Flow Cell

Abstract

An example of a flow cell includes: a substrate; a first primer set attached to a first region on the substrate, the first primer set including a non-cleavable first primer and a cleavable second primer; and a second primer set attached to a second region on the substrate, the second primer set including a cleavable first primer and a non-cleavable second primer.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 692,511, filed on June 29, 2018, and U.S. Provisional Application Serial No. 62 / 743,373, filed on October 9, 2018, the contents of each of which are incorporated herein by reference in their entirety.

[0003] Reference to a sequence listing

[0004] The sequence listing submitted herewith via EFS-Web is hereby incorporated by reference in its entirety. The file name is ILI172APCT_IP-1806-PCT_Sequence_Listing_ST25.txt, the file size is 551 bytes, and the file creation date is May 20, 2019. Technical Field

[0005] The present application relates to flow cells, kits comprising flow cells and methods for preparing flow cells. background

[0006] Some available platforms for nucleic acid sequencing utilize synthetic sequencing methods. Utilize this method, synthesize nascent chains, and detect the addition of every kind of monomer (such as nucleotide) to the growing chain optically and / or electrically. Because the template strand guides the synthesis of nascent chains, technicians can infer the sequence of template DNA from a series of nucleotide monomers added to the growing chain during the synthesis. In some instances, paired end sequencing can be used, wherein the forward strand is sequenced and removed, and then the reverse strand is constructed and sequenced.

[0007] introduction

[0008] The first aspect disclosed herein is a flow cell, comprising: a substrate; a first primer set attached to a first region on the substrate, the first primer set comprising a non-cleavable first primer and a cleavable second primer; and a second primer set attached to a second region on the substrate, the second primer set comprising a cleavable first primer and a non-cleavable second primer.

[0009] In an example of the first aspect, the first region includes a material having a first functional group; and the second region includes a material having a second functional group different from the first functional group.

[0010] In an example of the first aspect, the flow cell further includes a gap separating the first primer set and the second primer set.

[0011] In the example of the first aspect, the substrate includes depressions separated by gap regions; and each depression includes: a first region located in the first portion; and a second region located in the second portion. In one version of this example, the flow cell may also include a gap separating the first region from the second region. In another version of this example, the first region and the second region partially overlap. In still another version of this example, the first portion and the second portion have different depths. In another version of this example, the first region and the second region are different blocks of a block copolymer.

[0012] In an example of the first aspect, the substrate includes depressions separated by gap regions; each depression includes a first region; and the second region is located on at least some of the gap regions.

[0013] In an example of the first aspect, the first region comprises a first polymer, and the first primer set is grafted to the first polymer; and the second region comprises a second polymer, and the second primer set is grafted to the second polymer. In one version of this example, the flow cell further comprises a protective coating on the first primer set and on the first polymer. In another version of this example, the first polymer is a first layer on the substrate; the second polymer is a second layer on the first layer; the flow cell further comprises: a passivation resin on the second layer; and features defined in the passivation resin, the second polymer, and the first polymer; and the first primer set and the second primer set are each exposed at each feature.

[0014] In an example of the first aspect, the substrate comprises depressions separated by gap regions; each depression comprises: a first portion where the first region is located; and a second portion; and the flow cell further comprises a bead located in the second portion, wherein the second region is on the surface of the bead.

[0015] In the example of the first aspect, the cleavable first primer includes a first cleavage site, the cleavable second primer includes a second cleavage site, and the first cleavage site and the second cleavage site are of the same type. In one version of this example, the non-cleavable first primer, the cleavable second primer, the cleavable first primer and the non-cleavable second primer each include a corresponding joint; the first cleavage site of the first cleavable primer is located along its joint; and the second cleavage site of the second cleavable primer is located along its joint.

[0016] In the example of the first aspect, the cleavable first primer includes a first cleavage site, the cleavable second primer includes a second cleavage site, and the first cleavage site and the second cleavage site are of different types. In one version of this example, the non-cleavable first primer, the cleavable second primer, the cleavable first primer and the non-cleavable second primer each include a corresponding joint; the first cleavage site of the first cleavable primer is located along its joint; and the second cleavage site of the second cleavable primer is located along its joint.

[0017] In an example of the first aspect, the first primer set is attached to a first support structure; the first region is a first capture site attached to the first support structure; the second primer set is attached to a second support structure different from the first support structure; and the second region is a second capture site attached to the second support structure.

[0018] It should be understood that any features of the first aspect disclosed herein may be combined together in any desired manner and / or configuration.

[0019] A second aspect disclosed herein is a flow cell comprising: a first substrate; a first primer set attached to the first substrate, the first primer set comprising a non-cleavable first primer and a cleavable second primer; a second substrate opposite to the first substrate; and a second primer set attached to the second substrate, the second primer set comprising a cleavable first primer and a non-cleavable second primer.

[0020] It should be understood that any features of the second aspect can be combined in any desired manner. In addition, it should be understood that any combination of features of the first aspect and / or the second aspect can be used together and / or can be combined with any example disclosed herein.

[0021] The third aspect disclosed herein is a kit comprising a flow cell and a triggering fluid, wherein the flow cell comprises: a substrate comprising recesses separated by gap regions; a first polymer layer in each recess, wherein some functional groups of the first polymer layer are capped; a first primer set attached to other functional groups of the first polymer layer in each recess; and a second polymer layer on the gap regions; the triggering fluid comprises: a fluid carrier; and a second primer set different from the first primer set.

[0022] In an example of the third aspect, the first primer set includes a non-cleavable first primer and a cleavable second primer; and the second primer set includes a cleavable first primer and a non-cleavable second primer.

[0023] It should be understood that any feature of the third aspect can be combined in any desired manner. In addition, it should be understood that any combination of the features of the third aspect and / or the second aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0024] The fourth aspect disclosed herein is a method comprising introducing a template fluid into a flow cell, the flow cell comprising: a substrate comprising recesses separated by gap regions; a first polymer layer in each recess, wherein exposed functional groups of the first polymer layer are capped; a second primer set attached to the first polymer layer in each recess, the second primer set comprising a cleavable first primer and a non-cleavable second primer; and a second polymer layer on the gap regions; whereby templates from the template fluid are amplified to form clusters in at least some of the recesses; introducing a triggering fluid comprising a non-cleavable first primer and a cleavable second primer into the flow cell, whereby the non-cleavable first primer and the cleavable second primer are grafted to the second polymer layer; and initiating bridge amplification from the clusters to the non-cleavable first primer and the cleavable second primer, thereby forming second clusters on at least some of the gap regions.

[0025] It should be understood that any feature of the fourth aspect can be combined in any desired manner. In addition, it should be understood that any combination of the features of the fourth aspect and / or the third aspect and / or the second aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0026] The fifth aspect disclosed herein is a method comprising: introducing a template fluid into a flow cell, the flow cell comprising: a substrate comprising recesses separated by gap regions; a first polymer layer in each recess; a second primer set attached to the first polymer layer, the second primer set comprising a cleavable first primer and a non-cleavable second primer; an optional protective coating on the first polymer layer and the second primer set; a second polymer layer on the gap regions; and a first primer set attached to the second polymer layer, the first primer set comprising a non-cleavable first primer and a cleavable second primer; whereby templates from the template fluid are amplified to form clusters in at least some of the recesses and on at least some of the gap regions; and cleaving the cleavable first primer and the cleavable second primer.

[0027] It should be understood that any feature of the fifth aspect can be combined in any desired manner. In addition, it should be understood that any combination of the features of the fifth aspect and / or the third aspect and / or the second aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0028] The sixth aspect disclosed herein is a flow cell, comprising: a support; a patterned resin on the support, the patterned resin comprising a first recess and a second recess separated by a gap area, the first recess having a smaller opening size than the second recess; a first primer set attached to at least some of the first recesses; and functionalized beads respectively located in at least some of the second recesses, the functionalized beads comprising a second primer set attached to the surface of a core structure, wherein the second primer set is different from the first primer set.

[0029] In an example of the sixth aspect, the core structure of the functionalized bead is selected from the group consisting of silica, superparamagnetic material, polystyrene, and acrylate.

[0030] In an example of the sixth aspect, the patterning resin is selected from the group consisting of: polyhedral oligomeric silsesquioxane resin (POSS) based resin, epoxy resin, poly(ethylene glycol) resin, polyether resin, acrylic resin, acrylate resin, methacrylate resin and combinations thereof.

[0031] In an example of the sixth aspect, the flow cell further comprises polymers in the first recess and the second recess, and wherein the first primer set is attached to the polymers in at least some of the first recesses. In one version of this example, the functionalized beads are located on the polymers in at least some of the second recesses. In another version of this example, the first primer set is also attached to the polymers in at least some of the second recesses; and the functionalized beads are located on the first primer set in at least some of the second recesses.

[0032] In an example of the sixth aspect, the first primer set includes a first primer and a uracil-modified second primer; and the second primer set includes a uracil-modified first primer and a second primer.

[0033] It will be appreciated that any features of the sixth aspect disclosed herein may be combined together in any desired manner and / or configuration.

[0034] The seventh aspect disclosed herein is a flow cell, comprising: a support; a patterned resin on the support, the patterned resin comprising recesses separated by gap regions; a first primer set attached to at least some of the recesses; and functionalized beads placed in the at least some of the recesses so that at least some of the primers of the first primer set are exposed, the functionalized beads comprising a second primer set attached to the surface of a core structure, wherein the second primer set is different from the first primer set.

[0035] In an example of the seventh aspect, each recess includes a first portion and a second portion, wherein the first portion has a first opening size greater than or equal to the diameter of the functionalized bead, and the second portion has a second opening size less than the diameter of the functionalized bead; and the functionalized bead is located in the first portion of each recess in at least some of the recesses.

[0036] In an example of the seventh aspect, the core structure of the functionalized bead is selected from the group consisting of silica, superparamagnetic material, polystyrene, and acrylate.

[0037] In an example of the seventh aspect, the patterning resin is selected from the group consisting of caged polysilsesquioxane resin (POSS) based resins, epoxy resins, poly(ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof.

[0038] In an example of the seventh aspect, the flow cell further comprises a polymer in the depression. In one version of this aspect, the first primer set is attached to the portion of the polymer not occupied by the functionalized beads. In one example of this version, the first primer set is attached to the polymer in the depression; and the functionalized beads are located on some other primers of the first primer set.

[0039] It will be appreciated that any features of the seventh aspect disclosed herein may be combined together in any desired manner and / or configuration.

[0040] The eighth aspect disclosed herein is a method comprising: selectively applying a polymer to the recesses of a patterned resin on a support; grafting a first primer set to the polymer in at least some of the recesses; and before or after grafting the first primer set, depositing functionalized beads in i) a portion of each recess in at least some of the recesses, or in ii) a second recess having an opening size larger than an opening size of at least some of the recesses, wherein the functionalized beads include a second primer set attached to the surface of a core structure, wherein the first primer set and the second primer set are different.

[0041] In an example of the eighth aspect, prior to depositing the functionalized beads, the method further comprises forming the functionalized beads by attaching a second primer set to the core structure.

[0042] In an example of the eighth aspect, the portion of each recess in at least some of the recesses has an opening size greater than or equal to the diameter of each functionalized bead; the at least some of the recesses include a second portion interconnected with the portion, wherein the second portion has a second opening size smaller than the diameter of each functionalized bead; and the functionalized beads self-assemble into the portion of each recess in at least some of the recesses by size exclusion.

[0043] In an example of the eighth aspect, before selectively applying the polymer, the method further comprises forming a patterned resin on the support by: depositing a resin on the support; and patterning the resin using nanoimprint lithography.

[0044] It should be understood that any feature of the eighth aspect can be combined in any desired manner. In addition, it should be understood that any combination of the features of the eighth aspect and / or the seventh aspect and / or the sixth aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0045] The ninth aspect disclosed herein is a flow cell comprising: a support; a patterned resin on the support, the patterned resin comprising depressions separated by gap regions; a block copolymer on the patterned resin in the depressions, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer; and a primer attached to the block-specific functional group of at least one of the blocks.

[0046] In an example of the ninth aspect, the patterned resin is selected from the group consisting of: caged polysilsesquioxane resin (POSS) based resin, epoxy resin, poly (ethylene glycol) resin, polyether resin, acrylic resin, acrylate resin, methacrylate resin and a combination thereof. In one version of this example, the patterned resin is a POSS based resin, and wherein the POSS based resin is a cross-linked epoxy POSS resin. In another version of this example, the block copolymer comprises: a first block, wherein the first block comprises an acrylamide monomer having an amino group as its block-specific functional group; and a second block, wherein the second block comprises an azidoacetamidopentyl acrylamide monomer having an azido group as its block-specific functional group. In the example of this other version, the block copolymer is:

[0047]

[0048] wherein R is hydrogen or a polymer initiating species end group, n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. In yet another version of this example, the block copolymer is:

[0049]

[0050] wherein n is in the range from 1 to 10,000, and m is in the range from 1 to 10,000.

[0051] In an example of the ninth aspect, the patterning resin is an amorphous fluoropolymer. In one version of this example, the block copolymer comprises: a first block, the first block comprising a monomer having a trifluoromethyl group as its block-specific functional group; and a second block, the second block comprising a monomer having a primer grafting functional group as its block-specific functional group.

[0052] In an example of the ninth aspect, the block copolymer comprises: a first block, the first block comprising a monomer having a primer grafting functional group as its block-specific functional group; and a second block, the second block comprising a monomer that adjusts the interaction parameter to drive the phase separation of the first block and the second block. In one version of this example, the primer grafting functional group is an azido group; and the block-specific functional group of the monomer of the second block is selected from the group consisting of: an amino group, an alcohol group, an aryl group, and a charged group.

[0053] In an example of the ninth aspect, the block copolymer is a terpolymer comprising a first block, a second block, and a third block; the block-specific functional group of the first block is attached to a patterned resin; the block-specific functional group of the second block is attached to a primer; and the block-specific functional group of the third block is attached to another primer different from the primer or to an enzyme.

[0054] In an example of the ninth aspect, the block copolymer is a terpolymer comprising a first block, a second block, and a third block; the block-specific functional group of the first block is attached to a patterned resin; the block-specific functional group of the second block is attached to a primer; and the block-specific functional group of the third block affects the surface free energy of the block copolymer or affects the stability of the block copolymer.

[0055] In an example of the ninth aspect, the depression is selected from the group consisting of a well and a trench.

[0056] In an example of the ninth aspect, the patterning resin and the block copolymer each have a surface free energy ranging from about 25 mN / m to about 50 mN / m.

[0057] It should be understood that any feature of the ninth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the ninth aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0058] The tenth aspect disclosed herein is a flow cell, comprising: a support; a patterned caged polysilsesquioxane resin (POSS)-based resin on the support, the patterned POSS-based resin comprising depressions separated by gap regions; a separated block copolymer on the patterned POSS-based resin in the depressions, wherein one block of the separated block copolymer has a functional group attached to the patterned POSS-based resin and another block of the separated block copolymer has another functional group; and a primer attached to the other functional group.

[0059] In an example of the tenth aspect, the isolated block copolymer is selected from the group consisting of:

[0060]

[0061] wherein n is in the range from 1 to 10,000, and m is in the range from 1 to 10,000; and

[0062]

[0063] wherein R is hydrogen or a polymer initiating species end group, n ranges from 1 to 10,000, and m ranges from 1 to 10,000.

[0064] It should be understood that any feature of the tenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the tenth aspect and / or the ninth aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0065] The eleventh aspect disclosed herein is a method comprising: patterning a resin to form a patterned resin comprising recesses separated by gap regions; introducing a solution comprising a block copolymer into the patterned resin, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer; exposing the solution to solvent vapor annealing, whereby the block copolymer phase separates and self-assembles in the recesses; and grafting a primer to the block-specific functional group of at least one of the blocks.

[0066] In an example of the eleventh aspect, patterning the resin includes nanoimprint lithography.

[0067] In an example of the eleventh aspect, the solution comprising the block copolymer has a Flory-Huggins interaction parameter in a range from about 0.04 to about 0.30.

[0068] In an example of the eleventh aspect, before grafting, the method further comprises exposing the patterned resin to a curing process, the patterned resin comprising a phase-separated and self-assembled block copolymer in the recesses.

[0069] It should be understood that any feature of the eleventh aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the eleventh aspect and / or the tenth aspect and / or the ninth aspect and / or the first aspect can be used together and / or can be combined with any example disclosed herein.

[0070] The twelfth aspect disclosed herein is a method comprising: applying a first functionalized layer to a substrate; patterning the first functionalized layer to form a first functionalized region covered by a photoresist; applying a second functionalized layer to the photoresist and a portion of the substrate; stripping the photoresist and any second functionalized layer thereon; removing a portion of the second functionalized layer to form a second functionalized region adjacent to the first functionalized region; and attaching a first primer set to the first functionalized layer or the first functionalized region, and attaching a second primer set to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set.

[0071] In an example of the twelfth aspect, the attachment of the first primer set includes pre-grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer before applying the first functionalization layer; and the attachment of the second primer set includes pre-grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer before applying the second functionalization layer.

[0072] In an example of the twelfth aspect, the attachment of the first primer set includes grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer after the first functionalization layer is applied; and the attachment of the second primer set includes grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

[0073] In an example of the twelfth aspect, the method also includes: depositing a first self-assembled monolayer on the first functionalized area and depositing a second self-assembled monolayer on the second functionalized area, respectively; wherein the attachment of the first primer group includes grafting a non-cleavable first primer and a cleavable second primer to the first self-assembled monolayer; and wherein the attachment of the second primer group includes grafting a cleavable first primer and a non-cleavable second primer to the second self-assembled monolayer.

[0074] In an example of the twelfth aspect, wherein removing comprises: applying a second photoresist to the first functionalized region and a second portion of the second functionalized layer that will become the second functionalized region; and etching a portion of the second functionalized layer.

[0075] In an example of the twelfth aspect, the substrate includes a resin on a support; the resin includes recesses separated by gap regions; a first functionalized region is on a first portion of each recess; a second functionalized layer is on a second portion of each recess and the gap regions; and the removing includes polishing the second functionalized layer from the gap regions.

[0076] In an example of the twelfth aspect, the substrate includes a resin on a support; the resin includes multiple levels of recesses separated by gap areas; the first functionalized area is at the first level of each multi-level recess; and before applying the second functionalized layer, the method also includes: applying a sacrificial layer to portions of the photoresist and the resin; removing the sacrificial layer from portions of the resin; and removing areas of the resin from the multiple levels of recesses to produce areas adjacent to the first functionalized area; and applying the second functionalized layer to the sacrificial layer on the photoresist, to the areas, and to the gap areas.

[0077] It should be understood that any feature of the twelfth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the twelfth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0078] The thirteenth aspect disclosed herein is a method comprising: applying a first photoresist to a substrate so that the first substrate portion is exposed; applying a first functionalized layer to the photoresist and the first substrate portion; stripping the photoresist and any first functionalized layer thereon to form a first functionalized region on the first substrate portion; applying a second photoresist to the first functionalized region and the substrate so that the second substrate portion adjacent to the first functionalized region is exposed; applying a second functionalized layer to the second photoresist and the second substrate portion; stripping the second photoresist and any second functionalized layer thereon to form a second functionalized region adjacent to the first functionalized region; and attaching a first primer set to the first functionalized layer or the first functionalized region, and attaching a second primer set to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set.

[0079] In an example of the thirteenth aspect, the attachment of the first primer set includes pre-grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer before applying the first functionalization layer; and the attachment of the second primer set includes pre-grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer before applying the second functionalization layer.

[0080] In an example of the thirteenth aspect, the attachment of the first primer set includes grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer after the first functionalization layer is applied; and the attachment of the second primer set includes grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

[0081] In an example of the thirteenth aspect, the method also includes depositing a first self-assembled monolayer on the first functionalized area and depositing a second self-assembled monolayer on the second functionalized area, respectively; wherein the attachment of the first primer set includes grafting a non-cleavable first primer and a cleavable second primer to the first self-assembled monolayer; and wherein the attachment of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second self-assembled monolayer.

[0082] It should be understood that any feature of the thirteenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the thirteenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0083] A fourteenth aspect disclosed herein is a method, the method comprising: applying a first functionalized layer to a substrate, the substrate comprising grooves separated by gap regions and sacrificial material regions in a first portion of each groove; patterning the first functionalized layer to form a first functionalized region covered by a photoresist in a second portion of each groove; removing the sacrificial material region to expose the first portion of each groove; applying a second functionalized layer to the gap region, the first portion, and the photoresist; stripping the photoresist and any second functionalized layer thereon; The method comprises the steps of: removing any second functionalized layer in the gap region, thereby maintaining the second functionalized region in the first portion of each groove; applying a second photoresist in a pattern of spatially separated strips at least substantially perpendicular to the grooves; removing portions of the first functionalized region and the second functionalized region exposed between the spatially separated strips; removing the second photoresist; and attaching a first primer set to the first functionalized layer or the first functionalized region and attaching a second primer set to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set.

[0084] In an example of the fourteenth aspect, the attachment of the first primer set includes pre-grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer before applying the first functionalization layer; and the attachment of the second primer set includes pre-grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer before applying the second functionalization layer.

[0085] In an example of the fourteenth aspect, the attachment of the first primer set includes grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer after the first functionalization layer is applied; and the attachment of the second primer set includes grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

[0086] In an example of the fourteenth aspect, the substrate includes a second sacrificial material region in the second portion of each groove; the substrate, the sacrificial material region, and the second sacrificial material region have different etch rates; and before applying the first functionalization layer, the method also includes removing the second sacrificial material region from the second portion of each groove. In one version of this example, before removing the second sacrificial material region, the method also includes forming the sacrificial material region and the second sacrificial material region by: applying a sacrificial material to a substrate, the substrate including grooves separated by gap regions; removing a portion of the sacrificial material so that a region of the sacrificial material remains directly adjacent to each sidewall of each groove; applying a second sacrificial material to the substrate and the sacrificial material region; removing a portion of the second sacrificial material so that a region of the second sacrificial material remains directly adjacent to each sacrificial material region; and applying material to fill any space between the second sacrificial material regions. In one example of this version, the substrate is a multilayer substrate; the grooves are defined in the outermost layer of the multilayer substrate; and the material and the outermost layer are the same.

[0087] It should be understood that any feature of the fourteenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the fourteenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0088] A fifteenth aspect disclosed herein is a method comprising: applying a sacrificial material to a substrate including recesses separated by a first gap region, wherein each recess includes a deep portion and a shallow portion defined by a step portion, and wherein the sacrificial layer partially fills the deep portion; sequentially removing a portion of the sacrificial layer and a portion of the substrate to form a second gap region at least substantially flush with a remaining portion of the sacrificial layer, and removing the step portion to form a region adjacent to the remaining portion of the sacrificial layer; applying a first functionalization layer to the second gap region, the remaining portion of the sacrificial layer, and the region; applying a photoresist to the first functionalization layer; removing a portion of the photoresist; The invention relates to a method of removing a first functionalized layer and a lower portion of the first functionalized layer so that a remaining portion of the sacrificial layer and a second gap region are exposed and a portion of the first functionalized layer having a second portion of a photoresist thereon remains in the region; removing the remaining portion of the sacrificial layer to form a second region adjacent to a portion of the first functionalized region; applying a second functionalized layer to the region to form a second functionalized region; stripping off the second portion of the photoresist to form the first functionalized region; and attaching a first primer set to the first functionalized layer or the first functionalized region and attaching a second primer set to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set.

[0089] In an example of the fifteenth aspect, a second functionalization layer is also applied to the second portion of the photoresist and the second gap region; the first portion of the second functionalization layer is removed with the second portion of the photoresist; and the method also includes polishing the second functionalization layer from the second gap region.

[0090] In an example of the fifteenth aspect, the attachment of the first primer set includes pre-grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer before applying the first functionalization layer; and the attachment of the second primer set includes pre-grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer before applying the second functionalization layer.

[0091] In an example of the fifteenth aspect, the attachment of the first primer set includes grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer after the first functionalization layer is applied; and the attachment of the second primer set includes grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

[0092] It should be understood that any feature of the fifteenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the fifteenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0093] The sixteenth aspect disclosed herein is a method comprising: imprinting a multilayer substrate comprising: a support; a first functionalized layer on the support; a second functionalized layer on the first functionalized layer; and a passivation layer on the second functionalized layer; thereby forming features separated by gap regions of the passivation layer, wherein respective regions of the first functionalized layer and the second functionalized layer are exposed at respective features; attaching a first primer set to the first functionalized layer or the first functionalized region, and attaching a second primer set to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set.

[0094] In an example of the sixteenth aspect, the attachment of the first primer set includes pre-grafting the non-cleavable first primer and the cleavable second primer to the first functionalization layer before the first functionalization layer is incorporated into the multilayer substrate; and the attachment of the second primer set includes pre-grafting the cleavable first primer and the non-cleavable second primer to the second functionalization layer before the second functionalization layer is incorporated into the multilayer substrate.

[0095] In an example of the sixteenth aspect, the attachment of the first primer set includes grafting the non-cleavable first primer and the cleavable second primer to the first functionalized region in each recess; and the attachment of the second primer set includes grafting the cleavable first primer and the non-cleavable second primer to the second functionalized region in each recess.

[0096] It should be understood that any feature of the sixteenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the sixteenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0097] The seventeenth aspect disclosed herein is a method comprising: imprinting a first resin to form a recess, the recess comprising a deep portion and a shallow portion defined by a stepped portion, wherein the first resin is located on a sacrificial layer, and the sacrificial layer is located on a second resin; etching a first portion of the first resin and a portion below the deep portion of the sacrificial layer to expose a portion of the second resin; etching the stepped portion to expose a second portion of the sacrificial layer; applying a first functionalization layer to a portion of the second resin to form a first functionalization region; removing the second portion of the sacrificial layer to expose a second portion of the second resin; applying a second functionalization layer to the second portion of the second resin to form a second functionalization region; and attaching a first primer group to the first functionalization layer or the first functionalization region, and attaching a second primer group to the second functionalization layer or the second functionalization region, wherein the first primer group is different from the second primer group.

[0098] In an example of the seventeenth aspect, during applying the second functionalized layer, the second functionalized layer is deposited on the gap region around the recess and not on the first functionalized region; and the method further includes polishing the second functionalized layer from the gap region.

[0099] It should be understood that any feature of the seventeenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the seventeenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein.

[0100] The eighteenth aspect disclosed herein is a method comprising: attaching a first primer set to a first support structure; attaching a second primer set to a second support structure, wherein the second primer set and the second support structure are different from the first primer set and the first support structure; and loading the first support structure and the second support structure on a substrate surface, wherein the substrate surface has more than one (a plurality of) first capture sites selectively attached to the first support structure and more than one second capture sites selectively attached to the second support structure.

[0101] It should be understood that any feature of the eighteenth aspect disclosed herein can be combined in any desired manner and / or configuration. In addition, it should be understood that any combination of the features of the eighteenth aspect and / or the first aspect and / or the second aspect can be combined with any example disclosed herein. Sequence Listing <110> Illumina Co., Ltd. Illumina Cambridge Ltd <120> Flow Cell <130> IP-1806-PCT <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 1 aatgatacgg cgaccaccga 20 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 caagcagaag acggcatacg a 21 BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Features of examples of the present disclosure will become apparent by reference to the following detailed description and accompanying drawings, in which like reference numerals correspond to similar, though perhaps not identical, parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0103] Figure 1 A to Figure 1 D is a schematic diagram of different examples of first primer sets and second primer sets attached to first regions and second regions on a substrate;

[0104] Figure 2 is a schematic cross-sectional view of an example of a first region and a second region on a substrate surface;

[0105] Figure 3A and Figure 3B are schematic cross-sectional and top views of examples of first and second regions in a recess, respectively;

[0106] FIG. 4A to FIG. 4C are schematic cross-sectional views of various examples of first and second regions in a recess;

[0107] Figure 5 is a schematic cross-sectional view of an example of a first region in a recess and a second region on a substrate surface;

[0108] Fig. 6A and Figure 6B are a schematic cross-sectional view and a schematic top view of examples of a first region in a recess and a second region on a substrate surface, respectively;

[0109] FIG. 7A to FIG. 7G are schematic cross-sectional diagrams that together depict an example of a method for making an exemplary flow cell including an example of a first region in a recess and a second region on a surface of a substrate;

[0110] FIG. 8A to FIG. 8F are schematic cross-sectional views that together depict another example of a method for making another example flow cell including an example of a first region in a recess and a second region on a surface of a substrate;

[0111] Fig. 9 is a schematic cross-sectional view of an example of a first region in a depression and a second region that is part of a bead located in the depression;

[0112] Fig.10 is a schematic cross-sectional view of an example of a first primer set and a second primer set attached to separate substrates;

[0113] FIG. 11A to FIG. 11C are schematic perspective views together depicting an example of forming a patterned resin on a support;

[0114] Fig.11A , Fig. 11B and Fig.11D are schematic perspective views together depicting another example of forming a patterned resin on a support;

[0115] Fig.12 is a flow chart illustrating one example of the method disclosed herein;

[0116] FIG. 13A to FIG. 13D is depicted together using Fig. 11C A schematic perspective view of an example of a method disclosed herein for patterning a substrate;

[0117] Fig.14 is along Fig.13D A cross-sectional view taken along line 4-4;

[0118] FIG. 15A to FIG. 15D is depicted together using Fig. 11C A schematic perspective view of another example of a method disclosed herein for patterning a substrate;

[0119] Fig.16 is along Fig.15D A cross-sectional view taken along line 6-6;

[0120] FIG. 17A to FIG. 17D is depicted together using Fig.11D A schematic perspective view of an example of a method disclosed herein for patterning a substrate;

[0121] Fig.18 is along Fig.17D A cross-sectional view taken along line 8-8;

[0122] 19A to 19D is depicted together using Fig.11D A schematic perspective view of another example of a method disclosed herein for patterning a substrate;

[0123] Fig. 20 is along Fig.19D A cross-sectional view taken along line 10-10;

[0124] Fig.21 is a flow chart illustrating another example of the method disclosed herein;

[0125] FIG. 22A to FIG. 22E are schematic perspective views that together depict examples of other methods disclosed herein;

[0126] Fig.22F yes Fig.22E An enlarged view of a depression of an example of a flow cell is shown, wherein the depression includes a block copolymer and a primer grafted to one block;

[0127] Fig.23A and Fig. 23B are schematic top views of examples of depressions and surrounding interstitial regions in which different examples of block copolymers self-assemble and phase separate in the depressions, wherein each figure shows a different pattern of blocks;

[0128] Fig.24 depicts a schematic perspective view of an example of a flow cell disclosed herein;

[0129] Fig.25A and Fig.25B are schematic cross-sectional diagrams depicting various examples of flow cells disclosed herein that include triblock copolymers;

[0130] FIG. 26A to FIG. 26H is shown together for forming Figure 2 A schematic diagram of an exemplary method for an exemplary region shown in;

[0131] FIG. 27A to FIG. 27F is shown together for forming Figure 2 A schematic diagram of another exemplary method of the exemplary region shown in;

[0132] FIG. 28A to FIG. 28G is shown together for forming Figure 3A and Figure 3B A schematic diagram of an exemplary method for an exemplary region shown in;

[0133] FIG. 29A to FIG. 29H is shown together for forming Figure 3A and Figure 3B A schematic diagram of another exemplary method of the exemplary region shown in;

[0134] FIG. 30A to FIG. 30F is shown together for forming Figure 3A and Figure 3B A schematic diagram of yet another exemplary method of an exemplary region shown in;

[0135] FIG. 31A to FIG. 31I is shown together for forming Figure 3A and Figure 3B A schematic diagram of an exemplary method for an exemplary region shown in;

[0136] FIG. 32A to FIG. 32F is shown together for forming Figure 4C A schematic diagram of an exemplary method for an exemplary region shown in;

[0137] Fig.33A is a schematic diagram of an exemplary method for forming another example of a region disclosed herein;

[0138] Fig.33B The diagram shows the area Fig.33A A top view of one of the depressions;

[0139] FIG. 34A to FIG. 34S are schematic diagrams that together illustrate an exemplary method for forming an exemplary region in a trench; and

[0140] Fig.35 Schematic diagrams illustrate examples of functionalized support structures;

[0141] Fig.36A and Fig.36B is illustrated together for use Fig.35 A schematic diagram of an exemplary method of forming an exemplary region of a functionalized support structure;

[0142] Fig.37A and Fig.37B is illustrated together for use Fig.35 A schematic diagram of an exemplary method of forming an exemplary region of a functionalized support structure;

[0143] Fig.38A and Fig.38B are schematic diagrams that together illustrate an exemplary method involving another example of a block copolymer;

[0144] Fig.39A is a scanning electron microscopy (SEM) image of a flow cell substrate having 50 μm diameter depressions separated by gap regions, on which a pre-grafted polymer layer was deposited;

[0145] Fig.39B yes Fig.39A SEM image of a flow cell substrate, where a protective layer is deposited on the pre-grafted polymer layer;

[0146] Fig.39C yes Fig.39B SEM image of the flow cell substrate after etching to remove the protective layer from the gap area;

[0147] Fig.40A and Fig.40B Depicts the simultaneous paired-end reads ( Fig.40A ) and sequenced paired-end reads ( Fig.40B ) data analysis;

[0148] FIG. 41A to FIG. 41Gis shown together for forming Figure 2 a schematic diagram of another exemplary method of an exemplary region shown in; and

[0149] FIG. 42A to FIG. 42H is shown together for forming Figure 2 Schematic diagram of yet another exemplary method for an exemplary region shown in . Detailed Description

[0150] Examples of flow cells disclosed herein can be used for nucleic acid sequencing.

[0151] Some flow cells include different primer sets in different regions attached to flow cell substrates. In these examples, primer sets can be controlled so that cracking (linearization) chemistry is orthogonal in different regions. Orthogonal cracking chemistry can be achieved by being attached to the same cracking site of different primers in different groups, or by being attached to different cracking sites of different primers in different groups. This enables a cluster of forward strands to be produced in one region of substrate and a cluster of reverse strands to be produced in another region of substrate. In one example, regions are directly adjacent to each other. In another example, any space between regions is small enough so that clustering can span two regions. For some flow cell configurations disclosed herein, forward strand and reverse strand are spatially separated, which separates the fluorescent signal from two reads, while allowing base calls for each read at the same time. Therefore, some examples of flow cells disclosed herein enable simultaneous paired end reads to be obtained.

[0152] Other examples of flow cells can be used to obtain simultaneous paired end reads; or can be used to obtain sequential paired end reads, wherein the forward strand is sequenced and removed, and then the reverse strand is sequenced and removed. In these other examples, the patterned resin on the flow cell support is coated with a block copolymer that undergoes directed self-assembly in the recess of the patterned resin. The patterned resin is used as a guide for the arrangement of the block copolymers. Under controlled conditions, the block copolymers self-assemble into specific domains. In some examples disclosed herein, the function of the domain is controlled to be orthogonal, so that one or more domains can react with the patterned resin, and one or more other domains can be grafted with primers. In some examples, the function of the domain can be controlled to change the characteristics of the domain. These exemplary flow cells can be suitable for optical or non-optical detection methods.

[0153] definition

[0154] It should be understood that the terms used herein will adopt their ordinary meanings in the relevant art unless otherwise specified. Several terms used herein and their meanings are set forth below.

[0155] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0156] The terms comprising, including, containing and forms of these terms are synonymous with each other and are equally broadly meant.

[0157] The terms top, bottom, lower, upper, and above are used herein to describe the various components of a flow cell and / or a flow cell. It should be understood that these directional terms are not meant to imply a specific direction, but are used to indicate the relative direction between components. The use of directional terms should not be construed as limiting the examples disclosed herein to any specific direction.

[0158] "Acrylamide monomer" is a monomer with the structure A monomer or a monomer including an acrylamide group having this structure. Examples of monomers including an acrylamide group include azidoacetamidopentyl acrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used.

[0159] As used herein, an aldehyde is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to an oxygen), the carbon atom also bonded to a hydrogen and an R group such as an alkyl or other side chain. The general structure of an aldehyde is:

[0160] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., does not contain double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, and the like. As an example, the name "C1-4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.

[0161] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl and the like.

[0162] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0163] As used herein, "aryl" refers to an aromatic ring or aromatic ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the system is aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0164] The "amino" functional group refers to -NR a R b Group, where R a and R b are each independently selected from hydrogen (e.g., ), C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocyclyl, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0165] As used herein, the term "attachment" refers to a state in which two things are directly or indirectly joined, fastened, adhered, connected or combined. For example, a pearl attached to a depression can be physically trapped in a depression. For another example, nucleic acid can be attached to a functionalized polymer by a covalent bond or a non-covalent bond. A covalent bond is characterized by an electron pair between shared atoms. A non-covalent bond is a physical bond that does not involve the sharing of an electron pair, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions and hydrophobic interactions. For still another example, a primer can be attached to a region on a substrate by a supporting structure.

[0166] An "azide" or "azido" functional group refers to -N3.

[0167] The term "bead" or "core structure" of a functionalized bead refers to a small body made of a rigid or semi-rigid material. The body can have a shape characterized by, for example, a sphere, an ellipsoid, a microsphere, or other recognized particle shapes, whether of regular or irregular size. Exemplary materials that can be used for the bead / core structure include, but are not limited to, glass; plastics such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or polytetrafluoroethylene ( From Chemours); polysaccharides or cross-linked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon; carbon fibers, metals; inorganic glasses; optical fiber bundles or various other polymers. Examples of bead / core structures include controlled pore glass beads, paramagnetic beads, thoria sols, agarose beads, nanocrystals, and other substances known in the art, such as described in the Microsphere Detection Guide from Bangs Laboratories, Fishers Ind. The beads can also be coated with a polymer having functional groups that can be attached to primers.

[0168] "Block copolymers" are copolymers formed when two or more monomers come together and form blocks of repeating units. Each block should have at least one feature and / or at least one block-specific functional group that is not present in an adjacent block. In the examples disclosed herein, when exposed to specific annealing conditions, the block copolymers are able to self-assemble into ordered domains in nanoscale size through microphase separation of the constituent polymer blocks. Specific examples of block copolymers will be further described below.

[0169] "Block-specific functional groups" refer to the moieties of atoms and / or bonds within a specific block of a block polymer that have a specific function, such as reacting with a patterned resin, attaching primers, adjusting interaction parameters to drive microphase separation, changing the properties of the block copolymer, etc. In some examples disclosed herein, each block includes a different block-specific functional group. Specific examples of each block-specific functional group will be further described below.

[0170] As used herein, "bonding region" refers to a region on a support that will be bonded to another material, such as a spacer layer, a cover, another substrate, etc., or a combination thereof (e.g., a spacer layer and a cover). The bond formed in the bonding region can be a chemical bond (as described above), or a mechanical bond (e.g., using fasteners, etc.).

[0171] As used herein, "capture site" refers to a portion of a flow cell surface that has been modified physically and / or with a chemical property that allows for positioning of a functionalized support structure. In one example, a capture site can include a chemical capture agent.

[0172] As used herein, "carbocyclyl" means a non-aromatic ring or non-aromatic ring system containing only carbon atoms in the ring system skeleton. When the carbocyclyl is a ring system, two or more rings can be connected together in a fused, bridged or spiral connection. The carbocyclyl can have any saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclyl group can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo [2.2.2] octyl, adamantyl and spiro [4.4] nonyl.

[0173] As used herein, the term "carboxylic acid" or "carboxyl" refers to -COOH.

[0174] "Chemical capture agent" is a material, molecule or part that can attach, retain or bind to a target molecule (e.g., a functionalized support structure). An exemplary chemical capture agent includes a capture nucleic acid (e.g., a capture oligonucleotide) that is complementary to at least a portion of the target nucleic acid of the target molecule or complementary to at least a portion of the target nucleic acid attached to the target molecule. Still another exemplary chemical capture agent includes a member of a receptor-ligand binding pair (e.g., avidin, streptavidin, biotin, lectin, carbohydrate, nucleic acid binding protein, epitope, antibody, etc.) that can bind to a target molecule (or bind to a connecting portion attached to a target molecule). Yet another example of a chemical capture agent is a chemical reagent that can form an electrostatic interaction, a hydrogen bond or a covalent bond (e.g., thiol-disulfide exchange, click chemistry, Diels-Alder, etc.) with a target molecule.

[0175] As used herein, "cycloalkylene" means a fully saturated carbocyclyl ring or carbocyclyl ring system attached to the remainder of the molecule via two points of attachment.

[0176] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclyl ring or carbocyclyl ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclyl ring or carbocyclyl ring system having at least one double bond, having at least one heteroatom in the ring backbone, wherein no ring in the ring system is aromatic.

[0177] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclyl ring or carbocyclyl ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclyl ring or carbocyclyl ring system having at least one triple bond, having at least one heteroatom in the ring backbone, wherein no ring in the ring system is aromatic.

[0178] The term "deposition" as used herein refers to any suitable application technique, which can be manual or automatic, and in some cases results in a change in surface properties. Typically, deposition can be carried out using vapor deposition techniques, coating techniques, grafting techniques or similar techniques. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, soaking or dip coating, blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, micro-contact printing, inkjet printing or similar techniques.

[0179] As used herein, the term "depression" refers to a discrete concave feature in a substrate or patterned resin having a surface opening at least partially surrounded by a gap region of the substrate or patterned resin. The depression can have any of a variety of shapes at the opening in its surface, including, as examples, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. The cross-section of the depression taken orthogonally to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As an example, the depression can be a well or two interconnected wells. The depression can also have more complex structures, such as ridges, step features, etc.

[0180] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may exist if explicitly disclosed or the context clearly dictates otherwise.

[0181] As used herein, the term "epoxy group" (also known as a glycidyl group or an oxirane group) refers to

[0182] As used herein, the term "flow cell" is intended to refer to a container having a chamber (i.e., a flow channel) in which a reaction can be carried out, an inlet for transporting reagents to the chamber, and an outlet for removing reagents from the chamber. In some instances, the chamber enables detection of reactions occurring in the chamber. For example, the chamber / flow channel may include one or more transparent surfaces, allowing optical detection of arrays in depressions, optically labeled molecules, or the like.

[0183] As used herein, a "flow channel" can be an area defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel can be defined between a patterned resin and a cover, and can thus be in fluid communication with one or more recesses defined in the patterned resin.

[0184] "Functionalized support structure" refers to a small body made of a rigid or semi-rigid material having one of the primer sets disclosed herein attached to its surface. The body can have a shape characterized by, for example, a sphere, an ellipsoid, a microsphere, or other recognized particle shapes, whether of regular or irregular size. Exemplary materials that can be used for the body include, but are not limited to, glass; plastics such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or polytetrafluoroethylene ( from Chemours); polysaccharides or cross-linked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon; carbon fibers, metals; inorganic glasses; optical fiber bundles or various other polymers.

[0185] As used herein, "heteroaryl" refers to an aromatic ring or aromatic ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms (i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur) in the ring backbone. When heteroaryl is a ring system, each ring in the system is aromatic. A heteroaryl group can have 5-18 ring members.

[0186] As used herein, "heterocyclyl" means a non-aromatic ring or non-aromatic ring system containing at least one heteroatom in the ring skeleton. The heterocyclyl can be connected together in a fused, bridged or spirally connected manner. The heterocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms can be present in non-aromatic rings or aromatic rings. The heterocyclyl group can have 3 to 20 ring members (that is, the number of atoms constituting the ring skeleton, including carbon atoms and heteroatoms). In some instances, the heteroatom is O, N or S.

[0187] As used herein, the term "hydrazine" or "hydrazine" refers to a -NHNH2 group.

[0188] As used herein, the term "hydrazone" or "hydrazone group" refers to Group, where R a and R bEach is independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocyclyl, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0189] As used herein, "hydroxyl" or "hydroxyl" refers to an -OH group.

[0190] As used herein, the term "gap region" refers to a region of a separated recess, such as a substrate, patterned resin, or other support. For example, a gap region may separate one recess of an array from another recess of the array. Two regions separated from each other may be discrete, i.e., lack physical contact with each other. In many instances, the gap region is continuous, while the recess is discrete, for example, as in the case of more than one recess defined in an otherwise continuous surface. In other instances, the gap region and the feature are discrete, for example, as in the case of more than one groove separated by corresponding gap regions. The separation provided by the gap region may be partial or complete separation. The gap region may have a surface material different from the surface material of the recess defined in the surface. For example, the recess may have a polymer and a first primer set therein, and the gap region may have a polymer and a second primer set thereon. For another example, the recess of the array may have beads therein, while the gap region does not have beads thereon.

[0191] As used herein, "nitrile oxide" means "R a C≡N + O - " group, where R a As defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on imidoyl chlorides [RC(Cl)=NOH] or in situ generation from a reaction between hydroxylamine and an aldehyde.

[0192] As used herein, "nitrone" means A group, wherein R1, R2 and R3 can be R as defined herein a Group and R b Any one of the groups.

[0193] As used herein, "nucleotide" includes nitrogenous heterocyclic bases, sugars and one or more phosphate groups. Nucleotide is the monomer unit of a nucleic acid sequence. In RNA, sugar is ribose, and in DNA sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group at the 2' position present in ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) can be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bound to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs can have any changes in the altered phosphate backbone, sugar or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0194] "Patterned resin" refers to any polymer that can have depressions as defined herein. Specific examples of resins and techniques for patterning resins are further described below. In some examples disclosed herein, the patterned resin can be used as a guiding template for block copolymers to self-assemble thereon. Specific examples of the properties that make a polymer a "guiding template" are further described below.

[0195] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA). Some primers, referred to herein as amplification primers, are used as starting points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, are used as starting points for DNA or RNA synthesis. The 5' end of the primer can be modified to allow coupling reaction with a functional group of a polymer or with a bead surface. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In an example, a sequencing primer is a short chain in the range of from 10 to 60 bases or from 20 to 40 bases.

[0196] As used herein, "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation absorbing material that facilitates bonding, or can be in contact with a radiation absorbing material that facilitates bonding.

[0197] "Solvent annealing" or "solvent vapor annealing" includes exposing a polymer (e.g., in the form of a film or layer) to an excess of solvent in a sealed enclosure to create a saturated vapor (i.e., solvent atmosphere) above the polymer. The polymer film or layer can be maintained at room temperature (e.g., from about 18°C ​​to about 25°C) or an elevated temperature, which causes the polymer to swell and increase its chain mobility.

[0198] The term "substrate" refers to a structure to which various components of a flow cell (e.g., polymers, primers, etc.) can be added. The substrate can be a wafer, panel, rectangular sheet, die, or any other suitable configuration. The substrate is typically rigid and insoluble in aqueous liquids. The substrate can be inert to the chemical substances used to modify the depression or to be present in the depression. For example, the substrate can be inert to the chemical substances used to form polymers, attach primers, etc. The substrate can be a single-layer structure, or a multilayer structure (e.g., including a support and a patterned resin on the support). Examples of suitable substrates will be further described below.

[0199] A "thiol" functional group refers to -SH.

[0200] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0201] As used herein, "tetrazolyl" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazolyl may be optionally substituted.

[0202] Flow cell for simultaneous paired-end read sequencing

[0203] An example of a flow cell disclosed herein includes: a substrate; a first primer set attached to a first region on the substrate, the first primer set comprising a non-cleavable first primer and a cleavable second primer; and a second primer set attached to a second region on the substrate, the second primer set comprising a cleavable first primer and a non-cleavable second primer.

[0204] Examples of suitable substrates include epoxysilicones, glass and modified or functionalized glass, plastics including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as those available from Chemours), ), cycloolefins / cycloolefin polymers (COP) (such as from Zeon ), polyimide, etc.), nylon, ceramic / ceramic oxides, silicon dioxide, fused silica or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x), hafnium oxide (HaO2), carbon, metal, inorganic glass or the like. The substrate may also be a multilayer structure. Some examples of multilayer structures include glass or silicon with a coating of tantalum oxide or another ceramic oxide at the surface. Other examples of multilayer structures include a lower support (e.g., glass or silicon) with a patterned resin thereon. Still other examples of multilayer substrates may include silicon-on-insulator (SOI) substrates.

[0205] In one example, the substrate can have a diameter in the range of from about 2 mm to about 300 mm, or a rectangular sheet or panel with a maximum size of up to about 10 feet (~3 meters). In one example, the substrate is a wafer with a diameter in the range of from about 200 mm to about 300 mm. In another example, the substrate is a die with a width in the range of from about 0.1 mm to about 10 mm. Although exemplary dimensions have been provided, it should be understood that substrates of any suitable size can be used. For another example, a panel that is a rectangular support can be used, which has a larger surface area than a 300 mm round wafer.

[0206] In some examples of flow cells, a first primer set is attached to a first region on a substrate and a second primer set is attached to a second region on the substrate. Figure 1 A to Figure 1 D depicts different configurations of primer sets 12A, 12A′, 12B, 12B′, 12C, 12C′ and 12D, 12D′ attached to different regions 14 , 16 .

[0207] Each of the first primer sets 12A, 12B, 12C and 12D includes a non-cleavable first primer 18 or 18' and a cleavable second primer 20 or 20'; and each of the second primer sets 12A', 12B', 12C' and 12D' includes a cleavable first primer 19 and a non-cleavable second primer 21.

[0208] The non-cleavable first primer 18 or 18' and the cleavable second primer 20 or 20' are an oligonucleotide pair, for example, wherein the non-cleavable first primer 18 or 18' is a forward amplification primer and the cleavable second primer 20 or 20' is a reverse amplification primer, or wherein the cleavable second primer 20 or 20' is a forward amplification primer and the non-cleavable first primer 18 or 18' is a reverse amplification primer. In each example of the first primer set 12A, 12B, 12C and 12D, the cleavable second primer 20 or 20' includes a cleavage site 22, while the non-cleavable first primer 18 or 18' does not include a cleavage site 22.

[0209] The cleavable first primer 19 or 19' and the non-cleavable second primer 21 or 21' are also oligonucleotide pairs, for example, wherein the cleavable first primer 19 or 19' is a forward amplification primer and the non-cleavable second primer 21 or 21' is a reverse amplification primer, or wherein the non-cleavable second primer 21 or 21' is a forward amplification primer and the cleavable first primer 19 or 19' is a reverse amplification primer. In each example of the second primer set 12A', 12B', 12C' and 12D', the cleavable first primer 19 or 19' includes a cleavage site 22' or 23, while the non-cleavable second primer 21 or 21' does not include a cleavage site 22' or 23.

[0210] It should be understood that the non-cleavable first primer 18 or 18' of the first primer set 12A, 12B, 12C, 12D and the cleavable first primer 19 or 19' of the second primer set 12A', 12B', 12C' and 12D' have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 19 or 19' includes a cleavage site 22' or 23 integrated into the nucleotide sequence or attached to the linker 24' of the nucleotide sequence. Similarly, the cleavable second primer 20 or 20' of the first primer set 12A, 12B, 12C, 12D and the non-cleavable second primer 21 or 21' of the second primer set 12A', 12B', 12C' and 12D' have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 20 or 20' includes a cleavage site 22 integrated into the nucleotide sequence or attached to the linker 24 of the nucleotide sequence.

[0211] It should be understood that when the first primers 18 and 19 or 18' and 19' are forward amplification primers, the second primers 20 and 21 or 20' and 21' are reverse primers, and vice versa.

[0212] Examples of non-cleavable primers 18, 21 or 18', 21' include P5 primers and P7 primers, examples of which are used on the surface of commercial flow cells sold by Illumina Inc. for use, for example, in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOME ANALYZER TMand other instrument platforms. The P5 primer and the P7 primer have a universal sequence for capture and / or amplification purposes. In one example, the P5 primer and the P7 primer include the following:

[0213] P5: 5' → 3'

[0214] AATGATACGGCGACCACCGA(SEQ.ID.NO.1)

[0215] P7: 5' → 3'

[0216] CAAGCAGAAGACGGCATACGA(SEQ.ID.NO.2)

[0217] The P5 primer and the P7 primer are uncleavable primers 18, 21 or 18', 21', as they do not include cleavage sites 22, 22', 23. It will be appreciated that any suitable universal sequence may be used as uncleavable primer 18, 21 or 18', 21'.

[0218] Examples of cleavable primers 19, 20 or 19', 20' include P5 and P7 (or other universal sequence) primers, with cleavage sites 22, 22', 23 incorporated into the corresponding nucleic acid sequences, respectively (e.g. Figure 1 A and Figure 1 C), or incorporated into linkers 24', 24 that attach cleavable primers 19, 20 or 19', 20' to regions 16, 14, respectively ( Figure 1 B and Figure 1 D). Examples of suitable cleavage sites 22, 22', 23 include enzyme-cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases or joints (e.g., between nucleobases). Enzyme-cleavable nucleobases may be easily cleaved by reaction with glycosylases and endonucleases or with exonucleases. A specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted by the USER enzyme. In an example, uracil bases can be incorporated into the 7th base position at the 3' end of a P5 primer (P5U) or a P7 primer (P7U). Other abasic sites can also be used. Examples of chemically cleavable nucleobases, modified nucleobases or joints include vicinal diols, disulfides, silanes, azobenzenes, photo-cleavable groups, allyl T (thymine nucleotide analogs with allyl functional groups), allyl ethers or azido-functional ethers.

[0219] Each primer set 12A and 12A' or 12B and 12B' or 12C and 12C' or 12D and 12D' is attached to a region 14 or 16 on the substrate, respectively. In some examples, regions 14, 16 have the same surface chemistry, and any of the techniques described herein can be used to graft one set of primers 18, 20 or 18', 20' to region 14, and another set of primers 19, 21 or 19', 21' to region 16. In other examples, regions 14 or 16 include different surface chemicals (e.g., functional groups) that can selectively react with primers 18, 20 or 18', 20' or 19, 21 or 19', 21', respectively. In these other examples, the first region 14 has a first functional group, and the second region 16 has a second functional group different from the first functional group.

[0220] As mentioned, Figure 1 A to Figure 1 D depicts different configurations of primer sets 12A, 12A', 12B, 12B', 12C, 12C' and 12D, 12D' attached to different regions 14, 16. More specifically, Figure 1 A to Figure 1 D depicts different configurations of primers 18, 20 and 19, 21 or 18', 20' and 19', 21' that can be used.

[0221] exist Figure 1 In the example shown in A, primers 18, 20 and 19, 21 of primer sets 12A and 12A' are directly attached to regions 14 and 16, for example, without linkers 24, 24'. Region 14 can have surface functional groups that can fix terminal groups at the 5' end of primers 18, 20. Similarly, region 16 can have surface functional groups that can fix terminal groups at the 5' end of primers 19, 21. In one example, the immobilization chemistry between region 14 and primers 18, 20 and the immobilization chemistry between region 16 and primers 19, 21 can be different, so that primers 18, 20 or 19, 21 are selectively attached to the desired region 14 or 16. In another example, the immobilization chemistry can be the same for regions 14, 16 and the corresponding primers 18, 20 or 19, 21, respectively, and one primer set 12A, 12A' can be grafted at a time using patterning techniques. In yet another example, the materials applied to form regions 14, 16 may have primers 18, 20 or 19, 21, respectively, pre-grafted thereon, and thus the immobilization chemistries may be the same or different.

[0222] In this example, the immobilization can be by single point covalent attachment to the corresponding region 14 or 16 at the 5' end of primers 18 and 20 or 19 and 21, respectively. Any suitable covalent attachment means known in the art can be used at regions 14, 16. Examples of blocked primers that can be used include alkyne-terminated primers, tetrazine-terminated primers, azide-terminated primers, amino-terminated primers, epoxy- or glycidyl-terminated primers, phosphorothioate-terminated primers, thiol-terminated primers, aldehyde-terminated primers, hydrazine-terminated primers, phosphoramidite-terminated primers, and triazolinedione-terminated primers. In some specific examples, a succinimide (NHS) ester-terminated primer can react with an amine at the surface of region 14 and / or 16, an aldehyde-terminated primer can react with a hydrazine at the surface of region 14 and / or 16, or an alkyne-terminated primer can react with an azide at the surface of region 14 and / or 16, or an azide-terminated primer can react with an alkyne or DBCO (dibenzocyclooctyne) at the surface of region 14 and / or 16, or an amino-terminated primer can react with an activated carboxylate group or NHS ester at the surface of region 14 and / or 16, or a thiol-terminated primer can react with an alkylating reactant (e.g., iodoacetamide or maleimide) at the surface of region 14 and / or 16, a phosphoramidite-terminated primer can react with a thioether at the surface of region 14 and / or 16, or a biotin-modified primer can react with streptavidin at the surface of region 14 and / or 16.

[0223] Also in Figure 1 In the example shown in A, the cleavage sites 22, 22' of each cleavable primer 20, 19 are incorporated into the sequence of the primers 20, 19. In this example, the same type of cleavage sites 22, 22' are used in the cleavable primers 20, 19 of the primer sets 12A, 12A', respectively. As an example, the cleavage sites 22, 22' are uracil bases, and the cleavable primers 20, 19 are P5U and P7U. In this example, the non-cleavable primer 18 of the oligonucleotide pair 18, 20 can be P7, and the non-cleavable primer 21 of the oligonucleotide pair 19, 21 can be P5. Therefore, in this example, the first primer set 12A includes P7, P5U, and the second primer set 12A' includes P5, P7U. Primer sets 12A, 12A' have opposite linear chemistries which enable the formation of a forward template strand on one region 14 or 16 and a reverse strand on the other region 16 or 14 after amplification, clustering and linearization.

[0224] exist Figure 1In the example shown in B, primers 18', 20' and 19', 21' of primer sets 12B and 12B' are attached to regions 14 and 16 via, for example, linkers 24, 24'. Region 14 may have a surface functional group that can fix linker 24 at the 5' end of primers 18', 20'. Similarly, region 16 may have a surface functional group that can fix linker 24 at the 5' end of primers 19', 21'. In one example, the immobilization chemistry of region 14 and linker 24 and the immobilization chemistry of region 16 and linker 24' may be different, so that primers 18', 20' or 19', 21' are selectively grafted to the desired region 14 or 16. In another example, the immobilization chemistry of regions 14, 16 and linkers 24, 24' may be the same, and any suitable technique disclosed herein may be used to graft one primer set 12B, 12B' at a time. In still another example, the material used to form regions 14, 16 can have primers 18', 20' and 19', 21' pre-grafted thereon, respectively, and the immobilization chemistry can be the same or different. Examples of suitable linkers 24, 24' may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers, such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. An example of a nucleic acid linker is a polyT spacer, although other nucleotides may also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides, including non-nucleic acid linkers (where B is a nucleobase and the "oligonucleotide" is a primer):

[0225]

[0226] exist Figure 1 In the example shown in B, primers 18', 19' have the same sequence and the same or different adapters 24, 24'. Primer 18' is not cleavable, and primer 19' includes a cleavage site 22' incorporated into the adapter 24'. Also in this example, primers 20', 21' have the same sequence (e.g., P7) and the same or different adapters 24, 24'. Primer 21' is not cleavable, and primer 20' includes a cleavage site 22 incorporated into the adapter 24. The same type of cleavage site 22, 22' is used in the adapters 24, 24' of each cleavable primer 20', 19'. As an example, the cleavage site 22, 22' can be a uracil base incorporated into the nucleic acid adapter 24, 24'. Primer sets 12B, 12B' have opposite linear chemistries which enable the formation of a forward template strand on one region 14 or 16 and a reverse strand on the other region 16 or 14 after amplification, clustering and linearization.

[0227] Figure 1 The example shown in C is similar to Figure 1 The example shown in A, except that different types of cleavage sites 22, 23 are used in the cleavable primers 20, 19 of primer sets 12C, 12C', respectively. As an example, two different enzymatic cleavage sites can be used, two different chemical cleavage sites can be used, or one enzymatic cleavage site and one chemical cleavage site can be used. Examples of different cleavage sites 22, 23 that can be used for cleavable primers 20, 19, respectively, include any combination of vicinal diols, uracil, allyl ethers, disulfides, restriction enzyme sites, and 8-oxoguanine.

[0228] Figure 1 The example shown in D is similar to Figure 1 B, except that different types of cleavage sites 22, 23 are used in the linkers 24, 24' of the cleavable primers 20', 19', respectively, attached to the primer sets 12D, 12D'. Examples of different cleavage sites 22, 23 that can be used for the linkers 24, 24' attached to the cleavable primers 20, 19, respectively, include any combination of vicinal diols, uracil, allyl ethers, disulfides, restriction enzyme sites, and 8-oxoguanine.

[0229] exist Figure 1 A to Figure 1 In any of the examples shown in D, the attachment of primers 18, 20 and 19, 21 or 18', 20' and 19', 21' to regions 14, 16 allows the template-specific portions of primers 18, 20 and 19, 21 or 18', 20' and 19', 21' to be free to anneal to their cognate templates and the 3' hydroxyl groups to be free for primer extension.

[0230] Regions 14, 16 represent different regions on a substrate having different primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' attached thereto. Regions 14, 16 may include materials having different functional groups. In some cases, the different functional groups are surface functional groups of the substrate or functional groups that have been introduced to the surface of the substrate, or may be functional groups of another component (e.g., a polymer layer, a bead, etc.) deposited on the substrate.

[0231] In some instances, regions 14, 16 are chemically identical and any of the techniques disclosed herein can be used to sequentially attach primers 18, 20 and 19, 21 or 18', 20' and 19', 21' of groups 12A and 12A', or 12B and 12B', or 12C and 12C', or 12D and 12D' to regions 14, 16, respectively.

[0232] In one example where the regions 14, 16 are chemically identical, the two regions 14, 16 include the same polymer layer. The polymer layer can be a semi-rigid polymer material that is permeable to liquids and gases. Examples of polymer layers include acrylamide copolymers, such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, PAZAM. Some other forms of PAZAM and acrylamide copolymers are represented by the following structure (I):

[0233]

[0234] in:

[0235] R A is selected from the group consisting of an azido group, an optionally substituted amino group, an optionally substituted alkenyl group, an optionally substituted hydrazone group, an optionally substituted hydrazine group, a carboxyl group, a hydroxyl group, an optionally substituted tetrazole group, an optionally substituted tetrazine group, a nitrile oxide group, a nitrone group, and a thiol group;

[0236] R B is H or optionally substituted alkyl;

[0237] R C , R D and R E are each independently selected from the group consisting of H and optionally substituted alkyl;

[0238] Each -(CH2) p - may be optionally substituted;

[0239] p is an integer in the range of 1 to 50;

[0240] n is an integer in the range of 1 to 50,000; and

[0241] m is an integer in the range of 1 to 100,000.

[0242] One of ordinary skill in the art will recognize that the arrangement of the repeating "n" and "m" features in structure (I) is representative and that the monomer subunits may be present in the polymer structure in any order (e.g., random, blocky, patterned, or a combination thereof).

[0243] The molecular weight of PAZAM may range from about 10 kDa to about 1500 kDa, or in a particular example, may be about 312 kDa.

[0244] In some instances, PAZAM is a linear polymer. In some other instances, PAZAM is a lightly cross-linked polymer.

[0245] In other examples, polymer 26 can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by permutation, where R D , R E and R F Each is H, and R G and R H Each is a methyl group (instead of H as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can be used. In this example, in addition to the repeating "n" and "m" features, structure (I) can include Where R D , R E and R F Each is H, and R G and R H Each is a methyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0246] As another exemplary polymer, the repeating "n" features in structure (I) may be replaced with a monomer comprising a heterocyclic azido group having structure (II):

[0247]

[0248] Where R 1 is H or C1-C4 alkyl; R 2 is H or C1-C4 alkyl; L is a linker comprising a linear chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide in which H or C1-C4 alkyl is attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 ring members present in a monocyclic structure or a condensed structure.

[0249] As yet another example, the polymer may comprise repeating units of each of Structure (III) and Structure (IV):

[0250]

[0251] Where R 1a , R 2a , R 1b and R 2bEach of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b are each independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-14 aralkyl; and L 1 and L 2 Each is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0252] It should be understood that other molecules can be used to form a polymer layer, as long as they are functionalized to interact with the first primer set and the second primer set 12A, 12A' or 12B, 12B', or 12C, 12C', or 12D, 12D'. Other examples of suitable polymer layers include those with colloidal structures, such as agarose; or polymer mesh structures, such as gelatin; or cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA) or azidized forms of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers forming [2+2] photocycloaddition reactions. Still other examples of suitable polymer layers include mixed copolymers of acrylamide and acrylates. Branched polymers can also be used, such as star polymers, star-shaped or star-block polymers, dendrimers and the like.

[0253] In other examples, regions 14 and 16 are chemically different. For example, region 14 may have surface functional groups to which primers 18, 20 or 18', 20' of a first primer set 12A, 12B, 12C, 12D may be fixed, and region 16 may have different surface functional groups to which primers 19, 21 or 19', 21' of a second primer set 12A', 12B', 12C', 12D' may be fixed.

[0254] In one example where regions 14, 16 are chemically different, a block copolymer is used. In this example, the block copolymer comprises two different blocks, one block having a primer grafting functional group that can be attached to primers 18, 20 or 18', 20' of a first primer set 12A, 12B, 12C, 12D, and the other block having a primer grafting functional group that can be attached to primers 19, 21 or 19', 21' of a second primer set 12A', 12B', 12C', 12D'. Examples of primer grafting functional groups are selected from the group consisting of: azide / azido, optionally substituted amino, optionally substituted alkenyl, aldehyde, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, thiol and combinations thereof.

[0255] Other examples of chemically distinct regions 14, 16 include gold and PAZAM, gold and aluminum, silanes with two different surface functional groups (e.g., azide and amine), a thiol self-assembled monolayer on gold and a phosphonate self-assembled monolayer on aluminum or hafnium oxide, SiO2 and Ta2O5, epoxy and Ta2O5, a first polymer containing azide groups and a second polymer containing amine groups, SiO2 and copper, or epoxy and copper. Although several examples have been provided, it should be understood that other combinations of chemically distinct regions 14, 16 may be used.

[0256] The regions 14, 16 may also have different physical configurations. Figures 2 to 6B The figures show different examples of these configurations. In these examples, substrate 26 is shown as a single layer / material, such as glass, silicon, etc. However, it should be understood that a multi-layer substrate can be used with any of these exemplary configurations. For example, any of these examples can include a support and a patterned resin formed on the support.

[0257] Figure 2 The figure shows an example in which the regions 14 , 16 are located in different areas of the surface S of the substrate 26 .

[0258] For manufacturing Figure 2 An exemplary method of the example shown in FIG. 26A to FIG. 26H Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity.

[0259] like Fig.26AAs shown, a first functionalization layer 60 is applied to the substrate 26. The first functionalization layer 60 can be a polymer (PAZAM), a silane, a metal (gold, aluminum, etc.), or any other material having functional groups that can be attached to the first primer set 12A, 12B, 12C, 12D. The first functionalization layer 60 can be deposited using any of the techniques described herein.

[0260] Depending on the first functionalized layer 60 used, the substrate 26 can be activated using silanization or plasma ashing to produce surface groups that can react with the first functionalized layer 60. Examples of silanization and plasma ashing refer to Fig.13A Described in more detail. Then, the first functionalized layer 60 can be deposited using any of the techniques described herein. Depending on the materials used, the first functionalized layer 60 can also be cured.

[0261] exist Fig.26B and Fig.26C , the first functionalized layer 60 is then patterned to form a first functionalized area (area 14) covered by a photoresist 62. In one example, the photoresist 62 is a negative photoresist (exposed areas become insoluble). Examples of suitable negative photoresists include epoxy-based SU-8 photoresists (available from MicroChemicals). The photoresist 62 is applied to the first functionalized layer 60, selectively exposed to certain wavelengths of light to form insoluble areas (shown at 62), and exposed to a developer solution to remove the soluble portions. In another example, the photoresist 62 is a positive photoresist (exposed areas become soluble). Examples of suitable positive photoresists include S1800 series or 1500 series, both of which are available from MicroChemicals. Photoresist 62 is applied to substrate 26, selectively exposed to certain wavelengths of light to form soluble regions, and exposed to a developer solution to remove the soluble portion, leaving an insoluble portion (shown at 62). In other examples, photoresist 62 can be replaced with a nanoimprint lithography resin that is patterned to form regions (e.g., 62).

[0262] like Fig.26C As shown in FIG. 6 , exposed portions of first functionalized layer 60 (eg, portions not covered by photoresist 62 ) may then be removed, for example, via etching or another suitable technique.

[0263] like Fig.26DAs shown in , a second functionalized layer 64 is then applied over the photoresist 62 and a portion of the substrate 26 (eg, the exposed surface S) using any suitable deposition technique. Depending on the material used, the second functionalized layer 64 may also be cured.

[0264] like Fig.26E As shown in , the photoresist 62 may then be stripped, which also removes any second functionalization layer 64 thereon.

[0265] exist Fig.26F and Figure 26G , a portion of the second functionalized layer 64 is removed. To remove that portion, a second photoresist 62' is applied, exposed, and developed so that the insoluble region (shown at 62') covers the first functionalized region 14 and the desired portion of the second functionalized layer 64 that i) abuts the first functionalized region 14 and ii) will become the second functionalized region 16. Once the photoresist 62' is formed, the exposed portion of the second functionalized layer 64 (e.g., the portion not covered by the photoresist 62') can then be removed, for example, via etching or another suitable technique.

[0266] like Fig.26H As shown in FIG. 6 , the photoresist 62 ′ may then be stripped, which exposes the first functionalized region 14 and the second functionalized region 16 .

[0267] In some examples, primers 18, 20 or 18', 20' (in FIG. 26A to FIG. 26H ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 26A to FIG. 26H The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0268] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.26A If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.26H ), because they will not be grafted to the surface functional groups of region 16.

[0269] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.26D If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.26H ), because they will not be grafted to the surface functional groups of region 14.

[0270] When grafting is performed during the method, the grafting can be accomplished by flow-through deposition (e.g., using a temporarily bonded cap), dip coating, spray coating, puddle dispensing, or by another suitable method of attaching primer 18, 20 or 18', 20' to region 14 or primer 19, 21 or 19', 21' to region 16. Each of these exemplary techniques can utilize a primer solution or mixture that can include primer 18, 20 or 18', 20', 19, 21 or 19', 21', water, buffer, and a catalyst. With any grafting method, primer 18, 20 or 18', 20' reacts with the reactive groups of region 14, or primer 19, 21 or 19', 21' reacts with the reactive groups of region 16, and has no affinity for substrate 26.

[0271] Although in FIG. 26A to FIG. 26H Not shown, but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In one example, region 14 is gold, and the first SAM includes a thiol group that can be attached to gold and an azide group that can be attached to primers 18, 20 or 18', 20'. In another example, region 16 is hafnium oxide or aluminum oxide, and the second SAM includes a phosphonate group that can be attached to hafnium oxide or aluminum oxide and an amine group that can be attached to primers 19, 21 or 19', 21'. In the example of using a self-assembled monolayer, after the SAMS is formed, primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0272] For manufacturing Figure 2 Another exemplary method of the example shown in FIG. 27A to FIG. 27F Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity.

[0273] like Fig.27AAs shown, a first photoresist 62 is applied to substrate 26 such that a first substrate portion 66 remains exposed. In this example, photoresist 62 can be a positive photoresist (exposed areas become soluble) or a negative photoresist (exposed areas become insoluble). Photoresist 62 can also be replaced with a nanoimprint lithography resin that is patterned to form regions (e.g., 62).

[0274] like Fig.27B As shown, first functionalized layer 60 can be deposited over photoresist 62 and first base portion 66 using any of the techniques described herein. In some cases, first functionalized layer 60 can also be cured.

[0275] like Fig.27C As shown in FIG. 1 , the photoresist 62 can then be stripped, which also removes any first functionalized layer 60 thereon. This leaves the region 14 formed on the substrate surface S.

[0276] A second photoresist 62 ′ is applied, exposed, and developed such that the insoluble region (shown at 62 ′) covers the first functionalized region 14 and the substrate 26 except for a second substrate portion 68 adjacent to the first functionalized region 14 .

[0277] like Fig.27E As shown in FIG. 1 , a second functionalized layer 64 is then applied using any suitable deposition technique, and in some cases cured, over the photoresist 62 ′ and the second base portion 68 .

[0278] like Fig.27F As shown in FIG. 6 , the photoresist 62 ′ can then be stripped, which removes any second functionalized layer 64 thereon. This exposes the first functionalized region 14 and the second functionalized region 16 .

[0279] In some examples, primers 18, 20 or 18', 20' (in FIG. 27A to FIG. 27F ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 27A to FIG. 27F The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0280] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.27B or Fig.27CIf regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.27F ), because they will not be grafted to the surface functional groups of region 16.

[0281] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.27E If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.27F ), because they will not be grafted to the surface functional groups of region 14.

[0282] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for substrate 26.

[0283] Although in FIG. 27A to FIG. 27F , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0284] For manufacturing Figure 2 Yet another exemplary method of the example shown in FIG. 41A to FIG. 41G Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity.

[0285] Substrate 26 can be any example of a substrate disclosed herein. Although not shown, it should be understood that the substrate can also be a multilayer substrate that includes an unpatterned resin on a support (e.g., a nanoimprint lithography resin on a glass support, or any other example of a resin 54 and a support 52 described herein, see the "Bead-Based Flow Cell" section).

[0286] like Fig.41A, in this example, a sacrificial metal layer 98 is applied on substrate 26. In one example, the nanoimprint lithography resin / resist of the multilayer substrate can be exposed to an oxygen plasma, and then the sacrificial metal layer 98 can be deposited using any suitable metal deposition technique. In one example, the sacrificial metal layer 98 is deposited using sputtering. Examples of sacrificial metal layer 98 include aluminum or copper, and layer 98 can have a thickness ranging from about 10 nm to about 100 nm.

[0287] like Fig.41B As shown in , the resist is applied to the sacrificial metal layer 98 and patterned to define multi-level or multi-depth recesses therein. The patterned resin is shown with reference numeral 54'. In this example, the resin can be any nanoimprint lithography resin. In one example, the resin is spin-coated and soft-baked, and then imprinted and cured (e.g., using UV curing) to define multi-level or multi-depth recesses, which include deep portions 70 and shallow portions 72 partially defined by stepped portions 74 of the patterned resin 54'.

[0288] Then, a wet etch or dry etch may be used to expose a portion 100 of substrate 26 (e.g., a portion of the unpatterned resin or glass of a multilayer substrate) beneath deep portion 70 and a portion 102 of sacrificial metal layer 98 beneath shallow portion 72. The exposed portion is Fig.41C . In an example of wet etching, FeCl3 can be used to remove the copper sacrificial metal layer 98. In another example of wet etching, KOH can be used to remove the aluminum sacrificial metal layer 98. In an example of dry etching, oxygen plasma can first be used to remove the residue of the patterning resin 54', and then a combination of Cl2 and BCl3 plasma can be used to etch the aluminum sacrificial metal layer 98. Oxygen plasma can be used again to clean the exposed portions 100 and 102. In this example, the depths D1 (e.g., the depth of the shallow portion 72) and D2 (e.g., from the bottom of the deep portion 70 to the top of the step portion 74), as well as the thickness D3 of the sacrificial metal layer 98 can be the same or similar (e.g., within one nanometer of each other) so that the desired thickness of each of the materials 54' and 98 is removed during etching to expose the portions 100 and 102.

[0289] like Fig.41D , the first functionalized layer 60 can be deposited on the remaining patterned resin 54', on the exposed portion 100 of the substrate 26, and on the exposed portion 102 of the sacrificial metal layer 98. The first functionalized layer 60 can be any example and can be deposited using any of the techniques described herein. In some cases, the first functionalized layer 60 is also cured.

[0290] exist Fig.41EIn the embodiment of the present invention, wet etching is used to selectively remove a portion of the first functionalized layer 60 and another portion of the sacrificial metal layer 98 to expose another portion 104 of the substrate 26. The wet etching can be performed as described herein. The etchant used can etch the sacrificial metal layer 98, thereby stripping the first functionalized layer 60.

[0291] like Fig.41F , the second functionalized layer 64 is then applied over the exposed portion 104 and the first functionalized layer 60. Any suitable deposition technique may be used for the second functionalized layer 64. In any of the exemplary methods disclosed herein, when deposited under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.), the second functionalized layer 64 does not deposit or adhere to the first functionalized layer 60. Thus, the second functionalized layer 64 does not contaminate the first functionalized layer 60, leaving region 16.

[0292] like Figure 41G , the remaining patterned resin 54 can then be stripped, which removes any first functionalized layer 60 thereon. The stripping process can be performed in dimethyl sulfoxide (DMSO) using sonication, or in acetone, or using an NMP (N-methyl-2-pyrrolidone) based stripper. The remaining sacrificial metal layer 98 is then exposed and can be removed using wet etching as described herein. After wet etching, the regions 14, 16 remain intact on the substrate surface, in part because the sacrificial metal layer 98 is not present underneath the regions 14, 16.

[0293] In some examples, primers 18, 20 or 18', 20' (in FIG. 41A to FIG. 41G ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 41A to FIG. 41G The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0294] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.41D If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Figure 41G ), because they will not be grafted to the surface functional groups of region 16.

[0295] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.41F If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Figure 41G ), because they will not be grafted to the surface functional groups of region 14.

[0296] When grafting is performed during the method, the grafting can be accomplished by flow-through deposition (e.g., using a temporarily bonded cap), dip coating, spraying, puddle dispensing, or by another suitable method of attaching primer 18, 20 or 18', 20' to region 14 or primer 19, 21 or 19', 21' to region 16. Each of these exemplary techniques can utilize a primer solution or mixture that can include primer 18, 20 or 18', 20', 19, 21 or 19', 21', water, a buffer, and a catalyst. With any grafting method, primer 18, 20 or 18', 20' reacts with a reactive group of region 14, or primer 19, 21 or 19', 21' reacts with a reactive group of region 16, and has no affinity for substrate 26.

[0297] For manufacturing Figure 2 Still another exemplary method of the example shown in FIG. 42A to FIG. 42H Likewise, although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity.

[0298] Substrate 26 can be any example of a substrate disclosed herein. FIG. 41A to FIG. 41G As in the examples described in , the substrate may also be a multilayer substrate comprising an unpatterned resin on a support.

[0299] like Fig.42A As shown in FIG. 1 , in this example, a sacrificial metal layer 98 is applied to the substrate 26. The sacrificial metal layer 98 can be any exemplary material and can be referred to as Fig.41A Deposition of any example described.

[0300] like Fig.42BAs shown in , the resist is applied to the sacrificial metal layer 98 and patterned to define multi-level or multi-depth recesses therein. The patterned resin is shown with reference numeral 54'. In this example, the resin can be any nanoimprint lithography resin. In one example, the resin is spin-coated and soft-baked, and then imprinted and cured (e.g., using UV curing) to define multi-level or multi-depth recesses, which include deep portions 70 and shallow portions 72 partially defined by stepped portions 74 of the patterned resin 54'.

[0301] Then, a wet etch or dry etch may be used to expose a portion 100 of substrate 26 (e.g., a portion of the multilayer substrate that is not patterned with resin) beneath deep portion 70 and a portion 102 of sacrificial metal layer 98 beneath shallow portion 72. Exposed portions 100 and 102 are Fig.42C Wet etching or dry etching can refer to Fig.41C Describing the process.

[0302] like Fig.42D , the first functionalized layer 60 can be deposited on the remaining patterned resin 54', on the exposed portion 100 of the substrate 26, and on the exposed portion 102 of the sacrificial metal layer 98. The first functionalized layer 60 can be any example and can be deposited using any of the techniques described herein. In some cases, the first functionalized layer 60 can also be cured.

[0303] exist Fig.42E and Fig.42F In the embodiment of the present invention, the first functionalized layer 60 is then patterned to form a first functionalized area (area 14) covered by a photoresist 62. In this example, the photoresist 62 is a negative photoresist. The photoresist 62 can be applied to the first functionalized layer 60, selectively exposed to certain wavelengths of light to form insoluble areas, and exposed to a developer solution to remove the soluble portion. The remaining photoresist 62 is located on the portion of the first functionalized layer 60 that is above the portion 100 in the deep portion 70.

[0304] like Fig.42F , the exposed portions of the first functionalized layer 60 (e.g., portions not covered by the photoresist 62) can then be removed, for example, via etching or another suitable technique. The etching process (e.g., oxygen plasma) also removes some of the patterned resin 54' and some of the photoresist 62. In a separate etching process, the shallow portions 72 (see Fig.42B ) below the sacrificial metal layer 98. In this example, reference Fig.41C The process exposes another portion 104 of the substrate 26 .

[0305] like Figure 42G As shown in FIG. 1 , a second functionalized layer 64 is then applied using any suitable deposition technique over the exposed portions of the resin 54′, the photoresist 62, and the exposed portions 104 of the substrate 26. In one example, the second functionalized layer 64 can be deposited over the photoresist 62 but can be removed with the photoresist 62 when the photoresist 62 is stripped.

[0306] like Figure 42H , the remaining patterned resin 54' and photoresist 62 can then be stripped, which removes any second functionalized layer 64 thereon. The stripping process can be performed in dimethyl sulfoxide (DMSO) using sonication, or in acetone, or using an NMP (N-methyl-2-pyrrolidone) based stripper. The remaining sacrificial metal layer 98 is then exposed and can be removed using wet etching as described herein. After wet etching, regions 14, 16 remain intact on the substrate surface, in part because the sacrificial metal layer 98 is not present underneath regions 14, 16.

[0307] In some examples, primers 18, 20 or 18', 20' (in FIG. 42A to FIG. 42H ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 42A to FIG. 42H The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0308] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.42D If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Figure 42H ), because they will not be grafted to the surface functional groups of region 16.

[0309] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Figure 42G If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Figure 42H ), because they will not be grafted to the surface functional groups of region 14.

[0310] When grafting is performed during the method, the grafting can be accomplished by flow-through deposition (e.g., using a temporarily bonded cap), dip coating, spray coating, puddle dispensing, or by another suitable method of attaching primer 18, 20 or 18', 20' to region 14 or primer 19, 21 or 19', 21' to region 16. Each of these exemplary techniques can utilize a primer solution or mixture that can include primer 18, 20 or 18', 20', 19, 21 or 19', 21', water, buffer, and a catalyst. With any grafting method, primer 18, 20 or 18', 20' reacts with the reactive groups of region 14, or primer 19, 21 or 19', 21' reacts with the reactive groups of region 16, and has no affinity for substrate 26.

[0311] Figure 2 The exemplary regions 14, 16 shown in can also be formed using microcontact printing or direct printing techniques, such as inkjet printing. These methods can be particularly suitable when it is desired to produce regions on the micrometer scale, such as about 1 μm to about 50 μm.

[0312] exist Figure 2 In the example shown in FIG. 1 , it will be appreciated that multiple groups of discrete regions 14 , 16 may be formed in an array on the substrate surface S. Many different layouts may be used for the array, as long as the regions 14 , 16 within the discrete groups are adjacent to each other.

[0313] FIG. 3A to FIG. 6B The figures show various examples in which at least one of the regions 14, 16 is located in a depression 28 defined in a substrate 26. The depression 28 may be formed in a single-layer substrate (eg, substrate 26), or may be formed in the outermost layer of a multi-layer substrate.

[0314] The recess 28 may be formed using any suitable technique, such as photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, micro-etching techniques, and the like.

[0315] Although in FIG. 3A to FIG. 6B A single recess 28 is shown in each of the examples, but it should be understood that the flow cell may include more than one recess 28 separated by gap regions 30, wherein each recess 28 includes a first region 14 located in a first portion and a second region 16 located in a second portion. Still further, some examples disclosed herein include recesses 28A and 28B having different sizes (see, e.g., Fig. 11C ), or a recess 28C comprising two interconnected but differently sized portions 34, 34' (see e.g. Fig.11D ). It should be understood that the following discussion regarding the recess 28 may apply to any of the examples of recesses 28, 28A, 28B, 28C disclosed herein.

[0316] Many different layouts of the recesses 28 can be envisioned, including regular, repeating, and irregular patterns. In one example, the recesses 28 are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, a rectilinear (i.e., rectangular) layout (see Fig.24 ), triangular layouts, and similar layouts. In some examples, the layout or pattern may be an xy format of depressions 28 in rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of depressions 28 and / or gap regions 30. In still other examples, the layout or pattern may be a random arrangement of depressions 28 and / or gap regions 30. The pattern may include stripes, swirls, lines, triangles, rectangles, circles, arcs, checks, plaids, diagonal lines, arrows, squares, and / or cross-hatching.

[0317] The layout or pattern may be characterized with respect to the density of the depressions 28 (ie, the number of depressions 28) in a defined area. For example, the depressions 28 may be present in a ratio of 1 to 2. 2 Densities of about 2 million exist. The density can be adjusted to different densities, including for example per mm 2 At least about 100 per mm 2 At least about 1,000 per mm 2 At least about 100,000 per mm 2 At least about 1 million per mm 2 At least about 2 million per mm 2 At least about 5 million per mm 2 At least about 10 million per mm 2 A density of at least about 50 million or more. Alternatively or additionally, the density may be adjusted to be per mm 2 No more than about 50 million per mm 2 No more than about 10 million per mm 2 No more than about 5 million per mm 2 No more than about 2 million per mm 2 No more than about 1 million per mm 2 No more than about 100,000 per mm 2 Not more than about 1,000 per mm 2No greater than about 100 or less. It should also be understood that the density of depressions 28 can be between one of the lower values ​​and one of the higher values ​​selected from the ranges above. As an example, a high density array can be characterized as having depressions 28 spaced less than about 100 nm apart, a medium density array can be characterized as having depressions 28 spaced about 400 nm to about 1 μm apart, and a low density array can be characterized as having depressions 28 spaced greater than about 1 μm apart. While exemplary densities have been provided, it should be understood that a substrate having any suitable density can be used.

[0318] The layout or pattern of the recesses 28 can also or alternatively be characterized in terms of average spacing, i.e., the spacing from the center of the recess 28 to the center of the adjacent recess 28 (center-to-center spacing) or the spacing from the edge of one recess 28 to the edge of the adjacent recess 28 (edge-to-edge spacing). The pattern can be regular, so that the coefficient of variation about the average spacing is small, or the pattern can be irregular, in which case the coefficient of variation can be relatively large. In either case, the average spacing can be, for example, at least about 10 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more. Alternatively or in addition, the average spacing can be, for example, at most about 100 μm, about 10 μm, about 5 μm, about 1 μm, about 0.5 μm, about 0.1 μm, or less. The average spacing of a particular pattern of recesses 28 can be between one of the lower values ​​and one of the higher values ​​selected from the range above. In one example, the depressions 28 have a pitch (center-to-center spacing) of about 1.5 μm. Although exemplary average spacing values ​​have been provided, it should be understood that other average spacing values ​​may be used.

[0319] exist FIG. 3A to FIG. 6B In the example shown in FIG. 2 , the depression 28 is a well. The well may be a microwell or a nanowell. The size of each well may be characterized by its volume, well opening area, depth and / or diameter.

[0320] Each well can have any volume capable of confining a liquid. The minimum or maximum volume can be selected, for example, to accommodate the throughput (e.g., multiplexity), resolution, analyte composition, or analyte reactivity expected for downstream use of the flow cell. For example, the volume can be at least about 1×10 -3 μm 3 , at least about 1×10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively or additionally, the volume may be at most about 1×104 μm 3 , at most about 1×10 3 μm 3 , up to about 100μm 3 , up to about 10μm 3 , up to about 1μm 3 , up to about 0.1μm 3 Or less. It should be understood that regions 14, 16 may fill all or part of the volume of a well. The volume of, for example, a polymer layer in an individual well may be greater than, less than, or between the values ​​specified above.

[0321] The area occupied by each well opening on the surface can be selected based on criteria similar to those set forth above with respect to well volume. For example, the area for each well opening on the surface can be at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or additionally, the area may be at most about 1×10 3 μm 2 , up to about 100μm 3 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , about 1×10 -2 μm 2 The area occupied by each well opening may be greater than the value specified above, less than the value specified above, or between the values ​​specified above.

[0322] The depth of each well (or any other type of depression 28) may be at least about 0.1 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the depth may be at most about 1×10 3 The depth of each well (or other recess 28) may be greater than, less than, or between the values ​​specified above.

[0323] In some cases, the diameter of each well (or other recess 28) can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the diameter can be at most about 1×10 3 The diameter of each well (or other recess 28) can be greater than, less than, or between the values ​​specified above.

[0324] When the depression 28 is a groove (see e.g. Fig.34H ), both the grooves and the gap regions may have a straight line configuration. The depth of each groove may be at least about 0.02 μm (20 nm), at least about 0.1 μm (100 nm), at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the depth may be at most about 1×10 3 The depth of each trench may be greater than, less than, or between the values ​​specified above.

[0325] In some cases, the width of each groove can be at least about 0.02 μm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the width can be at most about 1×10 3 The width of each trench may be greater than, less than, or between the values ​​specified above.

[0326] Figure 3A and Figure 3B A cross-sectional view and a top view, respectively, depict an example in which regions 14, 16 are located in different regions of recess 28. In this example, regions 14, 16 are directly adjacent to each other within recess 28.

[0327] For manufacturing Figure 3A and Figure 3B An exemplary method of the example shown in FIG. 28A to FIG. 28G Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity. Figure 3A and Figure 3BDepicted are depressions 28 defined in a single layer substrate 26, while the exemplary method depicts depressions 28 defined in a patterned resin 54' on a support 52 of a multi-layer substrate. It should be understood that the method can be used for single layer substrates.

[0328] In this example, the multilayer substrate includes a (patterned) resin 54' on a support 52. Any example of resin 54 (eg, see the "Bead-Based Flow Cell" section), support 52, and methods for patterning resin 54 described herein may be used.

[0329] like Fig.28A As shown in FIG. 5 , the recesses 28 defined in the patterned resin 54 ′ are adjacent to gap regions 30, and the gap regions 30 separate the recesses 28 adjacent to each other. Fig.28B As shown in FIG. 5 , a first functionalized layer 60 is applied (eg, deposited or deposited and cured) over the patterned resin 54 ′ using any of the techniques described herein.

[0330] exist Fig.28C and Fig.28D In the embodiment, the first functionalized layer 60 is then patterned to form a first functionalized area (area 14) covered by a photoresist 62. In this example, the photoresist 62 can be a negative photoresist (the exposed areas become insoluble) or a positive photoresist (the exposed areas become soluble). The photoresist 62 is applied to the first functionalized layer 60, selectively exposed to certain wavelengths of light to form insoluble areas or soluble areas, and exposed to a developer solution to remove the soluble portions. In other examples, the photoresist 62 can be replaced with a nanoimprint lithography resin. As shown in FIG. Fig.28C As shown in FIG. 1 , in this example, the photoresist 62 covers a portion of the first functionalized layer 60 on a first portion 76 of the recess 28 (e.g., a portion of the layer 60 that will become region 14 ) and does not cover a second portion of the first functionalized layer 60 on a second portion 78 of the recess 28 .

[0331] like Fig.28D As shown in , the exposed portions of the first functionalized layer 60 (eg, portions not covered by the photoresist 62 ) may then be removed, for example, via etching or another suitable technique. This exposes the second portion 78 of the recess 28 and the gap region 30 .

[0332] like Fig.28E As shown in , a second functionalized layer 64 is then applied over the photoresist 62 and the portion of the substrate 26 including the second portion 78 of the recess 28 (e.g., the exposed surface S), as well as the gap region 30 using any suitable deposition technique (cured or uncured, depending on the material).

[0333] like Fig.28FAs shown in , the photoresist 62 may then be stripped, which also removes any second functionalization layer 64 thereon.

[0334] exist Figure 28G In the embodiment, a portion of the second functionalized layer 64 is removed. In particular, the second functionalized layer 64 is removed from the gap region 30. In this example, the removal includes polishing the second functionalized layer 64 (and any first functionalized layer 60 that may be present) from the gap region 30.

[0335] The polishing process can be performed with a mild chemical slurry (including, for example, an abrasive, a buffer, a chelating agent, a surfactant and / or a dispersant) that can remove the second functionalized layer 64 (and any first functionalized layer 60 that may be present) from the gap regions 30 without adversely affecting the underlying substrate 26 or patterned resin 54' at these regions. Alternatively, polishing can be performed with a solution that does not contain abrasive particles.

[0336] A chemical slurry may be used in a chemical mechanical polishing system to polish the surface of the gap region 30. A polishing head / pad or other polishing tool is capable of polishing the second functionalized layer 64 (and any first functionalized layer 60 that may be present) from the gap region 30 while leaving the regions 14, 16 in the recess 28, at least substantially intact. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head.

[0337] Cleaning and drying processes may be performed after polishing. The cleaning process may utilize a water bath and sonication. The water bath may be maintained at a relatively low temperature ranging from about 22° C. to about 30° C. The drying process may include spin drying, or drying via another suitable technique.

[0338] In some examples, primers 18, 20 or 18', 20' (in FIG. 28A to FIG. 28G ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, primers 19, 21 or 19', 21' (in FIG. 28A to FIG. 28G The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0339] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.28B If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Figure 28G), because they will not be grafted to the surface functional groups of region 16.

[0340] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.28E If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Figure 28G ), because they will not be grafted to the surface functional groups of region 14.

[0341] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for patterning resin 54'.

[0342] Although in FIG. 28A to FIG. 28G , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0343] For manufacturing Figure 3A and Figure 3B Another exemplary method of the example shown in FIG. 29A to FIG. 29H Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity. Figure 3A and Figure 3B Depicted are depressions 28 defined in a single layer substrate 26, while the exemplary method depicts depressions 28 defined in a patterned resin 54' on a support 52 of a multi-layer substrate. It should be understood that the method can be used for single layer substrates.

[0344] In this example, the multilayer substrate comprises a (patterned) resin 54' on a support 52. Fig.29A As shown in FIG. 1 , recesses 28' defined in patterned resin 54' abut gap regions 30 that separate adjacent recesses 28' from each other. Recesses 28' are multi-step or multi-depth recesses that include deep portions 70 and shallow portions 72 that are partially defined by stepped portions 74 of patterned resin 54'.

[0345] In this example, a sacrificial layer is applied over the patterned resin 54' so that the sacrificial layer at least partially fills the deep portion 70 in the recess 28'. An exemplary sacrificial layer 76 is any material having an etch rate different from that of the resin 54' and the photoresist 62 used in the method. Examples of suitable sacrificial layer materials 76 include silicon, aluminum, negative photoresist or positive photoresist, copper, etc. These materials can be deposited using any suitable technique disclosed herein. Although not shown, it should be understood that in addition to being deposited in at least a portion of the deep portion 70, the sacrificial layer can also be deposited over the gap region 30 and the step portion 74, or completely fill the recess 28'.

[0346] Then, a portion of the sacrificial layer and a portion of the resin 54' are sequentially removed. The sacrificial layer may be first etched back so that it is removed from the gap region 30 and the step portion 74, and the remaining portion of the sacrificial layer in the deep portion 70 (at Fig.29B 80) is substantially flush with the stepped portion 74. Fig.29B , portions of the resin 54' are removed. For example, portions of the resin 54' are removed to form a new (referred to as the second) gap region 30' that is substantially flush with the remaining portion of the sacrificial layer 80, and the resin 54' is removed to remove the step portion 74. The removal of the step portion 74 forms a region / portion 76 of the recess 28' adjacent to the remaining portion of the sacrificial layer 80.

[0347] like Fig.29C As shown in FIG. 1 , the first functionalized layer 60 is applied over the remaining portion of the sacrificial layer 80, the region / portion 76 and the (second) gap region 30 ′. Fig.29D As shown in , a photoresist 62 is then applied over the first functionalized layer 60 .

[0348] Portions of the photoresist 62 and the underlying first functionalized layer 60 may then be removed to expose the remaining portions of the sacrificial layer 80 and the gap region 30'. Fig.29E . The removal process can be accomplished by etching with an etchant that selectively removes portions of the photoresist 62 and the underlying first functionalization layer 60, but does not remove the remainder of the sacrificial layer 80. In this example, the wet etch can be performed with an alkaline pH developer solution such as NaOH, KOH, or TMAH (tetramethylammonium hydroxide), or the dry etch can be performed with an oxygen plasma. In this example, the etching stops when the remainder of the sacrificial layer 80 is exposed. This leaves a second portion (e.g., region 14) of the first functionalization layer 60 having a second portion 62" of photoresist on the first functionalization layer 60 at region / portion 76.

[0349] like Fig.29F As shown, the remaining portion of the sacrificial layer 80 is then removed to expose the second region / portion 78 adjacent to the second portion (e.g., region 14) of the first functionalization layer 60. The removal process can be accomplished by etching with an etchant that selectively removes the remaining sacrificial layer 76, but does not remove the second portion (e.g., region 14) of the first functionalization layer 60 having the second portion 62" of the photoresist thereon. As examples, the aluminum sacrificial layer 80 can be removed under acidic conditions or alkaline conditions, the copper sacrificial layer 80 can be removed using FeCl3, the photoresist sacrificial layer 80 can be removed using an organic solvent such as acetone, or under alkaline (pH) conditions; and the silicon sacrificial layer 80 can be removed under alkaline (pH) conditions.

[0350] like Figure 29G As shown in FIG. 1 , a second functionalized layer 64 is then applied to the region / portion 78 using any suitable deposition (and, if applicable, curing) technique. This forms the second functionalized region 16. Figure 29G As shown in FIG. 1 , a second functionalization layer 64 may also be applied over the second portion 62 ″ of the photoresist and the gap region 30 .

[0351] like Figure 29G As shown in FIG. 1 , the second portion 62″ of the photoresist may then be stripped, which also removes any second functionalization layer 64 thereon. This forms the first functionalization region 14. Polishing may also be performed to remove the second functionalization layer 64 from the gap region 30′.

[0352] Although Figures 29A to 29H The example shown in FIG. 1 includes photoresist 62, but it should be understood that photoresist 62 may be omitted if second functionalized layer 64 does not adhere to first functionalized layer 60. In addition, if sacrificial layer 80 is a transparent material to which first functionalized layer 60 does not adhere, sacrificial layer 80 may not be removed and region 16 may be formed on sacrificial layer 80.

[0353] In some examples, primers 18, 20 or 18', 20' (in FIG. 29A to FIG. 29H ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 29A to FIG. 29H The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0354] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.29C If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.29H ), because they will not be grafted to the surface functional groups of region 16.

[0355] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Figure 29G If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.29H ), because they will not be grafted to the surface functional groups of region 14.

[0356] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for patterning resin 54'.

[0357] Although in FIG. 29A to FIG. 29H , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0358] For manufacturing Figure 3A and Figure 3B Still another exemplary method of the example shown in FIG. 30A to FIG. 30F Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity. Figure 3A and Figure 3B Depicted are depressions 28' defined in a single layer substrate 26, while the exemplary method depicts depressions 28' defined in a patterned resin 54' on a support 52 of a multi-layer substrate. It should be understood that the method can be used for single layer substrates.

[0359] like Fig. 30A , in this example, the multilayer substrate includes an unpatterned resin 54 on a support 52 and a sacrificial layer 80 on the resin 54. Any examples of the resin 54, support 52, and sacrificial layer 80 may be used.

[0360] like Fig. 30B , additional resin is applied to sacrificial layer 80 and patterned to define recess 28' therein. The additional resin may be the same as or different from resin 54. Recess 28' is a multi-step or multi-depth recess that includes a deep portion 70 and a shallow portion 72 that are partially defined by a stepped portion 74 of patterned resin 54'.

[0361] like Fig. 30C , a first portion of patterned resin 54' (adjacent deep portion 70) and a portion of sacrificial layer 80 beneath deep portion 70 are etched. This exposes portion 82 of resin 54. In one example, patterned resin 54' can be etched using anisotropic oxygen plasma to expose underlying portions of sacrificial layer 80, and portions of sacrificial layer 80 can then be removed using, for example, BCl3 and Cl2 plasma.

[0362] like Fig.30D , the stepped portion 74 of the patterned resin 54' is etched away using, for example, oxygen plasma. This exposes the sacrificial layer 80 below the stepped portion 74. The etchant used can etch the resin 54', but not the sacrificial layer 80. Therefore, the sacrificial layer 80 acts as an etch stop layer, and thus a portion 102' of the sacrificial layer 80 is exposed.

[0363] It should be understood that when the resin 54' is etched, the initial gap region 30 may be shortened. Thus, a gap region 30' is formed.

[0364] Likewise Fig.30D As shown in , first functionalized layer 60 may be deposited (and in some cases cured). First functionalized layer 60 may not adhere to exposed portion 102' of sacrificial layer 80, but will adhere to portion 82 of resin 54 and gap region 30' around recess 28'.

[0365] The exposed portion 102' of the sacrificial layer 80 may then be etched away (eg, using an alkaline solution or FeCl3, depending on the material), and the second functionalization layer 64 may be deposited (and cured, depending on the material). Fig.30E , the second functionalized layer 64 is applied to the newly exposed portion of the resin 54 (where the portion 102' has been removed). In one example, the first functionalized layer 60 has no affinity for the second functionalized layer 64, and therefore the second functionalized layer 64 is not deposited on the first functionalized layer 60. In this example of the method, as Fig.30F As shown in FIG. 1 , polishing may be performed to remove the first functionalized layer 60 from the gap region 30 ′.

[0366] exist FIG. 30A to FIG. 30F In some embodiments of the method, primers 18, 20 or 18', 20' (in FIG. 30A to FIG. 30F ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, primers 19, 21 or 19', 21' (in Figure 30A-Figure 30F The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0367] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig. 30A or Fig.30D If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.30F ), because they will not be grafted to the surface functional groups of region 16.

[0368] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.30E If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.30F ), because they will not be grafted to the surface functional groups of region 14.

[0369] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for patterning resin 54'.

[0370] Although in FIG. 30A to FIG. 30F , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0371] For manufacturing Figure 3A and Figure 3B Still another exemplary method of the example shown in FIG. 31A to FIG. 31I Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity. Figure 3A and Figure 3B Depicted are depressions 28' defined in a single layer substrate 26, while the exemplary method depicts depressions 28' defined in a patterned resin 54' on a support 52 of a multi-layer substrate. It should be understood that the method can be used for single layer substrates.

[0372] like Fig.31A As shown, the multi-layer substrate includes a (patterned) resin 54' on a support 52. The recesses 28' defined in the patterned resin 54' are adjacent to gap regions 30, which separate adjacent recesses 28' from each other. The recesses 28' are multi-level or multi-depth recesses, which include deep portions 70 and shallow portions 72 defined in part by stepped portions 74 of the patterned resin 54'.

[0373] like Fig.31B As shown in FIG. 5 , a first functionalized layer 60 is applied over the patterned resin 54 ′. The first functionalized layer 60 can be any of the examples disclosed herein and can be deposited using any of the techniques described herein.

[0374] exist Fig.31C and Fig.31D In the embodiment, the first functionalized layer 60 is then patterned to form a first functionalized area (area 14) covered by a photoresist 62. In this example, the photoresist 62 is a negative photoresist (the exposed areas become insoluble). Fig.31C As shown in FIG. 1 , a photoresist 62 is applied to the first functionalized layer 60 and selectively exposed to certain wavelengths of light to form insoluble regions (at Fig.31D 62 in FIG), and exposed to a developer solution to remove the soluble portion. Fig.31D , the exposed portion of the first functionalized layer 60 (e.g., the portion not covered by the photoresist 62) can then be removed, for example, via etching or another suitable technique. The remaining portion of the first functionalized layer 60 (e.g., region 14) is at the first level of each multi-level recess. In this example, the first level is in the deep portion 70 on the support 52.

[0375] In this example, a sacrificial layer 84 is applied over portions of the photoresist 62 and the resin 54' (eg, the surface of the gap region 30, the stepped portion 74). Fig.31EAny material can be used as the sacrificial layer 84 having an etching difference relative to the resin 54 ′. In one example, aluminum can be used as the sacrificial layer 84 .

[0376] like Fig.31F As shown in FIG. 5 , the sacrificial layer 84 is removed from the portion of the resin 54 ′. The sacrificial layer 84 may first be etched back so that it is removed from the gap region 30 and the stepped portion 74 and the remaining portion of the sacrificial layer (at Fig.31F The photoresist 62 in the deep portion 70 is shown with reference numeral 84′ in FIG.

[0377] Regions of the resin 54' (specifically the step regions 74) are then removed from the multi-layer recess 28' to produce regions / portions 78 adjacent to the first functionalized region 14 (e.g., portions of the first functionalized layer 60 located below the photoresist 62) and remaining portions 84' of the sacrificial layer. This process may also remove portions of the gap regions 30, creating new gap regions 30'. This removal process may be accomplished by etching with an etchant, such as an oxygen plasma, that selectively removes the resin 54' but does not remove the remaining portions 84' of the sacrificial layer.

[0378] like Fig.31H As shown in FIG. 1 , a second functionalization layer 64 is then applied over the remaining portions of sacrificial layer 84 , over regions / portions 78 , and over gap regions 30 ′ using any suitable deposition technique.

[0379] like Fig.31I As shown in , the photoresist 62 may then be stripped, which also removes the remaining portion 84' of the sacrificial layer and any second functionalized layer 64 thereon. Any second functionalized layer 64 on the gap region 30' may also be removed via polishing.

[0380] exist FIG. 31A to FIG. 31I In some embodiments of the method, primers 18, 20 or 18', 20' (in FIG. 31A to FIG. 31I ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, primers 19, 21 or 19', 21' (in FIG. 31A to FIG. 31I The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0381] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.31BIf regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.31I ), because they will not be grafted to the surface functional groups of region 16.

[0382] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.31H If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.31I ), because they will not be grafted to the surface functional groups of region 14.

[0383] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for patterning resin 54'.

[0384] Although in FIG. 31A to FIG. 31I , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0385] exist FIG. 31A to FIG. 31I In the entire process in the example shown in FIG. 1 , the multi-stage depression 28 ′ is transformed into a single-stage depression 28, such as Figure 3A As shown in .

[0386] FIG. 4A to FIG. 4C The figures show different examples of regions 14 , 16 being located in different parts of the recess 28 .

[0387] exist Figure 4A In the example of the flow cell, there is a gap 36 between the regions 14 and 16. Thus, this example of the flow cell includes separating the first primer sets 12A, 12B, 12C, 12D (in the region 14 and not in the region 16). Figure 4A ) and a second primer set 12A', 12B', 12C', 12D' (in region 16, not in Figure 4B In one example, the void 36 is the space between the individual polymer portions that form the regions 14, 16. FIG. 31A to FIG. 31IAny of the methods shown in can be modified to form voids 36. Voids 36 can have any measurable length greater than zero. In one example, voids 36 are greater than 1 nm. In one example, voids are in a range from about 1 nm to about 10 nm.

[0388] exist Figure 4B , regions 14, 16 partially overlap. Overlap region 38 is the region where both primer 18, 20 or 18', 20' and primer 19, 21 or 19', 21' are grafted. In one example, this overlap region 38 can be formed during the patterning and grafting process by exposing the same portion of polymer layer 32 when primer 18, 20 or 18', 20' is grafted and when primer 19, 21 or 19', 21' is grafted. In another example, this overlap region 38 can be formed when the respectively grafted primers 18, 20 or 18', 20' and primers 19, 21 or 19', 21' physically overlap or diffuse into each other during or after the process.

[0389] exist Figure 4C , wherein the first and second portions of the recess 28' that create the regions 14, 16, respectively, have different depths. Any recess depth described herein may be used, as long as one portion of the recess 28' is deeper than another portion of the recess 28'. Different depths may be created when the recess 28' is formed, for example, via nanoimprinting, etching, etc.

[0390] For manufacturing Figure 4C An exemplary method of the example shown in FIG. 32A to FIG. 32F Although primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are mentioned throughout the specification, they are not shown for the sake of clarity. Figure 4C Depicted are depressions 28' defined in a single layer substrate 26, while the exemplary method depicts depressions 28' defined in a patterned resin 54' on a support 52 of a multi-layer substrate. It should be understood that the method can be used for single layer substrates.

[0391] like Fig.32A As shown, the multi-layer substrate includes a (patterned) resin 54' on a support 52. The recesses 28' defined in the patterned resin 54' are adjacent to gap regions 30, which separate adjacent recesses 28' from each other. The recesses 28' are multi-level or multi-depth recesses, which include deep portions 70 and shallow portions 72 defined in part by stepped portions 74 of the patterned resin 54'.

[0392] like Fig.32BAs shown in FIG. 5 , a first functionalized layer 60 is applied over the patterned resin 54 ′. The first functionalized layer 60 may be any of the embodiments disclosed herein and may be deposited using any of the techniques described herein and may also be cured if appropriate.

[0393] exist Fig.32C and Fig.32D In the embodiment, the first functionalized layer 60 is then patterned to form a first functionalized region (region 14) covered by a photoresist 62. In this example, the photoresist 62 is a negative photoresist or a positive photoresist. Fig.32C As shown in FIG. 1 , a photoresist 62 is applied to the first functionalized layer 60, selectively exposed to certain wavelengths of light to form insoluble regions or soluble regions (depending on the resist used), and exposed to a developer solution to remove the soluble portions. Fig.32D , the exposed portion of the first functionalized layer 60 (e.g., the portion not covered by the photoresist 62) can then be removed, for example, by etching or another suitable technique. In this example, the first functionalized layer 60 and the resin 54' can have an etching difference. The remaining portion of the first functionalized layer 60 (e.g., region 14) is in the first level of each multi-level recess. In this example, the first level is in the deep portion 70 on the resin 54'.

[0394] like Fig.32E , the second functionalized layer 64 is then applied to the exposed portions of the resin 54' (e.g., to the gap regions 30 and the stepped portions 74) using any suitable deposition technique. Depending on the material, the second functionalized layer 64 may also be cured. In one example, the photoresist 62 has no affinity for the second functionalized layer 64, and thus the second functionalized layer 64 is not deposited on the photoresist 62. In another example, the second functionalized layer 64 may be deposited on the photoresist 62, but may be removed with the photoresist 62 when the photoresist 62 is stripped.

[0395] like Fig.32F As shown in FIG. 1 , the photoresist 62 may then be stripped, which in some cases also removes any second functionalization layer 64 thereon. Any second functionalization layer 64 on the gap region 30 may also be removed via polishing.

[0396] exist FIG. 32A to FIG. 32F In some embodiments of the method, primers 18, 20 or 18', 20' (in FIG. 32A to FIG. 32F ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, primers 19, 21 or 19', 21' (in FIG. 32A to FIG. 32FThe primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0397] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Fig.32B If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Fig.32F ), because they will not be grafted to the surface functional groups of region 16.

[0398] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.32E If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Fig.32F ), because they will not be grafted to the surface functional groups of region 14.

[0399] When grafting is performed during the method, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for patterning resin 54'.

[0400] Although in FIG. 32A to FIG. 32F , but the exemplary method may also include depositing a first self-assembled monolayer (SAM) on the first functionalized region 14, and depositing a second self-assembled monolayer (SAM) on the second functionalized region 16. In the example of using self-assembled monolayers, after the SAMs are formed, the primer groups 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' are grafted.

[0401] Figure 5 , Fig. 6A and Figure 6B The figures show different examples in which the substrate 26 includes depressions 28 separated by gap regions 30; each depression includes a first region 14; and the second region 16 is located on at least some of the gap regions 30. Thus, in these examples, one region 14 is located in a depression 28, while another region 16 is located on the substrate surface S adjacent to the depression 28. Figure 5In the example shown in FIG. 1 , the area 16 on the substrate surface S is adjacent to the recess 28. Fig. 6A and Figure 6B In the example shown in FIG. 1 , the area 16 on the substrate surface S surrounds the recess 28. FIG. 7A to FIG. 7G and FIG. 8A to FIG. 8F An exemplary method for making one of the regions 14 , 16 and the other of the regions 16 , 14 in a recess 28 on at least a portion of a substrate surface S is described.

[0402] For manufacturing Fig. 6A and Figure 6B An exemplary method of the example shown in FIG. 7A to FIG. 7G As shown in Fig. 7A As shown in FIG. 1 , the method utilizes a substrate 26 having more than one depression 28 separated by gap regions 30. In this exemplary method, a polymer layer 32 is deposited on the substrate 26 and polished from the gap regions 30, as shown in FIG. Figure 3A and Figure 3B This leaves the polymer layer 32 in the recess 28 and not on the gap region 30. If the desired region 14 is in the recess 28, then the primers 18, 20 or 18', 20' can be grafted using any of the examples disclosed herein. If the desired region 16 is in the recess 28, then the primers 19, 21 or 19', 21' can be grafted using any of the examples disclosed herein. Figure 7B In the example shown in FIG. 1 , primers 18, 20 or 18', 20' are grafted to polymer layer 32. It should be understood that primers 18, 20 or 18', 20' will be grafted to polymer layer 32 in recesses 28, but not to gap regions 30, such as Figure 7B As shown in .

[0403] In some examples of the method, substrate 26 (which has region 14 or 16 formed in recess 28) is exposed to a capping agent. The capping agent includes a chemical that can react with any unreacted functional groups of polymer layer 32 (e.g., any functional groups that have not reacted with primers 18, 20 or 18', 20") to render these functional groups inactive during subsequent processing. This process can reduce the ability of a subsequently deposited polymer layer 32' to adhere to region 14. In other words, the interaction between polymer layer 32 and a subsequently deposited polymer layer 32' is reduced, so that little or no polymer layer 32' adheres to polymer layer 32. This, in turn, reduces the ability of a subsequently deposited primer (e.g., 19, 21 or 19', 21') to graft to the area covering region 14.

[0404] In the example where the polymer layer 32 includes azide functional groups, the chemical in the capping agent can be a reducing agent, such as a phosphine. An exemplary phosphine is tris(hydroxypropyl)phosphine. Unreacted azides of the polymer layer 32 will be reduced by the phosphine, which renders them ineffective for additional primer grafting.

[0405] like Figure 7C , the method then includes depositing a second polymer layer 32'. The polymer layer 32' may be the same polymer used in the polymer layer 32, or may be a different type of polymer than used in the polymer layer 32. In one example, each of the first polymer 32 and the second polymer 32' is an acrylamide copolymer, such as PAZAM. The polymer layer 32' may coat only the gap regions 30, or may coat at least some of the regions 14 in addition to the gap regions 30. Whether the polymer layer 32' at least partially coats the regions 14 will depend on the capping agent used on the polymer layer 32.

[0406] In this example, template polynucleotide chains, including non-cleavable first template chains 40 and cleavable second template chains 42, can be formed in region 14 using primers 18 or 18 'and 20, 20 ', respectively. At the beginning of template polynucleotide chain formation, library templates can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample). Nucleic acid samples can be fragmented into single-stranded, DNA or RNA fragments of similar size (e.g., <1000bp). During preparation, adapters can be added to the ends of these fragments. By reducing cyclic amplification, different motifs can be introduced into adapters, such as sequencing binding sites, indexes, and regions complementary to primers 18 or 18 'and 20, 20 'in region 14. Final library templates include DNA or RNA fragments and adapters at both ends. In some instances, fragments from a single nucleic acid sample have the same adapters added thereto.

[0407] More than one library template can be introduced into the substrate 26. This can include introducing a template fluid into the flow cell. The template fluid can include a liquid carrier and more than one library template. Because the substrate 26 includes an array of regions 14 in recesses 28, multiple library templates are hybridized with, for example, one of the two types of primers 18, 18' or 20, 20' immobilized therein.

[0408] Cluster generation can then be performed. During cluster generation, templates from the template fluid are amplified to form clusters in at least some recesses 28. In one example of cluster generation, a high-fidelity DNA polymerase is used to copy the library template from hybridized primers 18, 18' or 20, 20' by 3' extension. The original library template is denatured so that copies are fixed in region 14. Isothermal bridge amplification can be used to amplify fixed copies. For example, the copied template is looped on adjacent complementary primers 20, 20' or 18, 18' and hybridized with adjacent complementary primers 20, 20' or 18, 18', and the polymerase copies the copied template to form a double-stranded bridge, which is denatured to form two single strands. These two chains are looped on adjacent complementary primers 20, 20' or 18, 18' and hybridized with adjacent complementary primers 20, 20' or 18, 18', and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification to produce dense clonal clusters. Each cluster of double-stranded bridges is denatured to produce an uncleavable first template strand 40 attached to an uncleavable first primer 18, 18' and a cleavable second template strand 42 attached to a cleavable second primer 20, 20', as shown in FIG. Fig.7D . It should be understood that the cleavability of the primer drives the cleavability of the template strand attached thereto. Because the second template strand 42 attached to the cleavable second primer 20, 20' includes a cleavage site 22, the cleavable second template strand 42 is cleavable. This example of clustering is bridge amplification, and is an example of amplification that can be performed. It should be understood that other amplification techniques can be used, such as exclusion amplification (Examp) workflow (Illumina Inc.).

[0409] It will be appreciated that because the second polymer layer 32 ′ does not have primers 18 , 18 ′ or 20 , 20 ′ grafted thereto, the amplification process does not extend beyond the individual recesses 28 .

[0410] The initiating fluid may then be introduced into the substrate 26. The initiating fluid includes a liquid carrier and a second primer set 12A', 12B', 12C', 12D' that is different from the first primer set 12A, 12B, 12C, 12D that has been introduced into the recess 28. The liquid carrier in the initiating fluid may be any liquid capable of supporting click chemistry, such as phosphate buffered saline (PBS), saline sodium citrate (SSC), carbonate-based buffers, etc. In this example, the primer set in the initiating fluid includes primers 19 or 19' and 21 or 21'. It should be understood that if primer set 12A', 12B', 12C', 12D' (including primers 19 or 19' and 21 or 21') is first grafted to form region 16 in recess 28, the initiating fluid may include primer set 12A, 12B, 12C, 12D (including primers 18 or 18' and 20 or 20').

[0411] Primers 19 or 19' and 21 or 21' in the priming fluid may be grafted to the second polymer layer 32' covering the gap region 30. Because the second polymer layer 32' may not adhere to the polymer layer 32, because amplification has been performed in the region 14, and because the functional groups of the underlying polymer layer 32 have become inactive, the primers 19 or 19' and 21 or 21' may not be grafted to the exposed polymer layer 32.

[0412] like Fig. 7E As shown in , the grafted primers 19 or 19 ′ and 21 or 21 ′ are attached to a second polymer layer 32 ′ covering the gap region 30 , which forms the region 16 .

[0413] Additional amplification can then be performed. For example, bridge amplification can be initiated from the cluster to the grafted primers 19 or 19' and 21 or 21' to form a second cluster over at least some of the gap regions. During this round of amplification, the non-cleavable first template strand 40 loops on and hybridizes to the adjacent complementary primers 21, 21', while the cleavable second template strand 42 loops on and hybridizes to the adjacent complementary primers 19, 19'. Strands 40, 42 are each extended to form two new double-stranded loops. The process is repeated for each template copy through cycles of isothermal denaturation and amplification to produce a dense cluster of clones growing from the recess 28 to the gap region 30. Each additional cluster of double-stranded bridges is denatured to produce a non-cleavable second template strand 44 attached to the non-cleavable second primer 21, 21' and a cleavable first template strand 46 attached to the cleavable first primer 19, 19', as shown in FIG. Figure 7FBecause the cleavable first template strand 46 attached to the cleavable first primer 19, 19' includes the cleavage site 22' or 23, the cleavable first template strand 46 is cleavable.

[0414] It should be understood that when the non-cleavable first template strand 40 is the forward strand, the non-cleavable second template strand 44 is the reverse strand, and when the non-cleavable first template strand 40 is the reverse strand, the non-cleavable second template strand 44 is the forward strand. Similarly, when the cleavable first template strand 46 is the forward strand, the cleavable second template strand 42 is the reverse strand, and when the cleavable first template strand 46 is the reverse strand, the cleavable second template strand 42 is the forward strand.

[0415] Then, depending on the cleavage site 22, 22' or 22, 23, the cleavable first template strand 46 and the cleavable second template strand 42 can be removed by introducing a chemical or enzymatic cleavage agent. Figure 7G , after cleavage, the uncleavable first template strand 40 remains in region 14 in recess 28, and the uncleavable second template strand 44 remains in region 16 on interstitial region 30. In one example after cleavage, region 14 includes the forward strand, and region 16 includes the reverse strand.

[0416] For manufacturing Figure 5 , Fig. 6A and Figure 6B Another exemplary method of the example shown in FIG. 8A to FIG. 8F As shown in Fig. 8A As shown in , the method utilizes a substrate 26 having more than one depression 28 separated by gap regions 30. In this exemplary method, a polymer layer 32 is deposited on the substrate 26 so that it is present in the depressions 28 and on the gap regions 30. If the desired region 14 is in the depression 28, the primers 18, 20 or 18', 20' can be grafted using any of the examples disclosed herein. If the desired region 16 is in the depression 28, the primers 19, 21 or 19', 21' can be grafted using any of the examples disclosed herein. Figure 8B In the example shown in FIG. 1 , primers 18, 20 or 18', 20' are grafted to polymer layer 32. It should be understood that primers 18, 20 or 18', 20' will be grafted to polymer layer 32 on the entire substrate 26, such as Figure 8B As shown in .

[0417] In this exemplary method, Figure 8CAs shown in FIG. 1 , a protective coating 48 is then deposited on the polymer layer 32 having the primer groups 12A, 12B, 12C, 12D grafted thereto. The protective coating 48 may be a stripping resist. This type of protective coating 48 may be spun on, cured, and subsequently removed at a desired time in the process. The protective coating 48 may also be a water-soluble coating.

[0418] Etching may then be performed to expose gap regions 30 where it is desired to create regions 16 including primer sets 12A', 12B', 12C', 12D'. For example, separate portions of substrate surface S adjacent to each recess 28 may be exposed via etching to form Figure 5 For another example, a portion of the substrate surface S surrounding the entire recess 28 may be exposed by etching to form Fig. 6A and Figure 6B The example shown in . Fig.8D An example of substrate 26 is shown after an etch has been performed to expose gap region 30. In this example, the plasma etch may be performed with air or oxygen.

[0419] The exemplary method may then include silanizing the exposed portion of the substrate surface S. Silanization introduces an adhesion promoter to the substrate surface S to help the second polymer layer 32' adhere thereto.

[0420] Then a second polymer layer 32' is deposited. Fig. 8E , a second polymer layer 32′ may be deposited on the exposed portions of the substrate surface S (e.g., at the gap region 30) and on the protective coating 48. In this exemplary method, the polymer layer 32′ may be the same polymer used in the polymer layer 32, or may be a different type of polymer than used in the polymer layer 32.

[0421] like Figure 8F As shown in the figure, the primers 19, 19' and 21, 21' of the second primer set 12A', 12B', 12C', 12D' can then be grafted to the polymer layer 32' to produce the region 16. The grafting can be performed using any of the methods described herein. In another example, the polymer layer 32' can be pre-grafted with primers 19, 19' and 21, 21'.

[0422] Although not shown, it should be understood that the exemplary method can then include removing the protective coating 48. As an example, a stripping method can be used to remove the protective coating 48 and any polymer layer 32' and primers 19, 19' and 21, 21' thereon. If the protective coating 48 is water soluble, the removal can include dissolving the coating 48 in water, which will also remove any overlying polymer layer 32' and primers 19, 19' and 21, 21'. The removal of the protective coating exposes all primers 18, 18' and 20, 20' at region 14, and all primers 19, 19' and 21, 21' at region 16.

[0423] Although in FIG. 8A to FIG. 8F 26. It is not shown, but it will be appreciated that more than one library template may then be introduced to the substrate 26. Because the substrate 26 includes an array of regions 14 in the recesses 28, multiple library templates are hybridized with, for example, one of the two types of primers 18, 18' or 20, 20' immobilized therein. In this example, because the substrate 26 also includes an array of regions 16 on at least some of the gap regions 30, multiple library templates are hybridized with, for example, one of the two types of primers 19, 19' or 21, 21' immobilized therein. Cluster generation may then be performed as described herein. Cleavage of the cleavable template may also be performed by cleaving the cleavable first primer 19, 19' and the cleavable second primer 20, 20'.

[0424] Fig. 9 Still another example of regions 14, 16 located in different parts of a recess 28 is shown. In this example, one of the regions 14 or 16 is a portion of a bead 50 located in the recess 28. The bead 50 includes a core structure 49 and a region 16 at a surface of the core structure 49. In this example, the region 16 may include functional groups that are inherently present at the surface of the core structure 49, or functional groups that are incorporated onto the surface of the core structure 49 by any suitable functionalization technique (e.g., chemical reaction, coating the core structure 49 with a polymer containing reactive groups, etc.).

[0425] Although Fig. 9 A single depression 28 is shown in FIG. 1 , but it should be understood that in some examples, the substrate 26 includes more than one depression 28 separated by gap regions 30; and each depression includes: a first portion where the first region 14 is located; and a second portion; and the flow cell further includes a bead 50 located in the second portion, wherein the second region 16 is on the surface of the bead. FIG. 11A to FIG. 20 , several variations of this example are further described herein in the "Bead-based flow cells" section.

[0426] Fig.10Still another exemplary configuration of regions 14, 16 is depicted. In this example, regions 14, 16 are located on separate substrates 26, 26'. Thus, this example of a flow cell includes: a first substrate 26; a first primer set 12A attached to the first substrate 26, the first primer set including non-cleavable first primers 18, 18' and cleavable second primers 20, 20'; a second substrate 26' opposite the first substrate 26; and a second primer set 12A' attached to the second substrate 26', the second primer set 12A' including cleavable first primers 19, 19' and non-cleavable second primers 21, 21'. As an example of a method for manufacturing the flow cell, the substrates 26, 26' can each be coated with a polymer layer (e.g., 32, in Fig.10 ), the first primer set 12A (or 12B, 12C or 12D) may be grafted to one substrate 26, and the second primer set 12A' (or 12B', 12C' or 12D') may be grafted to another substrate 26'.

[0427] Although shown on the respective substrate surfaces S, it should be understood that the regions 14, 16 may alternatively be located in the recesses 28 of the substrates 26, 26', respectively. In this example, the polymer layer may be deposited in the recesses 28 and on the gap regions 30, and may then be removed from the gap regions 30 via polishing. The first primer set 12A (or 12B, 12C, or 12D) may be grafted to the recesses 28 of one substrate 26, and the second primer set 12A' (or 12B', 12C', or 12D') may be grafted to the recesses of the other substrate 26'.

[0428] In this example, it is desirable that the substrates 26, 26' are in close proximity so that template seeding and clustering can be successfully performed. In one example, "close proximity" means that the distance between the two substrates 26, 26' is about 100 μm or less. In another example, the distance between the two substrates 26, 26' is in the range of about 10 μm to about 90 μm.

[0429] The first region 14 and the second region 16 and the primer set 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' may be macroscopically separated on the substrate surface S, or may be present in separate recesses 28 macroscopically separated from each other, rather than being located on separate substrates 26, 26'. Macroscopic separation means that the regions 14, 16 are separated from each other by at least 5 μm. In one example, the regions 14, 16 are separated from each other by a distance ranging from about 5 μm to about 100 μm.

[0430] Fig.33AStill another exemplary configuration of regions 14, 16 is depicted. In this example, a first functionalized layer 60 and a second functionalized layer 64 are integrated into the resin portion of the multilayer substrate. Fig.33A As shown in , this example of a multi-layer substrate includes a support 52 ; a first functionalized layer 60 on the support 52 ; a second functionalized layer 64 on the first functionalized layer 60 ; and a passivation layer 86 on the second functionalized layer 64 .

[0431] In this example, the first functionalized layer 60 and the second functionalized layer 64 can be any nanoimprint lithography resin that has or can have surface functional groups introduced thereto that can be attached to the primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D', respectively. In one example, layer 60 can be functionalized with epoxy groups and layer 64 can be functionalized with amine groups.

[0432] If in the formation Fig.33A Before the multi-layer substrate shown in the figure is incorporated into the multi-layer substrate, the primer groups 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' are pre-grafted into the layers 60, 64, respectively, and the resins of the layers 60, 64 can be the same. In these examples of the method, before the first functionalized layer 60 is incorporated into the multi-layer substrate, the first primer groups 12A, 12B, 12C, 12D (e.g., the non-cleavable first primers 18, 18' and the cleavable second primers 20, 20') can be pre-grafted into the first functionalized layer 60; and before the second functionalized layer 64 is incorporated into the multi-layer substrate, the second primer groups 12A', 12B', 12C', 12D' (e.g., the cleavable first primers 19, 19' and the non-cleavable second primers 21, 21') can be pre-grafted into the second functionalized layer 64.

[0433] These layers (whether pre-grafted or not) can be deposited on support 52 using any of the examples disclosed herein.

[0434] When primers are grafted after imprinting, it is understood that layers 60, 64 have at least different surface functional groups that can be attached to primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D', respectively. Any resin disclosed herein may be used.

[0435] Passivation layer 86 can be any hydrophobic layer that can be imprinted. As an example, passivation layer 86 is selected from the group consisting of: fluorinated polymers, perfluorinated polymers, silicon polymers, and mixtures thereof. As an example, passivation layer 86 can include an amorphous fluoropolymer (commercially available examples of which include fluoropolymers from AGC Chemicals). Those in the series, they have one of the following terminal functional groups: A type: -COOH, M type: -CONH-Si(OR) n or S type: -CF3), polytetrafluoroethylene (commercially available examples of which are from Chemours ), polyparaxylene, fluorinated hydrocarbons, fluoroacrylic copolymers (commercially available examples of which include ). The passivation layer 86 may be deposited on the support 52 using any of the examples disclosed herein.

[0436] like Fig.33A As shown in FIG. 1 , this example of the method includes imprinting a multilayer substrate to form features (e.g., recesses 28) separated by gap regions 30 of a passivation layer 86, wherein regions 14, 16 of each of the first and second functionalized layers are exposed at each feature / recess 28. The exposed regions 14, 16 of a single feature / recess 28 and the surrounding gap regions 30 of the passivation layer 86 are separated by gap regions 30 of the passivation layer 86. Fig.33B For each region 14 , 16 , feature / recess 28 has a sloped bottom or stepped region, or some other variation in geometry that exposes a portion of layer 60 and a portion of layer 64 from the top of feature / recess 28 .

[0437] To imprint the multilayer substrate, a nanoimprint lithography mold or working stamp 56 is pressed against the resin layer 54 to produce an imprint of features in the layers 60, 64, 68. In other words, each of the layers 60, 64, 68 is recessed or perforated by a protrusion of the working stamp 56. The layers 60, 64, 68 can then be cured with the working stamp 56 in place. Curing can be accomplished by exposure to actinic radiation, such as visible radiation or ultraviolet (UV) radiation, or exposure to radiation of a wavelength in the range of about 240nm to 380nm when a photoresist is used; or by exposure to heat when a heat-curable resist is used. Curing can promote polymerization and / or cross-linking. As an example, curing can include multiple stages, including soft baking (e.g., removing solvents) and hard baking. The soft baking can be performed at a lower temperature in the range of from about 50°C to about 150°C. The duration of the hard bake may be from about 5 seconds to about 10 minutes at a temperature ranging from about 100° C. to about 300° C. Examples of apparatus that may be used for the soft bake and / or hard bake include a hot plate, an oven, and the like.

[0438] After curing, the working stamp 56 is released. This produces topographic features, namely depressions 28, in the layers 60, 64, 68.

[0439] As mentioned, primers 18, 20 or 18', 20' (in Fig.33A or Fig.33B) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14; and the primers 19, 21 or 19', 21' (in Fig.33A or Fig.33B The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0440] In other examples, primers 18, 20 or 18', 20' and / or primers 19, 21 or 19', 21' are not pre-grafted to the first functionalization layer 60 and the second functionalization layer 64, respectively. In these examples, regions 14, 16 have different functional groups, and primers 18, 20 or 18', 20' and primers 19, 21 or 19', 21' can be grafted after imprinting.

[0441] When grafting is performed after embossing, the grafting can be accomplished using any grafting technique disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for passivation layer 86.

[0442] As mentioned, some examples of depressions 28 may be in the form of grooves. Figure 34S Still another exemplary configuration of regions 14, 16 is depicted (top view) in which they are formed in trench 28".

[0443] like Fig.34A As shown, the multilayer substrate includes a (patterned) resin 54' on a support 52. The grooves 28" defined in the patterned resin 54' (e.g., NIL resin, SiO2, etc.) are adjacent to gap regions 30, which separate adjacent grooves 28" from each other (see, e.g., Fig.34H , which shows a top view of multiple grooves 28”).

[0444] like Fig.34B As shown in FIG. 1 , a sacrificial layer 84 is applied over the resin 54 ′ (eg, the gap region 30 and the trench 28 ″). Any material may be used as the sacrificial layer 84 that has an etching difference relative to the resin 54 ′ and relative to the second sacrificial layer 88 used. In one example, the sacrificial layer 84 is silicon, aluminum, or chromium.

[0445] like Fig.34C , the sacrificial layer 84 is removed from a portion of the resin 54'. In this example, the sacrificial layer 84 can be etched so that a region 84" of sacrificial material remains directly adjacent to each sidewall 90 of each trench 28". After etching, the gap region 30 and the bottom portion of each trench 28" are exposed.

[0446] like Fig.34D As shown in FIG. 1 , a second sacrificial layer 88 is applied over areas 84″ of sacrificial material and any exposed areas of resin 54″ (e.g., gap regions 30 and bottom portions of trenches 28″). Any material may be used as second sacrificial layer 88 that has an etching difference relative to resin 54′ and relative to sacrificial layer 84 used. For example, if layer 84 is silicon, layer 88 may be aluminum or chromium.

[0447] The sacrificial layers 84 , 88 may be applied using any of the deposition techniques described herein.

[0448] like Fig.34E As shown in the figure, the second sacrificial layer 88 is removed from the region 84" of sacrificial material and the portion of the resin 54'. In this example, the second sacrificial layer 88 can be etched so that the region 88" of the second sacrificial material remains directly adjacent to the respective sacrificial material region 84". In this example, after etching, the gap region 30 and another (smaller) bottom portion of each trench 28" are exposed.

[0449] like Fig.34F As shown in (depicting a top view), material 92 is deposited to fill any spaces between the second sacrificial material regions 84". In other words, additional material 92 covers the bottom portions of each trench 28" and completely separates the regions 88' of second sacrificial material. Additional material 92 can be the same material as resin 54'. For example, if silicon dioxide is used as resin 54', additional material 92 can be silicon dioxide. Additional material 92 helps define new trenches 28"' that are smaller than trench 28" (where regions 14, 16 will be defined).

[0450] In this example of the method, Figure 34G As shown in FIG. 1 , polishing may be performed to remove additional material 92 from gap region 30 ′.

[0451] Fig.34H A top view of a trench 28'" is depicted filled with two sacrificial materials / layers 84", 88'. As shown, each sacrificial material / layer 84", 88' extends the length of each trench 28'".

[0452] Fig.34I A cross-sectional view of one of the trenches 28'" is depicted filled with two sacrificial materials / layers 84", 88'.

[0453] like Fig.34JAs shown in , the sacrificial material region 84" is removed from a portion of each trench 28"'. This exposes the area / portion 76 where the first functionalized region 14 is to be formed. The sacrificial material region 84" can be etched, and due to the different etch rates, the etching process does not affect the resin 54' or the second sacrificial material region 88'.

[0454] exist Figure 34K , a first functionalized layer 60 is applied over gap region 30, region 76, and second sacrificial material region 88'. First functionalized layer 60 may be any of the embodiments disclosed herein and may be deposited using any of the techniques described herein.

[0455] exist Figure 34K , Figure 34L and Figure 34M , the first functionalized layer 60 is then patterned to form a first functionalized region (region 14) covered by the photoresist 62 in the region / portion 76. The photoresist 62 and the underlying first functionalized layer 60 can be polished or etched away, using the gap region 30 and the second sacrificial material region 88' as an etch stop region. This forms a first functionalized region 14 covered by the photoresist 62 in the region / portion 76 of the trench 28"'.

[0456] like Fig.34N As shown in FIG. 1 , the second sacrificial material region 88' is removed from a portion of each trench 28'". This exposes the area / portion 78 where the second functionalized region 16 is to be formed. The second sacrificial material region 88' can be etched, and due to the different etch rates, the etching process does not affect the resin 54' or the photoresist 62. The exposed portion of the first functionalized layer 60 can be removed during the etching process.

[0457] exist Fig.34O In the embodiment of the present invention, second functionalization layer 64 is applied over gap region 30, region 78, photoresist 62, and any exposed portions of region 14. Second functionalization layer 64 can be any of the examples disclosed herein and can be deposited using any of the techniques described herein.

[0458] exist Figure 34P In the embodiment of the present invention, the photoresist 62 can then be stripped, which removes any second functionalized layer 64 thereon. In any of the examples disclosed herein, sonication can be performed to improve the efficiency of the photoresist stripping or stripping process.

[0459] exist Figure 34Q In the embodiment of the present invention, the gap region 30 can be polished to remove any second functionalized layer 64 thereon. Figure 34QAs shown in FIG. 1 , regions 14, 16 are formed in corresponding regions of groove 28"'. It should be understood that regions 14, 16 extend the length of groove 28"' (eg Figure 34R ). This configuration of regions 14, 16 can be used for simultaneous paired-end read sequencing using primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' disclosed herein.

[0460] exist Figure 34R In the embodiment of the present invention, a second photoresist 62' is applied (and exposed and developed) to form a pattern of spaced-apart strips at least substantially perpendicular to the grooves 28''. The pattern leaves portions of the first functionalized regions 14 and the second functionalized regions 16 exposed between the spaced-apart strips, such as Figure 34R . The portions of the first functionalized regions 14 and the second functionalized regions 16 exposed between the spaced-apart strips are removed (e.g., via etching), and then the spaced-apart strips (the second photoresist 62') are removed (e.g., via etching). After removing the spaced-apart strips (the second photoresist 62'), the regions 14, 16 below the spaced-apart strips (the second photoresist 62') remain intact, as shown in FIG. Figure 34S In this example, the various regions 14, 16 are isolated pairs along the trench 28"'.

[0461] In some examples, primers 18, 20 or 18', 20' (in FIG. 34A to FIG. 34S ) can be pre-grafted to the first functionalized layer 60 and thus attached to the first functionalized region 14. Similarly, the primers 19, 21 or 19', 21' (in FIG. 34A to FIG. 34S The primers (not shown) may be pre-grafted to the second functionalized layer 64 and thus attached to the second functionalized region 16. In these examples, no additional primer grafting is performed.

[0462] In other examples, the primers 18, 20 or 18', 20' are not pre-grafted to the first functionalized layer 60. In these examples, the primers 18, 20 or 18', 20' can be grafted after the first functionalized layer 60 is applied (e.g., Figure 34K If regions 14, 16 have different functional groups, primers 18, 20 or 18', 20' can be grafted at the end of the process (e.g. Figure 34S ), because they will not be grafted to the surface functional groups of region 16.

[0463] Similarly, primers 19, 21 or 19', 21' may not be pre-grafted to the second functionalized layer 64. In these examples, primers 19, 21 or 19', 21' may be grafted after the second functionalized layer 64 is applied (e.g., Fig.34O If regions 14, 16 have different functional groups, primers 19, 21 or 19', 21' can be grafted at the end of the process (e.g. Figure 34S ), because they will not be grafted to the surface functional groups of region 14.

[0464] When grafting is performed during the method, the grafting can be performed using any of the examples disclosed herein. With any grafting method, primers 18, 20 or 18', 20' react with reactive groups of region 14, or primers 19, 21 or 19', 21' react with reactive groups of region 16, and have no affinity for resin 54'.

[0465] In still another example of a flow cell, regions 14, 16 may be formed on functionalized support structures 93, 94, respectively, such as Fig.35 . The functionalized support structures 93, 94 have surface functional groups so that they can be attached to the primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' disclosed herein, respectively. Any example of the core structure 49 disclosed herein can be used for the functionalized support structures 93, 94. Any surface functional groups capable of attaching different primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' disclosed herein can also be used. The functionalized support structures 93, 94 can be formed, for example, using the method disclosed herein for forming the functionalized beads 50 (see the "bead-based flow cell" section).

[0466] In some examples, the functionalized support structures 93, 94 may also have different shapes. In some examples, the shapes correspond to the shapes of the capture sites 95, 96 defined on or in the surface S of the substrate (which may be a single-layer substrate or a multi-layer substrate as described herein). Fig.36A , Fig.36B , Fig.37A and Fig.37B ). For example, the functionalized support structures 93, 94 can have the same shape as the well capture sites 95, 96, respectively (described below). The different shapes will help the functionalized support structure 93 to be physically trapped in the well capture site 95 of the complementary shape, and help the functionalized support structure 94 to be physically trapped in the well capture site 96 of the complementary shape.

[0467] In some instances, the functionalized support structures 93, 94 may also have different capture chemicals. The capture chemicals are chemicals that enable the structures 93, 94 to be attached to the desired locations on the substrate surface S. In some instances, the capture chemicals of the functionalized support structures 93, 94 correspond to the capture chemicals of the capture sites 95, 96 that will receive the corresponding functionalized support structures 93, 94, respectively. For example, the functionalized support structure 93 and the capture site 95 may each include a member of a receptor-ligand binding pair of one type, while the functionalized support structure 94 and the capture site 96 may each include a member of a receptor-ligand binding pair of different types. Different chemicals can help ensure that the functionalized support structures 93, 94 (and the corresponding regions 14, 16, respectively) are captured in the desired regions on the substrate surface S.

[0468] The capture sites 95, 96 are capable of physically and / or chemically securing the functionalized support structures 93, 94, respectively, to the substrate 26 (or the resin 54' of the multi-layer substrate). The capture sites 95, 96 may be located at any suitable location where it is desired to have adjacent regions 14, 16. The location of the capture sites 95, 96 on the substrate 26 may be uniform (see Fig.36A and Fig.36B ) or may be non-uniform. Capture sites 95, 96 may have any suitable shape, geometry, and size, which may depend at least in part on the configuration of the capture sites 95, 96 (e.g., patch, well, protrusion, etc.), and the type of functionalized support structure 93, 94 to be captured by the capture sites 95, 96.

[0469] In some examples, the capture sites 95, 96 are different chemical capture agents applied to a portion of the substrate surface S. Any example of a chemical capture agent disclosed herein can be used. In one example, the corresponding chemical capture agent can be deposited at the desired location using microcontact printing or another suitable technique.

[0470] In other examples, capture sites 95, 96 include corresponding wells defined in the surface S of substrate 26 (or resin 54'). Depending on the substrate used (e.g., single layer or multilayer), etching or embossing can be used to form the wells. The wells can have any suitable shape and geometry, such as those described herein for recess 28.

[0471] In some instances, the wells do not have additional chemical capture agents added to them. In these instances, the opening size enables the functionalized support structures 93, 94 to self-assemble into the respective wells (e.g., based on shape). In other instances, the wells do have respective chemical capture agents added to them.

[0472] Other examples of capture sites 95, 96 include wells and capture beads with chemical capture agents on their surfaces. Capture beads can be sized to fit into the wells. In some instances, the capture beads can be coplanar with adjacent gap regions 30, 30' or extend slightly above adjacent gap regions 30, 30' so that the functionalized support structures 93, 94 ultimately attached thereto are not confined in the wells. In one example, the capture beads are selected from the group consisting of silica, superparamagnetic materials, polystyrene and acrylates. Any example of the chemical capture agent disclosed herein can be used on the surface of the capture beads and can be coated on the capture beads before the capture beads are introduced into the wells. The configuration of the wells and beads of these capture sites 95, 96 can make the functionalized support structures 93, 94 (when attached) form regions 14, 16 adjacent to each other.

[0473] The depth of the capture site 95, 96 wells can vary depending on whether a chemical capture agent is to be introduced therein and whether a capture bead is to be introduced therein. The depth can be selected to at least accommodate the materials (i.e., the materials are contained within the wells). In one example, the depth of the wells is in the range of from about 1 nm to about 5 microns.

[0474] As another example, capture sites 95, 96 include protrusions defined in substrate 26 (or resin 54'). Protrusions are three-dimensional structures that extend outward (upward) from an adjacent surface. Protrusions can be created via etching, photolithography, embossing, and the like.

[0475] While any suitable three-dimensional geometry may be used for projection capture sites 95, 96, a geometry having at least a substantially flat top surface may be desirable. Exemplary projection geometries include spheres, cylinders, cubes, polygonal prisms (e.g., rectangular prisms, hexagonal prisms, etc.), or the like.

[0476] Different chemical capture agents can be applied respectively to the top surface of the projection capture sites 95, 96. Any example of chemical capture agent disclosed herein can be used, and any deposition technique can be used to apply the chemical capture agent to the top surface of the projection.

[0477] It should be understood that although capture sites 95, 96 have been described as both capture agents, wells, etc., any combination of capture site 95, 96 types may be used together in a flow cell (eg, capture agents and wells).

[0478] exist Fig.36A In the embodiment, the capture sites 95 and 96 on the surface S have different shapes. When the functionalized support structures 93 and 94 having the corresponding shapes are loaded into the flow cell ( Fig.36B), the functionalized support structures 93, 94 are self-assembled by physical extrusion and / or by capture chemistry, so that the functionalized support structure 93 is attached to the capture site 95 and the functionalized support structure 94 is attached to the capture site 96.

[0479] exist Fig.37A In FIG. 1 , the capture sites 95 and 96 on the surface S also have different shapes, but are similar to Fig.36A When the functionalized support structures 93, 94, respectively having corresponding shapes, are loaded into the flow cell ( Fig.37B ), the functionalized support structures 93, 94 are self-assembled by physical extrusion and / or by capture chemistry, so that the functionalized support structure 93 is attached to the capture site 95 and the functionalized support structure 94 is attached to the capture site 96.

[0480] Fig.36B and Fig.37B The two configurations shown in result in arrays of regions 14, 16 being at separate locations on the substrate surface S.

[0481] Figures 2 to 10 , Fig.33A , Figure 34S , Fig.36B and Fig.37B The figure shows the different configurations of the region 14,16 of the flow cell, wherein there is no cover bonded to substrate 26 (or resin 54'). Although not shown, it should be understood that the flow cell can have a cover bonded to at least a portion of the gap region 30,30'. In some instances, the cover can be combined before or after the grafting of primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D'. When the cover is combined before the primer grafting, it should be understood that the flow process can be used for grafting. In the flow process, primer solution or mixture can be introduced into the flow channel (defined between the cover and the gap region 30,30') through the corresponding input port (not shown), sufficient time (i.e. incubation period) can be maintained in the flow channel, for primers 18,18',20,20',19,19',21,21' are attached to the region 14,16 respectively, and then can be removed from the corresponding output port (not shown). After the primers 18, 18', 20, 20', 19, 19', 21, 21' are attached, additional fluid may be directed through the flow channel to wash the now functionalized recesses and flow channel.

[0482] The cover may be positioned over the gap region 30 such that it defines a single flow channel or a plurality of fluidly separated flow channels.

[0483] The cover can be any material that is transparent to the excitation light directed toward the substrate 26. As an example, the cover can be glass (e.g., borosilicate, fused silica, etc.), plastic, or the like. A commercially available example of a suitable borosilicate glass is available from Schott North America, Inc. A commercially available example of a suitable plastic material, namely a cycloolefin polymer, is available from Zeon Chemicals LP product.

[0484] In some examples, the cover can be formed integrally with the sidewall, and the sidewall corresponds to the shape of the portion of the gap region 30 to be combined with it. For example, a recess can be etched into a transparent block to form a substantially flat (e.g., top) portion and a sidewall extending from the substantially flat portion. When the etched block is mounted to the gap region 30, the recess can become a flow channel. In other examples, the sidewall and the cover can be separate components coupled to each other. For example, the cover can be a substantially rectangular block having at least a substantially flat outer surface and at least a substantially flat inner surface, and the block defines a portion (e.g., a top portion) of the flow channel (once combined to the portion of the gap region 30). The block can be mounted to (e.g., combined to) a sidewall that is combined to the portion of the gap region 30 and forms the sidewall of the flow channel. In this example, the sidewall can include any material described herein with respect to the spacer layer (described below).

[0485] The cover can be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, frit bonding, or other methods known in the art. In one example, a spacer layer can be used to bond the cover to portions of the gap region 30. The spacer layer can be any material that seals at least some of the gap region 30 and the cover together.

[0486] In one example, the spacer layer can be a radiation absorbing material that absorbs radiation at wavelengths transmitted by the cover and / or substrate 26 (or, for example, the patterned resin of the substrate 26). The absorbed energy then forms a bond between the spacer layer and the cover and between the spacer layer and the substrate 26. An example of such a radiation absorbing material is black PTFE from DuPont (USA) that absorbs at about 1064 nm. (Polyimide containing carbon black). It should be understood that the polyimide can be used without the addition of carbon black, except that the wavelength must be changed to a wavelength that is significantly absorbed by the native polyimide material (e.g., 480nm). As another example, the polyimide CEN JP can be bonded when irradiated with 532nm light. When the spacer layer is a radiation absorbing material, the spacer layer can be located at the interface between the cover and the portion of the gap area 30 so that the spacer layer contacts the desired bonding area. Compression (e.g., a pressure of about 100PSI) can be applied while laser energy of a suitable wavelength is applied to the interface (i.e., the radiation absorbing material is irradiated). The laser energy can be applied to the interface from both the top and the bottom to achieve suitable bonding.

[0487] In another example, the spacer layer can include a radiation absorbing material in contact therewith. The radiation absorbing material can be applied at the interface between the spacer layer and the cover and at the interface between the spacer layer and the portion of the gap region 30. As an example, the spacer layer can be a polyimide and the separate radiation absorbing material can be carbon black. In this example, the separate radiation absorbing material absorbs laser energy that forms a bond between the spacer layer and the cover and between the spacer layer and the portion of the gap region 30. In this example, compression can be applied at the corresponding interfaces while laser energy at a suitable wavelength is applied to the interface (i.e., the radiation absorbing material is irradiated).

[0488] Simultaneous paired-end sequencing method

[0489] Any example of a flow cell comprising primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' described herein can be used for simultaneous paired-end sequencing, where the forward and reverse strands (e.g., strands 40 and 44) ​​are read simultaneously.

[0490] Once a cluster of non-cleavable first template strands 40 is generated in region 14 and a cluster of non-cleavable second template strands 44 is generated in region 16 (refer to FIG. 7C to FIG. 7G The free ends of the primers described herein may be blocked to prevent unwanted priming. It should be understood that the free ends of any primers retained may also be blocked.

[0491] In these methods, a doping mixture can be added, which includes a sequencing primer that can hybridize with the first non-cleavable template strand 40 and the second non-cleavable template strand 44. The extension of the sequencing primer along the template strands 40 and 44 is monitored to determine the nucleotide sequence in the template strands 40 and 44. The potential chemical process can be polymerization (e.g., catalyzed by a polymerase) or connection (e.g., catalyzed by a ligase). In a specific polymerase-based process, fluorescently labeled nucleotides are added to the corresponding sequencing primers in a template-dependent mode so that the order and type of the nucleotides added to the corresponding sequencing primers can be used to determine the sequence of the template. For example, in order to start the first synthesis sequencing cycle, one or more labeled nucleotides, DNA polymerases, etc. can be delivered to the flow cell / delivered through the flow cell, wherein the sequencing primer extension causes the labeled nucleotides to be incorporated into the nascent chains complementary to the templates 40 and 44, respectively. The doping event can be detected in series by an imaging event, without the substantial physical overlap of the fluorescent signals generated at the templates 40 and 44, respectively. This allows simultaneous base calls at the templates 40 and 44, respectively. During an imaging event, an illumination system (not shown) can provide excitation light to the flow cell, and images can be captured and analyzed. As examples, illumination can be achieved with lasers, light emitting diodes, planar waveguides, or the like.

[0492] In some examples, the fluorescently labeled nucleotides may also include a reversible termination property that terminates further primer extension after the nucleotides have been added to the templates 40, 44, respectively. For example, a nucleotide analog having a reversible terminator portion may be added to the templates 40, 44 such that subsequent extension cannot occur until an unblocking agent is delivered to remove the portion. Thus, for examples using reversible termination, an unblocking agent may be delivered to a flow cell, etc. (after detection occurs).

[0493] Washing can be performed between the various fluid delivery steps.The sequencing cycle can then be repeated n times to extend the template by n nucleotides, thereby detecting a sequence of length n.

[0494] Paired end sequencing allows the user to sequence both ends of a fragment and generate high-quality, alignable sequence data. Paired end sequencing helps detect genomic rearrangements and repetitive sequence elements, as well as gene fusions and new transcripts. Although an exemplary paired end sequencing method has been described in detail, it should be understood that the flow cell described herein can be used for genotyping with other sequencing schemes, or for other chemical applications and / or biological applications. In yet another example, the flow cell disclosed herein can be used for library generation on cells.

[0495] Reagent test kit

[0496] Any of the examples of flow cells described herein can be part of a kit.

[0497] Some examples of the kit include a flow cell, a template mixture / fluid, and an incorporation mix. These examples of the flow cell all have a primer set 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' attached thereto. The template mixture / fluid includes a template to be sequenced, and the incorporation mix includes sequencing primers that can hybridize to a non-cleavable first template strand 40 and a non-cleavable second template strand 44 (formed using the template), respectively.

[0498] Other examples of test kit include flow cell and initiation fluid described herein. These examples of flow cell have a primer set 12A, 12B, 12C or 12D attached thereto, and initiation fluid can be used to introduce another primer set 12A ', 12B ', 12C ' or 12D '. In an example of test kit, flow cell includes: substrate 26, which includes a depression 28 separated by gap region 30; first polymer layer 32 in each depression, wherein some functional groups of the first polymer layer are blocked; first primer set 12A, 12B, 12C or 12D, which is attached to other functional groups of the first polymer layer 32 in each depression 28; and second polymer layer 32 ' on gap region 30; and initiation fluid includes fluid carrier and second primer set 12A ', 12B ', 12C ' or 12D ' that is different from first primer set 12A, 12B, 12C or 12D. This exemplary test kit can also include template mixture and incorporation mixture.

[0499] Bead-based flow cells

[0500] Fig. 9 One configuration of a flow cell is depicted in which one of the regions 14 or 16 is part of a bead 50. This section describes various examples and methods of this flow cell configuration.

[0501] The flow cell 10A disclosed herein ( Fig.13D and Fig.14 )、Flow cell 10B( Fig.15D and Fig.16 )、Flow cell 10C( Fig.17D and Fig.18 )、Flow cell 10D( Fig.19D and Fig. 20 Examples of the invention include a support 52 and patterned resin 54 ′, 54 ″ on the support 52 , the patterned resin including recesses 28A, 28B, or 28C separated by gap regions 30 . FIG. 11A to FIG. 11D An example of a method for patterning resin 54 to form recess 28A, 28B, or 28C is depicted together. More specifically, FIG. 11A to FIG. 11CThe formation of depressions 28A, 28B is depicted, and Fig.11A , Fig. 11B and Fig.11D The formation of recess 28C is depicted.

[0502] Fig.11A A support 52 is depicted, and Fig. 11B Resin 54 is depicted deposited on support 52. Any of the examples of substrate 12 described herein may be used for support 52.

[0503] Some examples of suitable resins 54 are selected from the group consisting of caged polysilsesquioxane resins (POSS) based resins, epoxy resins, poly(ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof. Although several examples have been provided, it is contemplated that any resin that can be cured may be used.

[0504] As used herein, the terms “cage polysilsesquioxane (POSS)” and “POSS-based resin” refer to a chemical composition that is a hybrid intermediate (RSiO) between silicon dioxide (SiO2) and siloxane (R2SiO2). 1.5 ). Examples of POSS may be described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. The composition is of the formula [RSiO 3 / 2 ] n The composition may include one or more different cage or core structures as monomer units. In some cases, the structure includes the following polyoctahedral cage or core structure. In some cases, the polyhedral structure may be a T8 structure, such as: And by The monomer unit usually has eight functional group arms R1 to R8.

[0505] The monomer unit may have a cage structure containing 10 silicon atoms and 10 R groups, referred to as T 10 , such as: Or it can have a cage structure containing 12 silicon atoms and 12 R groups, known as T 12 , such as: POSS-based materials can include T6, T 14 or T 16Cage structure. The average cage content can be adjusted during synthesis, and / or controlled by purification methods, and the distribution of the cage size of the monomer unit can be used for the examples disclosed herein. As an example, any cage structure can be present in an amount ranging from about 30% to about 100% of the total POSS monomer units used. POSS-based materials can be a mixture of cage structures and open and partially open cage structures. Therefore, a POSS-based resin precursor or resin can include an epoxy POSS material, which can be a mixture of silsesquioxane configurations. For example, any POSS material described herein can be a mixture of discrete POSS cages and non-discrete silsesquioxane structures and / or incompletely condensed discrete structures, such as polymers, ladders and the like. Therefore, partially condensed materials will include epoxy R groups as described herein at some silicon vertices, but some silicon atoms will not be substituted by R groups, but can be substituted by OH groups. In some examples, POSS materials include various forms of mixtures, such as:

[0506]

[0507]

[0508] In some examples disclosed herein, R1 to R8 or R 10 or R 12 At least one of the arms or R groups comprises an epoxy group, and thus the POSS is referred to as epoxy POSS. In some instances, a majority of the arms, such as eight, ten, or twelve arms or R groups, comprise an epoxy group. In other instances, R1 to R8 or R 10 or R 12 are the same, and therefore R1 to R8 or R 10 or R 12 Each of R1 to R8 or R 10 or R 12 are not the same, and therefore R1 to R8 or R 10 or R 12 At least one of R1 to R8 or R 10 or R 12At least one of the other is a non-epoxy functional group. The non-epoxy functional group can be (a) a reactive group that orthogonally reacts with an epoxy group (i.e., reacts under conditions different from the epoxy group), which is used as a handle for coupling the resin to an amplification primer, a polymer or a polymerizing agent; or (b) a mechanical property or functional property of the resin is adjusted, such as a group for adjusting the surface energy. In some examples, the non-epoxy functional group is selected from the group consisting of: azide / azido, thiol, poly (ethylene glycol), norbornene, tetrazine, amino, hydroxyl, alkynyl, ketone, aldehyde, ester group, alkyl, aryl, alkoxy and haloalkyl. In some aspects, the non-epoxy functional group is selected to increase the surface energy of the resin. In these other examples, the ratio of epoxy groups to non-epoxy groups is in the range of from 7:1 to 1:7, or 9:1 to 1:9, or 11:1 to 1:11. In any example, the disubstituted or monosubstituted (terminal) epoxy groups allow the monomer units to polymerize into a crosslinked matrix when initiated using ultraviolet (UV) light and acid. In some aspects, the epoxy POSS comprises a terminal epoxy group. An example of this type of POSS is a glycidyl POSS having the following structure:

[0509]

[0510] The epoxy POSS may also be a modified epoxy POSS including a controlled radical polymerization (CRP) agent and / or another functional group of interest incorporated into the resin or core structure or cage structure as the functional groups R1 to R8 or R 10 or R 12 One or more of .

[0511] In other examples of the POSS-based resin disclosed herein, R1 to R8 or R 10 or R 12 Each of the POSS monomers includes any non-epoxy group, such as acrylate, methacrylate, ethylene glycol or a short polyethylene glycol chain (up to 50 repeating units). Any non-epoxy POSS monomer that can be free radically polymerized can be used. An example is a methacryloyl POSS cage mixture with the following structure:

[0512]

[0513] Another example is a PEG-POSS cage mixture with the following structure:

[0514]

[0515] In the PEG-POSS example, the terminal methyl group (CH3) of the R group can be replaced by X, where X is an acryloyl group, a methacryloyl group, or another suitable terminal group.

[0516] Other resins 54 may also be used. Examples include (non-POSS) epoxy resins, poly(ethylene glycol) resins, polyether resins (which may be ring-opened epoxides), acrylic resins, acrylate resins, methacrylate resins, and combinations thereof. As examples, a resin comprising epoxy and acrylate monomers may be used, or a resin comprising epoxy and vinyl monomers may be used.

[0517] Another example of a suitable resin 54 is an amorphous fluoropolymer. An example of a commercially available amorphous (non-crystalline) fluoropolymer is fluoropolymer from Bellex.

[0518] like Fig. 11B As shown in FIG. 5 , resin 54 is deposited on support 52. In one example, deposition of resin 54 includes chemical vapor deposition, dip coating, immersion coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, or inkjet printing.

[0519] The deposited resin 54 is then patterned using any of the patterning techniques mentioned herein. Fig. 11B In the example shown in , nanoimprint lithography is used to pattern the resin 54. After the resin 54 is deposited, it can be soft-baked to remove excess solvent. The nanoimprint lithography mold or working stamp 56 is pressed against the resin 54 layer to produce an imprint on the resin 54. In other words, the resin 54 is recessed or perforated by the protrusions of the working stamp 56. Then, the resin 54 can be cured with the working stamp 56 in place. Curing can be done by exposure to actinic radiation, such as visible light radiation or ultraviolet (UV) radiation, or when a photoresist is used, exposure to radiation with a wavelength in the range of about 240nm to 380nm; or when a heat-curable resist is used, by exposure to heat. Curing can promote polymerization and / or cross-linking. As an example, curing can include multiple stages, including soft baking (for example, to remove solvent) and hard baking. Soft baking can be performed at a lower temperature in the range of from about 50°C to about 150°C. The duration of the hard bake may be from about 5 seconds to about 10 minutes at a temperature ranging from about 100° C. to about 300° C. Examples of apparatus that may be used for the soft bake and / or hard bake include a hot plate, an oven, and the like.

[0520] After curing, the working stamp 56 is released. This creates topographical features in the resin 54, namely the depressions 28A and 28B or 28C. Fig. 11C As shown in FIG. 1 , the resin 54 having the recesses 28A and 28B defined therein is referred to as a patterned resin 54 ′. Fig.11DAs shown in FIG. , the resin 54 having recesses 28C defined therein is referred to as patterned resin 54". The patterned resins 54', 54" may undergo further hard baking to complete curing and lock into the imprinted topography. In some examples, the hard baking may be performed at a temperature ranging from about 60°C to about 300°C.

[0521] Fig. 11C The recesses 28A and 28B shown in FIG. 5 have different sizes. In this example, "different sizes" means that some recesses 28B have smaller opening sizes than some other recesses 28A. In this example, "opening size" refers to the area occupied by each recess opening on the patterned resin 54' and / or the diameter of each recess opening on the patterned resin 54'. Fig. 11C In the example shown in FIG. 1 , the area and diameter of the opening of each recess 28B are smaller than the area and diameter of the opening of each recess 28A. The area and diameter of the opening of the larger recess 28A depend on the particle size (e.g., diameter) of the beads 50 to be introduced therein. The area and diameter of the opening of the smaller recess 28B are smaller than the particle size of the beads 50. These opening sizes enable the beads 50 to self-assemble into the recess 28A, rather than the recess 28B, by size exclusion.

[0522] Fig.11D The recess 28C shown in FIG. 2 includes two interconnected but differently sized portions 34, 34'. In this example, "different sizes" means that portion 34' of each recess 28C has a smaller opening size than portion 34. Also in this example, "opening size" refers to the area occupied by each partial opening on the patterned resin 54" and / or the diameter of each partial opening on the patterned resin 54". Fig.11D In the example shown in FIG. 1 , the area and diameter of the openings of each portion 34' are smaller than the area and diameter of the openings of each portion 34. The area and diameter of the openings of the larger portion 34 depend on the particle size (e.g., diameter) of the beads 50 to be introduced therein. The area and diameter of the openings of the smaller portion 34' are smaller than the particle size of the beads 50. These opening sizes enable the beads 50 to self-assemble into the portion 34, rather than the portion 34', by size exclusion.

[0523] An example of an area of ​​each recessed opening or partial opening on the surface may be at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or additionally, the area may be at most about 1×103 μm 2 , up to about 100μm 3 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , at most about 1×10 -2 μm 2 In some cases, the diameter of each depression 28A, 28B or portion 34, 34' can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the diameter can be at most about 1×10 3 The area and diameter of each recess opening or partial opening may be greater than, less than, or between the values ​​specified above. Any desired area and diameter may be used, as long as the area and diameter of the opening of recess 28A is greater than the area and diameter of the opening of recess 28B, or as long as the area and diameter of the opening of portion 34 of recess 28C is greater than the area and diameter of the opening of portion 34' of recess 28C.

[0524] Many different layouts of recesses 28A and 28B or 28C are contemplated, including regular, repeating, and irregular patterns. In one example, recesses 28A and 28B or 28C are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, a linear (i.e., rectangular) layout, a triangular layout, etc., as long as recess 28A or portion 34 can accommodate functionalized beads 50 (e.g., a core structure 49 with region 16 formed thereon, such as, for example, Fig. 13C , Fig.14 In some examples, the layout or pattern may be depressions 28A and 28B or 28C in an xy format of rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of depressions 28A and 28B or 28C and / or gap regions 30. In still other examples, the layout or pattern may be a random arrangement of depressions 28A and 28B or 28C and / or gap regions 30. The pattern may include stripes, swirls, lines, triangles, rectangles, circles, arcs, checkerboards, checkered, diagonal lines, arrows, squares, and / or cross-hatching.

[0525] It should be appreciated that the layout or pattern of recesses 28A and 28B or 28C may be characterized with respect to density and / or average spacing, as described herein.

[0526] Still further, recesses 28A and 28B or 28C may have any suitable depth.

[0527] For use Fig. 11C The patterned resin 54 ′ or Fig.11D An example of a method 100 for making a flow cell using a patterned resin 54" is shown in Fig.12 As depicted in Fig.12 As shown in FIG. 1 , method 100 includes selectively applying polymer 32 to recesses 28A, 28B, or 28C of patterned resin 54′ or 54″ on support 52 (reference numeral 102); grafting first primer set 12A, 12B, 12C, 12D to polymer 32 in at least some recesses 28A, 28B, or 28C (reference numeral 104); and before or after grafting first primer set 12A, 12B, 12C, 12D, depositing functionalized beads 50 in i) at least some recesses 28C; The functionalized beads 50 are deposited in a portion of each recess of the core structure 49, or in a second recess 28A having an opening size larger than the opening size of at least some recesses 28B, wherein the first primer set and the second primer set 12A, 12A' or 12B, 12B', or 12C, 12C', or 12D, 12D' are different. Different examples of the method 100 involving the recesses 28A, 28B will be referred to FIG. 13A to FIG. 13D and Fig.14 as well as FIG. 15A to FIG. 15D and Fig.16 Different examples of this method 100 involving recess 28C will be referred to FIG. 17A to FIG. 17D and Fig.18 as well as 19A to 19D and Fig. 20 To further describe.

[0528] Fig.13A Patterned resin 54' is depicted including larger recesses 28A and smaller recesses 28B. The depths of recesses 16A and 16B are omitted for clarity.

[0529] Fig. 13B The selective application of polymer 32 into each of recesses 28A and 28B is depicted. The selective application of polymer 32 may include a number of processes, including activation of exposed surfaces in gap regions 30 and recesses 28A, 28B, depositing polymer 32 in the activated gap regions 30 and recesses 28A, 28B, and removing polymer 32 from gap regions 30.

[0530] In some examples, activation includes silanizing the surface of the gap region 30 including the patterned resin 54' and the region of the support 52 exposed in the recesses 28A, 28B. Silanization can be done using any silane or silane derivative. The selection of the silane or silane derivative can depend in part on the polymer 32 to be formed, because it may be desirable to form a covalent bond between the silane or silane derivative and the polymer 32. The method for attaching the silane or silane derivative can vary depending on the silane or silane derivative used. Several examples are described herein.

[0531] Examples of suitable silylation methods include vapor deposition (eg, the YES method), spin coating, or other deposition methods.

[0532] In an example using a YES CVD oven, support 52 with patterned resin 54' thereon is placed in the CVD oven. The chamber can be vented, and then the silanization cycle begins. During the cycle, the silane or silane derivative container can be maintained at a suitable temperature (e.g., about 120°C for norbornene silane), the silane or silane derivative vapor line is maintained at a suitable temperature (e.g., about 125°C for norbornene silane), and the vacuum line is maintained at a suitable temperature (e.g., about 145°C).

[0533] In another example, silane or a silane derivative (e.g., liquid norbornene silane) can be deposited in a glass bottle and placed in a glass vacuum desiccator with the support 52 having the patterned resin 54' thereon. The desiccator can then be evacuated to a pressure in the range of from about 15 mTorr to about 30 mTorr and placed in an oven at a temperature in the range of from about 60°C to about 125°C. Silanization is allowed to proceed, and the desiccator is then removed from the oven, cooled, and ventilated in air.

[0534] Vapor deposition, the YES method and / or the vacuum dryer can be used with various silanes or silane derivatives, such as those including cycloolefin unsaturated moieties such as norbornene, norbornene derivatives (e.g., (hetero)norbornene including oxygen or nitrogen in place of one of the carbon atoms), trans-cyclooctene, trans-cyclooctene derivatives, trans-cyclopentene, trans-cycloheptene, trans-cyclononene, bicyclo[3.3.1]non-1-ene, bicyclo[4.3.1]dec-1(9)-ene, bicyclo[4.2.1]non-1(8)-ene, and bicyclo[4.2.1]non-1-ene. Any of these cycloolefins can be substituted, for example, with R groups such as hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclyl, aralkyl, or (heteroalicyclyl)alkyl. Examples of norbornene derivatives include [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane. As other examples, these methods can be used when the silane or silane derivative includes a cycloalkyne unsaturated moiety such as cyclooctyne, a cyclooctyne derivative, or a bicyclononyne (e.g., bicyclo[6.1.0]non-4-yne or a derivative thereof, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne). These cycloalkynes can be substituted with any of the R groups described herein.

[0535] The attachment of the silane or silane derivative forms an activated surface on the gap region 30 and in the recesses 28A, 28B.

[0536] The polymer layer 32 can then be applied as described herein. As an example, the polymer (e.g., PAZAM) can be deposited using spin coating, or dipping or dip coating, or flow of functionalized molecules under positive or negative pressure, or another suitable technique. The polymer deposited to form the polymer layer 32 can be present in a mixture. In one example, the mixture includes PAZAM in water or a mixture of ethanol and water.

[0537] After coating, the polymer-containing mixture may also be exposed to a curing process to form a polymer layer 32 in the activated gap regions 30 and recesses 28A, 28B of the patterned resin 54'. In one example, curing may be performed at a temperature ranging from room temperature (e.g., about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days. In another example, the time may be in the range of from 10 seconds to at least 24 hours. In still another example, the time may be in the range of from about 5 minutes to about 2 hours.

[0538] The attachment of the polymer layer 32 to the activated (silanized in this example) surface can be by covalent bonding. Covalent bonding is helpful to keep at least the first primer set 12A, 12B, 12C, 12D in the recess 28B during the entire life of the final flow cell during various uses. The following are some examples of reactions that can occur between the activated (e.g., silanized) surface and the polymer layer 32.

[0539] When the silane or silane derivative includes norbornene or a norbornene derivative as an unsaturated moiety, the norbornene or norbornene derivative can: i) undergo a 1,3-dipolar cycloaddition reaction with an azide / azido group of PAZAM; ii) undergo a coupling reaction with a tetrazine group attached to PAZAM; undergo a cycloaddition reaction with a hydrazone group attached to PAZAM; undergo a photoclick reaction with a tetrazole group attached to PAZAM; or undergo a cycloaddition with a nitrile oxide group attached to PAZAM.

[0540] When the silane or silane derivative includes cyclooctyne or cyclooctyne derivative as the unsaturated moiety, the cyclooctyne or cyclooctyne derivative can: i) undergo a strain-promoted azide-alkyne 1,3-cycloaddition (SPAAC) reaction with the azide / azide group of PAZAM, or ii) undergo a strain-promoted alkyne-nitrile oxide cycloaddition reaction with the nitrile oxide group attached to PAZAM.

[0541] When the silane or silane derivative includes a bicyclononyne as the unsaturated moiety, the bicyclononyne can undergo similar SPAAC alkyne cycloaddition with an azide or nitrile oxide attached to a PAZAM due to the strain in the bicyclic ring system.

[0542] In other examples, plasma ashing rather than silanization can be used to activate the exposed surfaces of the supports 52 in the gap regions 30 and recesses 28A, 28B. After plasma ashing, a mixture containing a polymer can be directly spin-coated (or otherwise deposited) on the plasma-ashed surface and then cured to form a polymer layer 32. In this example, plasma ashing can produce surfactants (e.g., hydroxyl groups (C-OH or Si-OH) and / or carboxyl groups) that can adhere the polymer to the exposed surfaces of the supports 52 in the gap regions 30 and recesses 28A, 28B. In these examples, the polymer 26 is selected so that it reacts with the surface groups produced by plasma ashing.

[0543] Whether activation occurs via silanization or plasma ashing, polishing may then be performed to remove the polymer layer 32 from the activated gap regions 30. Polishing may be performed as described herein. In some examples, polishing may or may not also remove silane or silane derivatives adjacent to the gap regions 30. When these silanized portions are completely removed, it should be understood that the underlying patterned resin 54' is exposed.

[0544] like Fig. 13C As shown in FIG. 1 , in this example of method 100, functionalized beads 50 are deposited into recesses 28A. Each functionalized bead 50 includes a core structure 49 and a second primer set 12A', 12B', 12C', 12D' attached to the surface of the core structure 49. The second primer set 12A', 12B', 12C', 12D' is different from the first primer set 12A, 12B, 12C, 12D as described herein. Any example of primer set 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' can be used.

[0545] Core structure 49 can be any example mentioned herein about bead / core structure.In one example, core structure 49 of functionalized bead 50 is selected from the group consisting of silica, superparamagnetic material, polystyrene and acrylate.Core structure 49 can have on its surface reactive groups for covalent coupling with second primer group 12A', 12B', 12C', 12D'.Examples of such reactive groups include carboxylic acid, aliphatic primary amine, aromatic amine, aromatic chloromethyl (e.g., vinylbenzyl chloride), amide, hydrazide, aldehyde, hydroxyl, thiol and epoxy.These reactive groups can be inherently present on the surface of core structure 49, or can be incorporated on the surface of core structure 49 by any suitable functionalization technique (e.g., chemical reaction, coating core structure 49 with polymer containing reactive groups, etc.).Core structure 49 with its inherent reactive groups or reactive groups or coatings added thereto defines region 16.

[0546] In the examples disclosed herein utilizing beads 50, one primer set 12A, 12B, 12C, 12D or 12A', 12B', 12C', 12D' can be functionalized at the 3' end with a phosphate blocking group, which will inhibit any extension from occurring after seeding. Once the first extension occurs (with another primer set 12A', 12B', 12C', 12D' or 12A, 12B, 12C, 12D), the phosphate group will then be removed along with any strand seeded into the phosphate-blocked primer set 12A, 12B, 12C, 12D or 12A', 12B', 12C', 12D', and amplification between the two primer sets 12A, 12B, 12C, 12D and 12A', 12B', 12C', 12D' can then proceed. This approach will help reduce the polyclonal rate because initially only one primer set 12A, 12B, 12C, 12D or 12A', 12B', 12C', 12D' is extendable.

[0547] Although in FIG. 13A to FIG. 13D 49, but prior to depositing the functionalized beads 50, the method 100 may include forming the functionalized beads 50 by attaching the second primer set 12A', 12B', 12C', 12D' to the core structure 49. Functionalization may be performed using any suitable technique, including reacting an azide (e.g., succinimidyl (NHS) ester) terminated primer with a hydrazine on the surface of the core structure 49, or reacting an alkyne terminated primer with an azide on the surface of the core structure, or reacting an amino terminated primer with an activated carboxylate group or NHS ester on the surface of the core structure 49, or reacting a thiol terminated primer with an alkylating reactant (e.g., iodoacetamide or maleimide), reacting a phosphoramidite terminated primer with a thioether, or reacting a biotin-modified primer with streptavidin on the surface of the core structure 49. Some nucleic acid primers 19, 19', 21, 21' can be captured on silica beads in the presence of a chaotropic agent (KI, NI or NaSCN). As a specific example, dibenzocyclooctyne (DBCO, which includes alkynes) terminated primers can be used for copper-free click grafting.

[0548] The functionalized beads 50 can be deposited on the patterned resin 54' using any suitable technique. As an example, the functionalized beads 50 can be mixed in a liquid carrier (e.g., water) that can be loaded onto the surface of the patterned resin 54'. In another example, the functionalized beads 50 can be forced to embed in the recess 28A by oscillating the beads 50 with 50 μm to 150 μm steel beads in an oscillator that also includes a support 52 having the patterned resin 54' thereon. Due to the size of the functionalized beads 50 and the size of the recesses 28A and 28B, size exclusion will prevent the functionalized beads 50 from entering the smaller recess 28B and will enable one functionalized bead 50 to self-assemble into one recess 28A. The functionalized beads 50 can be physically trapped in the corresponding recess 28A. The functionalized beads 50 can be optionally chemically attached to the corresponding recess 28A, for example via a streptavidin / biotin linker.

[0549] like Fig.13D As shown in FIG. 1 , recess 28B can then be functionalized with the first primer set 12A, 12B, 12C, 12D. Primers 18, 18' and 20, 20' can be any of the examples disclosed herein and include functional groups that can be attached to reactive groups of polymer layer 32. Because the polymer layer 32 in recess 28A is covered by functionalized beads 50, the polymer layer 32 in recess 28A is not exposed, and therefore its reactive groups are not available for reaction with the first primer set 12A, 12B, 12C, 12D.

[0550] Primers 18, 18' and 20, 20' can be any example set forth herein, and are different from each other, and from primers 19, 19' and 21, 21'. For example, if primers 21, 19 include P5 and P7U primers, primers 20, 18 can include P5U and P7 primers. In this example, the first primer set 12A includes a non-cleavable first primer 18 (e.g., P7) and a cleavable (e.g., uracil-modified) second primer (e.g., P5U); and the second primer set 12A' includes a cleavable (e.g., uracil-modified) first primer 19 (e.g., P7U) and a non-cleavable second primer 21 (e.g., P5). As discussed herein, the chemistry of primer sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' is orthogonal, which allows amplification across both primer populations (sets 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D'), and cleavage of some of the resulting template strands (e.g., 42, 46), leaving the same (forward or reverse) template strand 40 or 44 in a particular region 14 or 16. This enables the simultaneous acquisition of distinguishable read 1 and read 2 signals.

[0551] A grafting process may be performed to graft the primers 18, 18' and 20, 20' to the polymer layer 32 in the recess 28B. In one example, the grafting may be accomplished by flow-through deposition (e.g., using a temporarily bonded cap), dip coating, spray coating, puddle dispensing, or by another suitable method of attaching the primers 18, 18' and 20, 20' to the polymer layer 32 in the recess 28B. Each of these exemplary techniques may utilize a primer solution or mixture, which may include primers, water, a buffer, and a catalyst.

[0552] Dip coating may be used because, in this example, the functionalized beads 50 are functionalized prior to being introduced into the recess 28A and therefore do not react with the dip chemistry. Dip coating may include applying a Fig. 13C The support 52 shown in (having patterned resin 54' and functionalized beads 50 in recess 28A thereon) is immersed in a series of temperature controlled baths. The bath may also be flow controlled and / or covered with a nitrogen blanket. The bath may contain a primer solution or mixture. In various baths, primers 18, 18' and 20, 20' are attached to the reactive groups of the polymer layer 32. In one example, the support 52 is introduced into a first bath containing a primer solution or mixture, in which a reaction occurs to attach primers 18, 18' and 20, 20', and then moved to another bath for washing. The movement from bath to bath may involve a robotic arm, or may be performed manually. The drying system may also be used in immersion coating.

[0553] Spraying can be done by spraying the primer solution or mixture directly onto the Fig. 13C 28A) on a support 52 shown in FIG. 28A (having patterned resin 54' thereon and functionalized beads 50 in recesses 28A). The sprayed wafer can be incubated at a temperature ranging from about 0° C. to about 70° C. for a time ranging from about 4 minutes to about 60 minutes. After incubation, the primer solution or mixture can be diluted and removed using, for example, a spin coater.

[0554] Puddle dispensing can be performed according to the pool and spin stripping method and can therefore be accomplished with a spin coater. The primer solution or mixture can be applied (manually or via an automated process) to a substrate such as Fig. 13C 28A). The applied primer solution or mixture can be applied to or spread over the entire surface, including on the functionalized beads 50 and the gap regions 30. The primer-coated substrate can be incubated at a temperature ranging from about 0° C. to about 80° C. for a time ranging from about 2 minutes to about 60 minutes. After incubation, the primer solution or mixture can be diluted and removed using, for example, a spin coater.

[0555] With any grafting method, primers 18, 18' and 20, 20' react with the reactive groups of the exposed polymer layer 32 in recesses 28B and have no affinity for the interstitial regions 30 of the functionalized beads 50 or patterned resin 54'. Thus, primers 18, 18' and 20, 20' are selectively grafted to the polymer layer 32 in recesses 28B.

[0556] Fig.14 yes Fig.13D A cross-sectional view of a portion of a flow cell 10A is depicted in FIG. The flow cell 10A includes: a support 52; a patterned resin 54' on the support 52, the patterned resin 54' including a first recess 28B and a second recess 28A separated by a gap region 30, the first recess 28B having a smaller opening size than the second recess 28A; a first primer set 12A, 12B, 12C or 12D (including primers 18, 18' and 20, 20') attached to at least some of the first recesses 28B; and functionalized beads 50 respectively located in at least some of the second recesses 28A, the functionalized beads 50 including a second primer set 12A', 12B', 12C' or 12D' (including primers 19, 19' and 21, 21') attached to the surface of the core structure 49, wherein the second primer set 12A', 12B', 12C' or 12D' is different from the first primer set 12A, 12B, 12C or 12D. exist Fig.13D and Fig.14 In the example shown in FIG. 1 , the polymer layer 32 is present in the first recess 28B and the second recess 28A, and the first primer set 12A, 12B, 12C or 12D is attached to the polymer layer 32 in at least some of the first recesses 28B. Fig.13D and Fig.14 In the example shown in FIG. 2 , functionalized beads 50 are placed on polymer layer 32 in at least some of second recesses 28A.

[0557] Reference now FIG. 15A to FIG. 15D , another example of method 100 including recesses 28A, 28B is shown. Fig.15A A patterned resin 54' is depicted that includes a larger recess 28A and a smaller recess 28B. The depths of the recesses 28A and 28B are omitted for clarity.

[0558] Fig. 15B A polymer layer 32 is depicted for each of the recesses 28A and 28B. The polymer layer 32 may be selectively applied as described herein, which may include: activating the gap regions 30 and exposed surfaces in the recesses 28A, 28B, depositing the polymer layer 32 in the activated gap regions 30 and recesses 28A, 28B, and removing the polymer layer 32 from the gap regions 30.

[0559] In this example, if Fig. 15C As shown in FIG. 1 , primer sets 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') are then grafted to the polymer layer 32 in each recess 28A, 28B. Because the functionalized beads 50 are not introduced, the polymer layer 32 in each recess 28A, 28B is exposed, and thus its reactive groups are available for reaction with the first primer set 12A, 12B, 12C, 12D. The grafting can be performed using reference Fig.13D Because the polymer layer 32 is exposed in each recess 28A, 28B, the primers 18, 18' and 20, 20' can be grafted into each recess 28A, 28B.

[0560] like Fig.15D , the functionalized beads 50 can then be introduced into the recesses 28A (having the polymer layer 32 and the primer sets 12A, 12B, 12C, 12D therein). The functionalized beads 50 can be deposited on the patterned resin 54' using any suitable technique. Due to the size of the functionalized beads 50 and the size of the recesses 28A and 28B, size exclusion will prevent the functionalized beads 50 from entering the smaller recess 28B, and will enable one functionalized bead 50 to self-assemble into one recess 28A. In this example, the functionalized beads 50 can be physically trapped in the corresponding recess 28A. Alternatively, in this example, the functionalized beads 50 can be chemically attached to the corresponding recess 28A, for example via a streptavidin / biotin linker.

[0561] Fig.16 yes Fig.15D A cross-sectional view of a portion of a flow cell 10B is depicted in FIG. The flow cell 10B includes: a support 52; a patterned resin 54' on the support 52, the patterned resin 54' including a first recess 28B and a second recess 28A separated by a gap region 30, the first recess 28B having a smaller opening size than the second recess 28A; first primer groups 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') attached to at least some of the first recesses 28B; and functionalized beads 50 respectively located in at least some of the second recesses 28A, the functionalized beads 50 including second primer groups 12A', 12B', 12C', 12D' (including primers 19, 19' and 21, 21') attached to the surface of the core structure 49, wherein the second primer groups 12A', 12B', 12C', 12D' are different from the first primer groups 12A, 12B, 12C, 12D. exist Fig.15D and Fig.16In the example shown in FIG. 1 , the polymer layer 32 is present in the first recess 28B and the second recess 28A, and the first primer sets 12A, 12B, 12C, 12D are attached to the polymer layer 32 in the first recess 28B and the second recess 28A. Then, in this example, the functionalized beads 50 are placed on the first primer sets 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') in at least some of the second recesses 28A.

[0562] Reference now FIG. 17A to FIG. 17D , an example of method 100 including recess 28C is shown.

[0563] Fig.17A A patterned resin 54 including recesses 28C is depicted. Each recess 28C includes a larger portion 34 and a smaller portion 34'. For clarity, the recesses 28C (eg, Fig.11D The depth of ).

[0564] Fig. 17B The polymer layer 32 is depicted in each recess 28C. Fig. 17B , both the larger portion 34 and the smaller portion 34' of each recess 28C have a polymer layer 32 applied thereto. The polymer layer 32 may be selectively applied as described herein, which in one example may include: activating the exposed surfaces in the gap regions 30 and recesses 28C, depositing the polymer layer 32 in the activated gap regions 30 and recesses 28C, and removing the polymer layer 32 from the gap regions 30.

[0565] like Fig. 17C , in this example of method 100, functionalized beads 50 are deposited into the larger portion 34 of recess 28C. Any of the functionalized beads 50 described herein may be used in this example.

[0566] Functionalized beads 50 (including primers 19, 19' and 21, 21') can be deposited on the patterned resin 54" using any suitable technique, such as the techniques described herein. Due to the size of the functionalized beads 50 and the size of the portions 34 and 34', size exclusion will prevent the functionalized beads 50 from entering the smaller portion 34' and will enable one functionalized bead 50 to self-assemble into the larger portion 34 of each recess 28C. In this example, the functionalized beads 50 can be physically trapped in the corresponding larger portion 34, or can be chemically attached to the corresponding larger portion 34, for example via a streptavidin / biotin linker.

[0567] like Fig.17D, the smaller portion 34' of the recess 28C can then be functionalized with the first primer set 12A, 12B, 12C, 12D. Any examples of primers 18, 18' and 20, 20' described herein can be used, as long as they are selected to be different from and orthogonal to the primers 19, 19' and 21, 21' of the functionalized beads 50. In this example, the polymer layer 32 in the larger portion 34 of the recess 28C is covered by the functionalized beads 50, and therefore the polymer layer 32 in the larger portion 34 of the recess 28C is not exposed. Therefore, the polymer reactive groups are not available for reaction with the first primer set 12A, 12B, 12C, 12D. The polymer reactive groups in the smaller portion 34' remain exposed and are therefore available for reaction with the first primer set 12A, 12B, 12C, 12D. The grafting of primers 18, 18' and 20, 20' to the polymer layer 32 in the smaller portion 34' can be performed using reference Fig.13D Any of the techniques described can be used to accomplish this.

[0568] Fig.18 yes Fig.17D A cross-sectional view of a portion of a flow cell 10C is depicted in FIG. The flow cell 10C includes: a support 52; a patterned resin 54'' on the support 52, the patterned resin 54'' including recesses 28C separated by gap regions 30; first primer groups 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') attached to at least some of the recesses 28C; and functionalized beads 50 placed in at least some of the recesses 28C so that at least some of the primers 18, 18' and 20, 20' of the first primer groups 12A, 12B, 12C, 12D are exposed, the functionalized beads 50 including second primer groups 12A', 12B', 12C', 12D' attached to the surface of the core structure 49, wherein the second primer groups 12A', 12B', 12C', 12D' are different from the first primer groups 12A, 12B, 12C, 12D. Fig.17D and Fig.18 In the example shown in FIG. 2 , each recess 28C includes a first portion 34 and a second portion 34′, wherein the first portion 34 has a first opening size greater than or equal to the diameter of the functionalized bead 50, and the second portion 34′ has a second opening size less than the diameter of the functionalized bead 50; and the functionalized bead 50 is placed in the first portion 34 of each recess in at least some recesses 28C. Fig.17D and Fig.18In the example shown in , the polymer layer 32 is present in the recess 28C, and the first primer set 12A, 12B, 12C, 12D is attached to the portion of the polymer layer 32 not occupied by the functionalized beads 50 (i.e., the portion of the polymer layer 32 attached to the smaller portion 34' of the recess 28C).

[0569] Reference now 19A to 19D , another example of method 100 including recesses 28C is shown. Each recess 28C includes a larger portion 34 and a smaller portion 34'. For clarity, recesses 28C (eg, Fig.11D The depth of ).

[0570] Fig.19B The polymer layer 32 is depicted in each recess 28C. Fig.19B , both the larger portion 34 and the smaller portion 34' of each recess 28C have a polymer layer 32 applied thereto. The polymer layer 32 may be selectively applied as described herein, which in this example may include: activating the exposed surfaces in the gap region 30 and the recess 28C, depositing the polymer layer 32 in the activated gap region 30 and the recess 28C, and removing the polymer layer 32 from the gap region 30.

[0571] In this example, if Fig.19C As shown in FIG. 1 , primer sets 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') are then grafted to the polymer layer 32 in each recess 28C. Because the functionalized beads 50 are not introduced, the polymer layer 32 in each portion 34, 34' of the recess 28C is exposed, and thus its reactive groups are available for reaction with the first primer set 12A, 12B, 12C, 12D. The grafting can be performed using reference Fig.13D Since polymer layer 32 is exposed in respective portions 34, 34' of recess 28C, primers 18, 18' and 20, 20' can be grafted into respective portions 34, 34'.

[0572] like Fig.19D, the functionalized beads 50 can then be introduced into the larger portion 34 of the recess 28C (wherein the polymer layer 32 and the primer sets 12A, 12B, 12C, 12D are located). The functionalized beads 50 can be deposited on the patterned resin 54" using any suitable technique. Due to the size of the functionalized beads 50 and the size of the portions 34 and 34', size exclusion will prevent the functionalized beads 50 from entering the smaller portions 34' and will enable one functionalized bead 50 to self-assemble into one larger portion 34. In this example, the functionalized beads 50 can be physically trapped in the corresponding larger portion 34, or can be chemically attached to the corresponding larger portion 34, for example via a streptavidin / biotin linker.

[0573] Fig. 20 yes Fig.19D A cross-sectional view of a portion of a flow cell 10D is depicted in FIG. The flow cell 10D includes: a support 52; a patterned resin 54'' on the support 52, the patterned resin 54'' including recesses 28C separated by gap regions 30; a first primer set 12A, 12B, 12C, 12D (including primers 18, 18' and 20, 20') attached to at least some of the recesses 28C; and a functionalized bead 50 placed in at least some of the recesses 28C so that at least some of the primers 18, 18' and 20, 20' of the first primer set 12A, 12B, 12C, 12D are exposed, the functionalized bead 50 including a second primer set 12A', 12B', 12C', 12D' attached to the surface of the core structure 49, wherein the second primer set 12A', 12B', 12C', 12D' is different from the first primer set 12A, 12B, 12C, 12D. Fig.19D and Fig. 20 In the example shown in FIG. 2 , each recess 28C includes a first portion 34 and a second portion 34′, wherein the first portion 34 has a first opening size greater than or equal to the diameter of the functionalized bead 50, and the second portion 34′ has a second opening size less than the diameter of the functionalized bead 50; and the functionalized bead 50 is placed in the first portion 34 of each recess in at least some recesses 28C. Fig.19D and Fig. 20 In the example shown in , the polymer layer 32 is present in the recess 28C, the first primer set 12A, 12B, 12C, 12D is attached to the polymer layer 32 in the recess 28C, and the functionalized beads 50 are placed on some of the primers 18, 18' and 20, 20' of the first primer set 12A, 12B, 12C, 12D (i.e., on the primers 18, 18' and 20, 20' located on the polymer layer 32 attached to the larger portion 34 of the recess 28C).

[0574] Exemplary flow cells 10A, 10B, 10C, 10D are shown without a cover bonded thereto. Although not shown, the flow cells 10A, 10B, 10C, 10D can have a cover bonded to at least a portion of the interstitial region 30 as described. In some examples, the cover can be bonded after the flow cells 10A, 10B, 10C, 10D are formed.

[0575] The flow cells 10A, 10B, 10C, 10D can be used for a variety of sequencing methods or techniques, including techniques generally referred to as sequencing by synthesis (SBS), cycle array sequencing, ligation sequencing, pyrosequencing, etc. In a specific example, the flow cells 10A, 10B, 10C, 10D can be exposed to a template fluid / mixture and amplification can be performed as described herein to produce a non-cleavable first template strand 40, a cleavable first template strand 46, a non-cleavable second template strand 44, a cleavable second template strand 42. Cleavage can be performed, and then the simultaneous paired-end sequencing methods disclosed herein can be performed.

[0576] With any technique used with flow cell 10A, 10B, 10C, 10D, amplification and sequencing will be limited to recesses 28A and 28B or 28C because primer set 12A, 12A' or 12B, 12B' or 12C, 12C' or 12D, 12D' is present in recess 28A or 28B or portion 34 or 34' of recess 28C, and not in gap region 30.

[0577] Block copolymer based flow cells

[0578] Some examples of flow cells disclosed herein include block copolymers used with a multilayer substrate including a patterned resin. Figures 21 to 25B These examples are described.

[0579] In these examples, patterned resins (e.g., 54') can be manufactured using a "top-down" method such as nanoimprint lithography. The top-down method can produce an array of depressions 28 with high density, low spacing, and small nano features. When combined with the directed self-assembly of block copolymers, this is a "bottom-up" method, and even smaller features (with sub-lithographic size domains) can be formed in depressions 28. Smaller features can be desirable because higher cluster densities can be obtained. Higher cluster densities mean that more bases can be read from a given unit area, which increases the genetic yield of the patterned flow cell. In addition, non-grafted regions (e.g., gap regions 30) surround small features, which makes it easier to approach primers grafted to block copolymers. Therefore, the utilization of primers can be increased.

[0580] In these examples, the block copolymers self-assemble in the recesses 28 of the patterned resin, rather than in the interstitial regions 30 between the recesses 28. Therefore, additional processing for removing material from the interstitial regions 30 is not included.

[0581] These examples of flow cells include: a support 52; a patterned resin on the support 52, the patterned resin including recesses 28 separated by gap regions 30; a block copolymer on the patterned resin in the recess 28, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer; and a primer, the primer being attached to the block-specific functional group of at least one block. In some examples, the primer includes non-cleavable primers 18, 18' and 21, 21' attached to a block of the block copolymer, and the flow cell can be used for paired end sequencing technology, which includes sequentially sequencing the forward template strand attached to one block, and then sequencing the reverse template strand. In other examples, the primer sets 12A, 12A', or 12B, 12B', or 12C, 12C', or 12D, 12D' disclosed herein are attached to different blocks of the block copolymer, respectively. In this example, one block includes primers 18, 18' and 20, 20', and the other block includes primers 19, 19' and 21, 21'. This example of a flow cell can be used for the simultaneous paired-end sequencing technology disclosed herein.

[0582] Examples of parts of a flow cell are shown in Fig.22E 23 and will be further described herein.

[0583] An example method 200 for making an example flow cell is described in Fig.21 As shown. Fig.21 As shown in FIG. 1 , method 100 includes: patterning a resin to form a patterned resin including recesses 28 separated by gap regions 30 (reference numeral 202); introducing a solution containing a block copolymer into the patterned resin, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer (reference numeral 204); exposing the solution to solvent vapor annealing, whereby the block copolymer phase separates and self-assembles in the recesses 28 (reference numeral 206); and grafting a primer to the block-specific functional group of at least one block (reference numeral 208). The method 200 includes: patterning a resin to form a patterned resin including recesses 28 separated by gap regions 30 (reference numeral 202); introducing a solution containing a block copolymer, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer (reference numeral 204); exposing the solution to solvent vapor annealing, whereby the block copolymer phase separates and self-assembles in the recesses 28 (reference numeral 206); and grafting a primer to the block-specific functional group of at least one block (reference numeral 208). Figures 22A to 22E To further describe.

[0584] Fig.22A A support 52 is depicted, and Fig. 22BDepicted is a resin 54A deposited on a support 52. Any of the embodiments of the support 52 described herein may be used. With a block copolymer, the resin 54A can have a depression 28 ( Fig. 22C ), and can also serve as a guiding template for the subsequently deposited block copolymer 58 ( Fig. 22C and Fig.22D Therefore, any resin 54A that can be patterned using photolithography, nanoimprint lithography, stamping technology, embossing technology, molding technology, micro-etching technology, printing technology, etc. can be used. In addition, the resin 54A after being patterned (i.e., the patterned resin 54A') should have a surface energy in the same range as the block copolymer 58 to be deposited thereon. In one example, the resin 54A / patterned resin 54A' and the block copolymer 58 each have a surface energy in the range of from about 25mN / m to about 50mN / m.

[0585] Some examples of resin 54A that can be patterned and act as a guiding template are selected from the group consisting of: caged polysilsesquioxane resin (POSS) based resins, epoxy resins, poly(ethylene glycol) resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof. Although several examples have been provided, it is believed that any resin that can be cured by free radicals can be used. Any resin 54 disclosed herein can be used for resin 54A.

[0586] like Fig.22A and Fig. 22B As shown, resin 54A is deposited on support 52. In the example of method 200, deposition of resin 54A includes chemical vapor deposition, dip coating, immersion coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, or inkjet printing.

[0587] The deposited resin 54A is then patterned using any of the patterning techniques mentioned herein. Fig.22A and Fig. 22B Neutral Fig.22A and Fig. 22BIn the example shown between, nanoimprint lithography is used to pattern resin 54A. After resin 54A is deposited, it can be soft-baked to remove excess solvent. A nanoimprint lithography mold or working stamp 56 is pressed against the resin 54A layer to produce an imprint on the resin 54A. In other words, the resin 54A is recessed or perforated by the protrusions of the working stamp 56. Then, the resin 54A can be cured with the working stamp 56 in place. Curing can be done by exposure to actinic radiation, such as visible light radiation or ultraviolet (UV) radiation, or when a photoresist is used, exposure to radiation with a wavelength in the range of about 240nm to 380nm; or when a heat-curable resist is used, exposure to heat. Curing can promote polymerization and / or cross-linking. As an example, curing can include multiple stages, including soft baking (e.g., removing solvent) and hard baking. Soft baking can be performed at a lower temperature in the range of from about 50°C to about 150°C. The duration of the hard bake may be from about 5 seconds to about 10 minutes at a temperature ranging from about 100° C. to about 300° C. Examples of apparatus that may be used for the soft bake and / or hard bake include a hot plate, an oven, and the like.

[0588] After curing, the working stamp 56 is released. This creates topographic features, namely depressions 16, in the resin 54A. Fig. 22C As shown in FIG. 1 , the resin 54A having the recesses 28 defined therein is referred to as patterned resin 54A'. The patterned resin 54A' may undergo further hard baking to complete curing and lock into the imprinted topography. In some examples, the hard baking may be performed at a temperature ranging from about 60°C to about 300°C.

[0589] like Fig. 22C As shown in FIG. 1 , the patterned resin 54A′ includes recesses 28 defined therein and gap regions 30 separating adjacent recesses 28. In the examples disclosed herein, the recesses 28 become functionalized with a block copolymer (BCP) 58 and primers 18, 21 ( Fig.22F ), while part of the gap region 30 can be used for bonding but does not have block copolymer 58 or primers 18, 21.

[0590] like Fig. 22C As shown in FIG. 2 , patterned resin 54A′ can then be exposed to a process that forms a phase-separated block copolymer 58 (including blocks 58A and 58B) in recess 28. Fig. 22C and Fig.22D As shown, a solution of block copolymer 58 is deposited on patterned resin 54A', wherein each block 58A, 58B of block copolymer 58 has block-specific functional groups that are different from the block-specific functional groups of each other block 58B, 58A of block copolymer 58. Various examples of block copolymer 58 will now be described.

[0591] Block copolymer 58 is a heteropolymer composed of at least two different monomers. In one example, block copolymer 58 includes: a first block 58A, the first block 58A includes a monomer having a primer grafting functional group as its block-specific functional group; and a second block 58B, the second block 58B includes a monomer that adjusts the interaction parameters to drive the phase separation of the first block and the second block. In this example, the monomer of the second block 58B can also include a block-specific functional group, which can react with the patterned resin 54' (and thus attach to the patterned resin 54'). The block-specific functional group that can react with the patterned resin 54' (and thus attach to the patterned resin 54') is referred to as a resin attachment functional group in this article. It should be understood that the first and second names do not represent any particular order in the block copolymer, and any block can include a primer grafting functional group or a functional group that adjusts the interaction parameter. For example, the first block 58A may include a monomer having a block-specific functional group capable of grafting a primer (e.g., 18, 21) and capable of adjusting the interaction parameters to drive the phase separation of the first block and the second block, and the second block 58B may include a monomer having a resin attachment functional group. For another example, the first block 58A may include a monomer having a block-specific functional group capable of grafting a primer (e.g., 18, 21) and attaching to the resin 54', and the second block 58B may include a monomer capable of adjusting the interaction parameters to drive the phase separation of the first block and the second block.

[0592] In any example of block copolymer 58 disclosed herein, the primer grafting functional group is selected from the group consisting of: azide / azido, optionally substituted amino, optionally substituted alkenyl, aldehyde, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, thiol and combinations thereof. When multiple primer grafting functional groups are included in a single block, different primers can be attached to a single block. When different primer grafting functional groups are included in different blocks, different primers can be attached to different blocks.

[0593] The primer grafted functional group may be capable of reacting with a functional group attached to the 5' end of the primer. For example, a primer terminated with bicyclo[6.1.0]non-4-yne (BCN) may be captured by an azide primer grafted functional group of block copolymer 58 via strain-promoted catalyst-free click chemistry. For another example, an alkyne-terminated primer may be captured by an azide primer grafted functional group of block copolymer 58 via copper-catalyzed click chemistry. For still another example, a norbornene-terminated primer may undergo a catalyst-free ring strain-promoted click reaction with a tetrazine primer grafted functional group of block copolymer 58.

[0594] In one example, the primer grafting functional group is an azido group attached to an acrylamide monomer. An example of this monomer is azidoacetamidopentylacrylamide. In another example, the primer grafting functional group is an azido group attached to a benzene-containing monomer. Two examples of this monomer include benzyl azide or azide-functionalized styrene (e.g., ).

[0595] In any example of the block copolymer 58 disclosed herein, the resin attachment functional group is selected from the group consisting of an amino group, an alcohol group, an aromatic group, and a charged group. Suitable anionic charged groups include sulfates or carboxylic acids. Suitable cationic charged groups include ammonium, guanidine, or imidazolium. In other examples, the resin attachment functional group can be a trifluoromethyl group (-CF3). In still another example of the block copolymer 58 disclosed herein, the monomer comprising the resin attachment functional group can be a siloxane monomer, such as SiO(CH3)2.

[0596] In one example, the resin attachment functional group is an amino group attached to an acrylamide monomer. An example of such a monomer is In this example, the ethyl bridge (between the nitrogens) can be replaced with a propyl bridge or any other bridge length that does not interfere with the desired function of the monomer. In one example, the bridge length can be up to 16 carbon atoms. In another example, the resin attachment functional group is an aryl group of a styrene monomer. Other resin attachment groups (for covalent attachment) depend on how the resin 54 is functionalized. For example, if the resin contains epoxy groups, amines or alcohols can be suitable resin attachment functional groups.

[0597] Some examples of block copolymers 58 include primer grafting functional groups and resin attachment functional groups. These groups may depend, respectively and in part, on the primer to be grafted (e.g., 18, 21 or 18, 20 or 18', 20' or 19, 21 or 19', 21') and on the patterning resin 54' to be attached to the block copolymer 58. The following are some examples of block copolymers 58 that include primer grafting functional groups and resin attachment functional groups.

[0598] In the example where the patterning resin 54' is epoxy POSS, the block copolymer 58 includes: a first block 58A, which includes an acrylamide monomer having an amino group as its block-specific functional group; and a second block 58B, which includes an azidoacetamidopentyl acrylamide monomer having an azido group as its block-specific functional group. In this example, the first block 58A includes a resin attachment functional group, and the second block 58B includes a primer grafting functional group, although the second block 58B can also function as a resin attachment functional group. A specific example of this block copolymer 58 is:

[0599]

[0600] Wherein R is hydrogen or polymer initiator end group, n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. Examples of polymer initiator end groups include reversible addition-fragmentation chain transfer (RAFT) end groups, atom transfer radical polymerization (ATRP) end groups, nitroxide-mediated free radical polymerization (NMP) end groups, tetramethylethylenediamine (TEMED) end groups or free radical polymerization (FRP) end groups. In another example, n and m are independently in the range of from about 1 to about 1,000.

[0601] In another example where the patterning resin 54' is epoxy POSS, the block copolymer 58 comprises: a first block 58A, which includes a styrene monomer having an aryl group as its block-specific functional group; and a second block 58B, which includes an azide-functionalized styrene having an azido group as its block-specific functional group. In this example, the first block 58A includes a resin attachment functional group, and the second block 58B includes a primer grafting functional group, although the second block 58B can also function as a resin attachment functional group. A specific example of this block copolymer 58 is:

[0602]

[0603] wherein n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. In another example, n and m are independently in the range of from about 1 to about 1,000.

[0604] In still another example where the patterning resin 54' is epoxy POSS, the block copolymer 58 comprises: a first block 58A, which includes an azide-functionalized styrene having an azide group as its block-specific functional group; and a second block 58B, which includes a siloxane monomer having a siloxane as its block-specific functional group. In this example, the first block 58A includes a primer grafting functional group, although the first block 58A can also function as a resin attachment functional group, and the second block 58B includes a resin attachment functional group. A specific example of this block copolymer 58 is:

[0605]

[0606] wherein n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. In another example, n and m are independently in the range of from about 1 to about 1,000.

[0607] In the case where the patterning resin 54' is an amorphous fluoropolymer (such as ), the block copolymer 58 comprises: a first block 58A, the first block 58A includes a monomer having a trifluoromethyl group as its block-specific functional group; and a second block 58B, the second block 58B includes a monomer having a primer grafting functional group and a resin attachment functional group as its block-specific functional group. In one example of the block copolymer 58, the second block 58B includes an azidoacetamidopentyl acrylamide monomer, and the first block 58A (in this example, it can be a surface energy changing functional group) can be a fluorinated acrylate or a fluorinated acrylamide. A specific example of the block copolymer 58 has the following structure:

[0608]

[0609] Wherein n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. In another example, n and m are independently in the range of from about 1 to about 1,000. In another example of the block copolymer 58 (which is suitable for use with an amorphous fluoropolymer), the second block 58B includes azide-functionalized styrene, and the first block 58A (which is the surface energy-changing functional group in this example) can be trifluoroethyl acrylate. A specific example of the block copolymer 58 has the following structure:

[0610]

[0611] wherein n is in the range of from 1 to 10,000, and m is in the range of from 1 to 10,000. In another example, n and m are independently in the range of from about 1 to about 1,000.

[0612] It should also be understood that the block copolymers 58 disclosed herein may also include one or more other monomers that do not interfere with the functionality of blocks 58A and / or 58B, respectively (e.g., primer grafting, resin attachment, phase separation, etc.). Additional monomers of additional blocks (and in particular block-specific functional groups of additional monomers) may be selected to affect / change the surface free energy of the block copolymer 58, affect the stability of the block copolymer 58, attach to another primer, and / or attach an enzyme. Examples of monomers that can affect / change the surface free energy include acrylate monomers (e.g., trifluoroethyl acrylate or trifluoroethyl methacrylate) or the trifluoromethyl group of trifluoroethyl acrylamide. Examples of monomers that can attach enzymes may include the following block-specific functional groups: thiols, amines, or alcohols that can react with enzymes functionalized with N-hydroxysuccinimide (NHS). It should be understood that other functional groups may be used to attach enzymes or other biomolecules. Therefore, some examples of block copolymers 58 are terpolymers, which will refer to Fig.25B and Fig.25A Let’s discuss this in further detail.

[0613] As mentioned above, in method 200, a solution of block copolymer 58 is introduced into patterning resin 54' (eg Fig. 22C and Fig.22D ). The solution can be a dilute solution (eg, ranging from about 0.01 wt % to about 10 wt %) of the block copolymer 58 in a suitable solvent such as toluene. The block copolymer 58 solution can be deposited using any suitable technique, such as spin coating or the like.

[0614] In order for the block copolymer 58 to self-assemble on a topological patterned support (e.g., patterned resin 54') and undergo microphase separation, the solution containing the block copolymer will have a high Huggins interaction parameter with the underlying patterned resin 54'. In one example, the solution of the block copolymer 58 has a Flory-Huggins interaction parameter in the range of from about 0.04 to about 0.30. In another example, the solution of the block copolymer 58 has a Flory-Huggins interaction parameter of about 0.26.

[0615] The as-deposited block copolymer 58 on the patterned resin 54' is then exposed to solvent annealing. The solvent vapor, temperature, and time used in the solvent annealing may depend on the block copolymer 58 used, and specifically on the conditions under which the block copolymer 58 self-assembles into the recess 28 and microphase separates into blocks 58A and 58B, respectively. In one example, the solvent vapor is toluene, the temperature is room temperature (e.g., from about 14°C to about 25°C), and the time is about 3 hours. It should be understood that solvent selection, annealing time, and annealing temperature depend on the block copolymer. Some suitable solvents may be toluene, heptane, higher alkanes, and mixtures thereof. Time and temperature may affect the morphology in the recess 28, and may therefore be controlled. As an example, the annealing time may be in the range of from 1 minute to 180 minutes, or even longer, such as from about 3 hours to about 48 hours; and the annealing temperature may be in the range of from 18°C ​​to about 250°C.

[0616] As a result of solvent annealing, the block copolymer 58 self-assembles into the depressions 16 (and thus is absent from the interstitial regions 30), and also phase separates into separate domains or blocks 58A, 58B. Fig.22D In the embodiment, the separated blocks 58A, 58B have a circular pattern or a spiral pattern, although the pattern may depend on the block copolymer 58 used. Other examples of the pattern of the block copolymer 58 are as follows. Fig.23A and Fig. 23B Shown in. Fig.23A is a top view of depressions 28 and some of the surrounding interstitial regions 30, wherein the block copolymer 58 in the depressions 28 is phase separated into blocks 58A and 58B exhibiting a fingerprint pattern. Fig. 23B is a top view of a depression 28 and some surrounding interstitial regions 30, wherein the block copolymer 58 in the depression 28 is phase separated into blocks 58A and 58B exhibiting a linear pattern. The blocks 58A, 58B have sublithographically sized domains.

[0617] During solvent annealing, the block 58A or 58B including the resin attachment functional group may react with the patterning resin 54 ′ and thus may be attached to the patterning resin 54 ′.

[0618] Although not shown, in some examples of method 200, the patterned resin 54' in the recesses 28 including the phase separated and self-assembled block copolymers 58A, 58B is exposed to an additional curing process. Curing may be performed as previously described.

[0619] like Fig.22D and Fig.22EAs shown between the figures, a grafting process is performed so that primers (18, 21 or 18', 21' for sequential paired end sequencing or 18, 20 or 18', 20' and 19, 21 or 19', 21' for simultaneous paired end sequencing) are grafted to any primer grafting functional groups of blocks 58A and / or 58B in recess 28.

[0620] In one example, grafting can be accomplished by flow-through deposition (e.g., using a temporarily bonded cap), dip coating, spray coating, puddle dispensing, or by another suitable method of attaching primers (18, 21 or 18', 21' for sequential paired-end sequencing or 18, 20 or 18', 20' and 19, 21 or 19', 21' for simultaneous paired-end sequencing) to primer-grafting functional groups of blocks 58A and / or 58B. In the example of simultaneous paired-end sequencing, primers 18, 20 or 18', 20' can be grafted to one block 58A, and primers 19, 21 or 19', 21' can be grafted to another block 58B. Each of these exemplary techniques can be performed as described herein, and can utilize a primer solution or mixture, which can include primers, water, buffer, and a catalyst.

[0621] It will be appreciated that the primers (non-cleavable primers 18, 21 or 18', 21' for sequential paired-end sequencing or non-cleavable / cleavable primer pairs 18, 20 or 18', 20' and 19, 21 or 19', 21' for simultaneous paired-end sequencing) will be attached to blocks 58A and / or 58B containing primer grafting functional groups. Fig.22E and Fig.22F In the example shown in , primers 18, 21 are attached to block 58B but not to block 58A. In this example, block 58A may have a contributing interaction parameter to drive the phase separation of first block 58A and second block 58B, and may also be attached to patterning resin 54' via a resin attachment functional group.

[0622] Reference now Fig.24 , depicts another example in which the block copolymer 58 is phase-separated into two blocks 58A and 58B. In this example, two different primer sets, one comprising primers 18, 18' and 20, 20', and the other comprising primers 19, 19' and 21, 21', are attached to blocks 58A, 58B, respectively. This example enables simultaneous pairing of end reads during sequencing as described herein. In this example, blocks 58A, 58B each include primer-grafted functional groups to which corresponding primer sets can be attached, respectively.

[0623] As mentioned above, some block copolymers 58 are terpolymers in which each block comprises a different block-specific functional group. In one example, the block copolymer 58 is a terpolymer comprising a first block, a second block, and a third block; wherein the block-specific functional group of the first block is attached to a patterned resin (i.e., is a resin-attached functional group); the block-specific functional group of the second block is attached to a primer (i.e., is a primer-grafted functional group); and the block-specific functional group of the third block is attached to i) another primer different from the primer attached to the block-specific functional group of the second block or is attached to ii) an enzyme (e.g., NEXTERA TM Transposon). Examples of phase-separated terpolymers are Fig.25A In the embodiment of the present invention, the terpolymer of separation comprises block 58A, 58B, 58C, wherein 58A comprises primer grafting functional group, 58B comprises resin attachment functional group and / or affects the surface free energy of block copolymer and / or affects the stability of block copolymer, and 58C comprises different primer grafting functional groups or enzyme attachment functional groups. As depicted, block 58A attaches the first primer group 12A, 12B, 12C, 12D, including primers 18, 18' and 20, 20', and block 58C attaches the second primer group 12A', 12B', 12C', 12D', including primers 19, 19' and 21, 21'. In this embodiment, block 58A serves as region 14, and block 58C serves as region 16. In another example, regions 14, 16 may be blocks that are directly adjacent to each other (eg, 58A and 58B or 58B and 58C).

[0624] In another example, the block copolymer 58 is a terpolymer comprising a first block, a second block, and a third block; wherein the block-specific functional group of the first block is attached to the patterning resin 54' (i.e., is a resin attachment functional group); the block-specific functional group of the second block is attached to the primer (i.e., is a primer grafting functional group); and the block-specific functional group of the third block affects the surface free energy of the block copolymer or affects the stability of the block copolymer. Examples of phase-separated terpolymers are Fig.25B In this embodiment, the separated terpolymer includes blocks 58A, 58B, 58C, wherein 58A includes a resin attachment functional group, 58B affects the surface free energy of the block copolymer or affects the stability of the block copolymer, and 58C includes a primer grafting functional group. In this example, non-cleavable primers 18, 21 are attached, and thus this example may be particularly suitable for sequential paired end sequencing.

[0625] Fig.38A and Fig.38BAnother exemplary method involving a block copolymer 58' is depicted together. In this example, the block copolymer 58' is a layered block copolymer. The layered block copolymer will self-assemble so that different blocks 58A' and 58B' are layered on top of each other so that they are parallel to the underlying materials 54B, 54C and support 52. Examples of layered block copolymers include copolymers containing heterocyclic azide units. Materials 54B, 54C can be different examples of resin 54A described herein, silanes or silanized resins, and can be selected to guide the self-assembly of the block copolymer 58'. Under controlled conditions, the block copolymer 58' self-assembles into specific domains / blocks 58A' and 58B', which are layered on the underlying materials 54B, 54C. In Fig.38A and 38B In the example shown in , as a result of annealing, domains / blocks 58A' and 58B' self-assemble, so that block 58B' is exposed at the surface of one region (covering material 54B), and so that another block 58A' is exposed at the surface of another region (covering material 54C). Block 58B' can include a primer attachment functional group that can attach a first primer group 12A, 12B, 12C, 12D including primers 18, 18' and 20, 20'; and block 58A' can include a different primer attachment functional group that can attach a second primer group 12A', 12B', 12C', 12D' including primers 19, 19' and 21, 21'. In this example, block 58B' serves as region 14, and block 58A' serves as region 16.

[0626] The flow cell including the block copolymers 58, 58' can be used for a variety of sequencing methods or techniques, including techniques generally referred to as sequencing by synthesis (SBS), cycle array sequencing, ligation sequencing, pyrosequencing, etc. In some of these examples, since the phase-separated blocks 58A, 58B, 58C and the attached primers (non-cleavable primers 18, 21 or 18', 21' for sequential paired-end sequencing or non-cleavable / cleavable primer pairs 18, 20 or 18', 20' and 19, 21 or 19', 21' for simultaneous paired-end sequencing) are present in the recess 28 and not on the interstitial region 30, amplification will be limited to the recess 28.

[0627] As an example, a sequencing-by-synthesis (SBS) reaction can be run on a system such as the HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NOVASEQTM 、NEXTSEQDX TM 、NEXTSEQ TM , or any other sequencer system from Illumina (San Diego, CA). In SBS, monitoring sequencing primers along the extension of nucleic acid templates (e.g., sequencing templates) to determine the sequence of nuc...

Claims

1. A flow cell comprising: substrate; a first primer set attached to a first region on the substrate, the first primer set comprising a non-cleavable first primer and a cleavable second primer; and a second primer set, the second primer set being attached to a second region on the substrate, the second primer set comprising a cleavable first primer and a non-cleavable second primer; The second primer set is different from the first primer set.

2. The flow cell of claim 1, wherein: The first region includes a material having a first functional group; and The second region includes a material having a second functional group different from the first functional group. 3 . The flow cell of claim 1 , further comprising a gap separating the first primer set and the second primer set.

4. The flow cell of claim 1, wherein: The substrate includes depressions separated by gap regions; and Each of the depressions comprises: Located in the first area of ​​the first portion; and The second area is located in the second part. 5 . The flow cell of claim 4 , further comprising a gap separating the first region and the second region. The flow cell of claim 4 , wherein the first region and the second region partially overlap.

7. The flow cell of claim 4, wherein the first portion and the second portion have different depths.

8. The flow cell of claim 4, wherein the first region and the second region are different blocks of a block copolymer.

9. The flow cell of claim 1, wherein: The substrate includes depressions separated by gap regions; Each of the recesses includes the first region; and The second region is located on at least some of the gap regions.

10. The flow cell of claim 1, wherein: The first region comprises a first polymer, and the first primer set is grafted to the first polymer; and The second region comprises a second polymer, and the second primer set is grafted to the second polymer.

11. The flow cell of claim 10, wherein the flow cell further comprises a protective coating on the first primer set and on the first polymer.

12. The flow cell of claim 10, wherein: The first polymer is a first layer on the substrate; The second polymer is a second layer on the first layer; The flow cell also includes: A passivation resin on the second layer; and the features defined in the passivating resin, the second polymer, and the first polymer; and The first primer set and the second primer set are each exposed to a respective one of the features.

13. The flow cell of claim 1, wherein: The substrate includes depressions separated by gap regions; Each of the depressions comprises: The first area is located in the first portion; and Part II; and The flow cell further comprises a bead located in the second portion, wherein the second region is on a surface of the bead.

14. The flow cell of claim 1, wherein the cleavable first primer comprises a first cleavage site, the cleavable second primer comprises a second cleavage site, and the first cleavage site and the second cleavage site are of the same type.

15. The flow cell of claim 14, wherein: The non-cleavable first primer, the cleavable second primer, the cleavable first primer and the non-cleavable second primer each include a corresponding adapter; The first cleavage site of the cleavable first primer is located along its linker; and The second cleavage site of the cleavable second primer is located along its linker.

16. The flow cell of claim 1, wherein the cleavable first primer comprises a first cleavage site, the cleavable second primer comprises a second cleavage site, and the first cleavage site and the second cleavage site are of different types.

17. The flow cell of claim 16, wherein: The non-cleavable first primer, the cleavable second primer, the cleavable first primer and the non-cleavable second primer each include a corresponding adapter; The first cleavage site of the cleavable first primer is located along its linker; and The second cleavage site of the cleavable second primer is located along its linker.

18. The flow cell of claim 1, wherein: The first primer set is attached to a first support structure; The first region is a first capture site attached to the first support structure; The second primer set is attached to a second support structure different from the first support structure; and The second region is a second capture site attached to the second support structure.

19. The flow cell of claim 1, wherein the first region is formed by a first substrate and the second region is formed by a second substrate opposite to the first substrate.

20. A kit, comprising: A flow cell, comprising: a substrate comprising depressions separated by gap regions; a first polymer layer in each of the recesses, wherein some functional groups of the first polymer layer are capped; a first primer set attached to other functional groups of the first polymer layer in each of the recesses; and a second polymer layer on the gap region; and An initiating fluid, the initiating fluid comprising: a fluid carrier; and a second primer set different from the first primer set; in: The first primer set includes a non-cleavable first primer and a cleavable second primer; and The second primer set includes a cleavable first primer and a non-cleavable second primer.

21. A method comprising: A template fluid is introduced into a flow cell, the flow cell comprising: a substrate comprising depressions separated by gap regions; a first polymer layer in each of the recesses, wherein exposed functional groups of the first polymer layer are capped; a second primer set attached to the first polymer layer in each of the recesses, the second primer set comprising a cleavable first primer and a non-cleavable second primer; and a second polymer layer on the gap region; whereby templates from said template fluid are amplified to form clusters in at least some of the recesses; introducing a priming fluid comprising a first primer set different from the second primer set into the flow cell, the first primer set comprising a non-cleavable first primer and a cleavable second primer, whereby the non-cleavable first primer and the cleavable second primer are grafted to the second polymer layer; and Bridge amplification is initiated from the cluster to the uncleavable first primer and the cleavable second primer, thereby forming a second cluster over at least some of the gap regions.

22. A method comprising: A template fluid is introduced into a flow cell, the flow cell comprising: a substrate comprising depressions separated by gap regions; a first polymer layer in each of the recesses; a second primer set attached to the first polymer layer, the second primer set comprising a cleavable first primer and a non-cleavable second primer; an optional protective coating on the first polymer layer and on the second primer set; a second polymer layer on the gap region; and a first primer set attached to the second polymer layer, the first primer set comprising a non-cleavable first primer and a cleavable second primer, wherein the second primer set is different from the first primer set; whereby templates from said template fluid are amplified to form clusters in at least some of the recesses and over at least some of the interstitial regions; and The cleavable first primer and the cleavable second primer are cleaved.

23. A flow cell comprising: Supports; a patterned resin on the support, the patterned resin comprising a first recess and a second recess separated by a gap region, the first recess having a smaller opening size than the second recess; a first set of primers attached in at least some of the first recesses; and Functionalized beads are respectively located in at least some of the second recesses, the functionalized beads comprising a second primer set attached to the surface of the core structure of the functionalized beads, wherein the second primer set is different from the first primer set, and wherein the first primer set comprises a non-cleavable first primer and a cleavable second primer, and the second primer set comprises a cleavable first primer and a non-cleavable second primer.

24. The flow cell of claim 23, wherein the core structure of the functionalized beads is selected from the group consisting of silica, superparamagnetic materials, polystyrene, and acrylates.

25. The flow cell of claim 23, wherein the patterning resin is selected from the group consisting of caged polysilsesquioxane resin-based resins, epoxy resins, polyethylene glycol resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof.

26. The flow cell of claim 23, further comprising polymers in the first wells and the second wells, and wherein the first primer set is attached to the polymers in the at least some of the first wells.

27. The flow cell of claim 26, wherein the functionalized beads are located on the polymer in the at least some of the second recesses.

28. The flow cell of claim 26, wherein: The first primer set is also attached to the polymer in the at least some of the second recesses; and The functionalized beads are located on the first primer set in the at least some of the second recesses.

29. The flow cell of claim 23, wherein: The first primer set includes the non-cleavable first primer and a uracil-modified second primer; and The second primer set includes a uracil-modified first primer and the non-cleavable second primer.

30. A flow cell comprising: Supports; a patterned resin on the support, the patterned resin comprising depressions separated by gap regions; a first set of primers attached to at least some of the recesses; and A functionalized bead is placed in at least some of the recesses so that at least some of the primers of the first primer set are exposed, the functionalized bead comprising a second primer set attached to the surface of the core structure of the functionalized bead, wherein the second primer set is different from the first primer set, and wherein the first primer set comprises a non-cleavable first primer and a cleavable second primer, and the second primer set comprises a cleavable first primer and a non-cleavable second primer.

31. The flow cell of claim 30, wherein: Each of the recesses includes a first portion having a first opening size greater than or equal to the diameter of the functionalized bead and a second portion having a second opening size less than the diameter of the functionalized bead; and The functionalized beads are located in the first portion of each of the at least some of the recesses.

32. The flow cell of claim 30, wherein the core structure of the functionalized beads is selected from the group consisting of silica, superparamagnetic materials, polystyrene, and acrylates.

33. The flow cell of claim 30, wherein the patterning resin is selected from the group consisting of caged polysilsesquioxane resin-based resins, epoxy resins, polyethylene glycol resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof.

34. The flow cell of claim 30, further comprising a polymer in the depression.

35. The flow cell of claim 34, wherein the first primer set is attached to a portion of the polymer not occupied by the functionalized bead.

36. The flow cell of claim 35, wherein: The first primer set is attached to the polymer in the recess; and The functionalized beads are located on some other primers of the first primer set.

37. A method comprising: selectively applying a polymer into the recesses of the patterned resin on the support; grafting a first set of primers to the polymer in at least some of the recesses; as well as Before or after grafting the first primer set, a functionalized bead is deposited in i) a portion of each of the at least some of the recesses, or in ii) a second recess having an opening size larger than the opening size of the at least some of the recesses, the functionalized bead comprising a second primer set attached to the surface of the core structure of the functionalized bead, wherein the first primer set and the second primer set are different, and wherein the first primer set comprises a non-cleavable first primer and a cleavable second primer, and the second primer set comprises a cleavable first primer and a non-cleavable second primer.

38. The method of claim 37, wherein prior to depositing the functionalized beads, the method further comprises forming the functionalized beads by attaching the second primer set to the core structure.

39. The method of claim 37, wherein: said portion of each of said at least some of said recesses having an opening size greater than or equal to a diameter of each of said functionalized beads; said at least some of said recesses comprising a second portion interconnected with said portion, wherein said second portion has a second opening size that is smaller than a diameter of each of said functionalized beads; and The functionalized beads self-assemble by size exclusion into the portion of each of the at least some of the recesses.

40. The method of claim 37, wherein prior to selectively applying the polymer, the method further comprises forming the patterned resin on the support by: depositing a resin on the support; and The resin was patterned using nanoimprint lithography.

41. A flow cell comprising: Supports; a patterned resin on the support, the patterned resin comprising depressions separated by gap regions; a block copolymer on the patterned resin in the recess, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer; and A first primer set and a second primer set, wherein the first primer set includes a non-cleavable first primer and a cleavable second primer; and the second primer set includes a cleavable first primer and a non-cleavable second primer, wherein the second primer set is different from the first primer set such that the primers are attached to the block-specific functional group.

42. The flow cell of claim 41, wherein the patterning resin is selected from the group consisting of caged polysilsesquioxane resin-based resins, epoxy resins, polyethylene glycol resins, polyether resins, acrylic resins, acrylate resins, methacrylate resins, and combinations thereof.

43. The flow cell of claim 42, wherein the patterning resin is a caged polysilsesquioxane resin-based resin, and wherein the caged polysilsesquioxane resin-based resin is a cross-linked epoxy caged polysilsesquioxane resin-based resin.

44. The flow cell of claim 42, wherein the block copolymer comprises: a first block comprising an acrylamide monomer having an amino group as a block-specific functional group thereof; and The second block includes an azidoacetamidopentylacrylamide monomer having an azido group as its block-specific functional group.

45. The flow cell of claim 44, wherein the block copolymer is: wherein R is hydrogen or a polymer initiating species end group, n ranges from 1 to 10,000, and m ranges from 1 to 10,000.

46. ​​The flow cell of claim 42, wherein the block copolymer is: wherein n is in the range from 1 to 10,000, and m is in the range from 1 to 10,000.

47. The flow cell of claim 41, wherein the patterning resin is an amorphous fluoropolymer.

48. The flow cell of claim 47, wherein the block copolymer comprises: a first block comprising a monomer having a trifluoromethyl group as its block-specific functional group; and The second block includes a monomer having a primer-grafted functional group as a block-specific functional group thereof.

49. The flow cell of claim 41, wherein the block copolymer comprises: a first block including a monomer having a primer-grafted functional group as its block-specific functional group; and The second block includes monomers that adjust interaction parameters to drive phase separation of the first block and the second block.

50. The flow cell of claim 49, wherein: The primer grafting functional group is an azido group; and The block-specific functional groups of the monomers of the second block are selected from the group consisting of amino groups, alcohol groups, aromatic groups and charged groups.

51. The flow cell of claim 41, wherein: The block copolymer is a terpolymer comprising a first block, a second block and a third block; The block-specific functional group of the first block is attached to the patterned resin; The block-specific functional group of the second block is attached to the primer; and The block-specific functional group of the third block is attached to another primer different from the primer or to an enzyme.

52. The flow cell of claim 41, wherein: The block copolymer is a terpolymer comprising a first block, a second block and a third block; The block-specific functional group of the first block is attached to the patterned resin; The block-specific functional group of the second block is attached to the primer; and The block-specific functional group of the third block affects the surface free energy of the block copolymer or affects the stability of the block copolymer.

53. The flow cell of claim 41, wherein the depressions are selected from the group consisting of wells and trenches.

54. The flow cell of claim 41, wherein the patterning resin and the block copolymer each have a surface free energy ranging from 25 mN / m to 50 mN / m.

55. A flow cell comprising: Supports; a patterned caged polysilsesquioxane resin-based resin on the support, the patterned caged polysilsesquioxane resin-based resin comprising depressions separated by interstitial regions; an isolated block copolymer on the patterned caged polysilsesquioxane resin-based resin in the recess, wherein one block of the isolated block copolymer has a functional group attached to the patterned caged polysilsesquioxane resin-based resin and another block of the isolated block copolymer has another functional group; and A first primer set and a second primer set, wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer, wherein the second primer set is different from the first primer set such that the primers are attached to the functional group.

56. The flow cell of claim 55, wherein the isolated block copolymer is selected from the group consisting of: i) wherein n is in the range from 1 to 10,000, and m is in the range from 1 to 10,000; and ii) wherein R is hydrogen or a polymer initiating species end group, n ranges from 1 to 10,000, and m ranges from 1 to 10,000.

57. A method comprising: patterning the resin to form a patterned resin including recesses separated by gap regions; introducing into the patterning resin a solution comprising a block copolymer, each block of the block copolymer having a block-specific functional group different from the block-specific functional groups of each other block of the block copolymer; annealing the solution by exposing it to solvent vapor, whereby the block copolymers phase separate and self-assemble in the depressions; and grafting a first primer set to the block, the first primer set comprising a non-cleavable first primer and a cleavable second primer; and grafting a second primer set to the block, the second primer set comprising a cleavable first primer and a non-cleavable second primer, wherein the second primer set is different from the first primer set, such that the primers are grafted to the block-specific functional groups.

58. The method of claim 57, wherein patterning the resin comprises nanoimprint lithography.

59. The method of claim 57, wherein the solution comprising the block copolymer has a Flory-Huggins interaction parameter ranging from 0.04 to 0.

30.

60. The method of claim 57, wherein prior to grafting, the method further comprises exposing the patterned resin to a curing process, the patterned resin comprising phase separated and self-assembled block copolymers in the recesses.

61. A method comprising: applying a first functionalized layer to a substrate; patterning the first functionalized layer to form a first functionalized region covered by a photoresist; applying a second functionalized layer to portions of the photoresist and the substrate; stripping the photoresist and any second functionalized layer thereon; removing a portion of the second functionalized layer to form a second functionalized region adjacent to the first functionalized region; and A first primer set is attached to the first functionalized layer or the first functionalized region, and a second primer set is attached to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

62. The method of claim 61, wherein: said attaching of said first primer set comprises pre-grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer prior to applying said first functionalization layer; and The attaching of the second primer set includes pre-grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer prior to applying the second functionalization layer.

63. The method of claim 61, wherein: said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer after application of said first functionalization layer; and The attaching of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

64. The method of claim 61, further comprising: depositing a first self-assembled monolayer on the first functionalized region and a second self-assembled monolayer on the second functionalized region, respectively; wherein said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first self-assembled monolayer; and Wherein said attaching of said second primer set comprises grafting a cleavable first primer and a non-cleavable second primer to said second self-assembled monolayer.

65. The method of claim 61, wherein said removing comprises: applying a second photoresist to the first functionalized area and a second portion of the second functionalized layer that will become the second functionalized area; and The portion of the second functionalized layer is etched.

66. The method of claim 61, wherein: The substrate includes a resin on a support; The resin includes depressions separated by gap regions; The first functionalized region is on a first portion of each depression; The second functionalized layer is on the second portion of each recess and the gap region; and The removing includes polishing the second functionalized layer from the gap region.

67. The method of claim 61, wherein: The substrate includes a resin on a support; The resin includes multiple levels of depressions separated by gap regions; The first functionalized area is at the first level of each multi-level depression; and Prior to applying the second functionalized layer, the method further comprises: applying a sacrificial layer to portions of the photoresist and the resin; removing the sacrificial layer from portions of the resin; and removing a region of the resin from the multi-level depression to produce a region adjacent to the first functionalized region; and The second functionalization layer is applied to the sacrificial layer on the photoresist, to the regions, and to the gap regions.

68. A method comprising: applying a first photoresist to the substrate such that a portion of the first substrate is exposed; applying a first functionalized layer to the first photoresist and the first substrate portion; stripping the first photoresist and any first functionalized layer thereon to form a first functionalized region on the first substrate portion; applying a second photoresist to the first functionalized area and the substrate such that a portion of the second substrate adjacent to the first functionalized area is exposed; applying a second functionalized layer to the second photoresist and the second substrate portion; stripping the second photoresist and any second functionalized layer thereon, thereby forming a second functionalized region adjacent to the first functionalized region; as well as A first primer set is attached to the first functionalized layer or the first functionalized region, and a second primer set is attached to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

69. The method of claim 68, wherein: said attaching of said first primer set comprises pre-grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer prior to applying said first functionalization layer; and The attaching of the second primer set includes pre-grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer prior to applying the second functionalization layer.

70. The method of claim 68, wherein: said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer after application of said first functionalization layer; and The attaching of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

71. The method of claim 68, further comprising: depositing a first self-assembled monolayer on the first functionalized region and a second self-assembled monolayer on the second functionalized region, respectively; wherein said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first self-assembled monolayer; and Wherein said attaching of said second primer set comprises grafting a cleavable first primer and a non-cleavable second primer to said second self-assembled monolayer.

72. A method comprising: applying a first functionalized layer to a substrate comprising trenches separated by gap regions and a region of sacrificial material in a first portion of each of the trenches; patterning the first functionalized layer to form a first functionalized region covered by photoresist in the second portion of each of the trenches; removing the sacrificial material region to expose the first portion of each of the trenches; applying a second functionalization layer to the gap region, the first portion, and the photoresist; stripping the photoresist and any second functionalized layer thereon; removing any second functionalized layer from the interstitial region, whereby a second functionalized region remains in the first portion of each of the trenches; applying a second photoresist in a pattern of spaced-apart strips at least substantially perpendicular to the trenches; removing portions of the first functionalized region and the second functionalized region exposed between the spatially separated strips; removing the second photoresist; and A first primer set is attached to the first functionalized layer or the first functionalized region, and a second primer set is attached to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

73. The method of claim 72, wherein: said attaching of said first primer set comprises pre-grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer prior to applying said first functionalization layer; and The attaching of the second primer set includes pre-grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer prior to applying the second functionalization layer.

74. The method of claim 72, wherein: said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer after application of said first functionalization layer; and The attaching of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

75. The method of claim 72, wherein: said substrate comprising a second region of sacrificial material in said second portion of each of said trenches; The substrate, the sacrificial material region, and the second sacrificial material region have different etching rates; and Prior to applying the first functionalization layer, the method further includes removing the second sacrificial material region from the second portion of each of the trenches.

76. The method of claim 75, wherein before removing the second sacrificial material region, the method further comprises forming the sacrificial material region and the second sacrificial material region by: applying a sacrificial material to the substrate, the substrate comprising trenches separated by the gap regions; removing a portion of the sacrificial material such that an area of ​​the sacrificial material remains directly adjacent to each sidewall of each of the trenches; applying a second sacrificial material to the substrate and the sacrificial material region; removing a portion of the second sacrificial material such that an area of ​​the second sacrificial material remains directly adjacent to each of the sacrificial material areas; and Material is applied to fill any spaces between the second sacrificial material areas.

77. The method of claim 76, wherein: The substrate is a multi-layer substrate; The groove is defined in an outermost layer of the multi-layer substrate; and The material and the outermost layer are the same.

78. A method comprising: applying a sacrificial material to a substrate including recesses separated by first gap regions, wherein each recess includes a deep portion and a shallow portion defined by a stepped portion, and wherein the sacrificial material partially fills the deep portion; sequentially removing a portion of the sacrificial material and a portion of the substrate to form a second gap region at least substantially flush with a remaining portion of the sacrificial material, and removing the step portion to form a region adjacent to the remaining portion of the sacrificial material; applying a first functionalization layer to the second gap region, the remaining portion of the sacrificial material, and the region; applying a photoresist to the first functionalized layer; removing a portion of the photoresist and an underlying portion of the first functionalized layer such that a remaining portion of the sacrificial material and the second gap region are exposed and a portion of the first functionalized layer having the second portion of the photoresist thereon remains in the region; removing a remaining portion of the sacrificial material to form a second region adjacent to the portion of the first functionalized layer; applying a second functionalized layer to the second region to form a second functionalized area; stripping a second portion of the photoresist to form a first functionalized region; as well as A first primer set is attached to the first functionalized layer or the first functionalized region, and a second primer set is attached to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

79. The method of claim 78, wherein: also applying the second functionalization layer to a second portion of the photoresist and the second gap region; removing a first portion of the second functionalized layer with a second portion of the photoresist; and The method also includes polishing the second functionalized layer from the second gap region.

80. The method of claim 78, wherein: said attaching of said first primer set comprises pre-grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer prior to applying said first functionalization layer; and The attaching of the second primer set includes pre-grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer prior to applying the second functionalization layer.

81. The method of claim 78, wherein: said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first functionalization layer after application of said first functionalization layer; and The attaching of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second functionalization layer after the second functionalization layer is applied.

82. A method comprising: Imprinting a multi-layer substrate, the multi-layer substrate comprising: Supports; a first functionalized layer on the support; a second functionalized layer on the first functionalized layer; and a passivation layer on the second functionalized layer; thereby forming features separated by interstitial regions of the passivation layer, wherein respective regions of the first functionalized layer and the second functionalized layer are exposed at respective features; A first primer set is attached to the first functionalized layer, and a second primer set is attached to the second functionalized layer, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

83. The method of claim 82, wherein: said attaching of said first primer set comprises pre-grafting a non-cleavable first primer and a cleavable second primer to said first functionalized layer before said first functionalized layer is incorporated into said multi-layer substrate; and The attaching of the second primer set includes pre-grafting a cleavable first primer and a non-cleavable second primer to the second functionalized layer before the second functionalized layer is incorporated into the multi-layer substrate.

84. The method of claim 82, wherein: said attaching of said first primer set comprises grafting a non-cleavable first primer and a cleavable second primer to said first functionalized layer in each recess; and The attaching of the second primer set includes grafting a cleavable first primer and a non-cleavable second primer to the second functionalized layer in each recess.

85. A method comprising: imprinting a first resin to form a recess including a deep portion and a shallow portion defined by a stepped portion, wherein the first resin is located on a sacrificial layer, and the sacrificial layer is located on a second resin; etching a first portion of the first resin and a portion below the deep portion of the sacrificial layer to expose a portion of the second resin; etching the stepped portion to expose a second portion of the sacrificial layer; applying a first functionalized layer to the portion of the second resin to form a first functionalized region; removing a second portion of the sacrificial layer to expose a second portion of the second resin; applying a second functionalized layer to a second portion of the second resin to form a second functionalized region; as well as A first primer set is attached to the first functionalized layer or the first functionalized region, and a second primer set is attached to the second functionalized layer or the second functionalized region, wherein the first primer set is different from the second primer set, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer.

86. The method of claim 85, wherein: During the application of the second functionalized layer, the second functionalized layer is deposited on the gap region around the recess and not deposited on the first functionalized region; and The method also includes polishing the second functionalized layer from the gap region.

87. A method comprising: attaching a first primer set to a first support structure; attaching a second primer set to a second support structure, wherein the second primer set and the second support structure are different from the first primer set and the first support structure, and wherein the first primer set includes a non-cleavable first primer and a cleavable second primer, and the second primer set includes a cleavable first primer and a non-cleavable second primer; as well as The first support structure and the second support structure are loaded on a substrate surface having more than one first capture site selectively attached to the first support structure and more than one second capture site selectively attached to the second support structure.

Images