b, respectively, reflecting the antibacterial specific potency of the salmonicins.

[0358] Example 4: Plasmid constructs (colicins)

[0359] Six colicins representing two active groups were selected (Table 6). The list includes colicins coIS4, coI5, coI10, coIIa, coIIb and coIM. The corresponding amino acid sequences were retrieved from GenBank; the corresponding nucleotide sequences with codon usage optimized for Nicotiana benthamiana were synthesized by ThermoFisher Scientific Inc. The colicin coding sequences were inserted into the TMV-based assembly virus vector pNMD035 (described in detail in WO2012 / 019660) resulting in the plasmid constructs shown in Table 6. Figure 16 The coding sequence of colicin M was interrupted by insertion of the cat 1 intron (first intron of the castor cat 1 gene from the catalase CAT1 (GenBank: D21161.1, nucleotide positions between 679 and 867)).

[0360] Table 6. List of colicin E. coli bacteriocins (colicins) used in the examples.

[0361]

[0362] Example 5: Colicin expression screening

[0363] Six-week-old Nicotiana benthamiana plants were infiltrated with diluted Agrobacterium cultures carrying TMV-based assembly vectors using a needle-less syringe for cytosolic colicin expression. Overnight Agrobacterium cultures were adjusted to an OD of 600 =1.5 and further diluted 1:100 with infiltration buffer containing 10 mM MES, pH 5.5 and 10 mM MgSO4. The plasmid constructs used in this experiment are summarized in Table 7. To determine the optimal harvest time point, plant material was harvested at several time points after infiltration and used for protein extraction with 5 volumes of buffer containing 50 mM HEPES (pH 7.0), 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20 and 300 mM NaCl. Total soluble protein (TSP) concentration was determined using the Bradford assay and TSP extracts were analyzed using SDS-PAGE with Coomassie staining. In our experiments, all tested colicins were expressed at fairly high levels, varying between 1.5-4.7 mg recombinant colicin / g FW or 16-41% TSP as determined by comparison with bovine serum albumin (BSA) protein (Table 8).

[0364] Table 7. Summary of colicin expression screening

[0365] No. Colicin Construct Construct (characteristics) 1 colS4 pNMD25856 TMV 2 col5 pNMD15311 TMV 3 col10 pNMD25848 TMV 4 colIa pNMD19141 TMV 5 colIb pNMD25861 TMV 6 colM pNMD10221 TMV

[0366] Table 8. Yield of recombinant colicin expressed in Nicotiana benthamiana plants. FW stands for fresh weight, TSP stands for total soluble protein, dpi stands for days post-infiltration, AV stands for mean, SD stands for standard deviation, and N stands for the number of independent experiments.

[0367]

[0368] Example 6: Screening of colicin activity

[0369] We analyzed the antimicrobial activity of plant-produced recombinant colicins against 35 strains of 32 different serotypes of Salmonella enterica subsp. enterica. Detailed information on the strains used in our experiments is given in Tables 5A and 5B (strain numbers 1 to 35).

[0370] The antibacterial activity of plant extracts containing recombinant colicin was tested by spot method in radial diffusion assay as described in Example 3.

[0371] Among the six colicins tested, one showed narrow antimicrobial activity (coIS4 – inhibited 25% of the strains), three colicins had a moderate spectrum of activity (coI5, coI10, and coIM – inhibited 48%, 46%, and 42% of the strains, respectively), and two had a broad spectrum of activity against E. coli: coIIa and coIIb – inhibited 96% and 89% of the strains, respectively. Figure 17 ).

[0372] Example 7: Determination of the bactericidal effect of bacteriocins (colicin mixture) on pathogenic strains of Salmonella enterica subsp. enterica applied to meat matrix

[0373] Plant-produced colicins were tested for their antimicrobial activity against chicken breast samples contaminated with pathogenic Salmonella spp.

[0374] The efficacy evaluation involved analysis of pathogenic Salmonella enterica subspecies enterica on contaminated meat samples, which were subsequently treated with a mixture of plant-produced recombinant colicins or a control vehicle solution consisting of plant extracts from the same production hosts but without colicins, and the treated meat samples were stored at 4°C for different periods of time.

[0375] Meat samples of no particular origin were used to ensure that bacteriocin activity was evaluated in representative consumer products. Raw chicken breast fillets were purchased at a retail store (used for these studies, ALDI supermarket, Halle, Germany) one day before the experiment. The meat was stored at 4°C and was not washed or pretreated before the experimental exposure.

[0376] The strains were used to represent serotypes of Salmonella Typhimurium and Salmonella Enteritidis ( 9270 TM* , 13076 TM* ) or a mixture of 1:1:1:1 of two strains of Salmonella enterica subspecies enterica representing Salmonella typhimurium, Salmonella enteritidis, Newport, and Anatum ( 9270 TM* 、 13076 TM* 、 6962 TM* and 9270 TM* ) Experimental contaminated meat test matrix (respectively Figure 18 and 19 Before meat contamination, the strain was cultured alone to OD 600 =0.3 and mixed at 1:1 or 1:1:1:1. The strain mixture was further diluted with LB liquid medium to the desired cell number (OD600 = 0.005 to 0.001, 2 x 10 6 to 1.8 x 10 5 cfu / ml) as a meat contamination suspension to achieve an initial inoculum of ~2 x 10 4 cfu / g of meat. Chicken breast pieces (~25g weight of 3 pieces) were dipped into 12ml of bacterial suspension and turned over and dipped again to inoculate both sides. The contaminated meat and bacteria were allowed to dry and colonise the substrate samples respectively at room temperature for 30 minutes, during which the chicken breast pieces were turned over every 15 minutes.

[0377] Contaminated meat was treated by low pressure spraying (2-4 bar) of the carrier or E. coli mix solution (TSP extract prepared from either untreated plant material or plant material inoculated with Agrobacterium for E. coli expression, 50mM HEPES pH7.0, 10mM Potassium acetate, 5mM Magnesium acetate, 10% (v / v) Glycerol, 0.05% (v / v) Tween-200, 300mM NaCl) using a fogging bottle. For E. coli M, a recommended application rate of 3mg / kg was suggested, for any other E. coli used in the mix (E. coli la and E. coli 5), an application rate of 1mg / kg was suggested. The meat was further incubated at room temperature for 30 minutes while turning over every 15 minutes.

[0378] After 30 minutes of application of E. coli, aliquots of ~25g chicken breast pieces were placed in sterile sample bags (Whirl-Pak® 400P), operating in duplicate, the exact weight of each sample was recorded and the sample bags (Whirl-Pak® 400P) were closed using a closure clip. In total, the meat samples were incubated at room temperature for 1 hour after E. coli treatment, then the sealed meat samples were stored at 4°C. Meat samples stored at 4°C for 1 hour, 48 hours and 72 hours were sampled to determine the level of microbial contamination on the substrate. To recover pathogenic Salmonella from the meat samples, ~100ml buffered peptone water was added to each aliquot of ~25g meat sample. The samples were homogenised in a laboratory blender (Whirl-Pak® 400CC; settings: gap 0, time 30 seconds, speed 4). The microbial suspension from the filtered portion of the storage bag was collected and a 1 : 10 dilution series was prepared. 100μ1 aliquots of the undiluted or diluted microbial suspension were spread on XLD agar. The plates were incubated at 37°C for 18 to 24 hours and CFU (colony forming units) were counted. The number of CFU per g of sample was calculated as follows:

[0379] Meat samples stored at 4°C for 1 hour, 48 hours and 72 hours were sampled to determine the level of microbial contamination on the substrate. To recover pathogenic Salmonella from the meat samples, ~100ml buffered peptone water was added to each aliquot of ~25g meat sample. The samples were homogenised in a laboratory blender (Whirl-Pak® 400CC; settings: gap 0, time 30 seconds, speed 4). The microbial suspension from the filtered portion of the storage bag was collected and a 1 : 10 dilution series was prepared. 100μ1 aliquots of the undiluted or diluted microbial suspension were spread on XLD agar. The plates were incubated at 37°C for 18 to 24 hours and CFU (colony forming units) were counted. The number of CFU per g of sample was calculated as follows:

[0380] ​​

[0381] The efficacy of colicin treatment in reducing the number of viable pathogenic Salmonella in experimentally contaminated meat samples was assessed by one-way ANOVA (Tukey's multiple comparison test) and unpaired parametric t-test comparing data obtained with vehicle-treated control samples and colicin-treated samples using GraphPadPrism v.6.01.

[0382] Figure 18 and 19 The bacterial count results for contamination with two or four strains of Salmonella are shown separately. The most significant reduction in the bacterial population occurred already after 1 hour of storage following colicin treatment (1.8 logs).

[0383] In conclusion, by treating meat with the colicin cocktail, a statistically significant reduction in the Salmonella population on contaminated meat could be achieved.

[0384] Salmonella cocktails or salmonella / colicin cocktails were tested for their ability to remove Salmonella from food products and are intended for use in the food industry to reduce Salmonella contamination. Salmonella ScoIE1a and ScoIE1b exhibited the broadest antimicrobial activity against the Salmonella strains tested. Therefore, they can be used as the primary components of salmonella cocktails for Salmonella control.

[0385] Example 8: Production of Salmonella in a Stable Transgenic Host

[0386] Nicotiana benthamiana was transformed by Agrobacterium-mediated leaf disc transformation using vectors for EtOH-inducible transgene expression and induction of detached leaves of T0 transgenic plants expressing salmonellin. This was done as described in Schulz et al. Proc. Natl. Acad. Sci. USA 112, E5454-E5460 (2015).

[0387] Stable transgenic Nicotiana benthamiana plants containing a genomic insertion of a TMV-based viral vector for dual-inducible ScoIE1b expression with ethanol Figure 21 )) showed normal growth and development, and the selected transgenic lines accumulated salmonellins to the expected level after induction with ethanol ( Figure 22 ).

[0388] Example 9: Production of Salmonella in Spinach

[0389] Spinacia oleracea cv. Frühes Riesenblatt plants were grown in a greenhouse (day and night temperatures of 19 to 23 °C and 17 to 20 °C, respectively, 12 hours light and 35 to 70 % humidity). Six weeks old plants were used for syringe infiltration as described in Example 2. Expression of recombinant proteins was confirmed using SDS-PAGE with Coomassie staining Figure 23

[0390] Example 10: Extended screening for salmosin activity

[0391] We further analyzed the antibacterial activity of the recombinant salmosin produced by the plants as described in Example 6 against other Salmonella strains. To determine the salmosin antibacterial activity profile, 109 strains representing 105 serotypes of Salmonella enterica ssp. enterica were selected and screened (Table 9). The screening included one strain of each of all serotypes that caused at least 100 cases of human Salmonella infection in the United States from 2003 to 2012 as recorded by the Centers for Disease Control and Prevention (CDC) (www.cdc.gov / nationalsurveillance / pdfs / salmonella-annual-report--2013-508c.pdf), two strains of serotypes Salmonella typhimurium, Salmonella enteritidis and Salmonella javiana and 6 serotypes that caused less than 100 cases or were not reported to the CDC.

[0392] ​Table 9. List of Salmonella enterica ssp. enterica strains used for antimicrobial susceptibility analysis. Serotype antigen formula as provided by the supplier, given in (Subspecies [space] O antigen [colonic] 1 phase H antigen [colonic] 2 phase H antigen). Numbers in the source of supply correspond to 1 - Microbiologics, Inc. (St. Cloud, USA), 2 - LGC Standards (Teddington, UK), 3 - Robert Koch Institute, national reference centre for salmonellosis and other enteric pathogens (Wernigerode, Germany), 4 - Leibnitz Institute DSMZ - German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany), 5 - National Collection of Type Cultures (Salisbury, UK). Strains marked with "used for antimicrobial susceptibility test in triplicate replicates. The number of illnesses refers to laboratory-confirmed human Salmonella infections reported to CDC between 2003-2012 and published in National Enteric Disease Surveillance: Salmonella Annual Report, 2013 (CDC, June 2016; www.cdc.gov / nationalsurveillance / pdfs / salmonella-annual-report-2013-508c.pdf) (US).

[0393]

[0394]

[0395]

[0396]

[0397]

[0398] Table 10. List of E. coli STEC strains used in this study

[0399]

[0400] To assess the breadth of the activity spectrum, all strains were tested at least once, and subsequently 36 or 35 strains were screened in triplicate with salmonicin and colicin, respectively ( Figure 24 The broadest spectrum of antimicrobial activity was again identified for salmonellins ScoIE1a and ScoIE1b, which showed positive antimicrobial activity against 100% and 99% of all strains evaluated, respectively. Significant breadth of activity was also observed for salmonellins ScoIE2 (94%), ScoIE3 (70%), and ScoIE7 (95%), as shown by their Figure 24 This is reflected by the activity of a subset of 36 strains shown in e.

[0401] The five salmonellins analyzed were divided into four groups based on their ability to control the major pathogenic Salmonella strains. Salmonellins ScoIE1a and ScoIE1b were universally active, each able to kill all tested pathogenic strains and showing a 10-fold increase in activity against all tested strains. 5 The highest average activity of AU / μg recombinant protein ( Figure 24 a) and in most cases higher than 10 for each strain 3 AU / μg protein. The remaining salmonellins fell into two groups, one of which contained salmonellins ScoIE2 and ScoIE7 with 100-fold lower average activity (<10 5 AU / μg protein, Figure 24 a), while ScoIE3 in the other group showed significantly lower mean activity (10 2 AU / μg, Figure 24 a).

[0402] Compared to the high potency of salmonellins against enteropathogenic Salmonella enterica strains, the specific activities of colicins Ia, Ib, M, 5, 10, and S4 (Table 6) were 2 to 4 orders of magnitude lower (2-3 logAU / μg, Figure 24 b), although the majority of the 109 strains were inhibited by colicins Ia (92%) and Ib (90%), approximately one-third were inhibited by colicins S4 (45%), 5 (25%), 10 (29%), and M (34%), as also reflected in the susceptibility pattern of the subset of 35 strains ( Figure 24 f). Generally speaking, salmonellins showed higher and broader activity against Salmonella than E. coli colicin. In contrast, salmonellins showed low (less than 10 2 AU / μg) of interspecies specificity and narrow activity ( Figure 24 c, g).

[0403] Example 11: Salmonin ScoIEla and Salmonin mix control Salmonella on contaminated chicken meat substrate alone

[0404] The bactericidal efficacy of plant-produced Salmonin ScoIEla and Salmonin mix to control Salmonella contamination of meat surfaces was analyzed in a simulated study.

[0405] Chicken breast fillets were purchased from a local supermarket. Nalidixic acid resistant mutants of Salmonella enterica serovar Enteritidis (strain 13076 TM* ), Salmonella enterica serovar Typhimurium (strain 14028 TM* ), Salmonella enterica serovar Newport (strain 6962 TM* ), Salmonella enterica serovar Javiana (strain 10721 TM* ), Salmonella enterica serovar Heidelberg (strain 8326 TM* ), Salmonella enterica serovar Infantis (strain BAA-1675 TM* ), and Salmonella enterica serovar Muenchen (strain 8388 TM* ) were grown individually in LB medium supplemented with 25 μg / ml nalidixic acid to stationary phase, diluted in fresh LB and grown to exponential phase. For contamination of poultry meat, the bacterial cultures were diluted in LB medium to an OD 600 = 0.001 (~2 x 10 5 cfu / ml) and mixed 1 : 1 : 1 : 1 : 1 : 1 : 1. An amount of chicken breast fillets cut into pieces of ~20 g were contaminated with ~2 x 10 5A mixture of 7 Salmonella enterica strains was inoculated at a density of 1 ml CFU / ml to obtain an initial level of contamination of the meat substrate of about 3 log CFU / g of a mixture of 7 serotypes of pathogenic S. enterica; the bacteria were allowed to adhere to the meat surface for 30 minutes at room temperature. Subsequently, chicken breast pieces were treated by spraying (10 ml / kg) with a plant extract control (TSP extract of WT N. benthamiana plant material without salmosin, prepared in 50 mM HEPES pH 7.0, 10 mM potassium acetate, 5 mM magnesium acetate, 10% (v / v) glycerol, 0.05% (v / v) Tween-20, 300 mM NaCl) or salmosin solutions at a concentration of 3 mg / kg of ScoIEla, or 3 mg / kg of ScoIEla, 1 mg / kg of ScoIElb, 1 mg / kg of ScoIE2, 1 mg / kg of ScoIE7 or 0.3 mg / kg of ScoIEla, 0.1 mg / kg of ScoIElb, 0.1 mg / kg of ScoIE2 and 0.1 mg / kg of ScoIE7 (individual or mixtures of TSP extracts of N. benthamiana plant material expressing ScoIEla, ScoIElb, ScoIE2 and ScoIE7, prepared in the same buffer as the plant extract control). The treated pieces of meat were further incubated at room temperature for 30 minutes. Aliquots of ~ 40 g of meat pieces were packed in sterile bags (Interscience) and stored at 10°C for 1 h, 1 d and 3 d, which represent realistic industrial meat processing conditions that are permissive for bacterial growth but not optimal. 400P sterile bags (Interscience) and stored at 10°C for 1 h, 1 d and 3 d, which represent realistic industrial meat processing conditions that are permissive for bacterial growth but not optimal.

[0406] In summary, meat samples were incubated at room temperature for 1.5 hours during salmosin treatment, then they were sealed and stored at 10°C. To analyze the bacterial population, aliquots of poultry meat were homogenized with 4 volumes of peptone water (settings: gap 0, time 30 seconds, speed 4; Interscience) and, after plating with serial dilutions of the microbial suspension, the colony forming units (CFU) of S. enterica were counted on XLD medium (Sifin Diagnostics) supplemented with 25 pg / ml nalidixic acid. Samples were analyzed in quadruplicate.

[0407] The efficacy of salmosin treatment in reducing the number of viable pathogenic Salmonella enterica in experimentally contaminated meat samples was evaluated by two-tailed unpaired parametric t-test with 6 degrees of freedom using GraphPad Prism V.6.01 by comparing the data obtained with control samples treated with the carrier and salmosin-treated samples.

[0408] ​The efficacy of Salmonelin treatment on the reduction of the level of the pathogenic bacterial population treated with Salmonelin (individual ScoIEla at an application rate of 3 mg / kg of meat and the Salmonelin mixture composed of ScoIEla + ScoIElb + ScoIE2 + ScoIE7 at an application rate of 3+1+1+1 mg / kg of meat, respectively) was evaluated, finding a statistically significant net reduction of both the meat samples and the viable bacteria count in 2-3 log CFU / g of meat at all the analyzed time points associated with the plant extract control treatment Figure 25 ). The highest level of reduction of the bacterial population was observed with the four Salmonelin mixture (at a concentration of 3+1+1+1 mg / kg of meat), reaching an average log reduction of 3.39 compared to the carrier treatment after 48 hours of storage, which corresponds to a 99.6% average reduction of the bacteria. The single Salmonelin ScoIEla (applied at 3 mg / kg of meat) was able to control Salmonella contamination on meat with an effect similar to the mixture of four Salmonelins applied at double concentration (6 mg / kg of meat total Salmonelin). Even with very low doses of Salmonelin (total Salmonelin 0.6 mg / kg of meat; mixture of ScoIEla + ScoIElb + ScoIE2 + ScoIE7, 0.3+0.1+0.1+0.1 mg / kg of meat) a statistically significant reduction of the bacterial population was produced, of approximately 1 log CFU at 48 hours of maximum storage. After the initial reduction of the bacterial contamination, a regrowth of the viable bacteria was observed after 72 hours, indicating that Salmonelin acts rapidly but has no long-term technical effect on food.

[0409] Example 12: Plant correct expression of recombinant Salmonelin

[0410] The primary structure of the plant-expressed recombinant Salmonelin contained in the plant TSP extract, including post-translational modifications, was analyzed by matrix-assisted laser desorption / ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS).

[0411] For proteolytic digestion, TSP extracts prepared from plant material expressing salmosin using 5 volumes of 20 mM sodium citrate, 20 mM NaH2PO4, 30 mM NaCl, pH 5.5 were subjected to SDS-PAGE and Coomassie-stained SDS gel bands containing 5 μg of protein were excised and destained by successive washings with 100 mM NH4HCO3and 100 mM NH4HCO3in acetonitrile (ACN) / H2O (50; 50, v / v). Disulfide bonds were reduced with 10 mM DTT for 45 min at 50°C followed by alkylation with 10 mg / ml iodoacetamide for 60 min. The destained and alkylated gel bands were then subjected to proteolytic digestion with different sequencing grade endoproteases (Promega, Madison, USA). The protease:protein ratio was adjusted to 1 :20 (w / w) in the digestion solution and the digestion was performed for 12 h at 25°C (chymotrypsin) or 37°C (Asp-N, Glu-C, Lys-C, trypsin). Proteolytic peptides were extracted by successive washings with H2O, ACN / H2O / trifluoroacetic acid (50; 45; 5, v / v / v) and ACN, respectively. The extraction solutions were pooled, concentrated in a vacuum centrifuge and re-dissolved in H2O / acetic acid (90; 10, v / v).

[0412] The proteolyzed salmosin peptides obtained as described above or the purified intact plant-produced salmosin ScoIEla, ScoIElb and ScoIE7 proteins were purified by solid phase extraction using C4 or C18 bonded silica material (Bond Elut® Millipore, Darmstadt, Germany) for mass spectrometric analysis and the elution solution was co-crystallized with 2,5-dihydroxyphenylacetone and 2,5-dihydroxybenzoic acid matrix (Bruker Daltonics, Bremen, Germany) on MALDI ground steel targets.

[0413] Mass spectra were obtained on a MALDI-TOF / TOF mass spectrometer (Autoflex Speed™, Bruker Daltonics, Bremen, Germany) with linear mode positive polarity for molecular weight determination and reflector mode for protein sequencing by In-source decay (ISD) analysis. The matrix crystals were irradiated with a Nd:YAG laser (Smartbeam-IITM, Bruker Daltonics, Bremen, Germany) at an emission wavelength of 355 nm and a pulse rate of 1 kHz was set.

[0414] MS and MS / MS spectra were recorded by accumulating at least 5000 or 10000 laser shots per sample spot, respectively, with flexControl (version 3.4, Bruker Daltonics, Bremen, Germany). The laser energy was set to slightly above the threshold for the MS experiment and to maximum for the MS / MS analysis. Spectra processing was performed with flexAnalysis (version 3.4, Bruker Daltonics, Bremen, Germany) by applying baseline subtraction with the TopHat algorithm, smoothing with the Savitzky-Golay algorithm and peak detection with the SNAP algorithm.

[0415] The mass spectrometer was calibrated using a set of standard peptides and proteins with known mass (Peptide Calibration Standard II, Protein Calibration Standard I and II, Bruker Daltonics, Bremen, Germany).

[0416] The determination of the complete molecular weight is based on the mass-to-charge ratio (m / z) of single and multiple charged molecular ions.

[0417] Sequencing of the protein termini was performed by ISD analysis. The annotation of the ISD fragmentation spectra was performed with BioTools (version 3.2, Bruker Daltonics, Bremen, Germany) by computer generated m / z values of fragment ions and comparison with the m / z values of fragment signals observed in the obtained ISD spectra. This approach enabled the identification of the terminal amino acid sequence as well as the modification of the present application.

[0418] For protein sequencing analysis, only fragmentation (MS / MS) spectra were used to identify proteolytic peptides and were annotated with PEAKS Studio (version 7.5, Bioinformatics Solutions Inc., Waterloo, Canada). The identification of proteins and the verification of their amino acid sequence was performed by searching the MS / MS data against the NCBI nr database and the UniProt / SwissProt database supplemented with Salmonella sequences, respectively. Database searches were performed with a parent mass error tolerance of 50 ppm and a fragment mass error tolerance of 0.5 Da. The maximum number of missed cleavages as well as post-translational modifications of one proteolytic fragment was set to 3. Non-specific cleavages were allowed at both protein termini.

[0419] The search results for each MS / MS data set of proteolytic peptides of salmonellins against the UniProt / SwissProt database confirmed the characteristics of each analyzed salmonellin (Table 11). The integrity of the purified salmonellins ScoIE1a, ScoIE1b and ScoIE7 was further analyzed by MS-based protein terminal sequencing using ISD and molecular weight determination methods, which confirmed that all salmonellin proteins were intact after plant expression. The observed post-translational modifications were limited to cleavage of the N-terminal methionine in the case of ScoIE2, ScoIE7, ScoIE1a and ScoIE1b, and N-terminal acetylation of ScoIE7 and ScoIE1a (Table 11).

[0420] Table 11. Characterization and integrity of plant-derived salmonellins. MALDI-TOF / TOF mass spectrometry analysis of salmonellin-containing TSP extracts of Nicotiana benthamiana or purified Salmonella enterica was performed by peptide mass fingerprinting or protein-terminal sequencing by in-source decay and molecular weight determination, respectively. The proteases used to generate peptide fragments are shown. The identity of the salmonellins was confirmed by searching the MS / MS dataset obtained against the NCBI non-redundant database. The molecular weights obtained indicate that the proteins are intact. ND, not detected; PTM post-translational modification; aa, amino acid sequence.

[0421]

[0422]

[0423] European Patent Application No. 17162784.7 from which priority is claimed is incorporated herein by reference including its entire specification, claims and drawings.

[0424] Amino acid and nucleotide sequences

[0425] SEQ ID NO:1 Amino acid sequence of Salmonella ScolE2

[0426]

[0427] SEQ ID NO:2 Amino acid sequence of Salmonella ScolE3

[0428]

[0429] SEQ ID NO: 3 Amino acid sequence of Salmonella ScolE7

[0430]

[0431]

[0432] SEQ ID NO: 4 Amino acid sequence of Salmonin ScolE1 a

[0433]

[0434] SEQ ID NO: 5 Amino acid sequence of Salmonin ScolE1 b

[0435]

[0436] SEQ ID NO: 6 Amino acid sequence of Salmonin Spst

[0437]

[0438] SEQ ID NO: 7 Amino acid sequence of Salmonin ScoIE2 immunoprotein SImmE2

[0439]

[0440] SEQ ID NO: 8 Amino acid sequence of Salmonin ScoIE7 immunoprotein SImmE7

[0441]

[0442] SEQ ID NO: 9 Amino acid sequence of Colicin S4

[0443]

[0444] SEQ ID NO: 10 Amino acid sequence of Colicin 5

[0445]

[0446]

[0447] SEQ ID NO: 11 Amino acid sequence of Colicin 10

[0448] SEQ ID NO: 12 Amino acid sequence of Colicin Ia

[0449] SEQ ID NO: 13 Amino acid sequence of Colicin Ib

[0450]

[0451] SEQ ID NO: 14 Amino acid sequence of Colicin M

[0452]

[0453] SEQ ID NO: 15 nucleotide sequence for Salmonetin ScoIE2 expression in the example

[0454]

[0455]

[0456] SEQ ID NO: 16 nucleotide sequence for Salmonetin ScoIE3 expression in the example

[0457]

[0458]

[0459] SEQ ID NO: 17 nucleotide sequence for Salmonetin ScoIE7 expression in the example

[0460]

[0461]

[0462] SEQ ID NO: 18 nucleotide sequence for Salmonetin ScoIEla expression in the example

[0463]

[0464]

[0465] SEQ ID NO: 19 nucleotide sequence for Salmonetin ScoIElb expression in the example

[0466]

[0467]

[0468] SEQ ID NO: 20 nucleotide sequence for Salmonetin Spst expression in the example

[0469]

[0470] SEQ ID NO: 21 nucleotide sequence for Salmonetin ScoIE2 immunoprotein SImmE2 expression in the example

[0471]

[0472] SEQ ID NO: 22 nucleotide sequence of a binary TMV-based vector for expression of Salmonin ScoIE7 immunizing protein SImmE7 in the example

[0473]

[0474]

[0475] SEQ ID NO: 23 nucleotide sequence of a binary TMV-based vector for expression of Salmonin ScoIEa in the example

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484] SEQ ID NO: 24 nucleotide sequence of a binary PVX-based vector for expression of Salmonin ScoIE2 immunizing protein ImmScoIE2 in the example

[0485]

[0486]

[0487]

[0488]

[0489]

[0490]

[0491] SEQUENCE LISTING <110> Nomad Bioscience GmbH <120> Bacteriocins for control of Salmonella enterica <130> PCT-17317 <150> EP 17 162 784.7 <151> 2017-03-24 <160> 24 <170> PatentIn version 3.5 <210> 1 <211> 583 <212> PRT <213> Salmonella enterica <400> 1 Met Ser Gly Gly Asp Gly lie Gly His Asn Ser Gly Ala His Ser Thr 1 5 10 15 Gly Gly Val Asn Gly Ser Ser Ser Gly Arg Gly Gly Ser Ser Ser Gly 20 25 30 Gly Gly Asn Asn Pro Asn Ser Gly Pro Gly Trp Gly Thr Thr His Thr 35 40 45 Pro Asp Gly His Asp lie His Asn Tyr Asn Pro Gly Glu Phe Gly Gly 50 55 60 Gly Gly His Lys Pro Gly Gly Asn Gly Gly Asn His Ser Gly Gly Thr 65 70 75 80 Gly Asp Gly Gin Pro Pro Gly Ala Ala Met Ala Phe Gly Phe Pro Ala 85 90 95 Leu Val Pro Ala Gly Ala Gly Gly Leu Ala Val Thr Val Ser Gly Asp 100 105 110 Ala Leu Ala Ala Ala Ile Ala Asp Val Leu Ala Val Leu Lys Gly Pro 115 120 125 Phe Lys Phe Gly Ala Trp Gly Ile Ala Leu Tyr Gly Ile Leu Pro Thr 130 135 140 Glu Ile Ala Lys Asp Asp Pro Arg Met Met Ser Lys Ile Val Thr Ser 145 150 155 160 Leu Pro Ala Asp Ala Val Thr Glu Ser Pro Val Ser Ser Leu Pro Leu 165 170 175 Asp Gln Ala Thr Val Ser Val Thr Lys Arg Val Thr Asp Val Val Lys 180 185 190 Asp Glu Arg Gln His Ile Ala Val Val Ala Gly Val Pro Ala Ser Ile 195 200 205 Pro Val Val Asp Ala Lys Pro Thr Thr His Pro Gly Val Phe Ser Val 210 215 220 Ser Val Pro Gly Leu Pro Asp Leu Gln Val Ser Thr Val Lys Asn Ala 225 230 235 240 Pro Ala Met Thr Ala Leu Pro Arg Gly Val Thr Asp Glu Lys Asp Arg 245 250 255 Thr Val His Pro Ala Gly Phe Thr Phe Gly Gly Ser Ser His Glu Ala 260 265 270 Val Ile Arg Phe Pro Lys Glu Ser Gly Gin Ala Pro Val Tyr Val Ser 275 280 285 Val Thr Asp Val Leu Thr Pro Glu Gin Val Lys Gin Arg Gin Asp Glu 290 295 300 Glu Asn Arg Arg Gin Gin Glu Trp Asp Ala Thr His Pro Val Glu Val 305 310 315 320 Ala Glu Arg Asn Tyr Arg Leu Ala Ser Asp Glu Leu Asn Arg Ala Asn 325 330 335 Val Asp Val Ala Gly Lys Gin Glu Arg Gin He Gin Ala Ala Gin Ala 340 345 350 Val Ala Ala Arg Lys Gly Glu Leu Asp Ala Ala Asn Lys Thr Phe Ala 355 360 365 Asp Ala Lys Glu Glu He Lys Lys Phe Glu Arg Phe Ala His Asp Pro 370 375 380 Met Ala Gly Gly His Arg Met Trp Gin Met Ala Gly Leu Lys Ala Gin 385 390 395 400 Arg Ala Gin Asn Glu Val Asn Gin Lys Gin Ala Glu Phe Asn Ala Ala 405 410 415 Glu Lys Glu Lys Ala Asp Ala Asp Ala Ala Leu Asn Val Ala Leu Glu 420 425 430 Ser Arg Lys Gin Lys Glu Gin Lys Ala Lys Asp Ala Ser Asp Lys Leu 435 440 445 Asp Lys Glu Asn Lys Arg Asn His Pro Gly Lys Ala Thr Gly Lys Gly 450 455 460 Gln Pro Val Gly Asp Lys Trp Leu Glu Asp Ala Gly Lys Glu Ala Gly 465 470 475 480 Ala Pro Val Pro Asp Arg He Ala Asp Lys Leu Arg Asp Lys Glu Phe 485 490 495 Lys Asn Phe Asp Asp Phe Arg Lys Lys Phe Trp Glu Glu Val Ser Lys 500 505 510 Asp Pro Glu Leu Ser Lys Gin Phe He Pro Gly Asn Lys Lys Arg Met 515 520 525 Ser Gin Gly Leu Ala Pro Arg Ala Arg Asn Lys Asp Thr Val Gly Gly 530 535 540 Arg Arg Ser Phe Glu Leu His His Asp Lys Pro He Ser Gin Asp Gly 545 550 555 560 Gly Val Tyr Asp Met Asp Asn He Arg Val Thr Thr Pro Lys Leu His 565 570 575 He Asp He His Arg Gly Lys 580 <210> 2 <211> 587 <212> PRT <213> Salmonella enterica <400> 2 Met Ser Gly Gly Asp Gly Arg Gly His Asn Thr Gly Ala His Ser Thr 1 5 10 15 Ser Gly Asn Ile Asn Gly Gly Pro Thr Gly Leu Gly Val Ser Gly Gly 20 25 30 Ala Ser Asp Gly Ser Gly Trp Ser Ser Glu Asn Asn Pro Trp Gly Gly 35 40 45 Gly Ser Gly Ser Gly Ile His Trp Gly Gly Gly Ser Gly Arg Gly Asn 50 55 60 Gly Gly Gly Asn Gly Asn Ser Gly Gly Gly Ser Gly Thr Gly Gly Asn 65 70 75 80 Leu Ser Ala Val Ala Ala Pro Val Ala Phe Gly Phe Pro Ala Leu Ser 85 90 95 Thr Pro Gly Ala Gly Gly Leu Ala Val Ser Ile Ser Ala Ser Glu Leu 100 105 110 Ser Ala Ala Ile Ala Gly Ile Ile Ala Lys Leu Lys Lys Val Asn Leu 115 120 125 Lys Phe Thr Pro Phe Gly Val Val Leu Ser Ser Leu Ile Pro Ser Glu 130 135 140 Ile Ala Lys Asp Asp Pro Asn Met Met Ser Lys Ile Val Thr Ser Leu 145 150 155 160 Pro Ala Asp Asp Ile Thr Glu Ser Pro Val Ser Ser Leu Pro Leu Asp 165 170 175 Lys Ala Thr Val Asn Val Asn Val Arg Val Val Asp Asp Val Lys Asp 180 185 190 Glu Arg Gln Asn Ile Ser Val Val Ser Gly Val Pro Met Ser Val Pro 195 200 205 Val Val Asp Ala Lys Pro Thr Glu Arg Pro Gly Val Phe Thr Ala Ser 210 215 220 Ile Pro Gly Ala Pro Val Leu Asn Ile Ser Val Asn Asn Ser Thr Pro 225 230 235 240 Ala Val Gln Thr Leu Ser Pro Gly Val Thr Asn Asn Thr Asp Lys Asp 245 250 255 Val Arg Pro Ala Gly Phe Thr Gln Gly Gly Asn Thr Arg Asp Ala Val 260 265 270 Ile Arg Phe Pro Lys Asp Ser Gly His Asn Ala Val Tyr Val Ser Val 275 280 285 Ser Asp Val Leu Ser Pro Asp Gln Val Lys Gln Arg Gln Asp Glu Glu 290 295 300 Asn Arg Arg Gin Gin Glu Trp Asp Ala Thr His Pro Val Glu Val Ala 305 310 315 320 Glu Arg Glu Tyr Glu Asn Ala Arg Ala Glu Leu Glu Ala Glu Asn Lys 325 330 335 Asn Val His Ser Leu Gin Val Ala Leu Asp Gly Leu Lys Asn Thr Ala 340 345 350 Glu Gly Leu Ala Leu Ser Asp Ala Gly Arg His Pro Leu Thr Ser Ser 355 360 365 Glu Ser Arg Phe Val Ala Val Pro Gly Tyr Ser Gly Gly Gly Val His 370 375 380 Phe Asp Ala Thr Ala Thr Val Asp Ser Arg Asp Arg Leu Asn Ser Leu 385 390 395 400 Leu Ser Leu Gly Gly Ala Ala Tyr Val Asn Asn Val Leu Glu Leu Gly 405 410 415 Glu Val Ser Ala Pro Thr Glu Asp Gly Leu Lys Val Gly Asn Ala Ile 420 425 430 Lys Asn Ala Met Ile Glu Val Tyr Asp Lys Leu Arg Gin Arg Leu Ile 435 440 445 Thr Arg Gin Asn Glu Ile Asn His Ala Gin Val Ser Leu Asn Thr Ala 450 455 460 Ile Glu Ser Arg Asn Lys Lys Glu Glu Lys Lys Arg Ser Ala Glu Asn 465 470 475 480 Lys Leu Asn Glu Glu Arg Asn Lys Pro Arg Lys Gly Thr Lys Asp Tyr 485 490 495 Gly His Asp Tyr His Pro Ala Pro Glu Thr Glu Glu Ile Lys Gly Leu 500 505 510 Gly Asp Ile Lys Lys Gly Ile Pro Lys Thr Pro Lys Gln Asn Gly Gly 515 520 525 Gly Lys Arg Lys Arg Trp Ile Gly Asp Lys Gly Arg Lys Ile Tyr Glu 530 535 540 Trp Asp Ser Gln His Gly Glu Leu Glu Gly Tyr Arg Ala Ser Asp Gly 545 550 555 560 Gln His Leu Gly Ser Phe Asp Pro Lys Thr Gly Lys Gln Leu Lys Gly 565 570 575 Pro Asp Pro Lys Arg Asn Ile Lys Lys Tyr Leu 580 585 <210> 3 <211> 585 <212> PRT <213> Salmonella enterica <400> 3 Met Ser Gly Gly Asp Gly lie Gly His Asn Ser Gly Ala His Ser Thr 1 5 10 15 Gly Gly Val Asn Gly Ser Ser Ser Gly Ser Gly Gly Ser Ser Ser Gly 20 25 30 Ser Gly Asn Asn Pro Asn Ser Gly Pro Gly Trp Gly Thr Thr His Thr 35 40 45 Pro Asn Gly Asp lie His Asn Tyr Asn Pro Gly Glu Phe Gly Gly Gly 50 55 60 Gly Asn Lys Pro Gly Gly His Gly Gly Asn Ser Gly Asn His Asp Gly 65 70 75 80 Ser Ser Gly Asn Gly Gin Pro Ser Ala Ala Pro Met Ala Phe Gly Phe 85 90 95 Pro Ala Leu Ala Pro Ala Gly Ala Gly Ser Leu Ala Val Thr Val Ser 100 105 110 Gly Glu Ala Leu Ser Ala Ala lie Ala Asp lie Phe Ala Ala Leu Lys 115 120 125 Gly Pro Phe Lys Phe Gly Ala Trp Gly lie Ala Leu Tyr Gly lie Met 130 135 140 Pro Thr Glu lie Ala Lys Asp Asp Pro Asn Met Met Ser Lys lie Met 145 150 155 160 Thr Ser Leu Pro Ala Asp Thr Val Thr Asp Thr Pro Val Ser Ser Leu 165 170 175 Pro Leu Asp Gln Ala Thr Val Ser Val Thr Lys Arg Val Ala Asp Val 180 185 190 Val Lys Asp Glu Arg Gin His He Ala Val Val Ala Gly Val Pro Met 195 200 205 Ser Val Pro Val Val Asp Ala Lys Pro Thr Thr Arg Pro Gly He Phe 210 215 220 Ser Ala Thr Val Pro Gly Leu Pro Ala Leu Glu Val Ser Thr Gly Lys 225 230 235 240 Ser He Pro Ala Ser Thr Ala Leu Pro Arg Gly He Thr Glu Asp Lys 245 250 255 Asp Arg Thr Glu His Pro Ala Gly Phe Thr Phe Gly Gly Ser Ser His 260 265 270 Asp Ala Val He Arg Phe Pro Lys Glu Ser Gly Gin Ala Pro Val Tyr 275 280 285 Val Ser Val Thr Asp Val Leu Thr Pro Glu Gin Val Lys Gin Arg Gin 290 295 300 Asp Glu Glu Ser Arg Arg Gin Gin Glu Trp Asp Ala Thr His Pro Val 305 310 315 320 Glu Val Ala Glu Arg Asn Tyr Arg Leu Ala Ser Asp Glu Leu Asn Arg 325 330 335 Val Asn Ala Asp Val Ala Gly Lys Gln Glu Arg Gln Ala Gln Ala Gly 340 345 350 Gln Ala Val Ala Ala Arg Lys Gly Glu Leu Asp Ala Ala Asn Lys Thr 355 360 365 Phe Ala Asp Ala Lys Glu Glu Ile Lys Lys Phe Glu His Phe Ala Arg 370 375 380 Asp Pro Met Ala Gly Gly His Arg Met Trp Gln Met Ala Gly Leu Lys 385 390 395 400 Ala Gln Arg Ala Gln Asn Glu Val Asn Gln Lys Gln Ala Glu Phe Asp 405 410 415 Ala Ala Glu Lys Glu Lys Ala Asp Ala Asp Ala Ala Leu Asn Ala Ala 420 425 430 Leu Glu Ser Arg Lys Gln Lys Glu Gln Lys Ala Lys Asp Thr Lys Glu 435 440 445 Arg Leu Asp Lys Glu Asn Lys Arg Asn Gln Pro Gly Lys Ala Thr Gly 450 455 460 Lys Gly Gln Pro Val Ser Asp Lys Trp Leu Glu Asp Ala Gly Lys Glu 465 470 475 480 Ser Gly Ser Pro Ile Pro Asp Ser Ile Ala Asp Lys Leu Arg Asp Lys 485 490 495 Glu Phe Arg Asn Phe Asp Asp Phe Arg Lys Lys Phe Trp Glu Glu Val 500 505 510 Ser Lys Asp Pro Glu Leu Ser Lys Gln Phe Ile Lys Gly Asn Arg Asp 515 520 525 Arg Met Gln Val Gly Lys Ala Pro Lys Ser Arg Lys Lys Asp Ala Ala 530 535 540 Gly Lys Arg Thr Ser Phe Glu Leu His His Asp Lys Pro Val Ser Gln 545 550 555 560 Asp Gly Gly Val Tyr Asp Met Asp Asn Leu Arg Ile Thr Thr Pro Lys 565 570 575 Arg His Ile Asp Ile His Arg Gly Gln 580 585 <210> 4 <211> 483 <212> PRT <213> Salmonella enterica <400> 4 Met Ala Asp Asn Thr Ile Ala Tyr Tyr Glu Asp Gly Val Pro His Ser 1 5 10 15 Ala Asp Gly Lys Val Val Ile Val Ile Asp Gly Lys Met Pro Val Asp 20 25 30 Thr Gly Ala Gly Gly Thr Gly Gly Gly Gly Gly Gly Lys Val Gly Gly 35 40 45 Thr Ser Glu Ser Ser Ala Ala Ile His Ala Thr Ala Lys Trp Ser Thr 50 55 60 Ala Gln Leu Lys Lys Thr Leu Ala Glu Lys Ala Ala Arg Glu Arg Glu 65 70 75 80 Thr Ala Ala Ala Met Ala Ala Ala Lys Ala Lys Arg Asp Ala Leu Thr 85 90 95 Gln His Leu Lys Asp Ile Val Asn Asp Val Leu Arg His Asn Ala Ser 100 105 110 Arg Thr Pro Ser Ala Thr Asp Leu Ala His Ala Asn Asn Met Ala Met 115 120 125 Gln Ala Glu Ala Gln Arg Leu Gly Arg Ala Lys Ala Glu Glu Lys Ala 130 135 140 Arg Lys Glu Ala Glu Ala Ala Glu Leu Ala Phe Gln Glu Ala Glu Arg 145 150 155 160 Gln Arg Glu Glu Ala Val Arg Gln Leu Ala Glu Thr Glu Arg Gln Leu 165 170 175 Lys Gln Ala Glu Glu Glu Lys Arg Leu Ala Ala Leu Ser Asp Glu Ala 180 185 190 Arg Ala Val Glu Asn Ala Arg Lys Asn Leu Asp Thr Ala Lys Ser Glu 195 200 205 Leu Ala Asn Val Asp Ser Asp Ile Glu Arg Gln Arg Ser Gln Leu Ser 210 215 220 Ser Leu Asp Ala Asp Val Lys Lys Ala Glu Glu Asn Leu Arg Leu Thr 225 230 235 240 Met Arg Ile Lys Gly Arg Ile Gly Arg Lys Met Gln Ala Lys Ser Gln 245 250 255 Ala Ile Val Asp Asp Lys Lys Arg Ile Tyr Ser Asp Ala Glu Asn Val 260 265 270 Leu Asn Thr Met Thr Val Asn Arg Asn Leu Lys Ala Gln Gln Val Thr 275 280 285 Asp Ala Glu Asn Glu Leu Lys Val Ala Ile Asp Asn Leu Asn Ser Ser 290 295 300 Gln Met Lys Asn Ala Val Asp Ala Thr Val Ser Phe Tyr Gln Thr Leu 305 310 315 320 Thr Glu Lys Tyr Gly Glu Lys Tyr Ser Leu Ile Ala Gln Glu Leu Ala 325 330 335 Glu Lys Ser Lys Gly Lys Lys Ile Gly Asn Val Asp Glu Ala Leu Ala 340 345 350 Ala Phe Glu Lys Tyr Lys Asp Val Leu Asp Lys Lys Phe Ser Lys Ala 355 360 365 Asp Arg Asp Ala Ile Val Asn Ala Leu Lys Ser Phe Asn Tyr Asp Asp 370 375 380 Trp Ala Lys His Leu Asp Gln Phe Ala Lys Tyr Leu Lys Ile Thr Gly 385 390 395 400 His Val Ser Phe Gly Tyr Asp Val Val Ser Asp Val Leu Lys Ala Ser 405 410 415 Glu Thr Gly Asp Trp Lys Pro Leu Phe Ile Thr Leu Glu Gln Lys Val 420 425 430 Leu Asp Thr Gly Met Ser Tyr Leu Val Val Leu Met Phe Ser Leu Ile 435 440 445 Ala Gly Thr Thr Leu Gly Ile Phe Gly Val Ala Ile Ile Thr Ala Ile 450 455 460 Leu Cys Ser Phe Val Asp Lys Tyr Ile Leu Asn Ala Leu Asn Asp Ala 465 470 475 480 Leu Gly Ile <210> 5 <211> 527 <212> PRT <213> 肠道沙门氏菌(Salmonella enterica) <400> 5 Met Ser Asp Asn Thr Ile Ala Tyr Tyr Glu Asp Gly Val Pro Tyr Ser 1 5 10 15 Ala Asp Gly Gln Val Val Ile Val Ile Asp Gly Lys Met Pro Val Asp 20 25 30 Thr Gly Ala Gly Gly Thr Gly Gly Gly Gly Gly Gly Lys Val Gly Gly 35 40 45 Thr Ser Glu Ser Ser Ala Ala Ile His Ala Thr Ala Lys Trp Ser Lys 50 55 60 Ala Gln Leu Gln Lys Ser Leu Glu Glu Lys Ala Ala Arg Glu Arg Glu 65 70 75 80 Thr Ala Ala Ala Met Ala Ala Ala Lys Ala Lys Arg Asp Ala Leu Thr 85 90 95 Gln His Leu Lys Asp Ile Val Asn Asp Val Leu Arg Tyr Asn Ala Ser 100 105 110 Arg Thr Pro Ser Ala Thr Asp Leu Ala His Ala Asn Asn Met Ala Met 115 120 125 Gln Ala Glu Ala Gln Arg Leu Gly Arg Ala Lys Ala Glu Glu Lys Ala 130 135 140 Arg Lys Glu Ala Glu Ala Ala Glu Lys Ser Leu Gln Glu Ala Glu Arg 145 150 155 160 Gln Arg Glu Glu Ala Ala Arg Gin Arg Ala Glu Ala Glu Arg Gin Leu 165 170 175 Lys Gin Ala Glu Ala Glu Glu Lys Arg Leu Ala Ala Leu Ser Glu Glu 180 185 190 Ala Arg Ala Val Glu lie Thr Gin Lys Asn Leu Ala Ala Ala Gin Ser 195 200 205 Glu Leu Ser Lys Met Asp Gly Glu lie Lys Ser Leu Asn Val Arg Leu 210 215 220 Ser Thr Ser lie His Ala Arg Asp Ala Glu Met Asn Ser Leu Ser Gly 225 230 235 240 Lys Arg Asn Glu Leu Ala Gin Glu Ser Ala Lys Tyr Lys Glu Leu Asp 245 250 255 Glu Leu Val Lys Lys Leu Glu Pro Arg Ala Asn Asp Pro Leu Gin Asn 260 265 270 Arg Pro Phe Phe Asp Ala Thr Ser Arg Arg Ala Arg Ala Gly Asp Thr 275 280 285 Leu Ala Glu Lys Gin Lys Glu Val Thr Ala Ser Glu Thr Arg lie Asn 290 295 300 Glu Leu Asn Thr Glu lie Asn Gin Val Arg Gly Ala lie Ser Gin Ala 305 310 315 320 Asn Asn Asn Arg Asn Leu Lys Val Gin Gin Val Thr Glu Thr Glu Asn 325 330 335 Ala Leu Lys Val Ala lie Asp Asn Leu Asn Ser Ser Gin Met Lys Asn 340 345 350 Ala Val Asp Ala Thr Val Ser Phe Tyr Gin Thr Leu Thr Ala Lys Tyr 355 360 365 Gly Gin Lys Tyr Ser Leu lie Ala Gin Gin Leu Ala Gin Gin Ser Lys 370 375 380 Gly Lys Lys lie Ser Asn Val Asp Glu Ala Leu Ala Ala Phe Glu Lys 385 390 395 400 Tyr Lys Asp Val Leu Asp Lys Lys Phe Ser Lys Ala Asp Arg Asp Ala 405 410 415 lie Val Asn Ala Leu Lys Ser Val Asp Tyr Ala Asp Trp Ala Lys His 420 425 430 Leu Asp Gin Phe Ser Arg Tyr Leu Lys lie Ser Gly Arg Val Ser Thr 435 440 445 Gly Tyr Asp lie Tyr Ser Asp lie Arg Lys Gly Met Asp Thr Asn Asp 450 455 460 Trp Arg Pro Leu Phe Leu Thr Leu Glu Lys Leu Ala Val Asp Ala Gly 465 470 475 480 Val Gly Tyr Ile Val Ala Leu Gly Phe Ser Val Ile Ala Ser Thr Ala 485 490 495 Leu Gly Ile Trp Gly Val Ala Ile Ile Thr Gly Val Ile Cys Ser Phe 500 505 510 Val Asp Lys Lys Asp Leu Glu Lys Leu Asn Glu Ala Leu Gly Ile 515 520 525 <210> 6 <211> 296 <212> PRT <213> Salmonella enterica <400> 6 Met Phe Ile Lys Ser Gly Gly Asn Leu Thr Ile Arg Thr Phe Gly Gly 1 5 10 15 Leu Gly Val Gly Gly Asp Phe Asp Ser Asp Thr Trp Arg Arg Arg Ser 20 25 30 Thr Asp Ser Trp Val Pro Tyr Ser Glu Tyr Ile Ala Ile Glu Cys Ile 35 40 45 Val Ala Pro Asn Gln Leu Tyr Gln Leu Leu Thr Asp Val Ala Gln Val 50 55 60 Glu Thr Val Ala Ala Gln Leu Ala Gln Val Gly Tyr Gln Tyr Leu Gln 65 70 75 80 Gly Arg Leu Arg Leu Val Arg Glu Asp Gly Ser Cys Thr Asp Phe Ser 85 90 95 Gly Lys Ala Met Leu Asp Asn Leu Leu Asn Lys Ser Lys Asp Ile Leu 100 105 110 Asp Leu Asp Phe Leu His Val Ser Glu Gly Tyr Arg Ser Glu Ala Tyr 115 120 125 Trp Pro Gly Gln Ser Ser Gly Ile Thr Ile Gly Tyr Gly Val Asp Ile 130 135 140 Gly His Gln Ser Glu Glu Gly Leu His Lys Trp Gly Val Pro Gln Ser 145 150 155 160 Ile Ile Asp Lys Ile Lys Asp Tyr Phe Gly Ile Thr Gly Glu Ala Ala 165 170 175 Asn Thr Leu Leu Lys Gly Leu Lys Asp Lys Thr Leu Gly Leu Ser Asp 180 185 190 Arg Glu Ile Lys Gln Phe Ser Asp Ile Val Lys Lys Gln Ala Thr Ala 195 200 205 Asp Ile Ile Asn Lys Tyr Asn Ala Ala Thr Lys Gly Ile Thr Phe Asp 210 215 220 Lys Ile Pro Tyr Asn Thr Arg Thr Ala Ile Ile Asp Leu Phe Tyr Gln 225 230 235 240 Tyr Ser Ala Pro Lys Gly Ala Pro Lys Ser Trp Gly Phe Ile Ile Asn 245 250 255 Asn Asp Trp Asn Gly Phe Tyr Asn Glu Leu Met Asn Phe Gly Asp Lys 260 265 270 His Thr Thr Arg Arg Glu Arg Glu Ala Ala Leu Val Leu Ser Asp Ile 275 280 285 Val Asn Asn Gln Tyr Ile Tyr Lys 290 295 <210> 7 <211> 100 <212> PRT <213> 肠道沙门氏菌(Salmonella enterica) <400> 7 Met Glu Leu Lys Lys Ser Ile Ser Asp Tyr Thr Glu Ala Glu Phe Lys 1 5 10 15 Lys Ile Ile Glu Ala Ile Ile Asn Cys Glu Gly Asp Glu Lys Thr Gln 20 25 30 Asp Asp Asn Leu Glu Phe Phe Ile Arg Val Thr Glu Tyr Pro Ser Gly 35 40 45 Ser Asp Leu Ile Tyr Tyr Pro Glu Gly Asp Asn Asp Gly Ser Thr Glu 50 55 60 Ala Ile Ile Lys Glu Ile Lys Glu Trp Arg Ala Ala Asn Gly Lys Pro 65 70 75 80 Gly Phe Lys Gln Ala Asp Ser Ser Tyr Phe Val Ser Phe Asp Tyr Arg 85 90 95 Asp Gly Asp Trp 100 <210> 8 <211> 87 <212> PRT <213> Salmonella enterica <400> 8 Met Glu Leu Lys Asn Ser Ile Ser Asp Tyr Thr Glu Ala Glu Phe Ile 1 5 10 15 Glu Phe Met Lys Glu Ile Asp Lys Glu Asn Val Ala Glu Thr Asp Asp 20 25 30 Lys Leu Asp Leu Leu Leu Asn His Phe Glu Gln Val Thr Glu His Pro 35 40 45 Asp Gly Thr Asp Leu Ile Tyr Tyr Ala Ala Ser Asp Ala Glu Ser Thr 50 55 60 Pro Glu Ala Ile Thr Lys Lys Ile Lys Glu Trp Arg Ala Ala Asn Gly 65 70 75 80 Lys Pro Gly Phe Lys Gln Gly 85 <210> 9 <211> 499 <212> PRT <213> Escherichia coli <400> 9 Met Ala Lys Glu Leu Ser Val Tyr Gly Pro Thr Ala Gly Glu Ser Met 1 5 10 15 Gly Gly Thr Gly Ala Asn Leu Asn Gln Gln Gly Gly Asn Asn Asn Ser 20 25 30 Asn Ser Gly Val His Trp Gly Gly Gly Ser Gly Ser Gly Asn Gly Gly 35 40 45 Arg Glu His Gly Ser Gln Thr Gly Trp Gly Trp Ser Lys Thr Asn Asn 50 55 60 Pro Asp Val Pro Pro Tyr Val Asp Asp Asn Gly Gln Val Arg Ile Thr 65 70 75 80 Ile Thr Asn Gly Leu Val Lys Thr Pro Val Tyr Gly Val Pro Gly Ala 85 90 95 Gly Gly Asn Ser Asp Val Gln Gly Gly Tyr Ile Pro Glu Asn Pro Asn 100 105 110 Asp Glu Val Ala Arg Lys Trp Asp Lys Asn Asn Leu Pro Arg Glu Ile 115 120 125 Asp Val Ser Ile Asp Gly Phe Lys Tyr Arg Val Thr Leu Asn Asp Asn 130 135 140 Gly Arg Ala Ile Gly Ile Leu Arg Thr Gly Val Arg Pro Tyr Val Gly 145 150 155 160 Ser Glu Lys Ala Lys Ala Gly Ile Met Glu Lys Ile Asn His Lys Thr 165 170 175 Pro Glu Glu Ile Tyr Glu Ala Leu Gly Phe Asn Lys Asp Glu Ser Gln 180 185 190 Arg Gln Glu Lys Ala Lys Gln Gln Ala Glu Asp Ala Trp Asp Arg Leu 195 200 205 Pro Pro Asn Val Arg Lys Phe Asp Val Asp Val Glu Gln Phe His Tyr 210 215 220 Leu Val Val Leu Asp Asp Tyr Gly Asn Val Leu Ser Val Thr Arg Thr 225 230 235 240 Gly Val Arg Pro Tyr Val Gly Ser Glu Lys Ala Lys Ala Gly Ile Met 245 250 255 Asp Lys Val Asp His Lys Thr Pro Glu Glu Ile Tyr Glu Ala Leu Gly 260 265 270 Phe Asn Asn Glu Glu Pro Gln Arg Gln Asn Gln Ala Lys Lys Ala Ala 275 280 285 Tyr Asp Val Phe Tyr Ser Phe Ser Met Asn Arg Asp Arg Ile Gln Ser 290 295 300 Asp Val Leu Asn Lys Ala Ala Glu Val Ile Ser Asp Ile Gly Asn Lys 305 310 315 320 Val Gly Asp Tyr Leu Gly Asp Ala Tyr Lys Ser Leu Ala Arg Glu Ile 325 330 335 Ala Asp Asp Val Lys Asn Phe Gln Gly Lys Thr Ile Arg Ser Tyr Asp 340 345 350 Asp Ala Met Ala Ser Leu Asn Lys Val Leu Ser Asn Pro Gly Phe Lys 355 360 365 Phe Asn Arg Ala Asp Ser Asp Ala Leu Ala Asn Val Trp Arg Ser Ile 370 375 380 Asp Ala Gln Asp Met Ala Asn Lys Leu Gly Asn Ile Ser Lys Ala Phe 385 390 395 400 Lys Phe Ala Asp Val Val Met Lys Val Glu Lys Val Arg Glu Lys Ser 405 410 415 Ile Glu Gly Tyr Glu Thr Gly Asn Trp Gly Pro Leu Met Leu Glu Val 420 425 430 Glu Ser Trp Val Leu Ser Gly Ile Ala Ser Ala Val Ala Leu Gly Val 435 440 445 Phe Ser Ala Thr Leu Gly Ala Tyr Ala Leu Ser Leu Gly Ala Pro Ala 450 455 460 Ile Ala Val Gly Ile Val Gly Ile Leu Leu Ala Ala Val Val Gly Ala 465 470 475 480 Leu Leu Asp Asp Lys Phe Ala Asp Ala Leu Asn Lys Glu Ile Ile Lys 485 490 495 Pro Ala His <210> 10 <211> 490 <212> PRT <213> 大肠杆菌(Escherichia coli) <400> 10 Met Asp Lys Val Thr Asp Asn Ser Pro Asp Val Glu Ser Thr Glu Ser 1 5 10 15 Thr Glu Gly Ser Phe Pro Thr Val Gly Val Asp Thr Gly Asp Thr Ile 20 25 30 Thr Ala Thr Leu Ala Thr Gly Thr Glu Asn Val Gly Gly Gly Gly Gly 35 40 45 Ala Phe Gly Gly Ala Ser Glu Ser Ser Ala Ala Ile His Ala Thr Ala 50 55 60 Lys Trp Ser Thr Ala Gln Leu Lys Lys His Gln Ala Glu Gln Ala Ala 65 70 75 80 Arg Ala Ala Ala Ala Glu Ala Ala Leu Ala Lys Ala Lys Ser Gln Arg 85 90 95 Asp Ala Leu Thr Gln Arg Leu Lys Asp Ile Val Asn Asp Ala Leu Arg 100 105 110 Ala Asn Ala Ala Arg Ser Pro Ser Val Thr Asp Leu Ala His Ala Asn 115 120 125 Asn Met Ala Met Gln Ala Glu Ala Glu Arg Leu Arg Leu Ala Lys Ala 130 135 140 Glu Gln Lys Ala Arg Glu Glu Ala Glu Ala Ala Glu Lys Ala Leu Arg 145 150 155 160 Glu Ala Glu Arg Gln Arg Asp Glu Ile Ala Arg Gln Gln Ala Glu Thr 165 170 175 Ala His Leu Leu Ala Met Ala Glu Ala Ala Glu Ala Glu Lys Asn Arg 180 185 190 Gln Asp Ser Leu Asp Glu Glu His Arg Ala Val Glu Val Ala Glu Lys 195 200 205 Lys Leu Ala Glu Ala Lys Ala Glu Leu Ala Lys Ala Glu Ser Asp Val 210 215 220 Gln Ser Lys Gln Ala Ile Val Ser Arg Val Ala Gly Glu Leu Glu Asn 225 230 235 240 Ala Gln Lys Ser Val Asp Val Lys Val Thr Gly Phe Pro Gly Trp Arg 245 250 255 Asp Val Gln Lys Lys Leu Glu Arg Gln Leu Gln Asp Lys Lys Asn Glu 260 265 270 Tyr Ser Ser Val Thr Asn Ala Leu Asn Ser Ala Val Ser Ile Arg Asp 275 280 285 Ala Lys Lys Thr Asp Val Gln Asn Ala Glu Ile Lys Leu Lys Glu Ala 290 295 300 Lys Asp Ala Leu Glu Lys Ser Gln Val Lys Asp Ser Val Asp Thr Met 305 310 315 320 Val Gly Phe Tyr Gln Tyr Ile Thr Glu Gin Tyr Gly Glu Lys Tyr Ser 325 330 335 Arg Ile Ala Gin Asp Leu Ala Glu Lys Ala Lys Gly Ser Lys Phe Ser 340 345 350 Ser Val Asp Glu Ala Leu Ala Ala Phe Glu Lys Tyr Lys Asn Val Leu 355 360 365 Asp Lys Lys Ile Ser Lys Val Asp Arg Asp Ala Ile Phe Asn Ala Leu 370 375 380 Glu Ser Val Asn Tyr Asp Glu Leu Ser Lys Asn Leu Thr Lys Ile Ser 385 390 395 400 Lys Ser Leu Lys Ile Thr Ser Arg Val Ser Phe Leu Tyr Asp Val Gly 405 410 415 Ser Asp Phe Lys Asn Ala Ile Glu Thr Gly Asn Trp Arg Pro Leu Phe 420 425 430 Val Thr Leu Glu Lys Ser Ala Val Asp Val Gly Val Ala Lys Ile Val 435 440 445 Ala Leu Met Phe Ser Phe Ile Val Gly Val Pro Leu Gly Phe Trp Gly 450 455 460 Ile Ala Ile Val Thr Gly Ile Val Ser Ser Tyr Ile Gly Asp Asp Glu 465 470 475 480 Leu Asn Lys Leu Asn Glu Leu Leu Gly Ile 485 490 <210> 11 <211> 490 <212> PRT <213> Escherichia coli <400> 11 Met Asp Lys Val Thr Asp Asn Ser Pro Asp Val Glu Ser Thr Glu Ser 1 5 10 15 Thr Glu Gly Ser Phe Pro Thr Val Gly Val Asp Thr Gly Asp Thr Ile 20 25 30 Thr Ala Thr Leu Ala Thr Gly Thr Glu Asn Val Gly Gly Gly Gly Gly 35 40 45 Ala Phe Gly Gly Ala Ser Glu Ser Ser Ala Ala Ile His Ala Thr Ala 50 55 60 Lys Trp Ser Thr Ala Gln Leu Lys Lys His Gln Ala Glu Gln Ala Ala 65 70 75 80 Arg Ala Ala Ala Ala Glu Ala Ala Leu Ala Lys Ala Lys Ser Gln Arg 85 90 95 Asp Ala Leu Thr Gln Arg Leu Lys Asp Ile Val Asn Asp Ala Leu Arg 100 105 110 Ala Asn Ala Ala Arg Ser Pro Ser Val Thr Asp Leu Ala His Ala Asn 115 120 125 Asn Met Ala Met Gln Ala Glu Ala Glu Arg Leu Arg Leu Ala Lys Ala 130 135 140 Glu Gln Lys Ala Arg Glu Glu Ala Glu Ala Ala Glu Lys Ala Leu Arg 145 150 155 160 Glu Ala Glu Arg Gln Arg Asp Glu Ile Ala Arg Gln Gln Ala Glu Thr 165 170 175 Ala His Leu Leu Ala Met Ala Glu Ala Ala Glu Ala Glu Lys Asn Arg 180 185 190 Gln Asp Ser Leu Asp Glu Glu His Arg Ala Val Glu Val Ala Glu Lys 195 200 205 Lys Leu Ala Glu Ala Lys Ala Glu Leu Ala Lys Ala Glu Ser Asp Val 210 215 220 Gln Ser Lys Gln Ala Ile Val Ser Arg Val Ala Gly Glu Leu Glu Asn 225 230 235 240 Ala Gln Lys Ser Val Asp Val Lys Val Thr Gly Phe Pro Gly Trp Arg 245 250 255 Asp Val Gln Lys Lys Leu Glu Arg Gln Leu Gln Asp Lys Lys Asn Glu 260 265 270 Tyr Ser Ser Val Thr Asn Ala Leu Asn Ser Ala Val Ser Ile Arg Asp 275 280 285 Ala Lys Lys Thr Glu Val Gln Asn Ala Glu Ile Lys Leu Lys Glu Ala 290 295 300 Lys Asp Ala Leu Glu Lys Ser Gln Val Lys Asp Ser Val Asp Thr Met 305 310 315 320 Val Gly Phe Tyr Gln Tyr Ile Thr Glu Gin Tyr Gly Glu Lys Tyr Ser 325 330 335 Arg Ile Ala Gin Asp Leu Ala Glu Lys Ala Lys Gly Ser Lys Phe Asn 340 345 350 Ser Val Asp Glu Ala Leu Ala Ala Phe Glu Lys Tyr Lys Asn Val Leu 355 360 365 Asp Lys Lys Phe Ser Lys Val Asp Arg Asp Asp Ile Phe Asn Ala Leu 370 375 380 Glu Ser Ile Thr Tyr Asp Glu Trp Ala Lys His Leu Glu Lys Ile Ser 385 390 395 400 Arg Ala Leu Lys Val Thr Gly Tyr Leu Ser Phe Gly Tyr Asp Val Trp 405 410 415 Asp Gly Thr Leu Lys Gly Leu Lys Thr Gly Asp Trp Lys Pro Leu Phe 420 425 430 Val Thr Leu Glu Lys Ser Ala Val Asp Phe Gly Val Ala Lys Ile Val 435 440 445 Ala Leu Met Phe Ser Phe Ile Val Gly Ala Pro Leu Gly Phe Trp Gly 450 455 460 Ile Ala Ile Ile Thr Gly Ile Val Ser Ser Tyr Ile Gly Asp Asp Glu 465 470 475 480 Leu Asn Lys Leu Asn Glu Leu Leu Gly Ile 485 490 <210> 12 <211> 626 <212> PRT <213> Escherichia coli <400> 12 Met Ser Asp Pro Val Arg Ile Thr Asn Pro Gly Ala Glu Ser Leu Gly 1 5 10 15 Tyr Asp Ser Asp Gly His Glu Ile Met Ala Val Asp Ile Tyr Val Asn 20 25 30 Pro Pro Arg Val Asp Val Phe His Gly Thr Pro Pro Ala Trp Ser Ser 35 40 45 Phe Gly Asn Lys Thr lie Trp Gly Gly Asn Glu Trp Val Asp Asp Ser 50 55 60 Pro Thr Arg Ser Asp lie Glu Lys Arg Asp Lys Glu lie Thr Ala Tyr 65 70 75 80 Lys Asn Thr Leu Ser Ala Gin Gin Lys Glu Asn Glu Asn Lys Arg Thr 85 90 95 Glu Ala Gly Lys Arg Leu Ser Ala Ala lie Ala Ala Arg Glu Lys Asp 100 105 110 Glu Asn Thr Leu Lys Thr Leu Arg Ala Gly Asn Ala Asp Ala Ala Asp 115 120 125 lie Thr Arg Gin Glu Phe Arg Leu Leu Gin Ala Glu Leu Arg Glu Tyr 130 135 140 Gly Phe Arg Thr Glu lie Ala Gly Tyr Asp Ala Leu Arg Leu His Thr 145 150 155 160 Glu Ser Arg Met Leu Phe Ala Asp Ala Asp Ser Leu Arg lie Ser Pro 165 170 175 Arg Glu Ala Arg Ser Leu lie Glu Gin Ala Glu Lys Arg Gin Lys Asp 180 185 190 Ala Gin Asn Ala Asp Lys Lys Ala Ala Asp Met Leu Ala Glu Tyr Glu 195 200 205 Arg Arg Lys Gly lie Leu Asp Thr Arg Leu Ser Glu Leu Glu Lys Asn 210 215 220 Gly Gly Ala Ala Leu Ala Val Leu Asp Ala Gin Gin Ala Arg Leu Leu 225 230 235 240 Gly Gin Gin Thr Arg Asn Asp Arg Ala lie Ser Glu Ala Arg Asn Lys 245 250 255 Leu Ser Ser Val Thr Glu Ser Leu Asn Thr Ala Arg Asn Ala Leu Thr 260 265 270 Arg Ala Glu Gin Gin Leu Thr Gin Gin Lys Asn Thr Pro Asp Gly Lys 275 280 285 Thr lie Val Ser Pro Glu Lys Phe Pro Gly Arg Ser Ser Thr Asn His 290 295 300 Ser lie Val Val Ser Gly Asp Pro Arg Phe Ala Gly Thr lie Lys lie 305 310 315 320 Thr Thr Ser Ala Val lie Asp Asn Arg Ala Asn Leu Asn Tyr Leu Leu 325 330 335 Thr His Ser Gly Leu Asp Tyr Lys Arg Asn lie Leu Asn Asp Arg Asn 340 345 350 Pro Val Val Thr Glu Asp Val Glu Gly Asp Lys Lys lie Tyr Asn Ala 355 360 365 Glu Val Ala Glu Trp Asp Lys Leu Arg Gin Arg Leu Leu Asp Ala Arg 370 375 380 Asn Lys lie Thr Ser Ala Glu Ser Ala Val Asn Ser Ala Arg Asn Asn 385 390 395 400 Leu Ser Ala Arg Thr Asn Glu Gin Lys His Ala Asn Asp Ala Leu Asn 405 410 415 Ala Leu Leu Lys Glu Lys Glu Asn lie Arg Asn Gin Leu Ala Gly lie 420 425 430 Asn Gin Lys lie Ala Glu Glu Lys Arg Lys Gin Asp Glu Leu Lys Ala 435 440 445 Thr Lys Asp Ala lie Asn Phe Thr Thr Glu Phe Leu Lys Ser Val Ser 450 455 460 Glu Lys Tyr Gly Ala Lys Ala Glu Gin Leu Ala Arg Glu Met Ala Gly 465 470 475 480 Gln Ala Lys Gly Lys Lys lie Arg Asn Val Glu Glu Ala Leu Lys Thr 485 490 495 Tyr Glu Lys Tyr Arg Ala Asp lie Asn Lys Lys lie Asn Ala Lys Asp 500 505 510 Arg Ala Ala lie Ala Ala Ala Leu Glu Ser Val Lys Leu Ser Asp lie 515 520 525 Ser Ser Asn Leu Asn Arg Phe Ser Arg Gly Leu Gly Tyr Ala Gly Lys 530 535 540 Phe Thr Ser Leu Ala Asp Trp lie Thr Glu Phe Gly Lys Ala Val Arg 545 550 555 560 Thr Glu Asn Trp Arg Pro Leu Phe Val Lys Thr Glu Thr lie lie Ala 565 570 575 Gly Asn Ala Ala Thr Ala Leu Val Ala Leu Val Phe Ser lie Leu Thr 580 585 590 Gly Ser Ala Leu Gly lie lie Gly Tyr Gly Leu Leu Met Ala Val Thr 595 600 605 Gly Ala Leu lie Asp Glu Ser Leu Val Glu Lys Ala Asn Lys Phe Trp 610 615 620 Gly lie 625 <210> 13 <211> 626 <212> PRT <213> Escherichia coli <400> 13 Met Ser Asp Pro Val Arg lie Thr Asn Pro Gly Ala Glu Ser Leu Gly 1 5 10 15 Tyr Asp Ser Asp Gly His Glu lie Met Ala Val Asp lie Tyr Val Asn 20 25 30 Pro Pro Arg Val Asp Val Phe His Gly Thr Pro Pro Ala Trp Ser Ser 35 40 45 Phe Gly Asn Lys Thr lie Trp Gly Gly Asn Glu Trp Val Asp Asp Ser 50 55 60 Pro Thr Arg Ser Asp lie Glu Lys Arg Asp Lys Glu lie Thr Ala Tyr 65 70 75 80 Lys Asn Thr Leu Ser Ala Gin Gin Lys Glu Asn Glu Asn Lys Arg Thr 85 90 95 Glu Ala Gly Lys Arg Leu Ser Ala Ala lie Ala Ala Arg Glu Lys Asp 100 105 110 Glu Asn Thr Leu Lys Thr Leu Arg Ala Gly Asn Ala Asp Ala Ala Asp 115 120 125 lie Thr Arg Gin Glu Phe Arg Leu Leu Gin Ala Glu Leu Arg Glu Tyr 130 135 140 Gly Phe Arg Thr Glu lie Ala Gly Tyr Asp Ala Leu Arg Leu His Thr 145 150 155 160 Glu Ser Arg Met Leu Phe Ala Asp Ala Asp Ser Leu Arg lie Ser Pro 165 170 175 Arg Glu Ala Arg Ser Leu lie Glu Gin Ala Glu Lys Arg Gin Lys Asp 180 185 190 Ala Gin Asn Ala Asp Lys Lys Ala Ala Asp Met Leu Ala Glu Tyr Glu 195 200 205 Arg Arg Lys Gly lie Leu Asp Thr Arg Leu Ser Glu Leu Glu Lys Asn 210 215 220 Gly Gly Ala Ala Leu Ala Val Leu Asp Ala Gin Gin Ala Arg Leu Leu 225 230 235 240 Gly Gin Gin Thr Arg Asn Asp Arg Ala lie Ser Glu Ala Arg Asn Lys 245 250 255 Leu Ser Ser Val Thr Glu Ser Leu Lys Thr Ala Arg Asn Ala Leu Thr 260 265 270 Arg Ala Glu Gin Gin Leu Thr Gin Gin Lys Asn Thr Pro Asp Gly Lys 275 280 285 Thr lie Val Ser Pro Glu Lys Phe Pro Gly Arg Ser Ser Thr Asn His 290 295 300 Ser lie Val Val Ser Gly Asp Pro Arg Phe Ala Gly Thr lie Lys lie 305 310 315 320 Thr Thr Ser Ala Val lie Asp Asn Arg Ala Asn Leu Asn Tyr Leu Leu 325 330 335 Thr His Ser Gly Leu Asp Tyr Lys Arg Asn Ile Leu Asn Asp Arg Asn 340 345 350 Pro Val Val Thr Glu Asp Val Glu Gly Asp Lys Lys Ile Tyr Asn Ala 355 360 365 Glu Val Ala Glu Trp Asp Lys Leu Arg Gln Arg Leu Leu Asp Ala Arg 370 375 380 Asn Lys Ile Thr Ser Ala Glu Ser Ala Ile Asn Ser Ala Arg Asn Asn 385 390 395 400 Val Ser Ala Arg Thr Asn Glu Gin Lys His Ala Asn Asp Ala Leu Asn 405 410 415 Ala Leu Leu Lys Glu Lys Glu Asn Ile Arg Ser Gin Leu Ala Asp Ile 420 425 430 Asn Gin Lys Ile Ala Glu Glu Lys Arg Lys Arg Asp Glu Ile Asn Met 435 440 445 Val Lys Asp Ala Ile Lys Leu Thr Ser Asp Phe Tyr Arg Thr Ile Tyr 450 455 460 Asp Glu Phe Gly Lys Gin Ala Ser Glu Leu Ala Lys Glu Leu Ala Ser 465 470 475 480 Val Ser Gin Gly Lys Gin Ile Lys Ser Val Asp Asp Ala Leu Asn Ala 485 490 495 Phe Asp Lys Phe Arg Asn Asn Leu Asn Lys Lys Tyr Asn lie Gin Asp 500 505 510 Arg Met Ala lie Ser Lys Ala Leu Glu Ala lie Asn Gin Val His Met 515 520 525 Ala Glu Asn Phe Lys Leu Phe Ser Lys Ala Phe Gly Phe Thr Gly Lys 530 535 540 Val lie Glu Arg Tyr Asp Val Ala Val Glu Leu Gin Lys Ala Val Lys 545 550 555 560 Thr Asp Asn Trp Arg Pro Phe Phe Val Lys Leu Glu Ser Leu Ala Ala 565 570 575 Gly Arg Ala Ala Ser Ala Val Thr Ala Trp Ala Phe Ser Val Met Leu 580 585 590 Gly Thr Pro Val Gly lie Leu Gly Phe Ala lie lie Met Ala Ala Val 595 600 605 Ser Ala Leu Val Asn Asp Lys Phe lie Glu Gin Val Asn Lys Leu lie 610 615 620 Gly lie 625 <210> 14 <211> 271 <212> PRT <213> Escherichia coli <400> 14 Met Glu Thr Leu Thr Val His Ala Pro Ser Pro Ser Thr Asn Leu Pro 1 5 10 15 Ser Tyr Gly Asn Gly Ala Phe Ser Leu Ser Ala Pro His Val Pro Gly 20 25 30 Ala Gly Pro Leu Leu Val Gln Val Val Tyr Ser Phe Phe Gln Ser Pro 35 40 45 Asn Met Cys Leu Gln Ala Leu Thr Gln Leu Glu Asp Tyr Ile Lys Lys 50 55 60 His Gly Ala Ser Asn Pro Leu Thr Leu Gln Ile Ile Ser Thr Asn Ile 65 70 75 80 Gly Tyr Phe Cys Asn Ala Asp Arg Asn Leu Val Leu His Pro Gly Ile 85 90 95 Ser Val Tyr Asp Ala Tyr His Phe Ala Lys Pro Ala Pro Ser Gln Tyr 100 105 110 Asp Tyr Arg Ser Met Asn Met Lys Gln Met Ser Gly Asn Val Thr Thr 115 120 125 Pro Ile Val Ala Leu Ala His Tyr Leu Trp Gly Asn Gly Ala Glu Arg 130 135 140 Ser Val Asn Ile Ala Asn Ile Gly Leu Lys Ile Ser Pro Met Lys Ile 145 150 155 160 Asn Gin lie Lys Asp lie lie Lys Ser Gly Val Val Gly Thr Phe Pro 165 170 175 Val Ser Thr Lys Phe Thr His Ala Thr Gly Asp Tyr Asn Val Ile Thr 180 185 190 Gly Ala Tyr Leu Gly Asn lie Thr Leu Lys Thr Glu Gly Thr Leu Thr 195 200 205 lie Ser Ala Asn Gly Ser Trp Thr Tyr Asn Gly Val Val Arg Ser Tyr 210 215 220 Asp Asp Lys Tyr Asp Phe Asn Ala Ser Thr His Arg Gly Ile lie Gly 225 230 235 240 Glu Ser Leu Thr Arg Leu Gly Ala Met Phe Ser Gly Lys Glu Tyr Gin 245 250 255 lie Leu Leu Pro Gly Glu lie His lie Lys Glu Ser Gly Lys Arg 260 265 270 <210> 15 <211> 1942 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Codon optimized coding sequence for expression of ScoIE2 <400> 15 atgtctggtg gtgatggtat cggtcacaat agcggtgctc attctactgg tggtgtgaac 60 ggttcttcat ctggtagggg tggtagttct tcaggtggtg gtaacaaccc taactctggt 120 cctggttggg gtactactca tactcctgat ggtcacgata tccacaacta caaccctggt 180 gagtttggtg gtggtggaca taagcctggt ggaaacggtg gtaatcactc tggtggtact 240 ggtgatggac aacctcctgg tgctgctatg gcttttggtt tccctgctct tgttcctgct 300 ggtgctggtg gtcttgctgt tactgtttct ggtgatgctc tggctgctgc aattgctgat 360 gtgcttgctg ttctgaaggg acctttcaag tttggtgctt ggggtatcgc tctgtacggt 420 attcttccta ccgagatcgc taaggatgat ccaaggatga tgagcaagat cgtgacctct 480 ttgcctgctg atgctgtgac tgagtctcct gtgtcatctc tgcctcttga tcaggctact 540 gtgagcgtta ccaagagggt taccgatgtg gttaaggatg agaggcagca cattgctgtt 600 gttgctggtg tgcctgcttc tatccctgtt gttgatgcta agcctactac ccaccctggt 660 gtgttctctg tttctgttcc tggtctgcct gatctgcagg tttcaactgt gaagaacgct 720 cctgctatga ctgctttgcc taggggtgtt actgatgaga aggataggac tgttcaccct 780 gctggtttca ccttcggtgg ttcttctcat gaggctgtga tcaggttccc taaagagtct 840 ggtcaggctc ctgtttacgt gtcagtgacc gatgttctta cccctgagca ggttaagcag 900 agacaggatg aagagaatag aaggcagcaa gagtgggatg ctactcaccc tgttgaagtg 960 gctgagagga attacaggct ggcttctgat gagctgaaca gggctaatgt ggatgtggct 1020 ggtaagcaag agaggcagat tcaagctgct caagctgttg ctgctagaaa gggtgaactg 1080 gatgctgcta acaagacctt cgctgatgct aaagaagaga tcaagaagtt cgagaggttc 1140 gctcacgatc ctatggctgg tggacacaga atgtggcaaa tggctggtct taaggctcag 1200 agggctcaga atgaggttaa ccagaaacaa gctgagttca acgctgctga gaaagaaaag 1260 gctgatgcag atgctgctct gaacgtggca cttgagtcta ggaagcagaa agaacaaaag 1320 gcaaaggatg ctagcgataa gctggataag gaaaacaaga ggaaccaccc tggaaaggct 1380 actggtaagg gtcaacctgt tggtgataag tggcttgagg atgctggtaa agaagctgga 1440 gcacctgttc cagataggat cgctgataag ctgagagata aggaattcaa gaacttcgat 1500 gattttagga agaagttctg ggaagaggta aatttctagt ttttctcctt cattttcttg gttaggaccc ttttctcttt ttatttttttt gagctttgat ctttctttaa actgatctat tttttaattg attggttatg gtgtaaatat tacatagctt taactgataa tctgattact ttatttcgtg tgtctatgat gatgatgata actgcaggtt agcaaggatc ctgagctgag caagcagttc atccctggta acaagaaaag gatgagccag ggtcttgctc ctagggctag aaacaaggat actgtgggtg gtagaagatc cttcgagctg catcacgata agccaatctc tcaggatggt ggtgtttacg atatggataa catcagggtg accaccccaa agctgcacat cgatattcat aggggaagt aa <210> 16 <211> 1954 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <221> <222> <223> Other configuration ScoIE3 applications are available in the following format <400> 16 atgtctggtg gtgatggtag gggtcataat accggtgctc atagcaccag cggtaacatt aacggtggtc ctactggtct tggtgtgtca ggtggtgctt ctgatggttc tggttggtcc 120 tctgagaaca atccttgggg tggtggtagc ggttctggta ttcactgggg aggtggaagt 180 ggtagaggta atggtggtgg aaacggtaac agtggtggtg gttctggaac tggtggtaac 240 ctttctgctg ttgctgctcc tgttgctttc ggtttccctg ctctttctac tcctggtgct 300 ggtggtttgg ctgtgtctat ttctgcttct gagctgagcg ctgctatcgc tggtattatc 360 gctaagctga agaaggtgaa cctgaagttc acccctttcg gtgtggtgct gtcctctttg 420 attcctagcg agatcgctaa ggatgatcct aacatgatga gcaagatcgt gaccagcctg 480 cctgctgatg atattaccga gtctcctgtg tcctctctgc ctcttgataa ggctactgtg 540 aatgtgaacg tgagggtggt ggatgatgtg aaggatgaga ggcagaacat cagcgttgtg 600 tctggtgttc ctatgtctgt gcctgttgtg gatgctaagc ctactgaaag gcctggtgtg 660 ttcaccgctt ctattccagg tgctcctgtg ctgaacatct ccgtgaacaa ttctacccct 720 gctgtgcaga ctctttctcc tggtgtgact aacaacaccg ataaggatgt taggcctgct 780 ggtttcactc agggtggtaa taccagggat gctgtgatca ggttccctaa ggattctggt 840 cacaacgcag tgtacgtgtc cgtgtctgat gtgttgtctc cagatcaggt taagcagagg 900 caggatgaag agaatagaag gcagcaagag tgggatgcta ctcaccctgt tgaagttgct 960 gagagagat acgagaacgc tagagctgaa cttgaggctg aaaacaagaa cgtgcacagc 1020 cttcaggtgg cacttgatgg tcttaagaat accgctgagg gtctggctct ttctgatgct 1080 ggtagacatc ctctgaccag cagcgagtct agatttgttg ctgtgcctgg ttactccggt 1140 ggtggtgttc attttgatgc taccgctacc gtggatagca gggataggct taactctctt 1200 ctgtctcttg gtggtgctgc ttacgtgaac aacgtgttgg agcttggtga ggtgtcagct 1260 cctactgagg atggtttgaa ggtgggaaac gctatcaaga acgctatgat cgaggtgtac 1320 gataagctga ggcagaggct tattaccagg cagaacgaga tcaaccacgc tcaggtgtca 1380 cttaacaccg ctatcgagtc taggaacaag aaagagggaaa agaagaggtc cgcagagaac 1440 aagctgaacg aagagagaaa caagcctaga aagggtacta aggattacgg acacgattac 1500 catcctgctc cagagactga agaaatcaag ggtctgggtg atatcaagaa gggtatccct 1560 aagaccccta agcagaacgg tggtggtaag agaaagagat ggatcggaga taagggtaga 1620 aagatctacg agtgggatag ccagcatggt gagcttgaag gtaaatttct agtttttctc 1680 cttcattttc ttggttagga cccttttctc tttttatttt tttgagcttt gatctttctt 1740 taaactgatc tattttttaa ttgattggtt atggtgtaaa tattacatag ctttaactga 1800 taatctgatt actttatttc gtgtgtctat gatgatgatg ataactgcag gttatagggc 1860 ttcagatggt cagcacctgg gaagctttga tcctaagact ggtaagcagc tgaagggtcc 1920 tgatccaaag aggaacatca agaagtacct ttaa 1954 <210> 17 <211> 1948 <212> DNA <213> 人工序列(Artificial Sequence) <220> <221> <222> <223> 用于表达ScoIE7的密码子优化编码序列 <400> 17 atgtctggtg gtgatggtat cggtcacaat agcggtgctc attctactgg tggtgtgaac 60 ggttcctctt ctggttctgg tggaagctca tctggaagcg gtaacaaccc taattctggt 120 CCTGGTTGGG GTACTACTCA TACCCCTAAC GGTGATATCC ACAACTACAA CCCTGGTGAG 180 TTTGTTGGTG GTGGAAACAA GCCTGGTGGA CATGGTGGTA CTCTGGTAAC CACGATGGT 240 AGCTCTGGAA ACGGTCAACC TTCTGCTGCT CCTATGGCTT TTGTTTCCTC TCTTGCT 300 CCTGCTGGTG CTGGTTCTCT TGCTGTTACT GTTTCTGGTG AGGCTCTGTC TGCTGCTATC 360 GCTGATATTT TCGCTGCTCT GAAGGGACCT TTCAAGTTCG GTGCTTGGGG TATTGCTCTG 420 TACGGTATTA TGCCTACCGA GATCGCTAAG GATGATCCTA ACATGATGAG CAAGATCATG 480 ACCAGCCTGC CTGCTGATAC TGTTGACTGA TACTCCTGTG TCCTCTCTGC CTCTTGATCA 540 GCTACTGTGT CTGTGACTAA GAGGTTGCA GATGTGGTGA AGGATGAGAG GCAGCATATT 600 GCTGTTGTTG CTGGTGTGCC TATGTCTGTG CCTGTTGTTG ATGCTAAGCC TACCAC TAGG 660 CCTGGTATCT TCTCTGCTAC GTTTCCTGGA CTTCCTGCTT TGGAGGTGTC AACCGGTAAG 720 TCTATTCCTG CTTCTACCGC TCTGCCTAGG GTATTACTGA GGATAAGGA TAGGACTGAG 780 CACCCCTGCT GGTTCACCTT CGGTGGTTCT TCTCACGATG CTGTGATCAG GTTCCCTAAA 840 gagtctggtc aggctccagt ttacgtgtca gtgactgatg tgcttacccc tgagcaggtt 900 aagcagagac aggatgaaga gtctagaagg cagcaagagt gggatgctac tcatcctgtt 960 gaagtggctg agagacta caggcttgct tctgatgagc tgaacagggt gaacgctgat 1020 gtggctggta agcaagaaag acaagctcaa gctggacagg ctgttgctgc tagaaagggt 1080 gaacttgatg ctgctaacaa gaccttcgct gatgctaaag aagagatcaa gaagttcgag 1140 cacttcgcta gggatccaat ggctggtggt catagaatgt ggcagatggc tggtcttaag 1200 gctcagaggg ctcagaatga ggttaaccag aaacaagctg agttcgatgc tgcagaagaa 1260 gaaaaggctg atgctgatgc agctctgaac gctgctcttg aatctaggaa gcagaaagag 1320 cagaaggcta aggataccaa agagaggctg gataaggaaa acaagaggaa tcagcctggt 1380 aaggctaccg gtaagggtca gccagtttct gataagtggc ttgaggatgc tggtaaagag 1440 agcggttctc ctatccctga tagcattgct gataagctta gagataagga attcagaaac 1500 ttcgatgatt ttaggagaa gttctgggag gaagttagca aggatcctga gctgagcaag 1560 cagttcatca agggtaacag agataggatg caggtaaatt tctagttttt ctccttcatt 1620 ttcttggtta ggaccctttt ctctttttat ttttttgagc tttgatcttt ctttaaactg 1680 atctattttt taattgattg gttatggtgt aaatattaca tagctttaac tgataatctg 1740 attactttat ttcgtgtgtc tatgatgatg atgataactg caggttggaa aggctcctaa 1800 gtccagaaag aaggatgctg ctggtaagag gacctctttc gagcttcatc acgataagcc 1860 tgtgagccag gatggtggtg tttacgatat ggataacctg aggatcacca cccctaagag 1920 gcacatcgat attcataggg gacagtaa 1948 <210> 18 <211> 1452 <212> DNA <213> 人工序列(Artificial Sequence) <220> <221> <222> <223> 用于表达ScoIE1a的密码子优化编码序列 <400> 18 atggctgata acaccattgc ttactacgag gatggtgtgc ctcacagcgc tgatggtaag 60 gtggtgattg tgatcgatgg taagatgcct gtggataccg gtgctggtgg tactggtggt 120 ggtggaggtg gtaaggttgg aggaacttct gaaagctctg ctgctattca cgctaccgct 180 aagtggtcta ccgctcagct taagaaaacc ctggctgaga aggctgctag agagagagaa 240 actgctgctg caatggctgc tgctaaggct aagagagatg ctcttaccca gcacctgaag 300 gatatcgtga acgatgtgct taggcacaac gcttctagga ccccttctgc tactgatctt 360 gctcacgcta acaacatggc tatgcaggct gaagctcaga gacttggtag agctaaggct 420 gaggaaaagg ctagaaaaga ggctgaggct gctgagcttg ctttccaaga agctgaaaga 480 cagagggaag aggctgttag acagcttgct gaaactgaga ggcagcttaa gcaagctgag 540 gaagagaaga ggcttgctgc tctttctgat gaggctaggg ctgttgagaa cgctaggaag 600 aatctggata ccgcaaagtc cgagctggct aatgtggatt ctgatatcga gaggcagagg 660 tcccagctgt catctcttga tgctgatgtg aagaaggctg aagagaacct gaggctgacc 720 atgaggatta agggtaggat cggtaggaag atgcaggcta agtcacaggc tatcgtggat 780 gataagaaaa ggatctactc cgatgctgag aacgtgctga ataccatgac cgtgaatagg 840 aacctgaagg ctcagcaggt taccgatgca gagaatgagc ttaaggtggc aatcgataac 900 ctgaacagca gccagatgaa gaacgctgtg gatgctaccg tgtctttcta ccagactctg 960 accgagaagt acggtgagaa gtacagcctt atcgctcaag agctggcaga gaagtccaag 1020 ggtaagaaaa tcggaaatgt ggatgaggct ctggctgcat tcgagaagta taaggatgtg 1080 ctggataaga agttcagcaa ggctgatagg gatgctattg tgaacgctct gaagtccttc 1140 aactacgatg attgggctaa gcacctggat cagttcgcta agtacctgaa gatcaccggt 1200 cacgtgagct tcggttacga tgttgtgtct gatgtgctga aggctagcga gactggtgat 1260 tggaagcctc tgttcattac ccttgagcag aaggtgttgg atactggtat gagctacctg 1320 gtggtgctga tgttctctct tattgctgga accaccctgg gaatcttcgg tgtggctatt 1380 attaccgcta tcctgtgcag cttcgtggat aagtacatcc tgaacgcact gaacgatgct 1440 ctgggaatct aa 1452 <210> 19 <211> 1584 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> 用于表达ScoIE1b的密码子优化编码序列 <400> 19 atgagcgata acaccattgc ttactacgag gatggtgtgc cttacagcgc tgatggtcaa 60 gtggtgattg tgatcgatgg taagatgcct gtggataccg gtgctggtgg tactggtggt 120 ggtggaggtg gtaaggttgg aggaacttct gaaagctctg ctgctattca cgctaccgct 180 aagtggtcta aggctcagct tcagaagtcc ctggaagaga aggctgctag agagagagaa 240 actgctgctg caatggctgc tgctaaggct aagagagatg ctcttaccca gcacctgaag 300 gatatcgtga acgatgtgct gaggtacaac gcttctagga ctccttctgc taccgatctt 360 gctcacgcta acaacatggc tatgcaggct gaagctcaga gacttggtag agctaaggct 420 gaggaaaagg ctagaaaaga ggctgaggct gctgagaagt ctcttcaaga agctgagaga 480 cagagggaag aagctgctag gcaaagagct gaagcagaga ggcaacttaa gcaggcagag 540 gctgaagaga agaggttggc tgctctttct gaagaggcta gggcagttga gatcacccag 600 aagaatcttg ctgctgctca gagcgagctg tccaagatgg atggtgagat caagagcctt 660 aacgtgaggc tgtctacctc tatccatgct agggatgctg agatgaacag cctgtctggt 720 aagaggaacg agctggctca agagagcgct aagtacaaag aactggatga gctggtgaag 780 aagcttgagc ctagggctaa tgatcctctg cagaacaggc cttcttcga tgctacatct 840 agaagggcaa gggctggtga tactttggct gagaagcaga aagaggtgac cgcttctgag 900 actaggatca acgagcttaa caccgagatc aaccaggtga ggggtgctat ttcacaggca 960 aacaacaata ggaacctgaa ggtgcagcag gttaccgaga ctgagaacgc tcttaaggtg 1020 gcaatcgata acctgaacag cagccagatg aagaacgctg tggatgctac cgtgtctttc 1080 taccagaccc tgactgctaa gtacggtgag aagtacagcc tgatcgctca agaacttgct 1140 gagcagtcca agggtaagaa aatcagcaat gtggatgagg ctctggctgc attcgagaag 1200 tataaggatg tgctggataa gaagttcagc aaggctgata gggatgcaat tgtgaacgct 1260 ctgaagtccg tggattacgc tgattgggct aagcacctgg atcagttcag cagatacctg 1320 aagatcagcg gtagggtgtc aaccggttac gatatctaca gcgatatcag aaagggtatg 1380 GATACTGATG ATTTGGAGCC TCTGTTCCTG ACCCTTGAGA AGCTTGCTGT TGATGCTGGT 1440 GTGGGTTACA TC GTGGCTCTT G GTTTCTCT GTGATCGCTT CT ACCGCTCTT G GTATTTGG 1500 G GTGTGGCTA TTATCACCGGT GT GATCTGC AGCTTC GTTG AT AAGAAGGATTT GGAGAAG 1560 CTGAACGAGG CACTGGG AAT CTA 1584 <210> 20 <211> 891 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Codon optimized coding sequence for expression of Salmonella Spst <400> 20 ATGTTCATCA AGAGCGGTGG TAACCTGACC ATCAGGACTT TTGGTGGTCTT GGTGTGGGT 60 G GTGATTT CG AT AGC GAT AC TTGGAGAAGA AGGTCC ACCG ATTC TTGGGT GCC AT AC AGC 120 G AGT AC ATTG CT ATCG AGTG CATCGTGGCT CCTAACCAGC TT ACCAGCTT CTT ACTGAT 180 GTGGCTCAGGT GGAAACTGTG GCTGCTCAAC TTGCTCAGGT TGGATACAGT ATCTTCAG 240 GGTAGGCTTA GGCTGGTGAG AGAGGATGGT TCTTGCACCG ATTT C AGCGGT AAGGCTATG 300 CTGGATAACCT GCTGAACAA GAGCAAGGAT ATTC TGGATC TGGATTT CCT GCACGTGAGC 360 gagggttata ggtctgaagc ttattggcct ggtcagtcct ctggtatcac cattggttac 420 ggtgtggata tcggtcacca gtctgaagag ggacttcata agtggggtgt gcctcagagc 480 atcatcgata agatcaagga ttacttcggt attaccggtg aggctgctaa cacccttctt 540 aagggtctga aggataagac cctgggactg agcgatagag agatcaagca gttctccgat 600 atcgtgaaga agcaggctac cgctgatatc atcaacaagt acaacgctgc taccaagggt 660 atcacctttg ataagatccc ttacaacacc aggaccgcta tcatcgatct gttctaccag 720 tacagcgctc ctaagggtgc tcctaagtct tggggtttca ttatcaacaa cgattggaac 780 ggtttctaca acgagctgat gaacttcggt gataagcaca ccaccagaag agagagggaa 840 gctgctctgg ttctgtctga tattgtgaac aaccagtaca tctacaagta a 891 <210> 21 <211> 258 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Codon optimized coding sequence for expression of SImmE2 <400> 21 atggaactga agaagtccat cagcgattac accgaggctg agttcaagaa gatcatcgag 60 gctatcatca actgcgaggg tgatgagaaa acccaggatg ataaccttga gttcttcatc 120 agggtgaccg agtacccttc tggtagcgat cttatctact accctgaggg tgataacgat 180 ggtagcaccg aggcaattat caaagaaatc aaggaatgga gggctgctaa cggtaagcct 240 ggttttaagc aagcttaa 258 <210> 22 <211> 264 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Codon optimized coding sequence for expression of SImmE7 <400> 22 atggaactga agaacagcat cagcgattac accgaggctg agttcatcga gttcatgaaa 60 gaaatcgata aggaaaacgt ggcagagact gatgataagc tggatctgct gctgaaccac 120 ttcgagcagg ttacagaaca ccctgatgga accgatctga tctactacgc tgcttccgat 180 gctgagtcta cccctgaggc tatcaccaag aaaatcaaag aatggagggc tgctaacggt 240 aagcctggtt ttaagcaagg ttaa 264 <210> 23 <211> 15014 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Nucleotide sequence of binary TMV-based vector for expression of Salmonella Sco IE1a <400> 23 catggctgat aacaccattg cttactacga ggatggtgtg cctcacagcg ctgatggtaa 60 ggtggtgatt gtgatcgatg gtaagatgcc tgtggatacc ggtgctggtg gtactggtgg 120 tggtggaggt ggtaaggttg gaggaacttc tgaaagctct gctgctattc acgctaccgc 180 taagtggtct accgctcagc ttaagaaaac cctggctgag aaggctgcta gagagagaga 240 aactgctgct gcaatggctg ctgctaaggc taagagagat gctcttaccc agcacctgaa 300 ggatatcgtg aacgatgtgc ttaggcacaa cgcttctagg accccttctg ctactgatct 360 tgctcacgct aacaacatgg ctatgcaggc tgaagctcag agacttggta gagctaaggc 420 tgaggaaaag gctagaaaag aggctgaggc tgctgagctt gctttccaag aagctgaaag 480 acagagggaa gaggctgtta gacagcttgc tgaaactgag aggcagctta agcaagctga 540 ggaagagaag aggcttgctg ctctttctga tgaggctagg gctgttgaga acgctaggaa 600 gaatctggat accgcaaagt ccgagctggc taatgtggat tctgatatcg agaggcagag 660 gtcccagctg tcatctcttg atgctgatgt gaagaaggct gaagagaacc tgaggctgac 720 catgaggatt aagggtagga tcggtaggaa gatgcaggct aagtcacagg ctatcgtgga 780 840 gaacctgaag gctcagcagg ttaccgatgc agagaatgag cttaaggtgg caatcgataa 900 cctgaacagc agccagatga agaacgctgt ggatgctacc gtgtctttct accagactct 960 1020 gggtaagaaa atcggaaatg tggatgaggc tctggctgca ttcgagaagt ataaggatgt 1080 gctggataag aagttcagca aggctgatag ggatgctatt gtgaacgctc tgaagtcctt 1140 1200 tcacgtgagc ttcggttacg atgttgtgtc tgatgtgctg aaggctagcg agactggtga 1260 ttggaagcct ctgttcatta cccttgagca gaaggtgttg gatactggta tgagctacct 1320 ggtgtgctg atgttctctc ttattgctgg aaccaccctg ggaatcttcg gtgtggctat 1380 tattaccgct atcctgtgca gcttcgtgga taagtacatc ctgacgcac tgaacgatgc 1440 tctgggaatc taagcttact agagcgtggt gcgcacgata gcgcatagtg ttttctctc 1500 cactgaatc gagagatag acttacggtg taaatccgta ggggtggcgt aaaccaaatt 1560 acgcaatgtt ttgggttcca ttaatcga aaccccttat ttcctggatc acctgttaac 1620 gcacgtttga cgtgtattac agtgggaata agtaaaagtg agaggttcga atcctcccta 1680 accccggta ggggcccagc ggccgctta gctagagtca agcagatcgt tcaacattt 1740 ggcaataaag tttcttaaga ttgaatcctg tgccggtct tgcgatgat atcatataat 1800 ttctgttgaa ttacgttaag catgtaataa ttacatgta atgcatgacg ttatttga 1860 gatggggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaaaaaaaa 1920 tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatcgac 1980 ctgcatccac cccagtacat taaaaacgtc cgcaatgtgt tattaagttg tctaagcgtc 2040 aatttgttta caccacaata tatcctgcca ccagccagcc aacagctccc cgaccggcag 2100 ctcggcacaa aatcaccact cgatacaggc agcccatcag tcagatcagg atctcctttg 2160 cgacgctcac cgggctggtt gccctcgccg ctgggctggc ggccgtctat ggccctgcaa 2220 acgcgccaga aacgccgtcg aagccgtgtg cgagacaccg cggccgccgg cgttgtggat 2280 acctcgcgga aaacttggcc ctcactgaca gatgaggggc ggacgttgac acttgagggg 2340 ccgactcacc cggcgcggcg ttgacagatg aggggcaggc tcgatttcgg ccggcgacgt 2400 ggagctggcc agcctcgcaa atcggcgaaa acgcctgatt ttacgcgagt ttcccacaga 2460 tgatgtggac aagcctgggg ataagtgccc tgcggtattg acacttgagg ggcgcgacta 2520 ctgacagatg aggggcgcga tccttgacac ttgaggggca gagtgctgac agatgagggg 2580 cgcacctatt gacatttgag gggctgtcca caggcagaaa atccagcatt tgcaagggtt 2640 tccgcccgtt tttcggccac cgctaacctg tcttttaacc tgcttttaaa ccaatattta 2700 taaaccttgt ttttaaccag ggctgcgccc tgtgcgcgtg accgcgcacg ccgaaggggg 2760 gtgccccccc ttctcgaacc ctcccggccc gctaacgcgg gcctcccatc cccccagggg 2820 ctgcgcccct cggccgcgaa cggcctcacc ccaaaaatgg cagcgctggc caattcgtgc 2880 gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 2940 aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatggct aaaatgagaa 3000 tatcaccgga attgaaaaaa ctgatcgaaa aataccgctg cgtaaaagat acggaaggaa 3060 tgtctcctgc taaggtatat aagctggtgg gagaaaatga aaacctatat ttaaaaatga 3120 cggacagccg gtataaaggg accacctatg atgtggaacg ggaaaaggac atgatgctat 3180 ggctggaagg aaagctgcct gttccaaagg tcctgcactt tgaacggcat gatggctgga 3240 gcaatctgct catgagtgag gccgatggcg tcctttgctc ggaagagtat gaagatgaac 3300 aaagccctga aaagattatc gagctgtatg cggagtgcat caggctcttt cactccatcg 3360 acatatcgga ttgtccctat acgaatagct tagacagccg cttagccgaa ttggattact 3420 tactgaataa cgatctggcc gatgtggatt gcgaaaactg ggaagaagac actccattta 3480 aagatccgcg cgagctgtat gattttttaa agacggaaaa gcccgaagag gaacttgtct 3540 tttcccacgg cgacctggga gacagcaaca tctttgtgaa agatggcaaa gtaagtggct 3600 ttattgatct tgggagaagc ggcagggcgg acaagtggta tgacattgcc ttctgcgtcc 3660 ggtcgatcag ggaggatatc ggggaagaac agtatgtcga gctatttttt gacttactgg 3720 ggatcaagcc tgattgggag aaaataaaat attatatttt actggatgaa ttgttttagc 3780 tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta 3840 aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt 3900 tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 3960 tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 4020 gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 4080 agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 4140 tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 4200 ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 4260 cggggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 4320 tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg 4380 acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg 4440 gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat 4500 ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt 4560 tacggttcct ggcagatcct agatgtggcg caacgatgcc ggcgacaagc aggagcgcac 4620 cgacttcttc cgcatcaagt gttttggctc tcaggccgag gcccacggca agtatttggg 4680 caaggggtcg ctggtattcg tgcagggcaa gattcggaat accaagtacg agaggacgg 4740 ccagacggtc tacgggaccg acttcattgc cgataaggtg gattatctgg acaccaaggc 4800 accaggcggg tcaaatcagg aataagggca cattgccccg gcgtgagtcg gggcaatccc 4860 gcaaggaggg tgaatgaatc ggacgtttga ccggaaggca tacaggcaag aactgatcga 4920 cgcggggttt tccgccgagg atgccgaaac catcgcaagc cgcaccgtca tgcgtgcgcc 4980 ccgcgaaacc ttccagtccg tcggctcgat ggtccagcaa gctacggcca agatcgagcg 5040 cgacagcgtg caactggctc cccctgccct gcccgcgcca tcggccgccg tggagcgttc 5100 gcgtcgtctc gaacaggagg cggcaggttt ggcgaagtcg atgaccatcg acacgcgagg 5160 aactatgacg accaagaagc gaaaaaccgc cggcgaggac ctggcaaaac aggtcagcga 5220 ggccaagcag gccgcgttgc tgaaacacac gaagcagcag atcaaggaaa tgcagctttc 5280 cttgttcgat attgcgccgt ggccggacac gatgcgagcg atgccaaacg acacggcccg 5340 ctctgccctg ttcaccacgc gcaacaagaa aatcccgcgc gaggcgctgc aaaacaaggt 5400 cattttccac gtcaacaagg acgtgaagat cacctacacc ggcgtcgagc tgcgggccga 5460 cgatgacgaa ctggtgtggc agcaggtgtt ggagtacgcg aagcgcaccc ctatcggcga 5520 gccgatcacc ttcacgttct acgagctttg ccaggacctg ggctggtcga tcaatggccg 5580 gtattacacg aaggccgagg aatgcctgtc gcgcctacag gcgacggcga tgggcttcac 5640 gtccgaccgc gttgggcacc tggaatcggt gtcgctgctg caccgcttcc gcgtcctgga 5700 ccgtggcaag aaaacgtccc gttgccaggt cctgatcgac gaggaaatcg tcgtgctgtt 5760 tgctggcgac cactacacga aattcatatg ggagaagtac cgcaagctgt cgccgacggc 5820 ccgacggatg ttcgactatt tcagctcgca ccgggagccg tacccgctca agctggaaac 5880 cttccgcctc atgtgcggat cggattccac ccgcgtgaag aagtggcgcg agcaggtcgg 5940 cgaagcctgc gaagagttgc gaggcagcgg cctggtggaa cacgcctggg tcaatgatga 6000 cctggtgcat tgcaaacgct agggccttgt ggggtcagtt ccggctgggg gttcagcagc 6060 cagcgcctga tctggggaac cctgtggttg gcacatacaa atggacgaac ggataaacct 6120 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc 6180 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga 6240 tctaagctag cttggaattg gtaccacgcg tttcgacaaa atttagaacg aacttaatta 6300 tgatctcaaa tacattgata catatctcat ctagatctag gttatcatta tgtaagaaag 6360 ttttgacgaa tatggcacga caaaatggct agactcgatg taattggtat ctcaactcaa 6420 cattatactt ataccaaaca ttagttagac aaaatttaaa caactatttt ttatgtatgc 6480 aagagtcagc atatgtataa ttgattcaga atcgttttga cgagttcgga tgtagtagta 6540 gccattattt aatgtacata ctaatcgtga atagtgaata tgatgaaaca ttgtatctla 6600 ttgtataaat atccataaac acatcatgaa agacactttc tttcacggtc tgaattaatt 6660 atgatacaat tctaatagaa aacgaattaa attacgttga attgtatgaa atctaattga 6720 acaagccaac cacgacgacg actaacgttg cctggattga ctcggtttaa gttaaccact 6780 aaaaaaacgg agctgtcatg taacacgcgg atcgagcagg tcacagtcat gaagccatca 6840 aagcaaaaga actaatccaa gggctgagat gattaattag tttaaaaatt agttaacacg 6900 agggaaaagg ctgtctgaca gccaggtcac gttatcttta cctgtggtcg aaatgattcg 6960 tgtctgtcga ttttaattat ttttttgaaa ggccgaaaat aaagttgtaa gagataaacc 7020 cgcctatata aattcatata ttttcctctc cgctttgaag ttttagtttt attgcaacaa 7080 caacaacaaa ttacaataac aacaaacaaa atacaaacaa caacaacatg gcacaatttc 7140 aacaaacaat tgacatgcaa actctccaag ccgctgcggg acgcaacagc ttggtgaatg 7200 atttggcatc tcgtcgcgtt tacgataatg cagtcgagga gctgaatgct cgttccagac 7260 gtcccaaggt aataggaact ttctggatct actttatttg ctggatctcg atcttgtttt 7320 ctcaatttcc ttgagatctg gaattcgttt aatttggatc tgtgaacctc cactaaatct 7380 tttggtttta ctagaatcga tctaagttga ccgatcagtt agctcgatta tagctaccag 7440 aatttggctt gaccttgatg gagagatcca tgttcatgtt acctgggaaa tgatttgtat 7500 atgtgaattg aaatctgaac tgttgaagtt agattgaatc tgaacactgt caatgttaga 7560 ttgaatctga acactgttta aggttagatg aagtttgtgt atagattctt cgaaacttta 7620 ggatttgtag tgtcgtacgt tgaacagaaa gctatttctg attcaatcag ggtttatttg 7680 actgtattga actctttttg tgtgtttgca ggtccacttc tccaaggcag tgtctacgga 7740 acagaccctg attgcaacaa acgcatatcc ggagttcgag atttccttta ctcatacgca 7800 atccgctgtg cactccttgg ccggaggcct tcggtcactt gagttggagt atctcatgat 7860 gcaagttccg ttcggttctc tgacgtacga catcggcggt aacttttccg cgcacctttt 7920 caaagggcgc gattacgttc actgctgcat gcctaatctg gatgtacgtg acattgctcg 7980 ccatgaagga cacaaggaag ctatttacag ttatgtgaat cgtttgaaaa ggcagcagcg 8040 tcctgtgcct gaataccaga gggcagcttt caacaactac gctgagaacc cgcacttcgt 8100 ccattgcgac aaacctttcc aacagtgtga attgacgaca gcgtatggca ctgacaccta 8160 cgctgtagct ctccatagca tttatgatat ccctgttgag gagttcggtt ctgcgctact 8220 caggaagaat gtgaaaactt gtttcgcggc ctttcatttc catgagaata tgcttctaga 8280 ttgtgataca gtcacactcg atgagattgg agctacgttc cagaaatcag gtaacattcc 8340 ttagttacct ttcttttctt tttccatcat aagtttatag attgtacatg ctttgagatt 8400 tttctttgca aacaatctca ggtgataacc tgagcttctt cttccataat gagagcactc 8460 tcaattacac ccacagcttc agcaacatca tcaagtacgt gtgcaagacg ttcttccctg 8520 ctagtcaacg cttcgtgtac cacaaggagt tcctggtcac tagagtcaac acttggtact 8580 gcaagttcac gagagtggat acgttcactc tgttccgtgg tgtgtaccac aacaatgtgg 8640 attgcgaaga gttttacaag gctatggacg atgcgtggca ctacaaaaag acgttagcaa 8700 tgcttaatgc cgagaggacc atcttcaagg ataacgctgc gttaaacttc tggttcccga 8760 aggtgctctt gaaattggaa gtcttctttt gttgtctaaa cctatcaatt tctttgcgga 8820 aatttattg aagctgtaga gttaaaattg agtcttttaa acttttgtag gtgagagaca 8880 tggttatcgt ccctctcttt gacgcttcta tcacaactgg taggatgtct aggagagagg 8940 ttatggtgaa caaggacttc gtctacacgg tcctaaatca catcaagacc tatcaagcta 9000 aggcactgac gtacgcaaac gtgctgagct tcgtggagtc tattaggtct agagtgataa 9060 ttaacggtgt cactgccagg taagttgtta cttatgattg ttttcctctc tgctacatgt 9120 atttgttgt tcatttctgt aagatataag aattgagttt tcctctgatg atattattag 9180 gtctgaatgg gacacagaca aggcaattct aggtccatta gcaatgacat tcttcctgat 9240 cacgaagctg ggtcatgtgc aagatgaaat aatcctgaaa aagttccaga agttcgacag 9300 aaccaccaat gagctgattt ggacaagtct ctgcgatgcc ctgatggggg ttattccctc 9360 ggtcaaggag acgcttgtgc gcggtggttt tgtgaaagta gcagaacaag ccttagagat 9420 caaggttagt atcatatgaa gaaataccta gtttcagttg atgaatgcta ttttctgacc 9480 tcagttgttc tcttttgaga attatttctt ttctaatttg cctgattttt ctattaattc 9540 attaggttcc cgagctatac tgtaccttcg ccgaccgatt ggtactacag tacaagaagg 9600 cggaggagtt ccaatcgtgt gatctttcca aacctctaga agagtcagag aagtactaca 9660 acgcattatc cgagctatca gtgcttgaga atctcgactc ttttgactta gaggcgttta 9720 agactttatg tcagcagaag aatgtggacc cggatatggc agcaaaggta aatcctggtc 9780 cacactttta cgataaaaac acaagatttt aaactatgaa ctgatcaata atcattccta 9840 aaagaccaca cttttgtttt gtttctaaag taatttttac tgttataaca ggtggtcgta 9900 gcaatcatga agtcagaatt gacgttgcct ttcaagaaac ctacagaaga ggaaatctcg 9960 gagtcgctaa aaccaggaga ggggtcgtgt gcagagcata aggaagtgtt gagcttacaa 10020 aatgatgctc cgttcccgtg tgtgaaaaat ctagttgaag gttccgtgcc ggcgtatgga 10080 atgtgtccta agggtggtgg tttcgacaaa ttggatgtgg acattgctga tttccatctc 10140 aagagtgtag atgcagttaa aaagggaact atgatgtctg cggtgtacac agggtctatc 10200 aaagttcaac aaatgaagaa ctacatagat tacttaagtg cgtcgctggc agctacagtc 10260 tcaaacctct gcaaggtaag aggtcaaaag gtttccgcaa tgatccctct ttttttgttt 10320 ctctagtttc aagaatttgg gtatatgact aacttctgag tgttccttga tgcatatttg 10380 tgatgagaca aatgtttgtt ctatgtttta ggtgcttaga gatgttcacg gcgttgaccc 10440 agagtcacag gagaaatctg gagtgtggga tgttaggaga ggacgttggt tacttaaacc 10500 taatgcgaaa agtcacgcgt ggggtgtggc agaagacgcc aaccacaagt tggttattgt 10560 gttactcaac tgggatgacg gaaagccggt ttgtgatgag acatggttca gggtggcggt 10620 gtcaagcgat tccttgatat attcggatat gggaaaactt aagacgctca cgtcttgcag 10680 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 ttgtggaaaa acgaaggaga ttatcgaaaa ggtaagttct gcatttggtt atgctccttg 10800 gaaatctgta gtatttggcg tgaaatgagt ttgctttttg gtttctcccg tgttataggt 11400 gcccggctga tgttacgtat ttccttaaca agaagtatga cggggcggtg atgtgtacca 11460 gcgcggtaga gagatccgtg aaggcagaag tggtgagagg aaagggtgca ttgaacccaa 11520 taaccttacc gttggagggt aaaattttga ccttcacaca agctgacaag ttcgagttac 11580 tggagaaggg ttacaaggta aagtttccaa ctttccttta ccatatcaaa ctaaagttcg 11640 aaacttttta tttgatcaac ttcaaggcca cccgatcttt ctattcctga ttaatttgtg 11700 atgaatccat attgactttt gatggttacg caggatgtga acactgtgca cgaggtgcaa 11760 ggggagacgt acgagaagac tgctattgtg cgcttgacat caactccgtt agagatcata 11820 tcgagtgcgt cacctcatgt tttggtggcg ctgacaagac acacaacgtg ttgtaaatat 11880 tacaccgttg tgttggaccc gatggtgaat gtgatttcag aaatggagaa gttgtccaat 11940 ttccttcttg acatgtatag agttgaagca ggtctgtctt tcctatttca tatgtttaat 12000 cctaggaatt tgatcaattg attgtatgta tgtcgatccc aagactttct tgttcactta 12060 tatcttaact ctctctttgc tgtttcttgc aggtgtccaa tagcaattac aaatcgatgc 12120 agtattcagg ggagaact tgtttgttca gacgcccaag tcaggagatt ggcgagatat 12180 gcaattttac tatgacgctc ttcttccccgg aaacagtact attctcaatg aatttgatgc 12240 tgttacgatg aatttgaggg atatttcctt aaacgtcaaa gattgcagaa tcgactttc 12300 caaatccgtg caacttccta aagaacaacc tattttcctc aagcctaaaa taagaactgc 12360 ggcagaaatg ccgagaactg caggtaaaat attggatgcc agacgatatt ctttcttttg 12420 atttgtaact ttttcctgtc aaggtcgata aattttatt tttttggtaa aaggtcgata 12480 attttttttt ggagccatta tgtaattttc ctaattaact gaaccaaaat tatacaaacc 12540 aggtttgctg gaaatttgg ttgcaatgat caaaagaaac atgaatgcgc cggatttgac 12600 agggacaatt gacattgagg atactgcatc tctggtggtt gaaaagttt gggattcgta 12660 12720 gtaaggactt ctcatgaata ttagtggcag attagtgttg ttaaagtctt tggttagata 12780 atcgatgcct cctaattgtc catgttttac tggttttcta caattaaagg tggctttcga 12840 aacaagagtc atctacagtt ggtcagttag cggactttaa ctttgtggat ttgccggcag 12900 tagatgagta caagcatatg atcaagagtc aaccaaagca aaagttagac ttgagtattc 12960 aagacgaata tcctgcattg cagacgatag tctaccattc gaaaaagatc aatgcgattt 13020 tcggtccaat gttttcagaa cttacgagga tgttactcga aaggattgac tcttcgaagt 13080 ttctgttcta caccagaaag acacctgcac aaatagagga cttcttttct gacctagact 13140 caacccaggc gatggaaatt ctggaactcg acatttcgaa gtacgataag tcacaaaacg 13200 agttccattg tgctgtagag tacaagatct gggaaaagtt aggaattgat gagtggctag 13260 ctgaggtctg gaaacaaggt gagttcctaa gttccatttt tttgtaatcc ttcaatgtta 13320 ttttaacttt tcagatcaac atcaaaatta ggttcaattt tcatcaacca aataatattt 13380 ttcatgtata tataggtcac agaaaaacga ccttgaaaga ttatacggcc ggaatcaaaa 13440 catgtctttg gtatcaaagg aaaagtggtg atgtgacaac ctttattggt aataccatca 13500 tcattgccgc atgtttgagc tcaatgatcc ccatggacaa agtgataaag gcagcttttt 13560 gtggagacga tagcctgatt tacattccta aaggtttaga cttgcctgat attcaggcgg 13620 gcgcgaacct catgtggaac ttcgaggcca aactcttcag gaagaagtat ggttacttct 13680 gtggtcgtta tgttattcac catgatagag gagccattgt gtattacgat ccgcttaaac 13740 tatatctaa gttaggttgt aaacatatta gagatgttgt tcacttagaa gagttacgcg 13800 agtctttgtg tgatgtagct agtaacttaa ataattgtgc gtatttttca cagttagatg 13860 aggccgttgc cgaggttcat aagaccgcgg taggcggttc gtttgctttt tgtagtataa 13920 ttaagtattt gtcagataag agattgttta gagatttgtt ctttgtttga taatgtcgat 13980 agtctcgtac gaacctaagg tgagtgattt cctcaatctt tcgaagaagg aagagatctt 14040 gccgaaggct ctaacgaggt taaaaaccgt gtctattagt actaaagata ttatatctgt 14100 caaggagtcg gagactttgt gtgatataga tttgttaatc aatgtgccat tagataagta 14160 tagatatgtg ggtatcctag gagccgtttt taccggagag tggctagtgc cagacttcgt 14220 taaaggtgga gtgacgataa gtgtgataga taagcgtctg gtgaactcaa aggagtgcgt 14280 gattggtacg tacagagccg cagccaagag taagaggttc cagttcaaat tggttccaaa 14340 ttactttgtg tccaccgtgg acgcaaagag gaagccgtgg caggtaagga tttttatgat 14400 atagtatgct tatgtatttt gtactgaaag catatcctgc ttcattggga tattactgaa 14460 agcatttaac tacatgtaaa ctcacttgat gatcaataaa cttgattttg caggttcatg 14520 ttcgtataca agacttgaag attgaggcgg gttggcagcc gttagctctg gaagtagtttt 14580 cagttgctat ggtcaccaat aacgttgtca tgaagggtttt gagggaaaag gtcgtcgcaa 14640 taaatgatcc ggacgtcgaa ggtttcgaag gtaagccatc ttcctgctta tttttataat 14700 gaacatagaa ataggaagtt gtgcagagaa actaattaac ctgactcaaa atctaccctc 14760 ataattgttg tttgatattg gtcttgtatt ttgcaggtgt ggttgacgaa ttcgtcgatt 14820 cggttgcagc atttaaagcg gttgacaact ttaaaagaag gaaaaagaag gttgaagaaa 14880 agggtgtagt aagtaagtat aagtacagac cggagaagta cgccggtcct gattcgttta 14940 atttgaaaga agaaaacgtc ttacaacatt acaaacccga atcagtacca gtatttcgat 15000 aagaaacaag aaac 15014 <210> twenty four <211> 11586 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Nucleotide sequence of a binary PVX-based vector for expressing Salmonella ImmScoIE2 <400> twenty four gatcggtcgt atcactggaa caacaaccgc tgaggctgtt gtcactctac caccaccata 60 actacgtcta cataaccgac gcctacccca gtttcatagt attttctggt ttgattgtat 120 gaataatata aataaaaaaa aaaaaaaaaa aaaaaaacta gtgagctctt ctgtcagcgg 180 gcccactgca tccaccccag tacattaaaa acgtccgcaa tgtgttatta agttgtctaa 240 gcgtcaattt gtttacacca caatatatcc tgccaccagc cagccaacag ctccccgacc 300 ggcagctcgg cacaaaatca ccactcgata caggcagccc atcagtcaga tcaggatctc 360 ctttgcgacg ctcaccgggc tggttgccct cgccgctggg ctggcggccg tctatggccc 420 tgcaaacgcg ccagaaacgc cgtcgaagcc gtgtgcgaga caccgcggcc gccggcgttg 480 tggatacctc gcggaaaact tggccctcac tgacagatga ggggcggacg ttgacactlg 540 aggggccgac tcacccggcg cggcgttgac agatgagggg caggctcgat ttcggccggc 600 gacgtggagc tggccagcct cgcaaatcgg cgaaaacgcc tgattttacg cgagtttccc 660 acagatgatg tggacaagcc tggggataag tgccctgcgg tattgacact tgaggggcgc 720 gactactgac agatgagggg cgcgatcctt gacactlgag gggcagagtg ctgacagatg 780 aggggcgcac ctattgacat ttgaggggct gtccacaggc agaaaatcca gcatttgcaa 840 gggtttccgc ccgtttttcg gccaccgcta acctgtcttt taacctgctt ttaaaccaat 900 atttataaac cttgttttta accagggctg cgccctgtgc gcgtgaccgc gcacgccgaa 960 ggggggtgcc cccccttctc gaaccctccc ggcccgctaa cgcgggcctc ccatcccccc 1020 aggggctgcg cccctcggcc gcgaacggcc tcaccccaaa aatggcagcg ctggccaatt 1080 cgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat 1140 gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta tggctaaaat 1200 gagaatatca ccggaattga aaaaactgat cgaaaaatac cgctgcgtaa aagatacgga 1260 aggaatgtct cctgctaagg tatataagct ggtgggagaa aatgaaaacc tatatttaaa 1320 aatgacggac agccggtata aagggaccac ctatgatgtg gaacgggaaa aggacatgat 1380 gctatggctg gaaggaaagc tgcctgttcc aaaggtcctg cactttgaac ggcatgatgg 1440 ctggagcaat ctgctcatga gtgaggccga tggcgtcctt tgctcggaag agtatgaaga 1500 tgaacaaagc cctgaaaaga ttatcgagct gtatgcggag tgcatcaggc tctttcactc 1560 catcgacata tcggattgtc cctatacgaa tagcttagac agccgcttag ccgaattgga 1620 ttacttactg aataacgatc tggccgatgt ggattgcgaa aactgggaag aagacactcc 1680 atttaaagat ccgcgcgagc tgtatgattt tttaaagacg gaaaagcccg aagaggaact 1740 tgtcttttcc cacggcgacc tgggagacag caacatcttt gtgaaagatg gcaaagtaag 1800 tggctttatt gatcttggga gaagcggcag ggcggacaag tggtatgaca ttgccttctg 1860 cgtccggtcg atcagggagg atatcgggga agaacagtat gtcgagctat tttttgactt 1920 actggggatc aagcctgatt gggagaaaat aaaatattat attttactgg atgaattgtt 1980 ttagctgtca gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta 2040 atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg 2100 tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga 2160 tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt 2220 ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag 2280 agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa 2340 ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag 2400 tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca 2460 GCGGTCGGGC TGAACGGGGG TTCGTGCACA CAGCCCAGCT TGGAGCGAAC TACAC 2520 CGAAGTGGTA CCGTACAGCA GCTCGAGAAT ATCGGAGGTA TATGCTGCGT 2400 GGCAGAGAAG ATGCGGAGCA GCGGAGAAGA GCGGAGAAGA GCGGAGAAGA GCGGAGAAG 60 GGGGGAAACG CCTGCTATCT TTATAGTCCT GTCGGGTTTC GCCACCTCTG ACTTGAGCG 2700 TCGATTTTTT GTGATGCTCG TCAGGGGGGC GGAGCCTATG GAAAAACGCC AGCAACGC 2760 CTTTTTACGG TTCCTGGCAG ATCCTAGATG TGGCGCAACG ATGCCGGCGA CAAGCAGGA 2820 CGCACC GACTTCTTCCGCAT CAAGTGTTTT GGCTCTCAGG CC GAGGCCCA C GGCAAGTAT 2880 TTGGGCAAGG GTCGCTGGTA TTCGTGCAGG GCAAGATTCG GAATACCAA GTACGAGAAG 2940 GACGGCCAGA CGGTCTACGG GACC GACTTC ATTCGCCGATA AGGTGGATAT CTGGACACC 3000 AAGGCACCAG GC GGTTCAAAT CAGGAATAAG GGCACCTTG CCCCGGC GTG AGTCGGGGC A 3060 ATCCCGCAAG GAGGTTAATG AATCGGACGT TTGACCGGAA GGCATA CAG GCAAGA ACTG 3120 ATCGACGCGG GGTTC CGCC GAGGATGCC GAAACC ATCG CAAGCCGCAC C GTCATGC GT 3180 GCGGCCGCGAAACCTTCCAGTCCGTGGCCTCGATGGTCCAGCAAGCTACGGCCAAGATC 3240 GAGCGCGACAGCGTGCAACTGGCTCCCCCTGCCCGCGCCATCGGC CGCCGTGGAG 3300 CGTTTGGCGTCGTCTCGAACAGGAGGCAGGTCTTGGCGAAGTCGATGACCATCGACACG 3360 CGAGGAAC TATGACGACCAAGAAGCGAAAAACC GCCGGCGAGGACCTGGCAAACAGGTC 3420 AGCGAGGCCAAGCAGGCCGCGTTGCTGAAACACACGAAGCAGCAGATCAAGGAAATGCAG 3480 CTTT CCTTGTTCGATATTGCGCCGTGGCCGGACACGATGCGAGCGATGCCAAACGACACG 3540 GCCC GCTCTGCCCTGTTCACCACGC GCAACAAGAAAATCCC GC GCGAGGC GCTGCAA A AC 3600 AAGGTCATTTTCCACGTCAACAAGGACGTGAAGATCACCTACACCGGCGTCGAGCTGCGG 3660 GCCGACGATGACGAACTGGTGTGGCAGCAGGTGTTGGAGTACGC GAAGCGCACCCCTATC 3720 GGCGAGCCGATCACCTTCACGTTCTACGAGCTTTGCCAGGACCTGGGCTGGTCGATCAAT 3780 GGCCGGTATTACACGAAGGCCGAGGAATGCCTGTCGCGCCTACAGGC GACGC GATGGGC 3840 TTTACGTCCGACC GC GTTGGGCACCTGGAA TCGGTGTCGCTGCTGC ACCGC TTCCGC GTC 3900 ctggaccgtg gcaagaaaac gtcccgttgc caggtcctga tcgacgagga aatcgtcgtg 3960 ctgtttgctg gcgaccacta cacgaaattc atatgggaga agtaccgcaa gctgtcgccg 4020 acggcccgac ggatgttcga ctatttcagc tcgcaccggg agccgtaccc gctcaagctg 4080 gaaaccttcc gcctcatgtg cggatcggat tccacccgcg tgaagaagtg gcgcgagcag 4140 gtcggcgaag cctgcgaaga gttgcgaggc agcggcctgg tggaacacgc ctgggtcaat 4200 gatgacctgg tgcattgcaa acgctagggc cttgtggggt cagttccggc tgggggttca 4260 gcagccagcg cctgatctgg ggaaccctgt ggttggcaca tacaaatgga cgaacggata 4320 aaccttttca cgccctttta aatatccgat tattctaata aacgctcttt tctcttaggt 4380 ttacccgcca atatatcctg tcaaacactg atagtttaaa ctgaaggcgg gaaacgacaa 4440 tctgatctaa gctaggcatg cctgcaggtc aacatggtgg agcacgacac gcttgtctac 4500 tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 4560 agggtaatat ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg 4620 aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 4680 atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 4740 atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 4800 tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 4860 taaggaagtt catttcattt ggagaggaga aaactaaacc atacaccacc aacacaacca 4920 aacccaccac gcccaattgt tacacacccg cttgaaaaag aaagtttaac aaatggccaa 4980 ggtgcgcgag gtttaccaat cttttacaga ctccaccaca aaaactctca tccaagatga 5040 ggcttataga aacattcgcc ccatcatgga aaaacacaaa ctagctaacc cttacgctca 5100 aacggttgaa gcggctaatg atctagaggg gttcggcata gccaccaatc cctatagcat 5160 tgaattgcat acacatgcag ccgctaagac catagagaat aaacttctag aggtgcttgg 5220 ttccatccta ccacaagaac ctgttacatt tatgtttctt aaacccagaa agctaaacta 5280 catgagaaga aacccgcgga tcaaggacat tttccaaaat gttgccattg aaccaagaga 5340 CGTAGCCAGG TACCCC AAGG AAACAATAAT TGACAAACTC ACAGAGATCA CAACGGAAAC 5400 AGCATACACT AGTGACACTC TGC ACTTCTT GGATCCGAGC TACATAGTGG AGACATTC CA 5460 AAACTGCCCA AAATTGCAAA CATTGTATGC GACCTTAGTT CTCCCCGTTC AGGCAGCCTT 5520 TA AAATGGAA AGC ACTCACC CGA ACATAT AC AGCCTCAAAT ACTTCGGAG ATGGTTTCCA 5580 GTATATACCA GGCAACCATG GTGGCGGGC ATACCATCAT GAATTCGCT CATCTACAAT G 5640 GCTCAAAGTG GGAAAGATCA AGTGGAGGAC CCC AAGGAT AGCTTTCTCG GACATCTCAA 5700 TTACACGACT GAGCAGGTTG AGATGCACAC AGTGACAGTA CAGTTGCAGG AATCGTTG C 5760 GGCAAACCAC TTGTACTGCA TCAGGAGAGG AGACTTGCTC ACACCGGAGG TGC GC ACTT 5820 C GGCC AACCCT GACAGGTACG TGATTCCACC ACAGATCTTC CTCCCAAAG TTCACAAC TG 5880 CAAGAAGCCG ATTCTCAAGA AACTATGATG CAGCTCTTCT TGTA TGT TAGGACAGT CAA 5940 GGTCGCAA AAAATTGTGAC ATTTTTGCCA AAGTCAGACA ATTAATTAAT CATCTGACTT 6000 GGACAAATAC TCTGCTGTGG AACTGGTTTA CTTAGTAAGC TACATGGAGT TCCTTGCCGA 6060 tttacaagct accacctgct tctcagacac actttctggt ggcttgctaa caaagaccct 6120 tgcaccggtg agggcttgga tacaagagaa aaagatgcag ctgtttggtc ttgaggacta 6180 cgcgaagtta gtcaaagcag ttgatttcca cccggtggat ttttctttca aagtggaaac 6240 ttgggacttc agattccacc ccttgcaagc gtggaaagcc ttccgaccaa gggaagtgtc 6300 ggatgtagag gaaatggaaa gtttgttctc agatggggac ctgcttgatt gcttcacaag 6360 aatgccagct tatgcggtaa acgcagagga agatttagct gcaatcagga aaacgcccga 6420 gatggatgtc ggtcaagaag ttaaagagcc tgcaggagac agaaatcaat actcaaaccc 6480 tgcagaaact ttcctcaaca agctccacag gaaacacagt agggaggtga aacaccaggc 6540 cgcaaagaaa gctaaacgcc tagctgaaat ccaggagtca atgagagctg aaggtgatgc 6600 cgaaccaaat gaaataagcg ggacgatggg ggcaataccc agcaacgccg aacttcctgg 6660 cacgaatgat gccagacaag aactcacact cccaaccact aaacctgtcc ctgcaaggtg 6720 ggaagatgct tcattcacag attctagtgt ggaagaggag caggttaaac tccttggaaa 6780 agaaaccgtt gaaacagcga cgcaacaagt catcgaagga cttccttgga aacactggat 6840 tcctcaatta aatgctgttg gattcaaggc gctggaaatt cagagggata ggagtggaac 6900 aatgatcatg cccatcacag aaatggtgtc cgggctggaa aaagaggact tccctgaagg 6960 aactccaaaa gagttggcac gagaattgtt cgctatgaac agaagccctg ccaccatccc 7020 tttggacctg cttagagcca gagactacgg cagtgatgta aagaacaaga gaattggtgc 7080 catcacaaag acacaggcaa cgagttgggg cgaatacttg acaggaaaga tagaaagctt 7140 aactgagagg aaagttgcga cttgtgtcat tcatggagct ggaggttctg gaaaaagtca 7200 tgccatccag aaggcattga gagaaattgg caagggctcg gacatcactg tagtcctgcc 7260 gaccaatgaa ctgcggctag attggagtaa gaaagtgcct aacactgagc cctatatgtt 7320 caagacctct gaaaaggcgt taattggggg aacaggcagc atagtcatct ttgacgatta 7380 ctcaaaactt cctcccggtt acatagaagc cttagtctgt ttctactcta aaatcaagct 7440 aatcattcta acaggagata gcagacaaag cgtctaccat gaaactgctg aggacgcctc 7500 catcaggcat ttgggaccag caacagagta cttctcaaaa tactgccgat actatctcaa 7560 tgccacacac cgcaacaaga aagatcttgc gaacatgctt ggtgtctaca gtgagagaac 7620 gggagtcacc gaaatcagca tgagcgccga gttcttagaa ggaatcccaa ctttggtacc 7680 ctcggatgag aagagaaagc tgtacatggg caccgggagg aatgacacgt tcacatacgc 7740 tggatgccag gggctaacta agccgaaggt acaaatagtg ttggaccaca acacccaagt 7800 gtgtagcgcg aatgtgatgt acacggcact ttctagagcc accgatagga ttcacttcgt 7860 gaacacaagt gcaaattcct ctgccttctg ggaaaagttg gacagcaccc cttacctcaa 7920 gactttccta tcagtggtga gagaacaagc actcagggag tacgagccgg cagaggcaga 7980 gccaattcaa gagcctgagc cccagacaca catgtgtgtc gagaatgagg agtccgtgct 8040 agaagagtac aaagaggaac tcttggaaaa gtttgacaga gagatccact ctgaatccca 8100 tggtcattca aactgtgtcc aaactgaaga cacaaccatt cagttgtttt cgcatcaaca 8160 agcaaaagat gagactctcc tctgggcgac tatagatgcg cggctcaaga ccagcaatca 8220 agaaacaaac ttccgagaat tcctgagcaa gaaggacatt ggggacgttc tgtttttaaa 8280 ctaccaaaaa gctatgggtt tacccaaaga gcgtattcct ttttcccaag aggtctggga 8340 agcttgtgcc cacgaagtac aaagcaagta cctcagcaag tcaaagtgca acttgatcaa 8400 tgggactgtg agacagagcc cagacttcga tgaaaataag attatggtat tcctcaagtc 8460 gcagtgggtc acaaaggtgg aaaaactagg tctacccaag attaagccag gtcaaaccat 8520 agcagccttt taccagcaga ctgtgatgct ttttggaact atggctaggt acatgcgatg 8580 gttcagacag gctttccagc caaaagaagt cttcataaac tgtgagacga cgccagatga 8640 catgtctgca tgggccttga acaactggaa tttcagcaga cctagcttgg ctaatgacta 8700 cacagctttc gaccagtctc aggatggagc catgttgcaa tttgaggtgc tcaaagccaa 8760 acaccactgc ataccagagg aaatcattca ggcatacata gatattaaga ctaatgcaca 8820 gattttccta ggcacgttat caattatgcg cctgactggt gaaggtccca cttttgatgc 8880 aaacactgag tgcaacatag cttacaccca tacaaagttt gacatcccag ccggaactgc 8940 tcaagtttat gcaggagacg actccgcact ggactgtgtt ccagaagtga agcatagtttt 9000 ccacaggctt gaggacaaat tactcctaaa gtcaaagcct gtaatcacgc agcaaaagaa 9060 gggcagttgg cctgagtttt gtggttggct gatcacacca aaaggggtga tgaaagacccc 9120 aattaagctc catgttagct taaattggc tgaagctaag ggtgaactca agaaatgtca 9180 agattcctat gaaattgatc tgagttatgc ctatgaccac aaggactctc tgcatgactt 9240 gttcgatgag aaacagtgtc aggcacacac actcacttgc agaacactaa tcaagtcagg 9300 gagaggcact gtctcacttt cccgcctcag aaactttctt taaccgttaa gttaccttag 9360 agatttgaat aagatgtcag caccagctag tacaacacag cccatagggt caactacctc 9420 aactaccaca aaaactgcag gcgcaactcc tgccacagct tcaggcctgt tcactatccc 9480 ggatggggat ttctttagta cagcccgtgc catagtagcc agcaatgctg tcgcaacaaa 9540 tgaggacctc agcaagattg aggctatttg gaaggacatg aaggtgccca cagacactat 9600 ggcacaggct gcttgggact tagtcagaca ctgtgctgat gtagcatcat ccgctcaaac 9660 agaaatgata gatacaggtc cctattccaa cggcatcagc agagctagac tggcagcagc 9720 attaaagag gtgtgcacac ttaggcaatt ttgcatgaag tatgccccag tggtatggaa 9780 ctggatgtta actaacaaca gtccacctgc taactggcaa gcacaaggtt tcaagcctga 9840 gcacaaattc gctgcattcg acttcttcaa tggagtcacc aacccagctg ccatcatgcc 9900 caaagagggg ctcatccggc caccgtctga agctgaaatg aatgctgcc aaactgctgc 9960 cttgtgaag attacaaagg ccagggcaca atccaacgac tttgccagcc tagatgcagc 10020 tgtcactcga ggaaggatca ccggaacgac cacagcagag gcagtcgtta ctctgcctcc 10080 tccataacag aaactttctt taaccgttaa gttaccttag agatttgaat aagatggata 10140 ttctcatcag tagttgaaa agtttaggtt attctaggac ttccaaatct ttagattcag 10200 gacctttggt agtacatgca gtagccggag ccggtaagtc cacagcccta aggaagttga 10260 tcctcagaca cccaacattc accgtgcata cactcggtgt ccctgacaag gtgagtatca 10320 gaactagagg catacagaag ccaggaccta ttcctgaggg caacttcgca atcctcgatg 10380 agtatacttt ggacaacc acaaggaact cataccaggc actttttgct gacccttatc 10440 aggcaccgga gtttagccta gagccccact tctacttgga aacatcattt cgagttccga 10500 ggaaagtggc agatttgata gctggctgtg gcttcgattt cgagacgaac tcaccggaag 10560 aagggcactt agagatcact ggcatattca aagggcccct actcggaaag gtgatagcca 10620 ttgatgagga gtctgagaca acactgtcca ggcatggtgt tgagtttgtt aagccctgcc 10680 aagtgacggg acttgagttc aaagtagtca ctattgtgtc tgccgcacca atagaggaaa 10740 ttggccagtc cacagctttc tacaacgcta tcaccaggtc aaagggattg acatatgtcc 10800 gcgcagggcc ataggctgac cgctccggtc aattctgaaa aagtgtacat agtattaggt 10860 ctatcatttg cttagtttc aattacctt ctgctttcta gaaatagctt accccacgtc 10920 ggtgacaaca ttcacagctt gccacacgga ggagcttaca gagacggcac caaagcaatc 10980 ttgtacaact ccccaaatct agggtcacga gtgagtctac acaacggaaa gaacgcagca 11040 tttgctgccg tttgctact gactttgctg atctatggaa gtaaatacat atctcaacgc 11100 aatcatactt gtgcttgtgg taacaatcat agcagtcatt agcacttcct tagtgaggac 11160 tgaaccttgt gtcatcaaga ttactgggga atcaatcaca gtgttggctt gcaaactaga 11220 tgcagaaacc ataagggcca ttgccgatct caagccactc tccgttgaac ggttaagttt 11280 ccattgatac tcgaaagagg tcagcaccag ctagcaacaa acaagaacat ggaactgaag 11340 aagtccatca gcgattacac cgaggctgag ttcaagaaga tcatcgaggc tatcatcaac 11400 tgcgagggtg atgagaaaac ccaggatgat aaccttgagt tcttcatcag ggtgaccgag 11460 tacccttctg gtagcgatct tatctactac cctgagggtg ataacgatgg tagcaccgag 11520 gcaattatca aagaaatcaa ggaatggagg gctgctaacg gtaagcctgg ttttaagcaa 11580 gcttaa 11586

Claims

1. A method for preventing or reducing contamination of a target object by Salmonella enterica ssp. enterica for non-therapeutic purposes, the method comprising contacting the target object with one or more proteins having an amino acid sequence of: (Ai) SEQ ID NO: 1, (A-ii) SEQ ID NO: 2, (A-iii) SEQ ID NO: 3, (A-iv) SEQ ID NO: 4, (Av) SEQ ID NO: 5, or (A-vi) SEQ ID NO:

6.

2. The method according to claim 1, wherein the protein is a protein of: -(A-iv).

3. The method according to claim 1, wherein the protein is a protein of: -(Av).

4. The method according to claim 1, wherein the target object is sprayed with the aqueous solution of the protein or immersed in the aqueous solution of the protein.

5. The method of claim 4, wherein the target is immersed in the aqueous solution of the protein for at least 10 seconds. The method of claim 4 , wherein the target is immersed in the aqueous solution of the protein for at least 1 minute.

7. The method of claim 4, wherein the target is immersed in the aqueous solution of the protein for at least 5 minutes.

8. The method according to any one of claims 1 to 7, wherein the target is food or animal feed.

9. The method according to any one of claims 1 to 7, wherein the target item is a whole animal carcass, meat, eggs, raw fruit or vegetables.

10. Use of a protein as defined in any one of claims 1 to 3 in the preparation of a medicament for treating infection with Salmonella enterica subspecies enterica.

11. A composition comprising a protein having the following amino acid sequence: (Ai) SEQ ID NO: 1, and (A-iv) SEQ ID NO:

4.

12. The composition according to claim 11, wherein the composition is a plant material or an extract thereof, wherein the plant material is a material from a plant having the ability to express the protein; or wherein the composition is an aqueous solution containing the protein.

13. The composition of claim 12, wherein the plant material is material from an edible plant having a nutrient that expresses the protein.

14. Use of a composition comprising one or more proteins in the preparation of a medicament for treating Salmonella enterica subspecies enterica infection, wherein the amino acid sequence of the protein is: (Ai) SEQ ID NO: 1, (A-ii) SEQ ID NO: 2, (A-iii) SEQ ID NO: 3, (A-iv) SEQ ID NO: 4, (Av) SEQ ID NO: 5, or (A-vi) SEQ ID NO: 6.

Images