Construction method and application of a humanized cytokine CSF1 gene-modified non-human animal

Through gene editing technology, human CSF1 protein is expressed in non-human animals, and the problems of development and functional defects of human hematopoietic cells in the existing model are solved, and an animal model closer to the human immune system is constructed, which improves the effectiveness of new drug development.

CN111073907BActive Publication Date: 2025-07-29BIOCYTOGEN JIANGSU CO LTD +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN201911360465.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2018-12-25
Filing Date
2019-12-25
Publication Date
2025-07-29
Estimated Expiration
2039-12-25

AI Technical Summary

Technical Problem

The existing immunodeficiency animal models have defects in the development and function of human hematopoietic cells after transplantation of human cells and tissues, making it difficult to build an ideal humanized mouse model close to the human immune system for new drug development.

Method used

Through gene editing technology, especially CRISPR/Cas9 technology, the endogenous regulatory elements of the CSF1 gene of non-human animals are inserted or replaced, and the humanized CSF1 gene modification non-human animal model is constructed.

Benefits of technology

The expression of human CSF1 protein in non-human animal models has been achieved, the development and function of human hematopoietic cells are improved to that of humans, and the application value of animal models in the development of new drugs has been enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN111073907B_ABST
    Figure CN111073907B_ABST
Patent Text Reader

Abstract

The present invention relates to humanized genetically modified non-human animals, and specifically to a method for constructing a humanized CSF1 gene-modified non-human animal expressing a humanized cytokine protein and its application in the field of biomedicine. Specifically, it relates to an animal model expressing a human or humanized CSF1 protein. In some examples, the genetically modified non-human animal expressing the human CSF1 protein also has a deletion of IL2rg, and / or has more gene humanizations such as IL3 and CSF2.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to a method for establishing a humanized CSF1 gene-modified animal model and its applications. Specifically, it relates to a method for constructing an animal model modified based on a humanized cytokine CSF1 protein and its applications in biomedicine. Background Art

[0002] The differentiation, development, proliferation, and even activation of cells are all subject to the synergistic action of multiple cytokine signals. Among them, macrophage colony-stimulating factor M-CSF (Macrophage-colony stimulating factor, also known as colony-stimulating factor 1, CSF1) is a cytokine necessary for the differentiation of bone marrow progenitor cells into monocyte lineage cells, such as macrophages, osteoclasts, and microglia, and plays an important role in the survival, proliferation, differentiation, and maintenance of the activity of mononuclear macrophages to promote hematopoiesis. In addition, previous studies have shown that CSF1 also plays an important role in the differentiation of osteoclasts, the differentiation of female reproductive tract cells, the formation of the placenta, and the development of blood vessels and lymphatics, and participates in inflammatory reactions as a pro-inflammatory factor, and is an effective marker for tumors and inflammation.

[0003] Experimental animal disease models are indispensable research tools for studying the etiology, pathogenesis, developing prevention and treatment technologies, and developing drugs for human diseases. Among them, immunodeficient animals are prone to accepting xenogeneic cells or tissues due to their lack of immunity, and have been widely used in the research of tissue or cell humanized animals, the treatment mechanisms of tumor drugs and other diseases. Previous studies have shown that as recipient mice, the commonly used immunodeficient animals are ranked as follows: NOD-Prkdc scid IL-2rγ nul mice > NOD-Rag 1 - / - -IL2rg - / - > Rag 2 - / - -IL2rg - / - > NOD / scid > nude mice, indicating that NOD-Prkdc scid IL-2rγ nul mice are currently the best transplantation recipient mice (Ito R et al. Cell Mol Immunol. 2012 May; 9(3): 208-14).

[0004] An ideal humanized immune system mouse should not only have a human multi-lineage immune system, but also have the proportions of each cell subset close to those of humans and have functions. Although NOD-Prkdc scid IL-2rγ nullMice have severely defective immune functions, show little rejection of human cells and tissues, can form tumors with a small number of cells (depending on the cell line or cell type), and also have no B lymphocyte leakage. They are the most suitable tool mice for transplanting human cells or tissues and have been widely used in the research and development of new humanized mouse models. However, due to the poor effect of murine cytokines on human hematopoietic cells, there are defects in the development and function of human cells after transplanting human hematopoietic stem cells (Watanabe Y et al., Int Immunol. 2009 Jul; 21(7):843-58).

[0005] With the continuous development and maturity of genetic engineering technology, it has been achieved to replace or substitute homologous genes of animals with human genes. Developing humanized animal models in this way is the future development direction of animal models. However, due to the differences between animals and humans in physiology and pathology, and the complexity of genes (i.e., genetic factors), how to construct an "effective" humanized animal model for new drug research and development remains the biggest challenge (Scheer N, Snaith M, Wolf CR, Seibler J. Generation and utility of genetically humanized mouse models, Drug Discov Today; 18(23-24):1200-11, 2013). Beijing Biocytogen Co., Ltd. has successfully prepared NOD-Prkdc scid IL-2rγ null mice (named B-NDG mice). In order to further optimize the existing models and address the deficiencies and needs in clinical translation, there is an urgent need in this field to prepare new animal models. Summary of the Invention

[0006] In the first aspect of the present invention, a method for constructing a humanized CSF1 gene-modified non-human animal is provided, and the humanized CSF1 gene-modified non-human animal expresses human or humanized CSF1 protein in vivo.

[0007] Preferably, the genome of the humanized CSF1 gene-modified non-human animal contains all or part of the nucleotide sequence of the human CSF1 gene.

[0008] Preferably, the genome of the humanized CSF1 gene-modified non-human animal contains the nucleotide sequence encoding human CSF1 protein.

[0009] More preferably, the genome of the humanized CSF1 gene-modified non-human animal includes part or all of exons 1 to 8 of the human CSF1 gene, and the human CSF1 gene is regulated by endogenous regulatory elements, such that the non-human animal expresses human CSF1 protein in vivo.

[0010] Preferably, the part of exons 1 to 8 is at least 30, 60, or 90 nucleotides identical to the nucleotide sequence of the human CSF1 gene, and the CSF1 protein produced in the humanized CSF1 gene-modified non-human animal can bind to an antibody targeting a specific human antigen.

[0011] Even more preferably, the part or all of exons 1 to 8 includes any one or a combination of two or more of the nucleotide sequences of exons 1, 2, 3, 4, 5, 6, 7, or 8 of the human CSF1 gene. The "more than two" includes three, four, five, six, seven, or eight.

[0012] Still more preferably, the part or all of exons 1 to 8 includes a combination of nucleotide sequences of two or more consecutive exons among the nucleotide sequences of exons 1, 2, 3, 4, 5, 6, 7, or 8 of the human CSF1 gene. The "more than two consecutive" includes three consecutive, four consecutive, five consecutive, six consecutive, seven consecutive, or eight consecutive.

[0013] In a specific embodiment of the present invention, the genome of the humanized CSF1 gene-modified non-human animal includes a partial nucleotide sequence of exon 1, the entire nucleotide sequence of exon 2, the entire nucleotide sequence of exon 3, the entire nucleotide sequence of exon 4, the entire nucleotide sequence of exon 5, the entire nucleotide sequence of exon 6, the entire nucleotide sequence of exon 7, and a partial nucleotide sequence of exon 8 of the human CSF1 gene.

[0014] In a specific embodiment of the present invention, the genome of the humanized CSF1 gene-modified non-human animal includes the nucleotide sequence from the start codon of exon 1 to the stop codon of exon 8 of the human CSF1 gene.

[0015] In the construction method of the present invention, gene editing technology is used to construct the humanized CSF1 gene-modified non-human animal. The gene editing technology includes DNA homologous recombination technology based on embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease, or other molecular biology technologies.

[0016] More preferably, a nucleotide sequence encoding human CSF1 protein is inserted after the endogenous regulatory element of the CSF1 gene of a non-human animal using an sgRNA sequence targeting the CSF1 gene. Even more preferably, the insertion site is the start codon.

[0017] In a specific embodiment of the present invention, the construction method includes inserting a nucleotide sequence encoding human CSF1 protein before the start codon of the CSF1 gene of a non-human animal using an sgRNA sequence targeting the CSF1 gene or replacing a partial nucleotide sequence of exons 1 to 8 of the CSF1 gene of a non-human animal with a nucleotide sequence encoding human CSF1 protein, and enabling the humanized non-human animal to express human CSF1 protein in vivo;

[0018] Among them, the sgRNA sequence is unique on the target sequence of the CSF1 gene to be modified and conforms to the sequence arrangement rules of 5'-NNN(20)-NGG-3' or 5'-CCN-N(20)-3';

[0019] Preferably, the 5'-end target site sequence targeted by the sgRNA is shown in any one of SEQ ID NO: 9-17, and the 3'-end target site sequence is shown in any one of SEQ ID NO: 18-26.

[0020] More preferably, a nucleotide sequence encoding human CSF1 protein is inserted after the endogenous regulatory element of the CSF1 gene of a non-human animal using a targeting vector. Even more preferably, the insertion site is the start codon.

[0021] In a specific embodiment of the present invention, the construction method includes inserting a nucleotide sequence encoding human CSF1 protein before the start codon of the CSF1 gene of a non-human animal using a targeting vector or replacing a partial nucleotide sequence of exons 1 to 8 of the CSF1 gene of a non-human animal with a nucleotide sequence encoding human CSF1 protein, and enabling the humanized non-human animal to express human CSF1 protein in vivo;

[0022] Among them, the targeting vector contains a donor DNA sequence, which encodes a donor conversion region, and the donor DNA sequence contains all or part of the nucleotide sequence of the human CSF1 gene.

[0023] Preferably, the targeting vector further contains a DNA fragment homologous to the 5'-end of the conversion region to be modified, i.e., the 5'-arm, which is selected from nucleotides having at least 90% homology with NCBI accession number NC_000069.6.

[0024] Preferably, the targeting vector further comprises a second DNA fragment homologous to the 3' end of the conversion region to be altered, i.e., the 3' arm, which is selected from nucleotides having at least 90% homology to NCBI accession number NC_000069.6.

[0025] Preferably, the expression of the endogenous CSF1 protein is absent or the endogenous CSF1 protein is not expressed.

[0026] In a specific embodiment of the present invention, the construction method comprises replacing part of the nucleotide sequences of exons 1 to 8 of the endogenous CSF1 locus with the nucleotide sequence encoding the CSF1 protein, such that the non-human animal expresses the human CSF1 protein and the endogenous CSF protein is not expressed.

[0027] In a specific embodiment of the present invention, the construction method comprises inserting the nucleotide sequence encoding the human CSF1 protein into the CSF1 locus of the non-human animal and disrupting the coding frame of the endogenous CSF1 protein, such that the non-human animal expresses the human CSF1 protein and the endogenous CSF1 protein is not expressed.

[0028] In a second aspect of the present invention, there is provided a non-human animal genetically modified with a humanized CSF1 gene constructed by the construction method according to the above-mentioned genetically modified non-human animal with a humanized CSF1 gene.

[0029] In a third aspect of the present invention, there is provided a non-human animal genetically modified with a humanized CSF1 gene, wherein the non-human animal genetically modified with a humanized CSF1 gene expresses a human or humanized CSF1 protein in vivo.

[0030] Preferably, the genome of the non-human animal genetically modified with a humanized CSF1 gene contains all or part of the nucleotide sequence of the human CSF1 gene.

[0031] Preferably, the genome of the non-human animal genetically modified with a humanized CSF1 gene contains the nucleotide sequence encoding the human CSF1 protein.

[0032] More preferably, the genome of the non-human animal genetically modified with a humanized CSF1 gene includes part or all of exons 1 to 8 of the human CSF1 gene, and the human CSF1 gene is regulated by endogenous regulatory elements; the non-human animal with a humanized CSF1 gene expresses the human CSF1 protein in vivo.

[0033] The genome of the non-human animal genetically modified with a humanized CSF1 gene according to the present invention or the non-human animal genetically modified with a humanized CSF1 gene constructed by the construction method of the non-human animal genetically modified with a humanized CSF1 gene according to the present invention includes a chimeric CSF1 gene, and the chimeric CSF1 gene encodes a human or humanized CSF1 protein.

[0034] In a fourth aspect of the present invention, there is provided a cell genetically modified with the CSF1 gene, and the cell expresses human or humanized CSF1 protein.

[0035] Preferably, the genome of the cell contains all or part of the nucleotide sequence of the human CSF1 gene.

[0036] Preferably, the genome of the cell contains the nucleotide sequence encoding the CSF1 protein.

[0037] More preferably, the genome of the cell includes part or all of exons 1 to 8 of the human CSF1 gene, and the human CSF1 gene is regulated by endogenous regulatory elements; the cell expresses human CSF1 protein.

[0038] Further preferably, the genome of the cell contains a partial nucleotide sequence of exon 1, the entire nucleotide sequence of exon 2, the entire nucleotide sequence of exon 3, the entire nucleotide sequence of exon 4, the entire nucleotide sequence of exon 5, the entire nucleotide sequence of exon 6, the entire nucleotide sequence of exon 7, and a partial nucleotide sequence of exon 8.

[0039] In a specific embodiment of the present invention, the genome of the cell includes the nucleotide sequence from the start codon of exon 1 to the stop codon of exon 8 of the human CSF1 gene. Preferably, the cell is derived from a rodent; preferably, the cell is derived from a mouse.

[0040] In a fifth aspect of the present invention, there is provided a method for constructing a cell genetically modified with the above CSF1 gene, and the cell expresses human or humanized CSF1 protein.

[0041] Preferably, the genome of the cell contains all or part of the nucleotide sequence of the human CSF1 gene.

[0042] Preferably, the genome of the cell contains the nucleotide sequence encoding human CSF1 protein. Further preferably, the genome of the cell includes part or all of exons 1 to 8 of the human CSF1 gene, and the human CSF1 gene is regulated by endogenous regulatory elements such that the cell expresses human CSF1 protein.

[0043] In the method for constructing a cell genetically modified with the CSF1 gene according to the present invention, gene editing technology is used to construct the genetically modified cell, and the gene editing technology includes DNA homologous recombination technology based on embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease, or other molecular biology techniques.

[0044] More preferably, a nucleotide sequence encoding human CSF1 protein is inserted after the endogenous regulatory element of the CSF1 gene in the cell using an sgRNA sequence targeting the CSF1 gene. Even more preferably, the insertion site is the start codon.

[0045] In a specific embodiment of the present invention, the construction method includes inserting a nucleotide sequence encoding human CSF1 protein before the start codon of the CSF1 gene in a non-human animal cell using an sgRNA sequence targeting the CSF1 gene or replacing a partial nucleotide sequence of exons 1 to 8 of the CSF1 gene in the non-human animal cell with a nucleotide sequence encoding human CSF1 protein, and enabling the cell to express human CSF1 protein;

[0046] Wherein, the sgRNA sequence is unique on the target sequence of the CSF1 gene to be modified and conforms to the sequence arrangement rule of 5’-NNN(20)-NGG-3’ or 5’-CCN-N(20)-3’;

[0047] Preferably, the 5’-end target site sequence targeted by the sgRNA is shown as any one of SEQ ID NO: 9-17, and the 3’-end target site sequence is shown as any one of SEQ ID NO: 18-26.

[0048] More preferably, a nucleotide sequence encoding human CSF1 protein is inserted after the endogenous regulatory element of the CSF1 gene in the cell using a targeting vector. Even more preferably, the insertion site is the start codon.

[0049] In another specific embodiment of the present invention, the construction method includes inserting a nucleotide sequence encoding human CSF1 protein before the start codon of the CSF1 gene in a non-human animal cell using a targeting vector or replacing a partial nucleotide sequence of exons 1 to 8 of the CSF1 gene in the cell with a nucleotide sequence encoding human CSF1 protein, and enabling the cell to express human CSF1 protein;

[0050] Wherein, the targeting vector contains a donor DNA sequence, which encodes a donor conversion region, and the donor DNA sequence contains all or part of the nucleotide sequence of the human CSF1 gene.

[0051] Preferably, the targeting vector contains a DNA fragment homologous to the 5’-end of the conversion region to be modified, i.e., the 5’ arm, which is selected from nucleotides having at least 90% homology with NCBI accession number NC_000069.6.

[0052] Preferably, the targeting vector comprises a second DNA fragment homologous to the 3'-end of the conversion region to be modified, i.e., the 3'-arm, which is selected from nucleotides having at least 90% homology with NCBI accession number NC_000069.6.

[0053] Preferably, in the cells genetically modified with the CSF1 gene, the expression of endogenous CSF1 protein is absent or the endogenous CSF1 protein is not expressed.

[0054] In a specific embodiment of the present invention, the method for constructing the genetically modified cells comprises replacing a partial nucleotide sequence of exons 1 to 8 of the endogenous CSF1 locus with a nucleotide sequence encoding human CSF1 protein, such that the cells express human CSF1 protein and the endogenous CSF1 protein is not expressed.

[0055] In a specific embodiment of the present invention, the method for constructing the cells genetically modified with the CSF1 gene comprises inserting a nucleotide sequence encoding human CSF1 protein into the CSF1 locus of the cells and disrupting the coding frame of the endogenous CSF1 protein, such that the cells express human CSF1 protein and the endogenous CSF1 protein is not expressed.

[0056] The genome of the cells genetically modified with the CSF1 gene according to the present invention or the cells constructed by the method for constructing the genetically modified cells according to the present invention comprises a chimeric CSF1 gene, and the chimeric CSF1 gene encodes human or humanized CSF1 protein.

[0057] In a sixth aspect of the present invention, there is provided a targeting vector for the CSF1 gene, the targeting vector comprising a donor DNA sequence which encodes a donor conversion region, and the donor DNA sequence comprises all or part of the nucleotide sequence of the human CSF1 gene.

[0058] Preferably, the targeting vector comprises a DNA fragment homologous to the 5'-end of the conversion region to be modified, i.e., the 5'-arm, which is selected from nucleotides having at least 90% homology with NCBI accession number NC_000069.6. More preferably, the nucleotide sequence of the 5'-arm is as shown in SEQ ID NO: 6.

[0059] Preferably, the targeting vector comprises a second DNA fragment homologous to the 3'-end of the conversion region to be modified, i.e., the 3'-arm, which is selected from nucleotides having at least 90% homology with NCBI accession number NC_000069.6. More preferably, the nucleotide sequence of the 3'-arm is as shown in SEQ ID NO: 7.

[0060] Preferably, the donor DNA sequence is as shown in SEQ ID NO: 8.

[0061] Preferably, the conversion region to be altered is located in exons 1 to 8 of the CSF1 gene.

[0062] Preferably, the targeting vector further comprises an optional genetic marker.

[0063] Preferably, the marker gene is a coding gene for a negative selection marker. More preferably, the coding gene for the negative selection marker is the coding gene for diphtheria toxin A subunit (DTA).

[0064] Preferably, the targeting vector further comprises a resistance gene for positive clone screening. More preferably, the resistance gene for positive clone screening is the coding sequence Neo of neomycin phosphotransferase.

[0065] Preferably, the targeting vector further comprises a specific recombination system. More preferably, the specific recombination system is the Frt recombination site (or the conventional LoxP recombination system can also be selected). There are 2 of the specific recombination systems, which are respectively installed on both sides of the resistance gene.

[0066] In the seventh aspect of the present invention, there is provided an sgRNA sequence specifically targeting the CSF1 gene, and the sgRNA sequence is unique on the target sequence of the CSF1 gene to be altered and conforms to the sequence arrangement rule of 5'-NNN(20)-NGG-3' or 5'-CCN-N(20)-3'.

[0067] Preferably, the target site of the sgRNA sequence on the CSF1 gene of the non-human animal is located on exon 1 and / or exon 8 of the CSF1 gene of the non-human animal;

[0068] More preferably, the 5'-end target site sequence targeted by the sgRNA is shown as any one of SEQ ID NO: 9-17, and the 3'-end target site sequence is shown as any one of SEQ ID NO: 18-26.

[0069] In a specific embodiment of the present invention, the 5'-end target site sequence targeted by the sgRNA is shown as SEQ ID NO: 13, and the 3'-end target site sequence is shown as SEQ ID NO: 24.

[0070] In the eighth aspect of the present invention, there is provided a vector for constructing a non-human animal with a humanized CSF1 gene modification, and the vector produces the above-mentioned sgRNA sequence.

[0071] In the ninth aspect of the present invention, there is provided a method for constructing a vector for a non-human animal with a humanized CSF1 gene modification, and the method comprises the following steps:

[0072] 1) Prepare a forward oligonucleotide sequence and a reverse oligonucleotide sequence from any of the sgRNA target sequences shown in SEQ ID NO: 9 - 17 and / or any of the sgRNA target sequences shown in SEQ ID NO: 18 - 26.

[0073] 2) Synthesize a fragment DNA containing a T7 promoter and an sgRNA scaffold, and sequentially ligate the above fragment to a backbone vector through EcoRI and BamHI digestion. After sequencing verification, obtain the pT7 - sgRNA vector.

[0074] 3) Synthesize the forward oligonucleotide and the reverse oligonucleotide described in step 1) respectively. Denature and anneal the synthesized sgRNA oligonucleotides to form a double - strand that can be ligated into the pT7 - sgRNA vector described in step 2).

[0075] 4) Link the annealed double - strand sgRNA oligonucleotides in step 3) to the pT7 - sgRNA vector respectively, and screen to obtain the sgRNA vector.

[0076] Preferably, the sgRNA target sequence is SEQ ID NO: 13 and / or SEQ ID NO: 24.

[0077] In a specific embodiment of the present invention, the fragment DNA sequence containing the T7 promoter and the sgRNA scaffold is as shown in SEQ ID NO: 27. The forward oligonucleotide is SEQ ID NO: 29 or SEQ ID NO: 33; the reverse oligonucleotide is SEQ ID NO: 31 or SEQ ID NO: 35.

[0078] In the tenth aspect of the present invention, there is provided an application of the above - mentioned targeting vector, the above - mentioned sgRNA sequence or the above - mentioned vector in gene - editing the CSF1 gene.

[0079] In the eleventh aspect of the present invention, there is provided a method for preparing a CSF1 gene - knocked - out non - human animal, including the following steps:

[0080] a) Obtain the sgRNA vector according to the method steps 1) - 4) of constructing a vector for modifying a non - human animal with a humanized CSF1 gene as described above.

[0081] b) Mix the in vitro transcription product of the sgRNA vector and Cas9 mRNA to obtain a mixture. Inject the mixture into the cytoplasm or nucleus of a mouse fertilized egg, transfer the injected fertilized egg to a culture medium for culture, and then transplant it into the oviduct of a recipient female mouse for development to obtain F0 - generation mice.

[0082] c) Subject the F0 generation mice to PCR testing to verify that the CSF1 gene in the cells has been knocked out, and obtain positive CSF1 gene knockout mice;

[0083] d) Expand the population of the positive mice screened in step c) by hybridization and self-crossing to establish stable CSF1 gene knockout mice.

[0084] In the twelfth aspect of the present invention, there is provided a method for preparing a humanized CSF1 gene-modified non-human animal, and the method comprises the following steps:

[0085] First step: Obtain the sgRNA vector according to steps 1)-4) of constructing the vector for humanized gene-modified non-human animals as described above;

[0086] Second step: Mix the in vitro transcription product of the sgRNA vector, the targeting vector of the above CSF1 gene, and Cas9 mRNA, inject the mixture into the cytoplasm or nucleus of the fertilized eggs of female animals, transfer the injected fertilized eggs to a culture medium for culturing, and then transplant them into the oviducts of recipient animals for development to obtain F0 generation animals;

[0087] Third step: Subject the F0 generation animals to PCR testing to verify the humanized non-human animals of the CSF1 gene in the cells.

[0088] In the thirteenth aspect of the present invention, there is provided a method for preparing a multi-gene humanized non-human animal, comprising the following steps:

[0089] (a) Prepare the above-mentioned humanized CSF1 gene-modified non-human animal or the non-human animal constructed by the above method;

[0090] (b) Mate the non-human animal prepared in step (a) with other gene humanized animals, perform in vitro fertilization or directly perform gene editing, and conduct screening to obtain multi-gene humanized non-human animals.

[0091] Preferably, the other gene humanized animals are selected from one or a combination of two or more of the gene IL6, IL15, IL3, CSF2 or SIPRA humanized animals.

[0092] In a specific embodiment of the present invention, the multi-gene humanized animal is an immunodeficient CSF1 humanized gene-modified non-human animal, and the immunodeficient animal lacks the IL-2Rγ chain.

[0093] In another specific embodiment of the present invention, the multi-gene humanized animal is an IL3, CSF1 and CSF2 humanized animal.

[0094] Preferably, the multi-gene humanized non-human animal is a dual-gene humanized non-human animal, a triple-gene humanized non-human animal, a quadruple-gene humanized non-human animal, a quintuple-gene humanized non-human animal, a sextuple-gene humanized non-human animal, a septuple-gene humanized non-human animal, an octuple-gene humanized non-human animal or a nonuple-gene humanized non-human animal.

[0095] In a fourteenth aspect of the present invention, there is provided a multi-gene humanized non-human animal or its offspring prepared by the above method.

[0096] In a fifteenth aspect of the present invention, there is provided a tumor-bearing animal model or a method for preparing the same, the method for preparing the same comprising a humanized CSF1 gene-modified non-human animal or a multi-gene humanized non-human animal prepared by the above method. Further, the present invention also provides the use of the above humanized CSF1 gene-modified non-human animal or its offspring or a multi-gene humanized non-human animal or its offspring comprising a humanized CSF1 gene modification in the preparation of a tumor-bearing animal model.

[0097] Preferably, the method for preparing the tumor-bearing animal model further comprises the step of implanting tumor cells into the non-human animal or its offspring prepared by the above method.

[0098] In a sixteenth aspect of the present invention, there is provided a cell or cell line or primary cell culture, the cell or cell line or primary cell culture being derived from a humanized CSF1 gene-modified non-human animal constructed by the above construction method, the above humanized CSF1 gene-modified non-human animal, the above multi-gene humanized non-human animal or its offspring, or the above tumor-bearing animal model.

[0099] In a seventeenth aspect of the present invention, there is provided a tissue or organ or its culture, the tissue or organ or its culture being derived from the above humanized CSF1 gene-modified non-human animal, the above multi-gene CSF1 humanized non-human animal or its offspring, or the above tumor-bearing animal model. Preferably, the tissue is thymus tissue, spleen tissue, epidermal tissue or intestinal tissue.

[0100] In an eighteenth aspect of the present invention, there is provided a chimeric CSF1 gene, the chimeric CSF1 gene comprising all or part of the nucleotide sequence of the human CSF1 gene and part of the nucleotide sequence of the non-human animal CSF1 gene, and the chimeric CSF1 gene encoding a human or humanized CSF1 protein.

[0101] Preferably, the nucleotide sequence of the chimeric CSF1 gene is selected from one of the following groups:

[0102] a) having an identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% with the nucleotide sequence shown in SEQ ID NO: 5;

[0103] b) hybridize under stringent conditions to the nucleotide sequence set forth in SEQ ID NO: 5;

[0104] c) differ from the nucleotide sequence set forth in SEQ ID NO: 5 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide;

[0105] d) have a nucleotide sequence as set forth in SEQ ID NO: 5, including substitutions, deletions, and / or insertions of one or more nucleotides;

[0106] or,

[0107] e) a portion derived from the human CSF1 gene has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to the nucleotide sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 3;

[0108] f) a portion derived from the human CSF1 gene hybridizes under stringent conditions to the nucleotide sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 3;

[0109] g) a portion derived from the human CSF1 gene differs from the sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 3 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide;

[0110] h) a portion derived from the human CSF1 gene has a nucleotide sequence as set forth in SEQ ID NO: 8 or SEQ ID NO: 3, including substitutions, deletions, and / or insertions of one or more nucleotides;

[0111] or,

[0112] i) encode a partial or full amino acid sequence as set forth in SEQ ID NO: 4;

[0113] j) encode an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to the amino acid sequence set forth in SEQ ID NO: 4;

[0114] k) encode an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO: 4 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid;

[0115] l) The encoded amino acid sequence has the amino acid sequence shown in SEQ ID NO: 4, including substitution, deletion, and / or insertion of one or more amino acid residues;

[0116] or,

[0117] m) The transcribed mRNA sequence has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 49;

[0118] n) The transcribed mRNA sequence hybridizes with the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 49 under stringent conditions;

[0119] o) The transcribed mRNA sequence differs from the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 49 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide;

[0120] p) The transcribed mRNA sequence has the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 49, including substitution, deletion, and / or insertion of one or more nucleotides.

[0121] The non-human animal described in the present invention is a rodent; preferably, the non-human animal is a mouse.

[0122] The non-human animal described in the present invention has an immunodeficient genetic background; preferably, the non-human animal is a mouse lacking the IL-2Rγ chain; more preferably, the non-human animal is a B-NDG mouse.

[0123] In the nineteenth aspect of the present invention, a construct containing the above chimeric CSF1 gene is provided.

[0124] In the twentieth aspect of the present invention, a cell containing the above construct is provided.

[0125] In the twenty-first aspect of the present invention, a tissue containing the above cell is provided.

[0126] In the twenty-second aspect of the present invention, there is provided a humanized CSF1 gene-modified non-human animal constructed by the above-mentioned construction method, the above-mentioned humanized CSF1 gene-modified non-human animal, the above-mentioned cell in which the CSF1 gene is genetically modified, the cell in which the CSF1 gene is genetically modified prepared by the above-mentioned method, the above-mentioned CSF1 gene knockout non-human animal prepared by the above-mentioned method, the above-mentioned multi-gene humanized non-human animal or its offspring, or the above-mentioned tumor-bearing animal model for use in the development of products requiring immune processes involving human cells, the production of human antibodies, or as a model system for pharmacological, immunological, microbiological, and medical research; or, for use in the production and utilization of animal experimental disease models for etiological research and / or for the development of new diagnostic strategies and / or treatment strategies; or, for use in screening, validating, evaluating, or studying the function of the CSF1 gene, drugs targeting the CSF1 target site, the formation and function of human hematopoietic stem cells, and / or the efficacy research of constructing disease models, drugs for immune-related diseases, and anti-tumor drugs, wherein the disease is a tumor or a neovascular disease.

[0127] Preferably, the above-mentioned use is selected from the formation, function research, and / or construction of disease models of human hematopoietic stem cells.

[0128] Preferably, the above-mentioned use includes evaluating the efficacy, screening drugs of anti-human monoclonal antibodies, bispecific antibodies or combination drugs, or evaluating the anti-tumor effect in vivo of human CAR-T or screening after reconstructing the human immune system in a non-human animal using human PBMC and / or transplanting human tumor cells into the non-human animal.

[0129] Preferably, the above-mentioned use is not a treatment method. This evaluation method is used to detect and evaluate the effect of a drug or a CAR-T regimen to determine whether the drug or the CAR-T regimen has a therapeutic effect, that is, the therapeutic effect is not inevitable, but only a possibility.

[0130] In the twenty-third aspect of the present invention, there is provided a method for immune system reconstruction, the method including reconstructing the immune system of the humanized CSF1 gene-modified non-human animal of the present invention using human peripheral blood mononuclear cells (PBMC), including transplanting human tumor cells into the non-human animal, administering the corresponding drug for the tumor to the non-human animal transplanted with the tumor cells, and detecting the non-human animal administered with the drug.

[0131] Preferably, the above-mentioned detection includes determining the viability and / or proliferation rate of tumor cells; the method of the above-mentioned detection is flow cytometry and / or in vivo imaging detection of animals.

[0132] Preferably, the above-mentioned transplanting method is tail vein injection and / or intramedullary injection of femur and / or intramedullary injection of tibia.

[0133] Preferably, the tumor cells are selected from one or a combination of two or more of B cell lymphoma cell lines, human peripheral blood cells or umbilical cord blood cells; preferably, the human peripheral blood cells are selected from CD34+ cells or multiple myeloma cells.

[0134] The humanized CSF1 gene-modified non-human animals constructed by the present invention or the humanized CSF1 gene-modified non-human animals constructed by the method described in the present invention are helpful for improving cell differentiation during immune system reconstruction, preferably promoting the differentiation of bone marrow cells, and at the same time, after transplantation of hematopoietic stem cells, they can regulate the maturation of macrophages.

[0135] The "humanized CSF1 protein" described in the present invention comprises a part derived from human CSF1 protein and a part of non-human CSF1 protein, wherein the "human CSF1 protein" is the full-length amino acid sequence of human CSF1 protein.

[0136] The "human CSF1 gene" described in the present invention is the full-length nucleotide sequence of human CSF1 gene, and the "human-derived sequence" is the sequence part of the chimeric CSF1 gene derived from human CSF1 gene.

[0137] The "part or all" described in the present invention, "all" refers to the whole; "part" refers to the local part in the whole or an individual in the whole. For example, "all of exon 1 to exon 8" is the whole, that is, the entire nucleotide sequence of exon 1 to exon 8; "part of exon 1 to exon 8" is the local part of the whole or an individual in the whole, that is, one or two or more consecutive or spaced nucleotide sequences among exon 1 to exon 8.

[0138] The "two consecutive or three or more consecutive exons" described in the present invention means, for example, exon 1, 2, exon 2, 3, exon 1, 2, 3, exon 2, 3, 4, and 4, 5, 6, 7 or 8 consecutive exons.

[0139] As used herein, "homology" means that, in terms of using protein sequences or nucleotide sequences, those skilled in the art can adjust the sequences according to actual work needs so that the sequences used have (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity compared to the sequences obtained by the prior art.

[0140] Those skilled in the art are able to determine and compare sequence elements or degrees of identity to distinguish additional murine and human sequences.

[0141] Unless otherwise specified, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology. These techniques are explained in detail in the following references. For example: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D.N. Glover ed., 1985); Oligonucleotide Synthesis (M.J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. 1984); Transcription And Translation (B.D. Hames & S.J. Higgins eds. 1984); Culture Of Animal Cells (R.I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds. in chief, Academic Press, Inc., New York), specifically, Vols. 154 and 155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J.H. Miller and M.P. Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes V (D.M. Weir and C.C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

[0142] In one aspect, the non-human animal is a mammal. Preferably, the non-human animal is a small mammal, such as Dipodidae. In one embodiment, the non-human animal is a rodent. In one embodiment, the rodent is selected from mice, rats, and hamsters. In one embodiment, the rodent is selected from the Muridae family. In one embodiment, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (mountain mice, rock mice, tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from true mice or rats (Muroidea), gerbils, spiny mice, and crested rats. In one embodiment, the genetically modified mouse is from a member of the Muridae family. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0143] In a specific embodiment, the non-human animal is a rodent selected from the C57BL, C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, CBA / H strains of mice and NOD, NOD / SCID, NOD-Prkdc of the strains BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola scidIL-2rg null Background mice

[0144] The above only summarizes some aspects of the present invention and should not be considered, nor should it be construed as, a limitation of the present invention in any respect.

[0145] All patents and publications mentioned in this specification are incorporated herein by reference in their entirety. Those skilled in the art should recognize that certain changes can be made to the present invention without departing from the spirit or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered as limiting the present invention or the scope of the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0146] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, wherein:

[0147] Figure 1 : Schematic diagram of the comparison between murine CSF1 gene and human CSF1 gene (not to scale);

[0148] Figure 2 : Schematic diagram of the humanized CSF1 mouse gene (not to scale);

[0149] Figure 3 : Schematic diagram of the CSF1 gene targeting strategy and the design of the targeting vector (not to scale);

[0150] Figure 4A : Detection results of 5'-end sgRNA, where NC is the negative control, PC is the positive control, and blank is the blank control;

[0151] Figure 4B : Detection results of 3'-end sgRNA, where NC is the negative control, PC is the positive control, and blank is the blank control;

[0152] Figure 5 : Identification results of murine tail PCR (F0), where Figure A is the detection result of the 5'-end primer, Figure B is the detection result of the 3'-end primer, M is the Marker, WT is the NOD / scid mouse, + is the positive control, and H2O is the water control;

[0153] Figure 6 : Identification results of murine tail PCR (F1), where M is the Marker, WT is the NOD / scid mouse, H2O is the water control, + is the positive control, and Figure A is the detection result of the 5'-end primer and Figure B is the detection result of the 3'-end primer;

[0154] Figure 7: Southern blot results of F1 generation mice, where WT is NOD / scid mice, the upper figure shows the detection results of the 5' probe (probe P1), and the lower figure shows the detection results of probe A (probe P2);

[0155] Figure 8 : ELISA detection results, where + / + represents B-NDG mice, and B-hCSF-1(H / H) represents hGM-CSF homozygous mice. Figure (A) shows the detection results of mouse CSF1 protein expression, and Figure (B) shows the detection results of human CSF1 protein expression. Specific implementation mode

[0156] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, these embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

[0157] In each of the following embodiments, the equipment and materials are obtained from the following several companies:

[0158] NOD-Prkdc scid IL-2rg null (B-NDG) mice are from Beijing Biocytogen Co., Ltd., product number B-CM-001;

[0159] NOD / scid mice are purchased from Beijing Huafukang Biotech Co., Ltd.;

[0160] The UCA kit is from Beijing Biocytogen Co., Ltd., product number BCG-DX-001;

[0161] The Ambion in vitro transcription kit is purchased from Ambion, product number AM1354;

[0162] Cas9mRNA is from SIGMA, product number CAS9MRNA-1EA;

[0163] BamHI, EcoRI, BbsI, BglII and NcoI enzymes are purchased from NEB, and the product numbers are; R3136M, R3101M, R0539L, R0144M and R3193M;

[0164] LPS (Lipopolysaccharides from Escherichia coli O111:B4) is from Sigma-Aldrich, product number L2630;

[0165] The Human M-CSF ELISA (Human CSF-1) is from RayBiotech, Inc., with the catalog number ELH-MCSF-5;

[0166] The Mouse M-CSF ELISA (Mouse CSF-1) is from RayBiotech, Inc., with the catalog number ELM-MCSF-5.

[0167] The present invention plans to modify non-human animals (such as mice) so that the non-human animals contain a nucleotide sequence encoding human CSF1 protein, and the genetically modified non-human animals can express human or humanized CSF1 protein. The background of the non-human animals can be immunodeficient. In addition, other genetic modifications can be introduced into the genetically modified non-human animals according to different research needs, such as genes or any combination thereof such as IL6, IL15, IL3, CSF2, SIPRA, etc. for humanization modification, to obtain double-gene or multi-gene humanized modified non-human animals for the formation, functional research and / or construction of disease models of human hematopoietic stem cells.

[0168] Example 1 CSF1 Gene Humanized Mice

[0169] Schematic diagram of the comparison between the mouse CSF1 gene (NCBI Gene ID: 12977, Primary source: MGI:1339753, UniProtID: P07141) (based on the transcript of NM_007778.4→NP_031804.3, whose mRNA sequence is shown in SEQ ID NO: 1 and the corresponding amino acid sequence is shown in SEQ ID NO: 2) and the human CSF1 gene (NCBI Gene ID: 1435, Primary source: HGNC:2432, UniProt ID: P09603) (based on the transcript of NM_000757.5→NP_000748.3, whose mRNA sequence is shown in SEQ ID NO: 3 and the corresponding amino acid sequence is shown in SEQ ID NO: 4) is as Figure 1 shown.

[0170] To achieve the object of the present invention, a gene sequence encoding human CSF1 protein can be introduced into the endogenous mouse CSF1 locus so that the mouse expresses human CSF1 protein. For example, gene editing technology can be used to modify mouse cells. At the endogenous mouse CSF1 start codon (ATG), a coding sequence capable of expressing human CSF1 protein is inserted before the ATG, while disrupting the coding frame of the mouse CSF1 gene (for example, deleting all or part of the nucleotide sequence of exons 1 to 8 of the endogenous mouse CSF1 gene). It is expected that the resulting humanized mouse can express the human CSF1 protein shown in SEQ ID NO: 4 and not express the endogenous CSF1 protein. The schematic diagram of the humanized mouse CSF1 gene after modification is as Figure 2 shown, and the DNA sequence of the humanized mouse CSF1 gene (chimeric CSF1 gene DNA) finally obtained is as shown in SEQ ID NO: 5:

[0171]

[0172] SEQ ID NO: 5 only lists the DNA sequence of the modified part, and the italic underlined region is the nucleotide sequence encoding human CSF1 protein (abbreviated as human sequence). The mRNA sequence transcribed from the humanized mouse CSF1 gene finally obtained is as shown in SEQ ID NO: 48. In view of the fact that human CSF1 or mouse CSF1 has multiple subtypes or transcripts, the method described herein can be applied to other subtypes or transcripts. For example, when the mouse transcript is selected as NM_001113530.1→NP_001107002.1, the mRNA sequence transcribed from the humanized mouse CSF1 gene is as shown in SEQ ID NO: 49.

[0173] Introduce the CRISPR / Cas system for gene editing, and further design is as Figure 3Schematic diagram of the targeting strategy shown in the figure. The figure shows that the targeting vector contains homologous arm sequences upstream and downstream of mouse CSF1 (mouse DNA 1393 bp upstream of the ATG of the endogenous CSF1 gene and 1385 bp downstream of the TAG), as well as a 1665-bp sequence encoding the human CSF1 protein. Among them, the above-mentioned upstream homologous arm sequence (5' homologous arm, SEQ ID NO: 6) is the same as the nucleotide sequence at positions 107761456-107760064 of NCBI accession number NC_000069.6, and the downstream homologous arm sequence (3' homologous arm, SEQ ID NO: 7) is the same as the nucleotide sequence at positions 107746738-107745360 of NCBI accession number NC_000069.6; the human sequence (SEQ ID NO: 8) is the same as the italicized and underlined region in SEQ ID NO: 5, and there is only one sequence difference from the nucleotide sequence at positions 414-2078 of the sequence of NCBI accession number NM_000757.5 (SEQ ID NO: 3), specifically, C>T at position 1879 of this sequence. The construction of the targeting vector can be carried out by conventional methods, such as restriction enzyme ligation, direct synthesis, etc. After the constructed targeting vector is preliminarily verified by restriction enzyme digestion, it is sent to a sequencing company for sequencing verification. The vector plasmid with correct sequencing verification is used for subsequent experiments.

[0174] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, the selection and design of highly efficient and specific target sequences are the premise for constructing the sgRNA expression vector. Design and synthesize sgRNA sequences that recognize the 5'-end target site (sgRNA1-sgRNA9) and the 3'-end target site (sgRNA10-sgRNA18). The 5'-end target site and the 3'-end target site are located in exon 1 and exon 8 of the CSF1 gene respectively. The target site sequences of each sgRNA on CSF1 are as follows:

[0175] sgRNA-1 target site sequence (SEQ ID NO: 9): 5'-CAGCTGCCCGTATGACCGCG CGG-3'

[0176] sgRNA-2 target site sequence (SEQ ID NO: 10): 5'-GCTGCCCGTATGACCGCGCG GGG-3'

[0177] sgRNA-3 target site sequence (SEQ ID NO: 11): 5'-TATGACCGCGCGGGGCGCCG CGG-3'

[0178] sgRNA-4 target site sequence (SEQ ID NO: 12): 5'-TGACCGCGCGGGGCGCCGCG GGG-3'

[0179] sgRNA-5 target site sequence (SEQ ID NO: 13): 5'-CGAAGAAGGGCAGCGCCCCG CGG-3'

[0180] sgRNA-6 target site sequence (SEQ ID NO: 14): 5'-CGCGGGGCGCTGCCCTTCTT CGG-3'

[0181] sgRNA-7 target site sequence (SEQ ID NO: 15): 5'-GGTTGCAGCTTACCGAAGAA GGG-3'

[0182] sgRNA-8 target site sequence (SEQ ID NO: 16): 5'-CGGTTGCAGCTTACCGAAGA AGG-3'

[0183] sgRNA-9 target site sequence (SEQ ID NO: 17): 5'-AAGCTGCAACCGTGGCGCGC GGG-3'

[0184] sgRNA-10 target site sequence (SEQ ID NO: 18): 5'-ATAGAAAGGATTCTATGGTA AGG-3'

[0185] sgRNA-11 target site sequence (SEQ ID NO: 19): 5'-CCAGTATAGAAAGGATTCTA TGG-3'

[0186] sgRNA-12 target site sequence (SEQ ID NO: 20): 5'-GTGGAACTGCCAGTATAGAA AGG-3'

[0187] sgRNA-13 target site sequence (SEQ ID NO: 21): 5'-CACCTGTCTGTCCTCATCCT GGG-3'

[0188] sgRNA-14 target site sequence (SEQ ID NO: 22): 5'-GACCCAGGATGAGGACAGAC AGG-3'

[0189] sgRNA-15 target site sequence (SEQ ID NO: 23): 5'-GTCTGTCCTCATCCTGGGTC AGG-3'

[0190] sgRNA-16 target site sequence (SEQ ID NO: 24): 5'-CAGCTCCCTGACCCAGGATG AGG-3'

[0191] sgRNA-17 target site sequence (SEQ ID NO: 25): 5’-ATCCTGGGTCAGGGAGCTGC AGG-3’

[0192] sgRNA-18 target site sequence (SEQ ID NO: 26): 5’-TGCCTGCAGCTCCCTGACCC AGG-3’

[0193] The activities of multiple sgRNAs were detected using the UCA kit. It can be seen from the results that the sgRNAs have different activities. The detection results are shown in Table 1 and Figure 4. Two of them (sgRNA-5 and sgRNA-16) were preferentially selected for subsequent experiments. Restriction enzyme sites were added to the 5’ end and its complementary strand respectively to obtain the forward oligonucleotide and reverse oligonucleotide (the sequences are shown in Table 2). After annealing, the annealed products were respectively ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain the expression vectors pT7-CSF1-5 and pT7-CSF1-16.

[0194] The pT7-sgRNA vector was synthesized by a plasmid synthesis company to contain a DNA fragment (SEQ ID NO: 27) with a T7 promoter and an sgRNA scaffold, and was successively ligated to the backbone vector (source: Takara, catalog number 3299) through restriction enzyme digestion (EcoRI and BamHI). It was verified by sequencing of a professional sequencing company, and the results showed that the target plasmid was obtained.

[0195] Table 1 UCA detection results

[0196]

[0197] Table 2 Sequence list of sgRNA-5 and sgRNA-16

[0198]

[0199] Take the pronuclear stage fertilized eggs of NOD / scid mice. Using a microinjector, the in vitro transcription products of the premixed pT7-CSF1-5 and pT7-CSF1-16 plasmids (using the Ambion in vitro transcription kit and transcribing according to the instructions) and Cas9 mRNA, and the targeting vector plasmid were injected into the cytoplasm or nucleus of the mouse fertilized eggs. Microinjection of the embryos was carried out according to the method in "Mouse Embryo Manipulation Experimental Manual (Third Edition)". The injected fertilized eggs were transferred to the culture medium for short-term culture, and then transplanted into the oviduct of the recipient female mouse to produce gene-modified humanized mice, and the founder mice (F0 generation) were obtained.

[0200] The genotype of somatic cells of F0 mice can be identified by conventional detection methods (such as PCR analysis). The identification results of some F0 mice are shown in Figure 5 . Combining the detection results of the 5'-end primer and the 3'-end primer, it can be known that Figure 5 the mice numbered F0-45, F0-46, and F0-47 in

[0201] are positive mice. The PCR analysis includes the following primers:

[0202] 5'-end primer:

[0203] Forward primer: L-GT-F (SEQ ID NO: 36): 5'-CCACCCACAAGTTGAGAACCACCAG-3';

[0204] Reverse primer: L-GT-R (SEQ ID NO: 37): 5'-GTCCTTGACAACTGGGGTCTCTGGC-3'

[0205] 3'-end primer:

[0206] Forward primer: R-GT-F (SEQ ID NO: 38): 5'-CTGCAGGAACTCTCTTTGAGGCTGA-3';

[0207] The CSF1 humanized mice identified as positive in F0 were mated with NOD / scid mice to obtain F1 mice. The PCR results are shown in Figure 6 , showing that 6 F1 mice are positive mice, and the numbers are: F1-3, F1-6, F1-8, F1-11, F1-13, F1-14.

[0208] Furthermore, Southern blot detection was performed on these 6 F1 mice identified as positive by PCR to confirm whether there was random insertion. The mouse tails were cut to extract genomic DNA, and the genomic DNA was digested with BglII enzyme or NcoI enzyme, transferred to a membrane, and hybridized. Probes P1 and P2 are located outside the 5'-homologous arm and on the human fragment, respectively.

[0209] The PCR analysis of F1 includes the following primers:

[0210] 5'-end primer:

[0211] Forward primer: WT-F (SEQ ID NO: 40): 5'-AGCCAGGGTGATTTCCCATAAACCA-3';

[0212] Downstream primer: 5’ MSD-R (SEQ ID NO: 41): 5’-GGATGATGCCACACTCGGATCTTGT-3’

[0213] 3’-end primer:

[0214] Upstream primer: 3’ MSD-F (SEQ ID NO: 42): 5’-GGAGCTTGAGGGCCTATAGGTGGT-3’;

[0215] Downstream primer: WT-R (SEQ ID NO: 43): 5’-AGTAACTGGTCCAGGGCAGGGATT-3’

[0216] Probe synthesis primers are as follows:

[0217] P1-F (SEQ ID NO: 44): 5’-TGCACTTATGTGATGGATGGCTGAG-3’

[0218] P1-R (SEQ ID NO: 45): 5’-TAACTGGGCAGTTGGAATGGATGAG-3’

[0219] P2-F (SEQ ID NO: 46): 5’-ACTTCCTCTCAGCATCTTCTCCACT-3’

[0220] P2-R (SEQ ID NO: 47): 5’-CTGTGTCAGTCAAAGGAACGGAGTT-3’

[0221] The results of Southern blot detection are shown in Figure 7 . The combined results of P1 and P2 probes indicate that there is no random insertion in all 6 mice, confirming that these 6 mice are positive heterozygous mice and there is no random insertion. This indicates that the method can be used to construct CSF1 humanized genetically engineered mice that can be stably passed on and have no random insertion.

[0222] In addition, due to the double-strand break of genomic DNA caused by the cleavage of Cas9, insertion / deletion mutations may occur randomly through the repair mode of chromosomal homologous recombination, and gene knockout mice with loss of CSF1 protein function may be obtained.

[0223] Example 2 Generation of CSF1 and humanized cytokine mice with severe immunodeficiency

[0224] To generate mice containing human CSF1 and having severe immunodeficiency, the CSF1 humanized mouse heterozygotes prepared in Example 1 can be mated with B-NDG mice or in vitro fertilized (IVF). According to Mendelian inheritance laws, screening their offspring has a certain probability of obtaining heterozygous mice with CSF1 humanization and IL-2Rγ chain deletion. Then, the heterozygotes are mated with each other to obtain homozygotes with double-gene or multi-gene modifications.

[0225] In Example 1, during the microinjection process, fertilized egg cells of B-NDG mice were used to replace NOD / scid mice, and B-NDG mice expressing human CSF1 protein were directly obtained.

[0226] The expression of human CSF1 protein in positive mice can be confirmed by conventional detection methods, such as using the ELISA method. Select 1 B-NDG mouse and 1 B-NDG-hCSF1 homozygous mouse, intraperitoneally inject 20 μg / 200 μL of LPS, take the spleen after 2 hours of stimulation, grind it, and take the grinding solution after repeated freezing and thawing. Dilute it 5 times for ELISA detection. The results (see Figure 8 ) show that the expression of human CSF1 was detected in the grinding solution of the spleen of B-NDG-hCSF1 homozygous mice ( Figure 8 B), and the expression of murine CSF1 could not be detected ( Figure 8 A), while the expression of human CSF1 was not detected in the grinding solution of the spleen of B-NDG mice ( Figure 8 B), and only the expression of murine CSF1 could be detected ( Figure 8 A).

[0227] Example 3 Double-gene or multi-gene humanized mice containing human CSF1

[0228] Using this method or the obtained CSF1 mice, double-humanized or multi-humanized mouse models can also be prepared. For example, in the aforementioned Example 1, the fertilized egg cells used in the microinjection and embryo transfer processes were selected from fertilized egg cells of other gene-modified mice. For example, fertilized egg cells of IL3 or IL15 or CSF2 gene humanized mice were selected and used this method for gene editing, and humanized mouse models with double-gene modifications of IL3 or IL15 or CSF2 and CSF1 can be obtained.

[0229] The homozygous or heterozygous CSF1 mice obtained by this method are mated with other gene-modified homozygous or heterozygous mice or in vitro fertilized, and their offspring are screened. According to Mendelian inheritance, there is a certain probability of obtaining heterozygous mice with CSF1 humanization and other gene modifications of two or more genes. Then, the heterozygotes are mated with each other to obtain homozygotes with two or more gene modifications. Among them, the humanized IL3 gene mouse is modified by gene editing technology on mouse cells. After the endogenous mouse IL3 start codon (ATG), the entire coding frame of the mouse IL3 gene is replaced with a coding sequence of human IL3 protein (SEQ ID NO: 50). The humanized protein can be expressed in the mouse body and the endogenous IL3 protein is not expressed. The same strategy is adopted for the humanized CSF2 gene mouse. The coding sequence of the human CSF2 protein used for replacement is shown in SEQ ID NO: 51. The humanized protein can be expressed in the mouse body and the endogenous CSF2 protein is not expressed. The strategy of the humanized IL15 mouse is similar. The exon 1 of the endogenous mouse IL15 is replaced with a coding sequence containing human IL15 protein (SEQ ID NO: 52). There is an auxiliary sequence WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) and / or polyA (polyadenylic acid) after this sequence to terminate transcription prematurely. The humanized protein can be expressed in the mouse body.

[0230] Taking the generation of triple humanized IL3 / CSF2 / CSF1 mice as an example, since both the CSF2 and IL3 genes of the mouse are located on chromosome 11 and the CSF1 gene is located on chromosome 3, after obtaining the double humanized CSF2 / IL3, it is mated with the CSF1 humanized mouse. Through the screening of positive offspring mice, double humanized triple humanized GM-CSF2 / IL3 / CSF1 mice are finally obtained.

[0231] Example 4 Preparation method based on embryonic stem cells

[0232] The non-human mammals of the present invention can also be obtained by using other gene editing systems and preparation methods, including but not limited to gene homologous recombination technology based on embryonic stem cells (ES), zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, homing endonuclease (megabase large-scale ribozyme) or other molecular biology techniques. In this example, the traditional ES cell gene homologous recombination technology is taken as an example to illustrate how to prepare humanized CSF1 gene mice by other methods.

[0233] According to the gene editing strategy of the present invention and the schematic diagram of the humanized mouse CSF1 gene ( Figure 2 、 3), the inventors designed a new targeting strategy and a new recombinant vector. In view of one of the objectives of the present invention, which is to disrupt the coding frame of the mouse CSF1 gene and insert a nucleotide sequence encoding human CSF1 protein at the mouse CSF1 locus, the inventors designed a recombinant vector containing 5' homologous arm, 3' homologous arm and humanized gene fragment, and constructed a resistance gene for positive clone screening on the recombinant vector, such as the coding sequence of neomycin phosphotransferase Neo, and installed two site-specific recombination systems arranged in the same direction on both sides of the resistance gene, such as Frt or LoxP recombination sites. Further, a coding gene with a negative selection marker was constructed downstream of the 3' homologous arm of the recombinant vector, such as the coding gene of diphtheria toxin A subunit (DTA). The vector construction can be carried out by conventional methods, such as restriction enzyme digestion and ligation. The correctly constructed recombinant vector was transfected into mouse embryonic stem cells, and the transfected cells with the recombinant vector were screened using the positive clone screening marker gene, and DNA recombination was identified using Southern Blot technology. The correctly screened positive clones were microinjected into the isolated blastocysts (white mice) with the positive clone cells (black mice) according to the method in the "Mouse Embryo Manipulation Experimental Manual (Third Edition)". The injected chimeric blastocysts were transferred to the culture medium for short-term culture, and then transplanted into the oviduct of the recipient female mouse (white mouse) to produce F0 generation chimeric mice (black and white). Through extracting the mouse tail genome and PCR detection, the F0 generation chimeric mice with correct gene recombination were selected for subsequent breeding and identification. The F0 generation chimeric mice were mated with wild-type mice to obtain F1 generation mice. Through extracting the mouse tail genome and PCR detection, the positive F1 generation heterozygous mice with stable genetic gene recombination were selected. Then, the F1 generation heterozygous mice were mated with each other to obtain the positive F2 generation homozygous mice with gene recombination. In addition, after the F1 generation heterozygous mice were mated with Flp or Cre tool mice to remove the positive clone screening marker gene (neo, etc.), the humanized homozygous mice could be obtained by mating with each other. The methods for genotype and phenotype detection of the obtained F1 generation heterozygous or F2 generation homozygous mice were the same as those in Example 1 described above.

[0234] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0235] In addition, it should be noted that, in the case of no contradiction, the various specific technical features described in the above specific embodiments can be combined in any appropriate way. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0236] In addition, any combination can be made among various different embodiments of the present invention, as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention. Sequence Listing <110>Beijing Biolytix Jiangsu Gene Biotechnology Co., Ltd. Beijing Biolytix Gene Biotechnology Co., Ltd. <120>Construction Method and Application of a Humanized Cytokine CSF1 Gene-Modified Non-Human Animal <130>1 <160>52 <170>PatentInversion3.5 <210>1 <211>4192 <212>DNA / RNA <213>Mouse <400>1 acagagcgacggggaagagagctagcggggacgaccaggcggcccgcttgggggaaggga60 gtcggcggctcagtgggcctctggggtgtagtatgtgtcagtgcctgtgagtgtgtttgt120 gtgtgtgtatgtctgtgtgtgtctggcggagagccagggtgatttcccataaaccacatg180 ccccgccagcccgcccgcttaaaaggctgtgccgagggctggccagcgaagctcggccag240 gggaaagtgaaagtttgcctcggtgctctcggtgtcgctgcggctctctgcatcccagga300 cagcggcgtggccctcgaccggggcgcgggctcttcagccactagcgagcaagggagcga360 gcgaaccagggcggccaacacgccgtgccgggacccagctgcccgtatgaccgcgcgggg420 cgccgcggggcgctgcccttcttcgacatggctgggctcccggctgctgctggtctgtct480 cctcatgagcaggagtattgccaaggaggtgtcagaacactgtagccacatgattgggaa540 tggacacctgaaggtcctgcagcagttgatcgacagtcaaatggagacttcatgccagat600 tgcctttgaatttgtagaccaggaacagctggatgatcctgtttgctacctaaagaaggc660 cttttttctggtacaagacataatagatgagaccatgcgctttaaagacaacacccccaa720 tgctaacgccaccgagaggctccaggaactctccaataacctgaacagctgcttcaccaa780 ggactatgaggagcagaacaaggcctgtgtccgaactttccatgagactcctctccagct840 gctggagaagatcaagaacttctttaatgaaacaaagaatctccttgaaaaggactggaa900 catttttaccaagaactgcaacaacagctttgctaagtgctctagccgagatgtggtgac960 caagcctgattgcaactgcctgtaccctaaagccacccctagcagtgacccggcctctgc1020 ctcccctcaccagccccccgccccctccatggcccctctggctggcttggcttgggatga1080 ttctcagaggacagagggcagctccctcttgcccagtgagcttccccttcgcatagagga1140 cccaggcagtgccaagcagcgaccacccaggagtacctgccagaccctcgagtcaacaga1200 gcaaccaaaccatggggacagactcactgaggactcacaacctcatccttctgcgggggg1260 gcccgtccctggggtggaagacattcttgaatcttcactgggcactaactgggtcctaga1320 agaagcttctggagaggctagtgagggatttttgacccaggaagcaaagttttccccctc1380 cacgcctgtagggggcagcatccaggcagagactgacagacccagggccctctcagcatc1440 tccattccctaaatcaacagaggaccaaaagccagtggatataacagacaggccgttgac1500 agaggtgaaccctatgagacccattggccagacacagaataatactcctgagaagactga1560 tggtacatccacgctgcgtgaagaccaccaggagccaggctctccccatattgcgacacc1620 gaatccccaacgagtcagcaactcagccacccccgttgctcagttactgcttcccaaaag1680 ccactcttggggcattgtgctgccccttggggagcttgagggcaagagaagtaccaggga1740 tcgaaggagccccgcagagctggaaggaggatcagcaagtgagggggcagccaggcctgt1800 ggcccgttttaattccattcctttgactgacacaggccatgtggagcagcatgagggatc1860 ctctgacccccagatccctgagtctgtcttccacctgctggtgccgggcatcatcctagt1920 cttgctgactgttgggggcctcctgttctacaagtggaagtggaggagccatcgagaccc1980 tcagacattggattcttctgtggggcgaccagaggacagctccctgacccaggatgagga2040 cagacaggtggaactgccagtatagaaaggattctatgctgggcacacaggactatctct2100 ttatggaaggagacatatgggaacatccaccactaccctctcctaccatcttcctgggaa2160 tgtggcctaccactaccagagctcctgcctaccaagactggatgaaagaagcagctttga2220 tggggtctttccatcctcacccttagactctcaaccaaagagaaagggctggaggatgcc2280 ccccacatactgccactatttattgtgggccctggaggctccctgcattggaggaagggc2340 agctcagcagctcaggaccctttcccttaggggctgcttcctcccctcaaaaccagaacc2400 tggcaagggactcactagcctggatggcccatgggagaccaggacagatgagaaggagca2460 gaagagccctgtgcccagaagacccaactggtgccaaggaatcccagcatggacaggcag2520 ggacctgtttcccaagaagagagcctgatattcaaagggtgggacagcatctgcccgact2580 tcccgtaaaggcataaaggcacgcagcccaaaagacgggaagaggaggcctttggctgct2640 tgtgttgacagcttaaaggggtctacaccctcaacttgcttaagtgccctctgctgatag2700 ccaggaaggagggagaccagccctgcccctcaggacctgacctggctcatgatgccaaga2760 ggaagacagagctctagcctcgtcttctcctgcccacagcccctgccagagttcttttgc2820 ccagcagaggcacccctcatgaaggaagccattgcactgtgaatactgaacctgcctgct2880 gaacagcctgtcccatccatccctatgagtgaccatccgtccgaatgttctcccacttcc2940 ttcagcctctcctcggcttcttgcactgagctggcctcacgtgttgactgagggagcccc3000 tgagccccaaccttcccctgcctcagcctttgattgtccagggtgaagctgtgggagaac3060 cgcctgggctaccagtcagagctggtctttgggctgtgttccttgcccaggtttctgcat3120 cttgcactttgacattcccaggagggaagtgactagtggaagggagagaggaaggggagg3180 cagagacaaaggccacaggcagagctatgaatgagaatgggtcttgaaaatatgtgtgca3240 cccctaagcttgaaattgatctctatactctagcccctcagccagcctccttcctgttgt3300 ctgaaacctggagctaagcaggttgtcctgtcacaagctctggggactgagctccatgct3360 ccaaccccaccctcttctgacctttgttctccagacctgacccaggtaggcaagggtacc3420 ctcccagtctcacctaccatactgtgccatctctagccaagcaagccaggtttagagaag3480 ggtcaaaaaaaaaaaaaagggttgtttacttccaacttgttctgatgccctctgtttccc3540 aggccaggcttgtctgtggtgacctgggcatgggtgacagggctctcatttgccccttgg3600 tctctttatgctgctgagtccccctttcctgccctccctggctactgggtcaataatctt3660 tcaggccatgaatctgggaggagagtggtctgtaagctccatcagccctgtcctgagaca3720 gcaggggggaaggacactggagactttcttgtggggcttacttagccttctggttacaga3780 ctatttccatgctagaaaatacatattttaaaatagaaggaaaaacacagaaacaaaaca3840 aaacaaggcattctctacccctccaccttaaacatatattattaaagacagaagagaaaa3900 tccaacccattgcaagaagctctttgtgggtgcctggttacatcggagcaggggagcctc3960 aaatccacctttggagccgcccctgtgtgcattaggaacccttctctcctctgagaaagc4020 tcagagggagcactgcctcacaaactgtgagactgcgttttttatacttggaagtggtga4080 attattttatataaggtcatttaaatatctatttaaaaaataggaagctgcttttatatt4140 taataataaaagaagtgcacaagctgccacgtgtgaaaaaaaaaaaaaaaaa4192 <210>2 <211>552 <212>PRT <213>Mouse <400>2 MetThrAlaArgGlyAlaAlaGlyArgCysProSerSerThrTrpLeu 1 5 10 15 GlySerArgLeuLeuLeuValCysLeuLeuMetSerArgSerIleAla 20 25 30 LysGluValSerGluHisCysSerHisMetIleGlyAsnGlyHisLeu 35 40 45 LysValLeuGlnGlnLeuIleAspSerGlnMetGluThrSerCysGln 50 55 60 IleAlaPheGluPheValAspGlnGluGlnLeuAspAspProValCys 65 70 75 80 TyrLeuLysLysAlaPhePheLeuValGlnAspIleIleAspGluThr 85 90 95 MetArgPheLysAspAsnThrProAsnAlaAsnAlaThrGluArgLeu 100 105 110 GlnGluLeuSerAsnAsnLeuAsnSerCysPheThrLysAspTyrGlu 115 120 125 GluGlnAsnLysAlaCysValArgThrPheHisGluThrProLeuGln 130 135 140 LeuLeuGluLysIleLysAsnPhePheAsnGluThrLysAsnLeuLeu 145 150 155 160 GluLysAspTrpAsnIlePheThrLysAsnCysAsnAsnSerPheAla 165 170 175 LysCysSerSerArgAspValValThrLysProAspCysAsnCysLeu 180 185 190 TyrProLysAlaThrProSerSerAspProAlaSerAlaSerProHis 195 200 205 GlnProProAlaProSerMetAlaProLeuAlaGlyLeuAlaTrpAsp 210 215 220 AspSerGlnArgThrGluGlySerSerLeuLeuProSerGluLeuPro 225 230 235 240 LeuArgIleGluAspProGlySerAlaLysGlnArgProProArgSer 245 250 255 ThrCysGlnThrLeuGluSerThrGluGlnProAsnHisGlyAspArg 260 265 270 LeuThrGluAspSerGlnProHisProSerAlaGlyGlyProValPro 275 280 285 GlyValGluAspIleLeuGluSerSerLeuGlyThrAsnTrpValLeu 290 295 300 GluGluAlaSerGlyGluAlaSerGluGlyPheLeuThrGlnGluAla 305 310 315 320 LysPheSerProSerThrProValGlyGlySerIleGlnAlaGluThr 325 330 335 AspArgProArgAlaLeuSerAlaSerProPheProLysSerThrGlu 340 345 350 AspGlnLysProValAspIleThrAspArgProLeuThrGluValAsn 355 360 365 ProMetArgProIleGlyGlnThrGlnAsnAsnThrProGluLysThr 370 375 380 AspGlyThrSerThrLeuArgGluAspHisGlnGluProGlySerPro 385 390 395 400 HisIleAlaThrProAsnProGlnArgValSerAsnSerAlaThrPro 405 410 415 ValAlaGlnLeuLeuLeuProLysSerHisSerTrpGlyIleValLeu 420 425 430 ProLeuGlyGluLeuGluGlyLysArgSerThrArgAspArgArgSer 435 440 445 ProAlaGluLeuGluGlyGlySerAlaSerGluGlyAlaAlaArgPro 450 455 460 ValAlaArgPheAsnSerIleProLeuThrAspThrGlyHisValGlu 465 470 475 480 GlnHisGluGlySerSerAspProGlnIleProGluSerValPheHis 485 490 495 LeuLeuValProGlyIleIleLeuValLeuLeuThrValGlyGlyLeu 500 505 510 LeuPheTyrLysTrpLysTrpArgSerHisArgAspProGlnThrLeu 515 520 525 AspSerSerValGlyArgProGluAspSerSerLeuThrGlnAspGlu 530 535 540 AspArgGlnValGluLeuProVal 545 550 <210>3 <211>4249 <212>DNA / RNA <213>human <400>3 agtgcagcgcagaagacagagggtgactaggaagacgcgcgagcggggctggccggccgg60 agtgcagcgcagaagacagagggtgactaggaagacgcgcgagcggggctggccggccgg60 cgggtgggggaggggaggcgggggaaggcggctgagtgggcctctggagtgtgtgtgtct120 cgggtgggggaggggaggcgggggaaggcggctgagtgggcctctggagtgtgtgtgtct120 gtgtcagtgtgtgtgtgtgtgtgtgtatgtgtgtgtctggcgcctggccagggtgatttc180 gtgtcagtgtgtgtgtgtgtgtgtgtatgtgtgtgtctggcgcctggccagggtgatttc180 ccataaaccacatgccccccagtcctctcttaaaaggctgtgccgagggctggccagtga240 ccataaaccacatgccccccagtcctctcttaaaaggctgtgccgagggctggccagtga240 ggctcggcccggggaaagtgaaagtttgcctgggtcctctcggcgccagagccgctctcc300 ggctcggcccggggaaagtgaaagtttgcctgggtcctctcggcgccagagccgctctcc300 gcatcccaggacagcggtgcggccctcggccggggcgcccactccgcagcagccagcgag360 gcatcccaggacagcggtgcggccctcggccggggcgcccactccgcagcagccagcgag360 cgagcgagcgagcgagggcggccgacgcgcccggccgggacccagctgcccgtatgaccg420 cgagcgagcgagcgagggcggccgacgcgcccggccgggacccagctgcccgtatgaccg420 cgccgggcgccgccgggcgctgccctcccacgacatggctgggctccctgctgttgttgg480 cgccgggcgccgccgggcgctgccctcccacgacatggctgggctccctgctgttgttgg480 tctgtctcctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatga540 tctgtctcctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatga540 ttgggagtggacacctgcagtctctgcagcggctgattgacagtcagatggagacctcgt600 ttgggagtggacacctgcagtctctgcagcggctgattgacagtcagatggagacctcgt600 gccaaattacatttgagtttgtagaccaggaacagttgaaagatccagtgtgctacctta660 gccaaattacatttgagtttgtagaccaggaacagttgaaagatccagtgtgctacctta660 agaaggcatttctcctggtacaagacataatggaggacaccatgcgcttcagagataaca720 agaaggcatttctcctggtacaagacataatggaggacaccatgcgcttcagagataaca720 cccccaatgccatcgccattgtgcagctgcaggaactctctttgaggctgaagagctgct780 cccccaatgccatcgccattgtgcagctgcaggaactctctttgaggctgaagagctgct780 tcaccaaggattatgaagagcatgacaaggcctgcgtccgaactttctatgagacacctc840 tccagttgctggagaaggtcaagaatgtctttaatgaaacaaagaatctccttgacaagg900 actggaatattttcagcaagaactgcaacaacagctttgctgaatgctccagccaagatg960 tggtgaccaagcctgattgcaactgcctgtaccccaaagccatccctagcagtgacccgg1020 cctctgtctcccctcatcagcccctcgccccctccatggcccctgtggctggcttgacct1080 gggaggactctgagggaactgagggcagctccctcttgcctggtgagcagcccctgcaca1140 cagtggatccaggcagtgccaagcagcggccacccaggagcacctgccagagctttgagc1200 cgccagagaccccagttgtcaaggacagcaccatcggtggctcaccacagcctcgcccct1260 ctgtcggggccttcaaccccgggatggaggatattcttgactctgcaatgggcactaatt1320 gggtcccagaagaagcctctggagaggccagtgagattcccgtaccccaagggacagagc1380 tttccccctccaggccaggagggggcagcatgcagacagagcccgccagacccagcaact1440 tcctctcagcatcttctccactccctgcatcagcaaagggccaacagccggcagatgtaa1500 ctggtaccgccttgcccagggtgggccccgtgaggcccactggccaggactggaatcaca1560 ccccccagaagacagaccatccatctgccctgctcagagaccccccggagccaggctctc1620 ccaggatctcatcactgcgcccccagggcctcagcaacccctccaccctctctgctcagc1680 cacagctttccagaagccactcctcgggcagcgtgctgccccttggggagctggagggca1740 ggaggagcaccagggatcggaggagccccgcagagccagaaggaggaccagcaagtgaag1800 gggcagccaggcccctgccccgttttaactccgttcctttgactgacacaggccatgaga1860 ggcagtccgagggatcctccagcccgcagctccaggagtctgtcttccacctgctggtgc1920 ccagtgtcatcctggtcttgctggccgtcggaggcctcttgttctacaggtggaggcggc1980 ggagccatcaagagcctcagagagcggattctcccttggagcaaccagagggcagccccc2040 tgactcaggatgacagacaggtggaactgccagtgtagagggaattctaagctggacgca2100 cagaacagtctctccgtgggaggagacattatggggcgtccaccaccacccctccctggc2160 catcctcctggaatgtggtctgccctccaccagagctcctgcctgccaggactggaccag2220 agcagccaggctggggcccctctgtctcaacccgcagacccttgactgaatgagagaggc2280 cagaggatgctccccatgctgccactatttattgtgagccctggaggctcccatgtgctt2340 gaggaaggctggtgagcccggctcaggaccctcttccctcaggggctgcaccctcctctc2400 actcccttccatgccggaacccaggccagggacccaccggcctgtggtttgtgggaaagc2460 agggtggacgctgaggagtgaaagaaccctgcacccagagggcctgcctggtgccaaggt2520 atcccagcctggacaggcatggacctgtctccagagagaggagcctgaagttcgtggggc2580 gggacagcgtcggcctgatttcccgtaaaggtgtgcagcctgagagacgggaagaggagg2640 cctctggacctgctggtctgcactgacagcctgaagggtctacaccctcggctcacctaa2700 gtgccctgtgctggttgccaggcgcagaggggaggccagccctgccctcaggacctgcct2760 gacctgccagtgatgccaagagggggatcaagcactggcctctgcccctcctccttccag2820 cacctgccagagcttctccaggaggccaagcagaggctcccctcatgaaggaagccattg2880 cactgtgaacactgtacctgcctgctgaacagcctgcccccgtccatccatgagccagca2940 tccgtccgtcctccactctccagcctctccccagcctcctgcactgagctggcctcacca3000 gtcgactgagggagcccctcagccctgaccttctcctgacctggcctttgactccccgga3060 gtggagtggggtgggagaacctcctgggccgccagccagagccggtctttaggctgtgtt3120 gttcgcccaggtttctgcatcttgcactttgacattcccaagagggaagggactagtggg3180 agagagcaagggaggggagggcacagacagagaggctacagggcgagctctgactgaaga3240 tgggcctttgaaatataggtatgcacctgaggttgggggagggtctgcactcccaaaccc3300 cagcgcagtgtcctttccctgctgccgacaggaacctggggctgaacaggttatccctgt3360 caggagccctggactgggctgcatctcagccccacctgcatggtatccagctcccatcca3420 cttctcacccttctttcctcctgaccttggtcagcagtgatgacctccaactctcaccca3480 ccccctctaccatcacctctaaccaggcaagccagggtgggagagcaatcaggagagcca3540 ggcctcagcttccaatgcctggagggcctccactttgtggccagcctgtggtggtggctc3600 tgaggcctaggcaacgagcgacagggctgccagttgcccctgggttcctttgtgctgctg3660 tgtgcctcctctcctgccgccctttgtcctccgctaagagaccctgccctacctggccgc3720 tgggccccgtgactttcccttcctgcccaggaaagtgagggtcggctggccccaccttcc3780 ctgtcctgatgccgacagcttagggaagggcagtgaacttgcatatggggcttagccttc3840 tagtcacagcctctatatttgatgctagaaaacacatatttttaaatggaagaaaaataa3900 aaaggcattcccccttcatccccctaccttaaacatataatattttaaaggtcaaaaaag3960 caatccaacccactgcagaagctctttttgagcacttggtggcatcagagcaggaggagc4020 cccagagccacctctggtgtccccccaggctacctgctcaggaaccccttctgttctctg4080 agaagtcaagagaggacattggctcacgcactgtgagattttgtttttatacttggaagt4140 ggtgaattattttatataaagtcatttaaatatctatttaaaagataggaagctgcttat4200 atatttaataataaaagaagtgcacaagctgccaaaaaaaaaaaaaaaa4249 <210>4 <211>554 <212>PRT <213>human <400>4 MetThrAlaProGlyAlaAlaGlyArgCysProProThrThrTrpLeu 1 5 10 15 GlySerLeuLeuLeuLeuValCysLeuLeuAlaSerArgSerIleThr 20 25 30 GluGluValSerGluTyrCysSerHisMetIleGlySerGlyHisLeu 35 40 45 GlnSerLeuGlnArgLeuIleAspSerGlnMetGluThrSerCysGln 50 55 60 IleThrPheGluPheValAspGlnGluGlnLeuLysAspProValCys 65 70 75 80 TyrLeuLysLysAlaPheLeuLeuValGlnAspIleMetGluAspThr 85 90 95 MetArgPheArgAspAsnThrProAsnAlaIleAlaIleValGlnLeu 100 105 110 GlnGluLeuSerLeuArgLeuLysSerCysPheThrLysAspTyrGlu 115 120 125 GluHisAspLysAlaCysValArgThrPheTyrGluThrProLeuGln 130 135 140 LeuLeuGluLysValLysAsnValPheAsnGluThrLysAsnLeuLeu 145 150 155 160 AspLysAspTrpAsnIlePheSerLysAsnCysAsnAsnSerPheAla 165 170 175 GluCysSerSerGlnAspValValThrLysProAspCysAsnCysLeu 180 185 190 TyrProLysAlaIleProSerSerAspProAlaSerValSerProHis 195 200 205 GlnProLeuAlaProSerMetAlaProValAlaGlyLeuThrTrpGlu 210 215 220 AspSerGluGlyThrGluGlySerSerLeuLeuProGlyGluGlnPro 225 230 235 240 LeuHisThrValAspProGlySerAlaLysGlnArgProProArgSer 245 250 255 ThrCysGlnSerPheGluProProGluThrProValValLysAspSer 260 265 270 ThrIleGlyGlySerProGlnProArgProSerValGlyAlaPheAsn 275 280 285 ProGlyMetGluAspIleLeuAspSerAlaMetGlyThrAsnTrpVal 290 295 300 ProGluGluAlaSerGlyGluAlaSerGluIleProValProGlnGly 305 310 315 320 ThrGluLeuSerProSerArgProGlyGlyGlySerMetGlnThrGlu 325 330 335 ProAlaArgProSerAsnPheLeuSerAlaSerSerProLeuProAla 340 345 350 SerAlaLysGlyGlnGlnProAlaAspValThrGlyThrAlaLeuPro 355 360 365 ArgValGlyProValArgProThrGlyGlnAspTrpAsnHisThrPro 370 375 380 GlnLysThrAspHisProSerAlaLeuLeuArgAspProProGluPro 385 390 395 400 GlySerProArgIleSerSerLeuArgProGlnGlyLeuSerAsnPro 405 410 415 SerThrLeuSerAlaGlnProGlnLeuSerArgSerHisSerSerGly 420 425 430 SerValLeuProLeuGlyGluLeuGluGlyArgArgSerThrArgAsp 435 440 445 ArgArgSerProAlaGluProGluGlyGlyProAlaSerGluGlyAla 450 455 460 AlaArgProLeuProArgPheAsnSerValProLeuThrAspThrGly 465 470 475 480 HisGluArgGlnSerGluGlySerSerSerProGlnLeuGlnGluSer 485 490 495 ValPheHisLeuLeuValProSerValIleLeuValLeuLeuAlaVal 500 505 510 GlyGlyLeuLeuPheTyrArgTrpArgArgArgSerHisGlnGluPro 515 520 525 GlnArgAlaAspSerProLeuGluGlnProGluGlySerProLeuThr 530 535 540 GlnAspAspArgGlnValGluLeuProVal 545 550 <210>5 <211>1748 <212>DNA <213>Artificial Sequence <400>5 accagggcggccaacacgccgtgccgggacccagctgcccgtatgaccgcgccgggcgcc60 gccgggcgctgccctcccacgacatggctgggctccctgctgttgttggtctgtctcctg120 gcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatgattgggagtgga180 cacctgcagtctctgcagcggctgattgacagtcagatggagacctcgtgccaaattaca240 tttgagtttgtagaccaggaacagttgaaagatccagtgtgctaccttaagaaggcattt300 ctcctggtacaagacataatggaggacaccatgcgcttcagagataacacccccaatgcc360 atcgccattgtgcagctgcaggaactctctttgaggctgaagagctgcttcaccaaggat420 tatgaagagcatgacaaggcctgcgtccgaactttctatgagacacctctccagttgctg480 gagaaggtcaagaatgtctttaatgaaacaaagaatctccttgacaaggactggaatatt540 ttcagcaagaactgcaacaacagctttgctgaatgctccagccaagatgtggtgaccaag600 cctgattgcaactgcctgtaccccaaagccatccctagcagtgacccggcctctgtctcc660 cctcatcagcccctcgccccctccatggcccctgtggctggcttgacctgggaggactct720 gagggaactgagggcagctccctcttgcctggtgagcagcccctgcacacagtggatcca780 ggcagtgccaagcagcggccacccaggagcacctgccagagctttgagccgccagagacc840 ccagttgtcaaggacagcaccatcggtggctcaccacagcctcgcccctctgtcggggcc900 ttcaaccccgggatggaggatattcttgactctgcaatgggcactaattgggtcccagaa960 gaagcctctggagaggccagtgagattcccgtaccccaagggacagagctttccccctcc1020 aggccaggagggggcagcatgcagacagagcccgccagacccagcaacttcctctcagca1080 tcttctccactccctgcatcagcaaagggccaacagccggcagatgtaactggtaccgcc1140 ttgcccagggtgggccccgtgaggcccactggccaggactggaatcacaccccccagaag1200 acagaccatccatctgccctgctcagagaccccccggagccaggctctcccaggatctca1260 tcactgcgcccccagggcctcagcaacccctccaccctctctgctcagccacagctttcc1320 agaagccactcctcgggcagcgtgctgccccttggggagctggagggcaggaggagcacc1380 agggatcggaggagccccgcagagccagaaggaggaccagcaagtgaaggggcagccagg1440 cccctgccccgttttaactccgttcctttgactgacacaggccatgagaggcagtccgag1500 ggatccttcagcccgcagctccaggagtctgtcttccacctgctggtgcccagtgtcatc1560 ctggtcttgctggccgtcggaggcctcttgttctacaggtggaggcggcggagccatcaa1620 gagcctcagagagcggattctcccttggagcaaccagagggcagccccctgactcaggat1680 gacagacaggtggaactgccagtgtagagatctaaaggattctatggtaaggttctgatt1740 ttgatatc1748 <210>6 <211>1393 <212>DNA <213>Artificial Sequence <400>6 gtccagtgggaacacagaaagaaggaattatccatcagcctgaagcatcccagaaggctt60 tgcaagacaaggataagatgtgattataaccttaaaaggtgagacattcaccttaagatg120 gatgggggaaaggaagacttcatgtccgaggaagcagcctgagcaaaggtttatgaggga180 cgttgttgctctgagctaggtagtgcaaggaaatggaggacacgtgacaaaagtgcccct240 ttgagaccagaccactcatctgggcatgacgggattgaaacacattgaatcaggataaat300 ggaaggaagaaaaagatcctgacgttggcaatataattaataggctcctcttgataggtt360 aatctagatccattctcatgtaaagacaaaatgtgattgcacaaatgcatttccaacaga420 gttgagggaaatctagagtccaggcacaccaacctttccacataagctgggtttggcagc480 ccaggagcagggggccagccagtgctttcaggttaagcacctgaagtgtctcctggcaga540 gtgcagaaacacccagctagttgtcacaggaccaagtccttcctctcctacccaggtagc600 tggatgctccccacttctccctacagccaggggagaggatagtatagtagtatagtagat660 tctttgaacaatgcataggagggagcaagccaatctgcaaacctgctgccctgggttcca720 tgagggacttgaatggagctgcagcagagaggcgttggtccatccccattcaagtcctgt780 tcaatgtactctgtccgtttcctgctcagatttgaggattttcgggccttgagggaaagt840 ccctaggggccagcattagaccgagaacaatcacacgagattgacaagagtggcgagcac900 agaaggaaaggcagtgtcttgtccagagctcgagaagggcgggggagggcggtggagccc960 gggttactttgaggaggctgcacagccacagagcgacggggaagagagctagcggggacg1020 accaggcggcccgcttgggggaagggagtcggcggctcagtgggcctctggggtgtagta1080 tgtgtcagtgcctgtgagtgtgtttgtgtgtgtgtatgtctgtgtgtgtctggcggagag1140 ccagggtgatttcccataaaccacatgccccgccagcccgcccgcttaaaaggctgtgcc1200 gagggctggccagcgaagctcggccaggggaaagtgaaagtttgcctcggtgctctcggt1260 gtcgctgcggctctctgcatcccaggacagcggcgtggccctcgaccggggcgcgggctc1320 ttcagccactagcgagcaagggagcgagcgaaccagggcggccaacacgccgtgccggga1380 cccagctgcccgt1393 <210>7 <211>1385 <212>DNA <213>Artificial Sequence <400>7 agatctaaaggattctatggtaaggttctgattttgatatctctctatcccttaaaaaga60 actatctccaggtacccagtcctgttgtagaaaccacctgatgcccaagaggcccacaca120 tttcaacttcctctccccgtcccactcccaagcccatacattcatcatcacgtctagcta180 ggctcctctcttccaggcctcaggtctcctcttgctcctgaatccctgccctggaccagt240 tactgcaacctctgcattatgtttctattcttgctgttgctacatctgatcccaaagcaa300 ccacattcttcctcctctaatgaggctttttacaaggtctttaccaccctggagaatttt360 cattagcctttgcatggccgccagcccccttcaaatacgtgcatttccagcttggtgctg420 agccctgacctcctcagcatcctcttcttgccaaattgtgccttatctggtcctactccc480 aagccaaggttattgctgcctccctgatttaggatcattgtgccatagaaatttagtctt540 aggagagctgtcgagaggtcatttggcccagtgtcccagcctaaaagggttactctgcat600 cccccacagggagtcagccagcttcctgcacacacacacacacactcccagttccaggca660 agttctctgcatgccagtctgctcaactggggtcacaacattggggtcacaacacacaac720 actgggggagttccttccttatgtaggcaaagctgccttcctttcttcccttcccagacc780 aatcctctctcatcttctcatgaggcctgatatttaaagtcagctattcatgtcaccttt840 taaaattctctgtgttaagtgtggccaagcccctcaaacattccttatatgatatggttt900 tcagacccctcaccatcctggacacactcgtttgtcaatgtccctctgaaaatgtggcgc960 ccagccctggacacagtactccagatgttgtctgaccagctcagagtacagtgggacggt1020 tgtcttccttgatctggacagtactcttctactcgtgcagattaagatcacattagtttt1080 aacagctgcatcatatattgtcatatgttgagcttgtagtctattaaaaaccccagttct1140 atttcctgtgaacctttgtccagtagaccgtcgccatcccatactcccatacttggacac1200 aaccgttttagccaaagtgtagctggtgctcacctttgttaaaactccttgttgttttct1260 gcccatcccctgagcctactgaaagtgttttagttcctaatttggtcactttataactcc1320 tggttgggtcccctgcacattaatgcgtgtcttttgttgtccttgcccacgctattggtg1380 gagat1385 <210>8 <211>1665 <212>DNA <213>Artificial Sequence <400>8 atgaccgcgccgggcgccgccgggcgctgccctcccacgacatggctgggctccctgctg60 ttgttggtctgtctcctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagc120 cacatgattgggagtggacacctgcagtctctgcagcggctgattgacagtcagatggag180 acctcgtgccaaattacatttgagtttgtagaccaggaacagttgaaagatccagtgtgc240 taccttaagaaggcatttctcctggtacaagacataatggaggacaccatgcgcttcaga300 gataacacccccaatgccatcgccattgtgcagctgcaggaactctctttgaggctgaag360 agctgcttcaccaaggattatgaagagcatgacaaggcctgcgtccgaactttctatgag420 acacctctccagttgctggagaaggtcaagaatgtctttaatgaaacaaagaatctcctt480 gacaaggactggaatattttcagcaagaactgcaacaacagctttgctgaatgctccagc540 caagatgtggtgaccaagcctgattgcaactgcctgtaccccaaagccatccctagcagt600 gacccggcctctgtctcccctcatcagcccctcgccccctccatggcccctgtggctggc660 ttgacctgggaggactctgagggaactgagggcagctccctcttgcctggtgagcagccc720 ctgcacacagtggatccaggcagtgccaagcagcggccacccaggagcacctgccagagc780 tttgagccgccagagaccccagttgtcaaggacagcaccatcggtggctcaccacagcct840 cgcccctctgtcggggccttcaaccccgggatggaggatattcttgactctgcaatgggc900 actaattgggtcccagaagaagcctctggagaggccagtgagattcccgtaccccaaggg960 acagagctttccccctccaggccaggagggggcagcatgcagacagagcccgccagaccc1020 agcaacttcctctcagcatcttctccactccctgcatcagcaaagggccaacagccggca1080 gatgtaactggtaccgccttgcccagggtgggccccgtgaggcccactggccaggactgg1140 aatcacaccccccagaagacagaccatccatctgccctgctcagagaccccccggagcca1200 ggctctcccaggatctcatcactgcgcccccagggcctcagcaacccctccaccctctct1260 gctcagccacagctttccagaagccactcctcgggcagcgtgctgccccttggggagctg1320 gagggcaggaggagcaccagggatcggaggagccccgcagagccagaaggaggaccagca1380 agtgaaggggcagccaggcccctgccccgttttaactccgttcctttgactgacacaggc1440 catgagaggcagtccgagggatccttcagcccgcagctccaggagtctgtcttccacctg1500 ctggtgcccagtgtcatcctggtcttgctggccgtcggaggcctcttgttctacaggtgg1560 aggcggcggagccatcaagagcctcagagagcggattctcccttggagcaaccagagggc1620 agccccctgactcaggatgacagacaggtggaactgccagtgtag1665 <210>9 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>9 cagctgcccgtatgaccgcgcgg23 <210>10 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>10 gctgcccgtatgaccgcgcgggg23 <210>11 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>11 tatgaccgcgcggggcgccgcgg23 <210>12 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>12 tgaccgcgcggggcgccgcgggg23 <210>13 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>13 cgaagaagggcagcgccccgcgg23 <210>14 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>14 cgcggggcgctgcccttcttcgg23 <210>15 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>15 ggttgcagcttaccgaagaaggg23 <210>16 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>16 cggttgcagcttaccgaagaagg23 <210>17 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>17 aagctgcaaccgtggcgcgcggg23 <210>18 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>18 atagaaaggattctatggtaagg23 <210>19 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>19 ccagtatagaaaggattctatgg23 <210>20 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>20 gtggaactgccagtatagaaagg23 <210>21 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>21 cacctgtctgtcctcatcctggg23 <210>22 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>22 gacccaggatgaggacagacagg23 <210>23 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>23 gtctgtcctcatcctgggtcagg23 <210>24 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>24 cagctccctgacccaggatgagg23 <210>25 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>25 atcctgggtcagggagctgcagg23 <210>26 <211>23 <212>DNA / RNA <213>Artificial Sequence <400>26 tgcctgcagctccctgacccagg23 <210>27 <211>132 <212>DNA / RNA <213>Artificial Sequence <400>27 gaattctaatacgactcactatagggggtcttcgagaagacctgttttagagctagaaat60 agcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct120 tttaaaggatcc132 <210>28 <211>18 <212>DNA / RNA <213>Artificial Sequence <400>28 aagaagggcagcgccccg18 <210>29 <211>22 <212>DNA / RNA <213>Artificial Sequence <400>29 taggaagaagggcagcgccccg22 <210>30 <211>18 <212>DNA / RNA <213>Artificial Sequence <400>30 cggggcgctgcccttctt18 <210>31 <211>22 <212>DNA / RNA <213>Artificial Sequence <400>31 aaaccggggcgctgcccttctt22 <210>32 <211>17 <212>DNA / RNA <213>Artificial Sequence <400>32 ctccctgacccaggatg17 <210>33 <211>21 <212>DNA / RNA <213>Artificial Sequence <400>33 taggctccctgacccaggatg21 <210>34 <211>17 <212>DNA / RNA <213>Artificial Sequence <400>34 catcctgggtcagggag17 <210>35 <211>21 <212>DNA / RNA <213>Artificial Sequence <400>35 aaaccatcctgggtcagggag21 <210>36 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>36 ccacccacaagttgagaaccaccag25 <210>37 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>37 gtccttgacaactggggtctctggc25 <210>38 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>38 ctgcaggaactctctttgaggctga25 <210>39 <211>27 <212>DNA / RNA <213>Artificial Sequence <400>39 agcatcagccatatacaacagagcaga27 <210>40 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>40 agccagggtgatttcccataaacca25 <210>41 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>41 ggatgatgccacactcggatcttgt25 <210>42 <211>24 <212>DNA / RNA <213>Artificial Sequence <400>42 ggagcttgagggcctataggtggt24 <210>43 <211>24 <212>DNA / RNA <213>Artificial Sequence <400>43 agtaactggtccagggcagggatt24 <210>44 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>44 tgcacttatgtgatggatggctgag25 <210>45 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>45 taactgggcagttggaatggatgag25 <210>46 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>46 acttcctctcagcatcttctccact25 <210>47 <211>25 <212>DNA / RNA <213>Artificial Sequence <400>47 ctgtgtcagtcaaaggaacggagtt25 <210>48 <211>4198 <212>DNA / RNA <213>Artificial Sequence <400>48 acagagcgacggggaagagagctagcggggacgaccaggcggcccgcttgggggaaggga60 gtcggcggctcagtgggcctctggggtgtagtatgtgtcagtgcctgtgagtgtgtttgt120 gtgtgtgtatgtctgtgtgtgtctggcggagagccagggtgatttcccataaaccacatg180 ccccgccagcccgcccgcttaaaaggctgtgccgagggctggccagcgaagctcggccag240 gggaaagtgaaagtttgcctcggtgctctcggtgtcgctgcggctctctgcatcccagga300 cagcggcgtggccctcgaccggggcgcgggctcttcagccactagcgagcaagggagcga360 gcgaaccagggcggccaacacgccgtgccgggacccagctgcccgtatgaccgcgccggg420 cgccgccgggcgctgccctcccacgacatggctgggctccctgctgttgttggtctgtct480 cctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatgattgggag540 tggacacctgcagtctctgcagcggctgattgacagtcagatggagacctcgtgccaaat600 tacatttgagtttgtagaccaggaacagttgaaagatccagtgtgctaccttaagaaggc660 atttctcctggtacaagacataatggaggacaccatgcgcttcagagataacacccccaa720 tgccatcgccattgtgcagctgcaggaactctctttgaggctgaagagctgcttcaccaa780 ggattatgaagagcatgacaaggcctgcgtccgaactttctatgagacacctctccagtt840 gctggagaaggtcaagaatgtctttaatgaaacaaagaatctccttgacaaggactggaa900 tattttcagcaagaactgcaacaacagctttgctgaatgctccagccaagatgtggtgac960 caagcctgattgcaactgcctgtaccccaaagccatccctagcagtgacccggcctctgt1020 ctcccctcatcagcccctcgccccctccatggcccctgtggctggcttgacctgggagga1080 ctctgagggaactgagggcagctccctcttgcctggtgagcagcccctgcacacagtgga1140 tccaggcagtgccaagcagcggccacccaggagcacctgccagagctttgagccgccaga1200 gaccccagttgtcaaggacagcaccatcggtggctcaccacagcctcgcccctctgtcgg1260 ggccttcaaccccgggatggaggatattcttgactctgcaatgggcactaattgggtccc1320 agaagaagcctctggagaggccagtgagattcccgtaccccaagggacagagctttcccc1380 ctccaggccaggagggggcagcatgcagacagagcccgccagacccagcaacttcctctc1440 agcatcttctccactccctgcatcagcaaagggccaacagccggcagatgtaactggtac1500 cgccttgcccagggtgggccccgtgaggcccactggccaggactggaatcacacccccca1560 gaagacagaccatccatctgccctgctcagagaccccccggagccaggctctcccaggat1620 ctcatcactgcgcccccagggcctcagcaacccctccaccctctctgctcagccacagct1680 ttccagaagccactcctcgggcagcgtgctgccccttggggagctggagggcaggaggag1740 caccagggatcggaggagccccgcagagccagaaggaggaccagcaagtgaaggggcagc1800 caggcccctgccccgttttaactccgttcctttgactgacacaggccatgagaggcagtc1860 cgagggatccttcagcccgcagctccaggagtctgtcttccacctgctggtgcccagtgt1920 catcctggtcttgctggccgtcggaggcctcttgttctacaggtggaggcggcggagcca1980 tcaagagcctcagagagcggattctcccttggagcaaccagagggcagccccctgactca2040 ggatgacagacaggtggaactgccagtgtagaaaggattctatgctgggcacacaggact2100 atctctttatggaaggagacatatgggaacatccaccactaccctctcctaccatcttcc2160 tgggaatgtggcctaccactaccagagctcctgcctaccaagactggatgaaagaagcag2220 ctttgatggggtctttccatcctcacccttagactctcaaccaaagagaaagggctggag2280 gatgccccccacatactgccactatttattgtgggccctggaggctccctgcattggagg2340 aagggcagctcagcagctcaggaccctttcccttaggggctgcttcctcccctcaaaacc2400 agaacctggcaagggactcactagcctggatggcccatgggagaccaggacagatgagaa2460 ggagcagaagagccctgtgcccagaagacccaactggtgccaaggaatcccagcatggac2520 aggcagggacctgtttcccaagaagagagcctgatattcaaagggtgggacagcatctgc2580 ccgacttcccgtaaaggcataaaggcacgcagcccaaaagacgggaagaggaggcctttg2640 gctgcttgtgttgacagcttaaaggggtctacaccctcaacttgcttaagtgccctctgc2700 tgatagccaggaaggagggagaccagccctgcccctcaggacctgacctggctcatgatg2760 ccaagaggaagacagagctctagcctcgtcttctcctgcccacagcccctgccagagttc2820 ttttgcccagcagaggcacccctcatgaaggaagccattgcactgtgaatactgaacctg2880 cctgctgaacagcctgtcccatccatccctatgagtgaccatccgtccgaatgttctccc2940 acttccttcagcctctcctcggcttcttgcactgagctggcctcacgtgttgactgaggg3000 agcccctgagccccaaccttcccctgcctcagcctttgattgtccagggtgaagctgtgg3060 gagaaccgcctgggctaccagtcagagctggtctttgggctgtgttccttgcccaggttt3120 ctgcatcttgcactttgacattcccaggagggaagtgactagtggaagggagagaggaag3180 gggaggcagagacaaaggccacaggcagagctatgaatgagaatgggtcttgaaaatatg3240 tgtgcacccctaagcttgaaattgatctctatactctagcccctcagccagcctccttcc3300 tgttgtctgaaacctggagctaagcaggttgtcctgtcacaagctctggggactgagctc3360 catgctccaaccccaccctcttctgacctttgttctccagacctgacccaggtaggcaag3420 ggtaccctcccagtctcacctaccatactgtgccatctctagccaagcaagccaggttta3480 gagaagggtcaaaaaaaaaaaaaagggttgtttacttccaacttgttctgatgccctctg3540 tttcccaggccaggcttgtctgtggtgacctgggcatgggtgacagggctctcatttgcc3600 ccttggtctctttatgctgctgagtccccctttcctgccctccctggctactgggtcaat3660 aatctttcaggccatgaatctgggaggagagtggtctgtaagctccatcagccctgtcct3720 gagacagcaggggggaaggacactggagactttcttgtggggcttacttagccttctggt3780 tacagactatttccatgctagaaaatacatattttaaaatagaaggaaaaacacagaaac3840 aaaacaaaacaaggcattctctacccctccaccttaaacatatattattaaagacagaag3900 agaaaatccaacccattgcaagaagctctttgtgggtgcctggttacatcggagcagggg3960 agcctcaaatccacctttggagccgcccctgtgtgcattaggaacccttctctcctctga4020 gaaagctcagagggagcactgcctcacaaactgtgagactgcgttttttatacttggaag4080 tggtgaattattttatataaggtcatttaaatatctatttaaaaaataggaagctgcttt4140 tatatttaataataaaagaagtgcacaagctgccacgtgtgaaaaaaaaaaaaaaaaa4198 <210>49 <211>2330 <212>DNA / RNA <213>Artificial Sequence <400>49 acagagcgacggggaagagagctagcggggacgaccaggcggcccgcttgggggaaggga60 gtcggcggctcagtgggcctctggggtgtagtatgtgtcagtgcctgtgagtgtgtttgt120 gtgtgtgtatgtctgtgtgtgtctggcggagagccagggtgatttcccataaaccacatg180 ccccgccagcccgcccgcttaaaaggctgtgccgagggctggccagcgaagctcggccag240 gggaaagtgaaagtttgcctcggtgctctcggtgtcgctgcggctctctgcatcccagga300 cagcggcgtggccctcgaccggggcgcgggctcttcagccactagcgagcaagggagcga360 gcgaaccagggcggccaacacgccgtgccgggacccagctgcccgtatgaccgcgccggg420 cgccgccgggcgctgccctcccacgacatggctgggctccctgctgttgttggtctgtct480 cctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatgattgggag540 tggacacctgcagtctctgcagcggctgattgacagtcagatggagacctcgtgccaaat600 tacatttgagtttgtagaccaggaacagttgaaagatccagtgtgctaccttaagaaggc660 atttctcctggtacaagacataatggaggacaccatgcgcttcagagataacacccccaa720 tgccatcgccattgtgcagctgcaggaactctctttgaggctgaagagctgcttcaccaa780 ggattatgaagagcatgacaaggcctgcgtccgaactttctatgagacacctctccagtt840 gctggagaaggtcaagaatgtctttaatgaaacaaagaatctccttgacaaggactggaa900 tattttcagcaagaactgcaacaacagctttgctgaatgctccagccaagatgtggtgac960 caagcctgattgcaactgcctgtaccccaaagccatccctagcagtgacccggcctctgt1020 ctcccctcatcagcccctcgccccctccatggcccctgtggctggcttgacctgggagga1080 ctctgagggaactgagggcagctccctcttgcctggtgagcagcccctgcacacagtgga1140 tccaggcagtgccaagcagcggccacccaggagcacctgccagagctttgagccgccaga1200 gaccccagttgtcaaggacagcaccatcggtggctcaccacagcctcgcccctctgtcgg1260 ggccttcaaccccgggatggaggatattcttgactctgcaatgggcactaattgggtccc1320 agaagaagcctctggagaggccagtgagattcccgtaccccaagggacagagctttcccc1380 ctccaggccaggagggggcagcatgcagacagagcccgccagacccagcaacttcctctc1440 agcatcttctccactccctgcatcagcaaagggccaacagccggcagatgtaactggtac1500 cgccttgcccagggtgggccccgtgaggcccactggccaggactggaatcacacccccca1560 gaagacagaccatccatctgccctgctcagagaccccccggagccaggctctcccaggat1620 ctcatcactgcgcccccagggcctcagcaacccctccaccctctctgctcagccacagct1680 ttccagaagccactcctcgggcagcgtgctgccccttggggagctggagggcaggaggag1740 caccagggatcggaggagccccgcagagccagaaggaggaccagcaagtgaaggggcagc1800 caggcccctgccccgttttaactccgttcctttgactgacacaggccatgagaggcagtc1860 cgagggatccttcagcccgcagctccaggagtctgtcttccacctgctggtgcccagtgt1920 catcctggtcttgctggccgtcggaggcctcttgttctacaggtggaggcggcggagcca1980 tcaagagcctcagagagcggattctcccttggagcaaccagagggcagccccctgactca2040 ggatgacagacaggtggaactgccagtgtagaaaggattctatgacccctcaccatcctg2100 gacacactcgtttgtcaatgtccctctgaaaatgtggcgcccagccctggacacagtact2160 ccagatgttgtctgaccagctcagagtacagtgggacggttgtcttccttgatctggaca2220 gtactcttctactcgtgcagattaagatcacattagttttaacagctgcatcatatattg2280 tcatatgttgagcttgtagtctattaaaaaccccagttctatttcctgtg2330 <210>50 <211>455 <212>DNA <213>Artificial Sequence <400>50 agccgcctgcccgtcctgctcctgctccaactcctggtccgccccggactccaagctccc60 atgacccagacaacgcccttgaagacaagctgggttaactgctctaacatgatcgatgaa120 attataacacacttaaagcagccacctttgcctttgctggacttcaacaacctcaatggg180 gaagaccaagacattctgatggaaaataaccttcgaaggccaaacctggaggcattcaac240 agggctgtcaagagtttacagaacgcatcagcaattgagagcattcttaaaaatctcctg300 ccatgtctgcccctggccacggccgcacccacgcgacatccaatccatatcaaggacggt360 gactggaatgaattccggaggaaactgacgttctatctgaaaacccttgagaatgcgcag420 gctcaacagacgactttgagcctcgcgatcttttg455 <210>51 <211>432 <212>DNA <213>Artificial Sequence <400>51 tggctgcagagcctgctgctcttgggcactgtggcctgcagcatctctgcacccgcccgc60 tcgcccagccccagcacgcagccctgggagcatgtgaatgccatccaggaggcccggcgt120 ctcctgaacctgagtagagacactgctgctgagatgaatgaaacagtagaagtcatctca180 gaaatgtttgacctccaggagccgacctgcctacagacccgcctggagctgtacaagcag240 ggcctgcggggcagcctcaccaagctcaagggccccttgaccatgatggccagccactac300 aagcagcactgccctccaaccccggaaacttcctgtgcaacccagattatcacctttgaa360 agtttcaaagagaacctgaaggactttctgcttgtcatcccctttgactgctgggagcca420 gtccaggagtga432 <210>52 <211>2335 <212>DNA <213>Artificial Sequence <400>52 agttggtggttatgtgaatctttgtatttgattgctcttattcaaattgagatggccctg60 aaacctgtcagatctgggacactgtgtgaaataatggctttgttcttttattcagacaaa120 cctggttttagtctgggcagtcatgggatttctatgacgccagatcagattttctaaatg180 atgctctcaggagggctaaatctgatgcatgtgttaaggaacacagagcctaccctatgg240 aaagcagatgtggcataagcaccaggcgtttctctatctgcttctggcttactcgcttgt300 gttttgatagtcatccttcatcctggttctgttgcaggaagagttctggatggatggcag360 ctggaagcccatcgccatagccagctcatcttcaacattgaagctcttacctgggcatta420 agtaatgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgttt480 acttctaaacagtcattttctaactgaagctggcattcatgtcttcattttgggctgttt540 cagtgcagggcttcctaaaacagaagccaactgggtgaatgtaataagtgatttgaaaaa600 aattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgt660 tcaccccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttc720 acttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaa780 caacagtttgtcttctaatgggaatgtaacagaatctggatgcaaagaatgtgaggaact840 ggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcat900 caacacttcttgaaatcaacctctggattacaaaatttgtgaaagattgactggtattct960 taactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgc1020 tattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctct1080 ttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctga1140 cgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgc1200 tttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggac1260 aggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctt1320 tccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgt1380 cccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcc1440 tcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctcccc1500 gcatcgataccgtcgacctcgactgtgccttctagttgccagccatctgttgtttgcccc1560 tcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaat1620 gaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtgggg1680 caggacagcaagggggaggattgggaagacaatagcaggcatgctggggaaaatagcata1740 tggcttttcttataaggtcaccttaatctcagttctactttataataagtcgcatgatta1800 ctctctaaacatctctggctgcgacagatatgtttctccaagatttatcttgattttaaa1860 aataagtagcatgggctttggaaaacaagactagcagtatgcctgtattctttgtgccat1920 tgttaaggtgttattacacttcactcagtctcttttgttctctaaatgtctattcacttc1980 gcacattgtgtctctgagggcaaggtctggtgctaggcatctttcagcagagtctacaca2040 gagtacagacttctggtgtttaaggtgttgactgacgctgctctctgtaactataaaatc2100 tctgacagcactgacaagtcaggtcagagaattaaaactgtgtctatctcagacaaataa2160 ggtcctaaataaccaaattaagttttcatgtaggagctgttagaatgaaaaaggatatac2220 ttctttttgagacaggatttcataactatgtagcgttgggtggcctggaactcaccaggg2280 tagtcctgagcttacagaatcccttgttcctgtctctctcatcctaggtccgacg2335

Claims

1. A method for constructing a humanized CSF1 gene-modified non-human animal, characterized in that, The described humanized CSF1 gene-modified non-human animal expresses human CSF1 protein in vivo; the genome of the described humanized CSF1 gene-modified non-human animal includes a chimeric CSF1 gene, and the chimeric CSF1 gene encodes human CSF1 protein; the nucleotide sequence of the chimeric CSF1 gene is the nucleotide sequence shown in SEQ ID NO: 5 or the nucleotide sequence of the transcribed mRNA sequence is the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 49; the construction method includes inserting the nucleotide sequence encoding human CSF1 protein before the start codon of the non-human animal CSF1 gene using an sgRNA sequence targeting the CSF1 gene, and the sgRNA sequence is unique on the target sequence of the CSF1 gene to be modified. The sgRNA targets a 5'-end target site sequence as shown in SEQ ID NO: 13 and a 3'-end target site sequence as shown in SEQ ID NO: 24; the non-human animal is NOD-Prkdc scid IL-2rg null mouse.

2. A sgRNA specifically targeting the CSF1 gene, characterized in that, The sgRNA is unique to the target sequence on the CSF1 gene to be modified. The target sites of the sgRNA on the CSF1 gene of the non-human animal are located on exon 1 and exon 8 of the CSF1 gene of the non-human animal. The 5'-end target site sequence targeted by the sgRNA is as shown in SEQ ID NO: 13, and the 3'-end target site sequence is as shown in SEQ ID NO:

24.

3. A method for preparing a multi-gene humanized non-human animal, characterized in that, Comprising the following steps: (a) A non-human animal obtained by the method according to claim 1; (b) Mating the non-human animal prepared in step (a) with other gene humanized animals, in vitro fertilization, or directly performing gene editing, and screening to obtain a multi-gene humanized non-human animal.

4. The method according to claim 3, wherein The other gene humanized animals are selected from one or a combination of two or more of gene IL6, IL15, IL3, CSF2 or SIPRA humanized animals.

5. Use of a humanized CSF1 gene-modified non-human animal constructed by the construction method of claim 1 or a multi-gene humanized non-human animal obtained by the method of any one of claims 3-4, characterized in that: The applications include: A) Applications in model systems for pharmacological, immunological, microbiological and medical research; B) Applications in the production and utilization of animal experimental disease models for etiological research; C) Applications in studying the function of the CSF1 gene, the formation and function of human hematopoietic stem cells; D) Applications in screening, validating and evaluating drugs targeting the CSF1 target site, drugs for immune-related diseases and anti-tumor drugs; E) Applications in the efficacy study of constructing disease models, wherein the disease is a tumor, and the application is not a method for diagnosing or treating the disease.

Citation Information

Patent Citations

  • Genetically modified non-human animals and methods of use thereof

    CN104955326A

  • Preparation method and application of humanized gene modification animal model

    CN107815468A

  • Genetically modified non-human animals expressing human epo

    US20150327524A1

  • Genetically modified non-human animals and methods of use thereof

    WO2014039782A3

  • Humanized M-CSF mice

    CN105861553A