A method for detecting multiple drug resistance sites of neisseria gonorrhoeae

Abstract

The application provides a method for detecting 19 Neisseria gonorrhoeae drug resistance site mutations. The method uses multiplex PCR-mass spectrometry to detect 19 Neisseria gonorrhoeae drug resistance site mutations. The detection method comprises the following steps: 1) designing primers for different drug resistance sites; 2) multiplex PCR amplification reaction; 3) shrimp alkaline phosphatase treatment; 4) single base extension reaction; 5) resin desalting purification; and 6) mass spectrometry detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology detection, and relates to a detection method of multiple drug resistance sites, in particular to a method for detecting drug resistance sites of Neisseria gonorrhoeae by multiplex PCR-mass spectrometry. BACKGROUND

[0002] Neisseria gonorrhoeae (NG) is a sexually transmitted pathogen that seriously affects public health, and the global incidence of new infections is as high as 87 million cases. High incidence not only increases the global health economic cost, but also leads to serious drug resistance problems. With the rapid development and spread of drug resistance of gonococci, the widely recommended antibiotics (sulfonamides, penicillin, early cephalosporins, tetracyclines, macrolides and quinolones) have successively withdrawn from the recommended first-line drugs for gonorrhea. At present, the first-line empirical drug recommended by the World Health Organization is cephalosporin combined with azithromycin, and extended-spectrum cephalosporins (ESCs) are considered to be the last choice for the treatment of gonococcal infection in many countries. Unfortunately, in recent years, there have been many reports of dual resistance strains of cephalosporins and azithromycin, and recently super-resistant strains have been found in the United Kingdom and Australia, which are resistant to both azithromycin and cephalosporins. The growing drug resistance may lead to gonorrhea entering an era that cannot be treated.

[0003] The treatment of gonococcal infection is faced with the serious situation of drug resistance, and the bacteria are still gaining new drug resistance mechanisms. We must detect and monitor its drug resistance in time, and establish appropriate treatment plan to make us more powerful in the control of gonorrhea. The conventional gonococcal drug resistance detection methods are divided into culture method and non-culture method, the culture method for detecting gonococcal MIC (minimum inhibitory concentration) is the "gold standard" for the diagnosis of gonococcal drug resistance, which has strong specificity and high accuracy, and is also the only method that can obtain pure culture of isolated strains. But this method needs to go through a tedious and time-consuming culture process, lacks timeliness, and is not suitable for a large number of samples. Nucleic acid amplification method (Nucleic acid amplification tests, NAATs) has the advantages of short time consumption, automation, etc., and can realize rapid detection of gonococcal drug resistance by detecting specific drug resistance related mutation sites. However, such methods are limited by the method throughput, and the detection sites are limited, which cannot be used for drug resistance related site monitoring and obtaining comprehensive drug resistance information of large-scale samples. At present, WGS (Whole Genome Sequencing) has also been successfully applied to gonococcal drug resistance detection, which can timely find new drug resistance related genes and mutations, and has guiding significance for the prediction of drug resistance mutation sites. But the cost and technology limit the wide application of WGS in some resource-limited areas, and it is also not suitable for large-scale sample monitoring. Therefore, it is necessary to develop a multiplex detection method with high throughput, low cost and comprehensive detection of gonococcal drug resistance related sites for effective screening. In clinical treatment, comprehensive drug resistance information can be obtained through one-time rapid detection, so as to select the best treatment plan. In the public health field, one staff can detect a large number of samples at the same time within 8 hours, which is suitable for large-scale gonococcal drug resistance monitoring, and can timely monitor the drug resistance distribution of different populations in different regions. SUMMARY

[0004] The purpose of the present application is to provide a method for detecting mutations of gonococcal drug resistance related sites, which is used for non-diagnostic purposes. The method uses multiplex PCR-mass spectrometry to detect 19 mutations of Neisseria gonorrhoeae drug resistance sites.

[0005] The special primer provided by the present application for multiplex detection of Neisseria gonorrhoeae drug resistance sites is selected from five kinds of antibiotic (cephalosporin, macrolide, quinolone, spectinomycin and penicillin) resistance related genes as the target genes for detection, including rpsE, penA, gyrA, parC, ponA, porB, mtrR, 16S rRNA and 23S rRNA.

[0006] The 19 mutations of Neisseria gonorrhoeae drug resistance sites described in the present application include:

[0007] 1) 16S rRNA C1192U

[0008] 2) rpsE T24P

[0009] 3) 23S rRNA C2611T

[0010] 4) 23S rRNA A2059G

[0011] 5) gyrA D95G / A

[0012] 6) gyrA S91F

[0013] 7) parC D86N

[0014] 8) parC S88P

[0015] 9) penA G542S

[0016] 10) penA G545S

[0017] 11) penA A501T / V

[0018] 12) penA P551S / L

[0019] 13) penA A311V

[0020] 14) penA D345-insertion

[0021] 15) ponA L421P

[0022] 16) mtrR-G45D

[0023] 17) mtrR-deletion A

[0024] 18) porB-A121DN(G)

[0025] 19) porB G120D(KNR)

[0026] The 19 detection targets described in the present application have the following effects:

[0027] 1) 16S rRNA C1192U and rpsE T24P are used for detecting macrolide antibiotic resistance;

[0028] 2) 23S rRNA C2611T and 23S rRNA A2059G are used for detecting macrolide antibiotic resistance;

[0029] 3) gyrA D95G / A, gyrA S91F, parC D86N and parC S88P are used for detecting quinolone antibiotic resistance;

[0030] 4) penA G542S, penA G545S, penA A501T / V, penA P551S / L and penA A311V for detecting cephalosporin resistance;

[0031] 5) penA D345-insertion, ponA L421P for detecting penicillin antibiotic resistance;

[0032] 6) mtrR-G45D and mtrR-deletion A two targets for determining the expression of efflux pump MtrCDE, which is related to multiple antibiotic resistance;

[0033] 7) Target porB-A121DN(G) and porB G120D(KNR) for determining the expression of major outer membrane protein, which is related to multiple antibiotic resistance;

[0034] 8) penA-D345del and penA-G545S for identifying the mosaic penA type of Neisseria gonorrhoeae;

[0035] 9) penA A311V for identifying the mosaic penA type containing A311V mutation;

[0036] 10) opa and porA two targets as identification and confirmation of Neisseria gonorrhoeae species;

[0037] The detection method provided by the application comprises the following steps:

[0038] 1) primer design: for each drug resistance site to be detected, first, download 9 drug resistance gene sequences of each Neisseria gonorrhoeae strain with complete annotation as a reference sequence from the GenBank database, including rpsE, penA, gyrA, parC, ponA, porB, mtrR, 16S rRNA and 23S rRNA, submit the reference sequence to NCBI for nucleic acid sequence BLAST, select nr database, download the results obtained by comparison, obtain 19 target gene sequences of drug resistance site mutations of Neisseria gonorrhoeae, and design specific amplification primers for each target gene to be detected. In order to avoid the quality of the amplification primer in the result window, 10 bases of a universal sequence ACGTTGGATG are added to the 5' end of each amplification primer to increase the quality, and a single-base extension probe is designed in the region of the drug resistance site in the amplification region, so that the probe is combined with the target gene, and only one designed and determined base is allowed to be extended at the 3' end, as a genotype-specific sequence marker. The amplification primer and extension probe sequence of the 19 drug resistance sites are shown in Table 1.

[0039] 2) Multiplex PCR amplification reaction: UNG enzyme, dNuTPs mixture, DNA polymerase and multiplex PCR primers are added to the PCR reaction system and mixed, UNG enzyme is used to digest dUTP, and the PCR amplification product is degraded, then the UNG enzyme is inactivated, pre-denatured, and then PCR amplification is performed to obtain the target gene amplification product in the sample to be tested;

[0040] 3) Shrimp alkaline phosphatase reaction: After the multiplex PCR reaction is completed, SAP mixture is added to digest the remaining dNTPs in the reaction system using SAP to prevent excess substrate from affecting the results of the next single base extension reaction;

[0041] 4) Single base extension reaction: An extension probe designed for the drug-resistant site is added to the amplified target gene for single base extension reaction, and the substrate is a modified dideoxynucleotide triphosphate, which allows the extension probe to extend one base at a specific single nucleotide site and then terminate the reaction. The extended base can be determined by the difference in molecular weight, and the molecular weight marker is used to determine the genotype of the drug-resistant site;

[0042] 5) Resin desalting: Cation exchange resin is used to adsorb salt ions in the system to purify the extension reaction product;

[0043] 6) Mass spectrometry detection: The purified product is spotted onto a chip using a full-automatic spotting device for molecular weight detection, and the genotype of the drug-resistant site on the target gene to be tested is determined according to the difference in molecular weight.

[0044] In step (1) of the primer design, a pair of amplification primers and an extension probe are designed for each drug-resistant site to be detected. The sequences of the amplification primers and the extension probe are SEQ ID NO. 1 to SEQ ID NO. 62, as shown in Table 1.

[0045] Preferably, the opa gene is added as a sample species identification reference, and the primer sequences are SEQ ID NO. 63 and SEQ ID NO. 64, and the extension probe sequence is SEQ ID NO. 65.

[0046] Preferably, the porA gene is added as a sample species identification reference, and the primer sequences are SEQ ID NO. 66 and SEQ ID NO. 67, and the extension probe sequence is SEQ ID NO. 68.

[0047] Preferably, a negative control is added in each reaction, and the negative control is nuclease-free distilled water.

[0048] In step (2), the PCR reaction system is shown in Table 2-1, and the reaction process is shown in 2-2.

[0049] The shrimp alkaline phosphatase reaction system in step (3) is shown in Table 3-1, and the reaction flow is shown in 3-2.

[0050] The base extension reaction system in step (4) is shown in Table 4-1, and the reaction flow is shown in 4-2.

[0051] The mass spectrometry detection in step (6) is as follows: after the product is purified, it is transferred to a chip by using a special device, and is co-crystallized with a chip matrix. The crystallized chip is placed in a vacuum tube of a mass spectrometry instrument. The chip is excited by a strong laser in a vacuum tube of a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI TOF mass spectrometry) system, so that the nucleic acid molecules are desorbed and single-charge ions are generated. The ions fly to a detector in the vacuum tube, and the ion mass is proportional to the time of flight. The detection result is presented in a visualized graph on a server, that is, an analysis spectrum is formed with the intensity of the ion peak as the ordinate and the ion mass as the abscissa. According to the difference in the molecular mass before and after the specific probe extension reaction, the extended base of the specific drug-resistant site in the sample is judged, so as to judge whether there is a mutation. The software automatically processes and reports the detection result and the reliability of each drug-resistant site.

[0052] Most preferably, the detection method of the present application comprises the following steps:

[0053] 1) Primer design: first, 9 drug-resistant gene sequences of representative strains of each Neisseria gonorrhoeae with complete annotation as reference sequences are downloaded from the GenBank database ( https: / / www.ncbi.nlm.nih.gov / genbank / ), including rpsE, penA, gyrA, parC, ponA, porB, mtrR, 16S rRNA and 23S rRNA. The reference sequence is subjected to nucleic acid sequence BLAST

[0054] https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) with the nr database of NCBI, the obtained results are downloaded, and more detected drug-resistant target gene sequences are obtained. According to the drug-resistant sites of the 19 selected target genes, specific amplification primers for each to-be-detected drug-resistant site are designed by using the Assay Design 4.0 software of Agena Company. In order to avoid the quality of the amplification primers appearing in the result window, 10 bases of a universal sequence ACGTTGGATG are added to the 5' end of each amplification primer. A single-base extension probe is designed in the region of the drug-resistant site in the amplification region, so that after the probe is combined with the target gene, only one designed base is allowed to be extended at the 3' end, as a genotype-specific sequence marker. The extended base can be judged by the difference in the molecular weight, so as to judge the genotype of the drug-resistant site. The amplification primer and the extension probe sequence of the 19 drug-resistant sites are shown in Table 1.

[0055] ​Table 1, nucleotide sequence

[0056]

[0057]

[0058] 2) Multiplex PCR amplification reaction: The reaction uses a 384-well plate, and the reaction system is prepared according to the following table, and the total reaction system is 5 μl. The UNG enzyme, dNuTPs mixture, DNA polymerase and multiplex PCR primers are added to the PCR reaction system, first the UNG enzyme is used for dUTP digestion, and the PCR amplification product is degraded, then the UNG enzyme is inactivated, and then the PCR amplification (45 cycles) is carried out to obtain the target gene amplification product in the sample to be tested. The reaction system is shown in Table 2-1 and the reaction process is shown in Table 2-2, and after completion, it is stored at 4°C.

[0059] Table 2-1

[0060]

[0061] Table 2-2

[0062]

[0063] 3) Shrimp alkaline phosphatase (SAP) treatment: After multiplex PCR amplification of the target fragment, SAP is used to digest the excess substrate to prevent the interference of the unconsumed substrate with the next single base extension reaction. The reaction system is prepared according to the following table,

[0064] Then transfer to the reaction plate of the previous step with a continuous dispenser, 2 μl per well. The reaction system is shown in Table 3-1 and the reaction process is shown in Table 3-2, and after completion, it is stored at 4°C.

[0065] Table 3-1

[0066]

[0067] Table 3-2

[0068]

[0069] 4) Single-base extension (iPLEX) reaction: Add the designed extension probe for a single-base extension reaction. Use modified dideoxynucleoside triphosphates (ddNTPs) as the reaction substrate. The extension probe extends one base at a specific single nucleotide site before terminating the reaction. This is done in the second round of amplification by extending the 3' end of the single-base extension probe by a sequence-specific single nucleotide, which serves as a molecular weight marker. The extended base is identified by molecular weight differences, thereby determining the genotype of the drug-resistant site. Prepare the reaction system according to the table below and then transfer it to the reaction plate from the previous step using a continuous dispenser, transferring 2 μl per well. See Table 4-1 for the reaction system and Table 4-2 for the reaction process. Store at 4°C after completion.

[0070] Table 4-1

[0071]

[0072] Table 4-2 Workflow

[0073]

[0074] 5) Resin Desalting: Use cation exchange resin to absorb salt ions in the system and purify the extension reaction products. Add 16 μL of nuclease-free water to a shaker, shake at 80 rpm for 4 minutes, and centrifuge at 2000 rpm for 5 minutes.

[0075] 6) Mass spectrometry detection: After the product is purified, it is transferred to a chip using dedicated equipment and co-crystallized with the chip matrix. The crystallized chip is placed in the vacuum tube of the mass spectrometer and the chip is subjected to matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDITOF mass spectrometry).

[0076] The system's vacuum tube is subjected to instantaneous intense laser excitation, causing the nucleic acid molecules to desorb and generate singly charged ions. These ions travel through the vacuum tube to the detector. The ion mass is proportional to the flight time, and the detectable molecular mass depends on the length of the flight tube. The test results are presented to the server as visual graphics, with the intensity of the ion peak as the vertical axis and the ion mass as the horizontal axis to form an analysis map. The difference in molecular mass before and after the specific probe extension reaction is used to determine the bases extended at specific drug-resistant sites in the sample to determine whether there are mutations. The software automatically processes and reports the test results and credibility of each drug-resistant site. TyperAnalyzer software is used to automatically analyze and report the results and export the data.

[0077] The detection method of the present invention can detect 24 mutations located at 19 drug-resistant sites, with no cross-reactivity with other microorganisms. These 24 reported important resistance-associated mutations cover most of the resistance mutations currently used to treat gonorrhea and can screen for mosaic penA.

[0078] The method of the present application is a high-throughput multiplex detection method for Neisseria gonorrhoeae drug resistance related sites, which can simultaneously perform mosaic penA screening on the basis of high-throughput multiplex (24-fold) detection, and well cope with the problem of multiple drug resistance of Neisseria gonorrhoeae. And the operation is simple, one staff can detect a large number of samples in one working day by using 384 chips. The method has high sensitivity and specificity, and can accurately identify low-abundance target sequences in samples. At the same time, the detection speed is fast, and has good scalability, and the experimental operation is simple and easy. It is suitable for large-scale Neisseria gonorrhoeae drug resistance monitoring, and has more value in clinical medicine use and promotion.

[0079] Another object of the present application is to provide a kit for detecting clinical samples.

[0080] The kit of the present application comprises one or more primer sets shown in Table 1.

[0081] Preferably, the kit of the present application comprises the following primer sets: two forward and reverse amplification primer sequences for detecting target genes and corresponding extension probe sequences SEQ ID NO. 1-SEQ ID NO. 62; amplification primers SEQ ID NO. 63 and SEQ ID NO. 64 for Neisseria gonorrhoeae species identification target based on opa gene, and extension probe sequence SEQ ID NO. 65; amplification primer sequences SEQ ID NO. 66 and SEQ ID NO. 67 for Neisseria gonorrhoeae species identification target based on porA gene, and extension probe sequence SEQ ID NO. 68.

[0082] According to the needs, the kit of the present application can also include reagents that are beneficial to laboratory operation, such as solvents, buffer solvents, auxiliary materials, etc.

[0083] The kit of the present application can include reagents prepared from the above components, and the preparation method of the reagents is a conventional technology, which only needs to mix various raw materials uniformly at room temperature, without special equipment and conditions.

[0084] The kit of the present application can separately contain different reagents, and then be packaged in the same packaging box together, and be used according to the method described in the instruction manual.

[0085] Another object of the present application is to provide the use of the above-mentioned kit for detecting Neisseria gonorrhoeae drug resistance sites.

[0086] The kit is used for detecting 19 drug resistance sites of Neisseria gonorrhoeae, including: 16S rRNA C1192, 23S rRNA C2611T, 23S rRNA A2059G, gyrA D95 / A, gyrA S91F, parC D86N, parC S88, mtrR deletion-A, mtrR G45D, penA D345-insertion, penA G542S, penA G545S, penA A501T / V, penA P551S / L, ponA L421P, porB A121(DN) / G, porB G120D / (KNR), rpsE T24P and penA A311V.

[0087] For the technical terms appearing in the text, further explanation is made:

[0088] Template DNA: DNA template

[0089] SAP Buffer: shrimp alkaline phosphatase buffer

[0090] shrimp alkaline phosphatase: shrimp alkaline phosphatase

[0091] iPLEX Pro buffer: single base extension reaction buffer

[0092] Terminator mix: termination reaction mixture

[0093] Extension probe Mix: extension probe mixture

[0094] Total volume: total volume

[0095] MALDI TOF mass spectrometry: matrix-assisted laser desorption ionization time-of-flight mass spectrometry

[0096] ddNTP: double deoxy triphosphate nucleotide

[0097] PCR Buffer: PCR buffer

[0098] dNuTPs: dATP, dCTP, dGTP and dUTP, a mixture of four kinds of deoxynucleotides

[0099] Amplification primer Mix: primer mixture for multiplex PCR amplification

[0100] DNA polymerase enzyme: DNA polymerase

[0101] uracil-DNA glycosylase: uracil DNA glycosylase, also known as UNG enzyme BRIEF DESCRIPTION OF DRAWINGS

[0102] Figure 1 : mass spectrum of gonococcal drug resistance site detection DETAILED DESCRIPTION

[0103] The present application includes simultaneous detection of 19 gonorrhea Neisseria drug resistance sites. The specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0104] Example 1, detection method

[0105] The method for detecting and / or identifying gonorrhea Neisseria drug resistance sites provided by the embodiments of the present application has high sensitivity, and the 19 gonorrhea Neisseria drug resistance sites to be detected include: 16S rRNA C1192, 23S rRNA C2611T, 23S rRNA A2059G, gyrA D95 / A, gyrA S91F, parC D86N, parC S88, mtrR deletion-A, mtrR G45D, penA D345-insertion, penA G542S, penA G545S, penA A501T / V, penA P551S / L, ponA L421P, porB A121(DN) / G, porB G120D / (KNR), rpsE T24P and penA A311V. The embodiments of the present application include the following steps:

[0106] 1) primer design: first download the drug resistance gene sequences of representative strains of gonorrhea Neisseria with complete annotations as reference sequences from the GenBank database ( https: / / www.ncbi.nlm.nih.gov / genbank / ), perform nucleic acid sequence BLAST ( https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) on the reference sequences and the nr database of NCBI, download the results obtained by comparison, and obtain more detection drug resistance target gene sequences. According to the drug resistance sites of the selected target genes, the Assay Design 4.0 software of Agena Company is used to design specific amplification primers for each drug resistance site to be detected, and a universal sequence of 10 bases is added to the 5' end of each amplification primer

[0107] ACGTTGGATG, a single base extension probe is designed in the conserved sequence region in the amplification region, and at the 3' end of the probe, the extension probe will terminate the reaction after extending a designed and determined base at a specific nucleotide site, as a genotype-specific sequence marker. The amplification primer and extension probe sequences of the 19 drug resistance sites are shown in Table 1.

[0108] 2) Multiplex PCR amplification reaction: The reaction used 384-well plates, and the reaction system was prepared according to the following table, and the total reaction system was 5 μl. The dNuTPs mixture, UNG enzyme, DNA polymerase enzyme and multiplex PCR primers were added to the PCR reaction system, and the UNG enzyme was used to digest the dUTP first, and then the UNG enzyme was inactivated, and then 45 cycles of PCR amplification were performed to obtain the target gene amplification product in the sample to be tested. The reaction system is shown in Table 2-1 and the reaction process is shown in Table 2-2, and after completion, it is stored at 4°C.

[0109] Table 2-1

[0110]

[0111]

[0112] Table 2-2

[0113]

[0114] 3) Shrimp alkaline phosphatase (SAP) treatment: After multiplex PCR amplification of the target fragment, SAP was used to digest the excess substrate to prevent the interference of the unconsumed substrate with the next single base extension reaction. The reaction system was prepared according to the following table,

[0115] Then transfer to the reaction plate of the previous step with a continuous dispenser, 2 μl per well. The reaction system is shown in Table 3-1 and the reaction process is shown in Table 3-2, and after completion, it is stored at 4°C.

[0116] Table 3-1

[0117]

[0118]

[0119] Table 3-2

[0120]

[0121] 4) Single base extension (iPLEX) reaction: add designed extension probe to perform single base extension reaction, use modified dideoxy triphosphate nucleotides (ddNTP) as reaction substrate, so that the extension probe is extended by one base at a specific single nucleotide site and terminated, i.e. the 3' end of the single base extension probe in the second round of amplification is extended by one sequence-specific single nucleotide, which is labeled by molecular weight, and the extended base is determined by the difference in molecular weight, so as to determine the drug resistance site genotype. The reaction system is prepared according to the following table, and then transferred to the reaction plate of the previous step by using a continuous dispenser, 2 μl per well. The reaction system is shown in Table 4-1 and the reaction process is shown in Table 4-2. After completion, store at 4°C.

[0122] Table 4-1

[0123]

[0124] Table 4-2

[0125]

[0126]

[0127] 5) Resin desalination: use cation exchange resin to adsorb salt ions in the system, and purify the extension reaction product. Add 16 μl of water to the shaker and shake for 50 minutes at 2000 rpm for 5 minutes.

[0128] 6) Mass spectrometry detection: after purification, the product is detected by mass spectrometry. After purification, the product is co-crystallized with the chip matrix. The chip is excited by a strong laser in the vacuum tube of the matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI TOF mass spectrometry) system. With the sublimation of the matrix crystal, the nucleic acid molecules are desorbed and converted into single-charge ions. These single-charge ions obtain kinetic energy under the acceleration electric field and fly to the detector in the vacuum tube. The detection result is presented in a visual graph on the server, i.e. an analysis spectrum is formed with the intensity of the ion peak as the vertical coordinate and the ion mass as the horizontal coordinate. According to the difference in molecular weight before and after the specific probe extension reaction, the specific base extended by the drug resistance site in the sample is determined to determine whether there is a mutation. The TyperAnalyzer

[0129] software automatically analyzes and reports the results and exports the data.

[0130] Example 2, kit

[0131] The kit provided by the application is used for detecting 19 drug resistance sites of Neisseria gonorrhoeae, and comprises the following steps:

[0132] 1. Nucleic acid extraction: Use a nucleic acid extraction kit to extract the test secretion or urine sample.

[0133] 2. Multiplex PCR: Using a dedicated amplification reaction system, multiplex PCR is performed to amplify multiple genes. The reaction begins with a 45°C reaction for 2 minutes to activate the UNG enzyme and digest dUTP. The UNG is then inactivated at 94°C for 4 minutes (this also serves as a pre-denaturation step), followed by a 45-cycle denaturation at 95°C for 30 seconds, annealing at 56.5°C for 30 seconds, and extension at 72°C for 1 minute. The reaction is followed by a final extension at 72°C for 5 minutes, followed by storage at 4°C. Uracil N-glycosylase (UNG) is incorporated into the PCR process. In the initial PCR reaction, dUTP replaces the dTTP used in conventional PCR, resulting in the incorporation of a large amount of dU into the product. Before further PCR amplification, the PCR mixture is treated with UNG to eliminate residual contamination of the PCR product. Since the UNG enzyme is inactivated during the denaturation step of the PCR cycle, it will not affect new dU-containing PCR reactions and products, completely eliminating the problem of false positives caused by contamination of PCR amplification products. Through the first round of PCR amplification, the target sequence amplification product in the sample to be tested is obtained.

[0134] 3. Shrimp Alkaline Phosphatase (SAP) Treatment: After the multiplex PCR reaction, shrimp alkaline phosphatase (SAP) is used to digest and remove excess dNTPs from the reaction system to prevent interference with the subsequent base extension reaction. The reaction conditions are set to incubate at 37°C for 40 minutes to allow SAP to remove excess dNTPs. The SAP enzyme is then inactivated at 85°C for 5 minutes. After completion, the reaction is stored at 4°C.

[0135] 4. Base extension reaction: Add the designed extension probe to perform single base extension reaction, using modified dideoxy nucleoside triphosphate

[0136] (ddNTP) is used as a reaction substrate, allowing the extension probe to extend one base at a specific single nucleotide site before terminating the reaction. This means that in the second round of amplification, the 3' end of the single-base extension probe is extended by a sequence-specific single nucleotide to serve as a molecular weight marker. The entire single-base extension reaction is set up as a 400-step ladder program, consisting of two cycles of chimerism: initial denaturation at 94°C for 30 seconds, followed by 40 cycles at 94°C for 5 seconds, annealing at 52°C for 5 seconds, and extension at 80°C for 5 seconds. Within each cycle, five short cycles of annealing and extension are inserted; the final extension is at 72°C for 5 minutes.

[0137] 5. Resin desalting: Desalt and purify the extension reaction product, flip at 80 rpm for 40 minutes.

[0138] 6. Mass spectrometry detection: The purified product is co-crystallized with the chip matrix. The chip is then subjected to instantaneous intense laser excitation in the vacuum tube of a matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDITOF) system. As the matrix crystals sublime, the nucleic acid molecules desorb and transform into singly charged ions. These singly charged ions gain kinetic energy under the accelerating electric field and travel through the vacuum tube to the detector. The test results are displayed on the server as a visual graph, with the ion peak intensity as the vertical axis and the ion mass as the horizontal axis. The microorganisms present in the sample are identified based on the molecular mass difference before and after the specific probe extension reaction. The software automatically processes and reports the detection results and confidence level for each microorganism.

[0139] Test Example 1: Detection Effect Experiment

[0140] The effectiveness of the method for detecting multidrug-resistant sites in Neisseria gonorrhoeae, as described herein, was evaluated in terms of sensitivity and accuracy. 1. Sensitivity: Three isolates of Neisseria gonorrhoeae were randomly selected and quantified using real-time quantitative polymerase chain reaction (PCR). The isolates were diluted into five gradients (100 copies / μL, 50 copies / μL, 10 copies / μL, 5 copies / μL, and 1 copy / μL) based on the quantitative results for each isolate. All diluted samples were tested using the multidrug resistance site detection method for Neisseria gonorrhoeae disclosed in the present invention. The results showed that the sensitivity of the detection sites of the species identification reference genes porA and opa and 18 was 5 copies / μL, including 16S rRNA C1192U, RpsE T24P, 23S rRNA C2611T, 23S rRNA A2059G, GyrAD95G / A, GyrAS91F, ParC D86N, ParC S88P, PenA G542S, PenA G545S, PenA A501T / V, PenA P551L / S,

[0141] PenA A311V, PenA D345-insertion, PonA L421P, MtrR G45D, MtrR deletion A, PorB G120D (KNR),

[0142] The sensitivity of PorB A121DN(G) locus was 50 copies / μL.

[0143] 2. Accuracy: For the detection of 24 mutations at 19 drug resistance sites by the method for detecting multi-drug resistance sites of Neisseria gonorrhoeae according to the present application, two strains of each mutation type were selected for accuracy testing, which were pre-prepared by whole genome sequencing of the clear drug resistance site mutation isolates.

[0144] The results show that the detection method can accurately detect 24 mutations at 19 drug resistance sites.

[0145] The detection method of the present application can accurately detect related drug resistance site mutations, and has no cross-reaction with other microorganisms.

[0146] The sensitivity is as high as 5 copies / μL (PorB A121DN(G) site sensitivity is 50 copies / μL).

[0147] Test Example 2:

[0148] Compared with other technologies and similar technologies for detecting drug resistance sites of Neisseria gonorrhoeae, the detection method of the present application has the following advantages: first, by using the high-sensitivity MALDI-TOF mass spectrometry method to identify the amplification products, by reasonably selecting and designing the sites and appropriately adding modified bases, the mass of the extension probe can be distinguished and uniformly distributed within the detection range, thereby achieving the purpose of multiple detection, which is much higher than the commonly used fluorescent quantitative PCR method; second, the platform can use 384 chips, such as single-hole reaction for detection, which can simultaneously analyze the drug resistance site information of more than 760 samples in one run, and the total experimental time is not more than 8 hours; finally, researchers can adjust the detection reagents according to the actual situation, which is simple to operate and does not require the assistance of professionals. These advantages of the present application are very suitable for rapid drug resistance site screening of Neisseria gonorrhoeae with complex drug resistance (see Table 5).

[0149] Table 5. Comparison of different detection methods

[0150] SEQUENCE LISTING <110> Institute of Pathogen Biology, Chinese Academy of Medical Sciences <120> A multi-detection method for drug resistance sites of Neisseria gonorrhoeae <130> <160> 4 <210> 1 <211> 33 <212> DNA <213> 16S rRNA-C1192U <400> 1 ACGTTGGATGTGTGAAGCCCTGGTCATAAG <210> 2 <211> 33 <212> DNA <213> 16S rRNA-C1192U <400> 2 ACGTTGGATGTGGGCACTCTAATGAGACTG <210> 3 <211> 33 <212> DNA <213> 16S rRNA-C1192U <400> 3 GGGCCATGAGGACTTGAC <210> 4 <211> 33 <212> DNA <213> rpsE-T24P <400> 1 ACGTTGGATGGATTGAAAAGATGGTCGCAG <210> 5 <211> 33 <212> DNA <213> rpsE-T24P <400> 2 ACGTTGGATGCAACAACAGTTAGCGCAGAG <210> 6 <211> 33 <212> DNA <213> rpsE-T24P <400> 3 AGATGGTCGCAGTTAACCGTGTA <210> 7 <211> 33 <212> DNA <213> 23S rRNA-A2059G <400> 1 ACGTTGGATGTCCCACCTATCCTACACAAG <210> 8 <211> 33 <212> DNA <213> 23S rRNA-A2059G <400> 2 ACGTTGGATGAAGATGCAATCTACCCGCTG <210> 9 <211> 33 <212> DNA <213> 23S rRNA-A2059G <400> 3 AGTAAAGGTTCACGGGGTCT <210> 10 <211> 33 <212> DNA <213> 23S rRNA-C2611T <400> 1 ACGTTGGATGGCTGGGTTTAAAACGTCGTG <210> 11 <211> 33 <212> DNA <213> 23S rRNA-C2611T <400> 2 ACGTTGGATGTCCTCTCGTACTAGGAGCAG <210> 12 <211> 33 <212> DNA <213> 23S rRNA-C2611T <400> 3 TCGTGAGACAGTTTGGTC <210> 13 <211> 33 <212> DNA <213> parC-D86N <400> 1 ACGTTGGATGGTCGGCGAGATTTTGGGTAA <210> 14 <211> 33 <212> DNA <213> parC-D86N <400> 2 ACGTTGGATGGGTAAAATCCTGAGCCATGC <210> 15 <211> 33 <212> DNA <213> parC-D86N <400> 3 ACCATCCGCACGGC <210> 16 <211> 33 <212> DNA <213> parC-S88P <400> 1 ACGTTGGATGGGTAAAATCCTGAGCCATGC <210> 17 <211> 33 <212> DNA <213> parC-S88P <400> 2 ACGTTGGATGGTCGGCGAGATTTTGGGTAA <210> 18 <211> 33 <212> DNA <213> parC-S88P <400> 3 ATCGCCTCATAGGCGG <210> 19 <211> 33 <212> DNA <213> gyrA-D95G / A <400> 1 ACGTTGGATGCGAAATTTTGCGCCATACGG <210> 20 <211> 33 <212> DNA <213> gyrA-D95G / A <400> 2 ACGTTGGATGGCGACGTCATCGGTAAATAC <210> 21 <211> 33 <212> DNA <213> gyrA-D95G / A <400> 3 CATACGGACGATGGTG <210> 22 <211> 33 <212> DNA <213> gyrA-S91F <400> 1 ACGTTGGATGGCGACGTCATCGGTAAATAC <210> 23 <211> 33 <212> DNA <213> gyrA-S91F <400> 2 ACGTTGGATGCGAAATTTTGCGCCATACGG <210> 24 <211> 33 <212> DNA <213> gyrA-S91F <400> 3 ATACCACCCCCACGGCGATT <210> 25 <211> 33 <212> DNA <213> penA-G545S <400> 1 ACGTTGGATGTTTTTTGAAGGGCGGCCCTG <210> 26 <211> 33 <212> DNA <213> penA-G545S <400> 2 ACGTTGGATGGATTGTGGCGGTAACCATTG <210> 27 <211> 33 <212> DNA <213> penA-G545S <400> 3 TGCCACTACACCGC <210> 28 <211> 33 <212> DNA <213> penA-A501T / V <400> 1 ACGTTGGATGTTCGACGTCGGCGCAAAAAC <210> 29 <211> 33 <212> DNA <213> penA-A501T / V <400> 2 ACGTTGGATGAAACGCCCAAGATGTTCAGG <210> 30 <211> 33 <212> DNA <213> penA-A501T / V <400> 3 AGACCGTTAACCAACTTACGC <210> 31 <211> 33 <212> DNA <213> penA-A501T / V <400> 4 TCGGCGCAAAAACCGGTACG <210> 32 <211> 33 <212> DNA <213> penA-G542S <400> 1 ACGTTGGATGTTTTTTGAAGGGCGGCCCTG <210> 33 <211> 33 <212> DNA <213> penA-G542S <400> 2 ACGTTGGATGGATTGTGGCGGTAACCATTG <210> 34 <211> 33 <212> DNA <213> penA-G542S <400> 3 GAGCCGACTGCAAAC <210> 35 <211> 33 <212> DNA <213> penA-P551L / S <400> 1 ACGTTGGATGTTCGACGTCGGCGCAAAAAC <210> 36 <211> 33 <212> DNA <213> penA-P551L / S <400> 2 ACGTTGGATGAAACGCCCAAGATGTTCAGG <210> 37 <211> 33 <212> DNA <213> penA-P551L / S <400> 3 GACATAGGTGTAGTGGCAGGG <210> 38 <211> 33 <212> DNA <213> penA-P551L / S <400> 4 GCCCATAATTTTTTTGAAGGGC <210> 39 <211> 33 <212> DNA <213> penA-A311V <400> 1 ACGTTGGATGAACCGACATGATCGAACCTG <210> 40 <211> 33 <212> DNA <213> penA-A311V <400> 2 ACGTTGGATGGGATCCACTTTGCCTGAATC <210> 41 <211> 33 <212> DNA <213> penA-A311V <400> 3 GTGATCGAACCTGGTTCTG <210> 42 <211> 33 <212> DNA <213> penA-D345ins <400> 1 ACGTTGGATGATAAAATCGGACCGTCTCCC <210> 43 <211> 33 <212> DNA <213> penA-D345ins <400> 2 ACGTTGGATGGCCTTACAAAATCGGTTCGG <210> 44 <211> 33 <212> DNA <213> penA-D345ins <400> 3 ACGTTGGATGACGATTTCTGCATAATGCCG <210> 45 <211> 33 <212> DNA <213> penA-D345ins <400> 4 ACGTTGGATGTTTTGCATAATGCCGCGCAC <210> 46 <211> 33 <212> DNA <213> penA-D345ins <400> 5 ACCGTCTCCCGTGCGCGA <210> 47 <211> 33 <212> DNA <213> penA-D345ins <400> 6 TTCGGCTACCGTACAAGA <210> 48 <211> 33 <212> DNA <213> ponA-L421P <400> 1 ACGTTGGATGTCCGTGTCAAAAACAACGGC <210> 49 <211> 33 <212> DNA <213> ponA-L421P <400> 2 ACGTTGGATGTGCATCCAGCGAAACCAAAG <210> 50 <211> 33 <212> DNA <213> ponA-L421P <400> 3 TCAAGAGCCGTTGC <210> 51 <211> 33 <212> DNA <213> mtrR-G45D <400> 1 ACGTTGGATGATGTCGTCGCAGATACGTTG <210> 52 <211> 33 <212> DNA <213> mtrR-G45D <400> 2 ACGTTGGATGACCTCGCTCAACGAAATCGC <210> 53 <211> 33 <212> DNA <213> mtrR-G45D <400> 3 GCCAATAGAGCGCG <210> 54 <211> 33 <212> DNA <213> mtrR-delA <400> 1 ACGTTGGATGATACATACACGATTGCACGG <210> 55 <211> 33 <212> DNA <213> mtrR-delA <400> 2 ACGTTGGATGTTTCGTTTCGGGTCGGTTTG <210> 56 <211> 33 <212> DNA <213> mtrR-delA <400> 3 CACGATTGCACGGATAAAA <210> 57 <211> 33 <212> DNA <213> porB-A121DN / (G) <400> 1 ACGTTGGATGCCGGTAAATTTGCCGGATTC <210> 58 <211> 33 <212> DNA <213> porB-A121DN / (G) <400> 2 ACGTTGGATGCCTGAACAGCCCCCTGAAAA <210> 59 <211> 33 <212> DNA <213> porB-A121DN / (G) <400> 3 CCGGATTCCCAAGCATTGACGTTG <210> 60 <211> 33 <212> DNA <213> porB-G120D / (KNR) <400> 2 ACGTTGGATGCCTGAACAGCCCCCTGAAAA <210> 61 <211> 33 <212> DNA <213> porB-G120D / (KNR) <400> 2 ACGTTGGATGCCGGTAAATTTGCCGGATTC <210> 62 <211> 33 <212> DNA <213> porB-G120D / (KNR)1 <400> 2 CAGCCCCCTGAAAAACACCG <210> 63 <211> 33 <212> DNA <213> opa <400> 1 ACGTTGGATGTCAGCGTAGCCGTCGTTATC <210> 64 <211> 33 <212> DNA <213> opa <400> 2 ACGTTGGATGCACGCATTTTGACGGCAAAG <210> 65 <211> 33 <212> DNA <213> opa <400> 3 GGGCGGAGCAAATCAAAGGC <210> 66 <212> DNA <213> porA <400> 1 ACGTTGGATGGACAATACGAGGGCGGTAAG <210> 67 <211> 33 <212> DNA <213> porA <400> 2 ACGTTGGATGGTTTGCCCGATGTTTTTAGC <210> 68 <211> 33 <212> DNA <213> porA <400> 3 GTAAGTTTTTTTCGCATATCGGCTTC

Claims

1. A method for multiplex detection of drug resistance sites in Neisseria gonorrhoeae, which is used for non-diagnostic purposes, characterized in that: The following steps are involved: 1) Primer design: For each drug resistance site to be detected, first download the 9 drug resistance gene sequences of the representative strains of Neisseria gonorrhoeae that have been fully annotated as reference sequences from the GenBank database, including rPsE 、 penA 、 gyrA 、 parC 、 ponA 、 porB 、 mtrR 、 16S rRNA and 23S rRNA , submit the reference sequence to NCBI for nucleic acid sequence BLAST, select the nr database, download the alignment results, obtain 19 target gene sequences for detecting the drug resistance site mutations of Neisseria gonorrhoeae, and design specific amplification primers for the drug resistance site to be tested in each target gene; 2) Multiplex PCR amplification reaction: UNG enzyme, dNuTPs mixture, DNA polymerase, and multiplex PCR primers are added to the PCR reaction system and mixed. UNG enzyme is first used to digest dUTP to degrade the PCR amplification products. The UNG enzyme is then inactivated, pre-denatured, and then PCR amplification is performed to obtain the target gene amplification products in the sample to be tested. 3) Shrimp alkaline phosphatase reaction: After the multiplex PCR reaction is completed, SAP mixture is added to remove the remaining dNuTPs in the reaction system through SAP digestion to prevent excess substrate from affecting the results of the next single-base extension reaction; 4) Single-base extension reaction: An extension probe designed for the drug-resistant site is added and bound to the amplified target gene for a single-base extension reaction. The substrate is a modified dideoxynucleoside triphosphate, which allows the extension probe to extend one base at a specific single nucleotide site before terminating the reaction. 5) Resin desalting: using cation exchange resin to adsorb salt ions in the system and purify the extension reaction products; 6) Mass spectrometry: The purified product is spotted onto a chip using a fully automated spotting device for molecular weight determination. The genotype of the drug-resistant locus on the target gene to be tested is determined based on the molecular weight difference. Among them, in step (1), in order to avoid the mass of the amplification primer appearing in the result window, a universal sequence of 10 bases ACGTTGGATG must be added to the 5' end of each amplification primer to increase the mass, and a single base extension probe is designed in the area where the drug resistance site is located in the amplification region. After the probe binds to the target gene, only one designed base is allowed to extend at the 3' end as the genotype-specific sequence marker. Among them, 19 drug-resistant site mutations include: 1) 16S rRNA C1192U 2) rpsE T24P 3) 23S rRNA C2611T 4) 23S rRNA A2059G 5) gyrA D95G / A 6) gyrA S91F 7) parC D86N 8) parC S88P 9) penA G542S 10) penA G545S 11) penA A501T / V 12) penA P551S / L 13) penA A311V 14) penA D345-insertion 15) ponA L421P 16) mtrR -G45D 17) mtrR -deletion A 18) porB -A121DN(G) 19) porB G120D(KNR); The amplification primers and extension probe sequences of the 19 drug-resistant sites are shown in Table 1.

2. The detection method according to claim 1, wherein by opa The gene was used as a reference for sample species identification. The primer sequences were SEQ ID NO.63 and SEQ ID NO.64, and the extended probe sequence was SEQ ID NO.

65.

3. The detection method according to claim 1, wherein by porA The gene was used as a reference for sample species identification. The primer sequences were SEQ ID NO.66 and SEQ ID NO.67, and the extended probe sequence was SEQ ID NO.

68.

4. The detection method according to claim 1, wherein in, Add a negative control to the reaction from step (2) to step (4), wherein the negative control is nuclease-free distilled water; The PCR reaction system of step (2) is shown in Table 2-1, and the reaction process is shown in Table 2-2; The shrimp alkaline phosphatase reaction system in step (3) is shown in Table 3-1, and the reaction process is shown in Table 3-2; The base extension reaction system of step (4) is shown in Table 4-1, and the reaction process is shown in Table 4-2; Among them, step (6) mass spectrometry detection: after the product is purified, it is transferred to the chip using dedicated equipment and co-crystallized with the chip matrix. The crystallized chip is placed in the vacuum tube of the mass spectrometer. The chip is subjected to instantaneous strong laser excitation in the vacuum tube of the matrix-assisted laser desorption ionization time-of-flight mass spectrometry system, causing the nucleic acid molecules to desorb and generate single-charged ions. These ions fly in the vacuum tube to reach the detector. The ion mass is proportional to the flight time. The detectable molecular mass number depends on the flight tube length. The detection results will be presented to the server in a visual graphic, that is, the intensity of the ion peak is the vertical coordinate and the ion mass is the horizontal coordinate to form an analysis map. The base extended at the specific drug-resistant site in the sample is judged based on the difference in molecular mass before and after the specific probe extension reaction to determine whether there is a mutation. The software automatically processes and reports the detection results and credibility of each drug-resistant site.

5. A kit, characterized in that The kit includes the following primer sets: forward and reverse amplification primer sequences for detecting target genes and corresponding extension probe sequences SEQ ID NO.1 to SEQ ID NO.62; opa The amplification primers for the gene for identification of Neisseria gonorrhoeae species are SEQ ID NO.63 and SEQ ID NO.64, and the extension probe sequence is SEQ ID NO.65; porA The amplification primer sequences for the gene, which is the target for identification of Neisseria gonorrhoeae species, are SEQ ID NO.66 and SEQ ID NO.67, and the extension probe sequence is SEQ ID NO.68.

Images