Stable genome editing complex with few side effects and nucleic acid encoding the complex

Abstract

The present invention provides a complex, which is a complex obtained by combining a nucleic acid sequence recognition module with a protein degradation tag, wherein the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in a double-stranded DNA, and the protein degradation tag is composed of (i) a peptide containing three residues of a hydrophobic amino acid at the C-terminus or (ii) a peptide containing three residues of an amino acid in which at least a part of the amino acid residues is substituted with serine at the C-terminus.

Description

Technical Field

[0001] The present invention relates to a genome editing complex that is stable and has few side effects, a nucleic acid encoding the complex, and a genome editing method using the complex. Background Art

[0002] Such genome editing that can suppress the influence on the expression of downstream genes in the same operon to a minimum without the integration of the selection marker gene is particularly advantageous in prokaryotes. RecET and λ-Red recombinases derived from bacteriophages are used as recombination techniques to facilitate integration / replacement of homology dependent on donor DNA or oligonucleotides (e.g., non-patent document 1). By combining with strains lacking methyl-directed mismatch repair (MMR), efficient recombination can be achieved without the integration of selection markers (non-patent document 2), and genetic polymorphisms in multiple target loci can be generated within a few days, so it is applied in multiple automated genome engineering methods (MAGE). However, the above-mentioned recombination techniques rely on host-dependent factors such as the defect of MMR or RecA, which is a central component of the recombinant DNA repair system, which can harm most of the Escherichia coli used as hosts for cloning, and therefore cannot be easily transferred to bacterial species with different backgrounds (non-patent document 3).

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins are known to function as an adaptive immune system of bacteria by cleaving target DNA in a manner that is dependent on a single guide RNA (sgRNA) and a protospacer adjacent motif (PAM). The Cas9 nuclease derived from Streptococcus pyogenes is widely used as a powerful genome editing tool in eukaryotic organisms with a repair pathway for double-stranded DNA scissions (DSBs) (e.g., non-patent literature 4, 5). In DSB repair by the non-homologous end joining (NHEJ) pathway, small insertions and / or deletions (indels: insertions / deletions) are introduced into the target DNA to produce site-specific mutations or gene disruptions. Although the efficiency depends on the host cell, for more accurate editing, homologous recombination repair (HDR) can be promoted by providing donor DNA containing homology arms for the target region.

[0004] However, since the current genome editing technology depends on the host's DNA repair system, its application in prokaryotes needs further study. In most bacteria, due to the lack of NHEJ pathway, cell death occurs by DNA cleavage using artificial nucleases (non-patent literature 6, 7). Therefore, CRISPR / Cas9 is only used as a counter-selector (counter-selector) for cells whose genes have been modified by other methods such as the λ-Red recombination system (e.g., non-patent literature 8, 9).

[0005] Recently, targeted base editing mediated by deaminase has been confirmed, which directly edits nucleotides through the target locus without using donor DNA containing homologous arms for the target region (e.g., Patent Document 1, Non-Patent Documents 10-12). This technology uses DNA deamination instead of nuclease-mediated DNA cleavage, so it does not induce bacterial cell death and can be applied to bacterial genome editing, but its mutation efficiency, especially the efficiency of editing multiple sites at the same time, is not sufficient.

[0006] Prior art literature

[0007] Patent Documents Patent Document 1: International Publication No. 2015 / 133554;

[0008] Non-patent literature

[0009] Non-patent document 1: Datsenko, KA & Wanner, BL, Proc. Natl. Acad. Sci. USA 97, 6640-5 (2000);

[0010] Non-patent document 2: Costantino, N. & Court, DL, Proc. Natl. Acad. Sci. USA 100, 15748-53 (2003);

[0011] Non-patent document 3: Wang, J. et al., Mol. Biotechnol. 32, 43-53 (2006);

[0012] Non-patent document 4: Mali, P et al., Science 339, 823-827 (2013);

[0013] Non-patent document 5: Cong, L et al., Science 339, 819-823 (2013);

[0014] Non-patent document 6: Bowater, R. & Doherty, AJ, PLoS Genet. 2, 93-99 (2006);

[0015] Non-patent document 7: Cui, L. & Bikard, D., Nucleic Acids Res. 44, 4243-4251 (2016);

[0016] Non-patent document 8: Jiang, W et al., Nat Biotechnol 31, 233-239 (2013);

[0017] Non-patent document 9: Li, Y et al., Metab. Eng. 31, 1-9 (2015);

[0018] Non-patent document 10: Komor, AC et al., Nature 61, 5985-91 (2016);

[0019] Non-patent document 11: Nishida, K et al., Science 102, 553-563 (2016);

[0020] Non-patent document 12: Ma, Y ​​et al., Nat. Methods 1-9 (2016). doi: 10.1038 / nmeth.4027. Summary of the invention

[0021] Problems to be solved by the invention

[0022] The toxicity of the genome editing complex expressed by the vector and acting on the host's genomic DNA is high, so it is a heavy burden on the host, especially bacteria, and may cause the vector to become unstable in the host. In genome editing, side effects such as non-specific mutations or off-target mutations may occur, especially when the mutation efficiency is improved by using uracil DNA glycosylase inhibitors (UGI), etc., as a price, strong toxicity is produced to the host, causing cell death or an increase in non-specific mutation rate. Therefore, the subject of the present invention is to provide a nucleic acid such as a low-toxic vector that can be stably amplified even in the host and a genome editing complex encoded by the nucleic acid; and to provide a method for genome editing, which uses the vector and, if necessary, a nucleic acid modification enzyme, is independent of host-dependent factors such as RecA, can be applied to a wide range of bacteria, and can modify the DNA of bacteria while suppressing non-specific mutations.

[0023] Means for solving problems

[0024] The inventors of the present invention have come up with the following idea: by suppressing the amount of genome editing complexes in bacteria that are highly toxic to the host bacteria, the vectors in the bacteria can be stabilized, and perhaps non-specific mutations in bacterial DNA can be reduced. Therefore, in order to suppress the amount of genome editing complexes present, the LVA tag, a protein degradation tag known to promote protein degradation and shorten the half-life in bacteria, was studied. The results confirmed that by adding the protein degradation tag to the genome editing complex, non-specific mutations can be reduced while maintaining the mutation efficiency of the target site. In addition, even in the case of combining UGI, non-specific mutations can be reduced, and the target sequence can be modified with high efficiency ( Fig. 9 , Fig.10 ). The present inventors have further conducted studies based on these findings and have completed the present invention.

[0025] That is, the contents of the present invention are as follows.

[0026] [1] A complex comprising a nucleic acid sequence recognition module and a protein degradation tag, wherein the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in a double-stranded DNA, and the protein degradation tag is composed of (i) a peptide comprising three residues of a hydrophobic amino acid at the C-terminus or (ii) a peptide comprising three residues of an amino acid in which at least a portion of the amino acid residues are substituted with serine at the C-terminus.

[0027] [2] The complex described in [1], wherein the complex is a complex further bound to a nucleic acid modifying enzyme, wherein one or more nucleotides at the target site are converted to or deleted from other one or more nucleotides, or one or more nucleotides are inserted into the target site.

[0028] [3] The complex described in [1] or [2], wherein the three amino acid residues are leucine-valine-alanine, leucine-alanine-alanine, alanine-alanine-valine or alanine-serine-valine.

[0029] [4] The complex according to any one of [1] to [3], wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of Cas or both of the DNA cleavage abilities are inactivated.

[0030] [5] The complex according to any one of [1] to [3], wherein the complex is a complex in which the CRISPR-Cas system is bound to a protein degradation tag.

[0031] [6] The complex according to any one of [2] to [4], wherein the nucleic acid modifying enzyme is a nucleobase transferase or a DNA glycosylase.

[0032] [7] The complex described in [6], wherein the nucleic acid base transfer enzyme is a deaminase.

[0033] [8] The complex described in [6] or [7], further comprising a base excision repair inhibitor.

[0034] [9] A nucleic acid encoding the complex according to any one of [1] to [8].

[0035]

[10] A method for modifying a target site of bacterial double-stranded DNA, or regulating the expression of a gene encoded by the double-stranded DNA near the site, the method comprising the following steps: contacting the double-stranded DNA with a complex obtained by binding a nucleic acid sequence recognition module to a protein degradation tag, wherein the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in the selected double-stranded DNA, and the protein degradation tag is composed of (i) a peptide containing three residues of a hydrophobic amino acid at the C-terminus or (ii) a peptide containing three residues of an amino acid in which at least a part of the amino acid residues is substituted with serine at the C-terminus.

[0036]

[11]

[10] The method described in claim 1, wherein the complex is a complex further bound to a nucleic acid modifying enzyme, the method comprising the following steps: converting one or more nucleotides at the target site into one or more other nucleotides or deleting them, or inserting one or more nucleotides into the target site.

[0037]

[12] The method of

[10] or

[11] , wherein the three amino acid residues are leucine-valine-alanine, leucine-alanine-alanine, alanine-alanine-valine or alanine-serine-valine.

[0038]

[13] The method according to any one of

[10] to

[12] , wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of Cas or both of the DNA cleavage abilities are inactivated.

[0039]

[14] The method according to any one of

[10] to

[12] , wherein the complex is a complex formed by combining a CRISPR-Cas system with a protein degradation tag.

[0040]

[15] The method according to any one of

[10] to

[14] , characterized in that two or more nucleic acid sequence recognition modules that specifically bind to different target nucleotide sequences are used.

[0041]

[16] The method described in

[15] , wherein the different target nucleotide sequences are present in different genes.

[0042]

[17] The method according to any one of

[10] to

[13] ,

[15] and

[16] , wherein the nucleic acid modifying enzyme is a nucleobase transferase or a DNA glycosylase.

[0043]

[18] The method described in

[17] , wherein the above-mentioned nucleic acid base transfer enzyme is a deaminase.

[0044]

[19] The method according to

[17] or

[18] , wherein the complex is further bound to a base excision repair inhibitor.

[0045]

[20] The method according to any one of

[10] to

[19] , wherein the contacting of the double-stranded DNA with the complex is performed by introducing a nucleic acid encoding the complex into a bacterium having the double-stranded DNA.

[0046] Effects of the Invention

[0047] According to the present invention, a low-toxic nucleic acid (e.g., a vector) that can be stably amplified even in a host bacterium and a genome editing complex encoded by the nucleic acid are provided. According to the genome editing method using the nucleic acid and nucleic acid modifying enzyme of the present invention, the gene of the host bacterium can be modified while suppressing nonspecific mutations, or the expression of the gene encoded by the double-stranded DNA can be regulated. This method is applicable to a wide range of bacteria because it does not rely on host-dependent factors such as RecA. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] [ Figure 1 ] Figure 1 Figure 1 shows an overview of the target-AID system in bacteria. (a) shows a schematic model of target-AID (dCas9-PmCDA1 / sgRNA) base editing. The dCas9-PmCDA1 / sgRNA complex binds to double-stranded DNA and forms an R-loop in a sgRNA and PAM-dependent manner. PmCDA1 catalyzes the deamination of cytosine on the upper (non-complementary) strand within 15-20 bases upstream of the PAM, resulting in mutagenesis from C to T. (b) shows a single target-AID plasmid in bacteria. The plasmid includes chloramphenicol resistance (Cm R ) gene, temperature-sensitive (ts) λcI repressor, pSC101 replication origin (ori), and RepA101 (ts). The λ operator expresses the dCas9-PmCDA1 fusion at high temperatures (>37°C) along with inactivation of the cI repressor (ts). The sgRNA is expressed from the constitutive promoter J23119. dCas9 shows a nuclease-deficient Cas9 with the D10A H840A mutation, and PmCDA1 shows a P. marinus (sea lamprey) cytosine deaminase.

[0049] [ Figure 2] Figure 2 The transformation efficiency of Cas9 and target AID vectors in Escherichia coli is shown. The E. coli DH5α strain was transformed using a plasmid expressing sgRNA targeting the galK gene and each modification protein (Cas9, dCas, Cas9-CDA, nCas-CDA or dCas-CDA) and selected by a chloramphenicol resistance marker. The surviving cells were counted and calculated as colony forming units (CFU) per unit amount of the transformed plasmid DNA. The points represent 3 independent experiments, and the boxes represent the 95% confidence interval of the geometric mean obtained by t-test analysis.

[0050] [ Figure 3 ] Figure 3 Shows mutations induced by dCas-CDA at specific sites in the galK9 gene. DH5α cells expressing both sgRNA targeting galK_9 and dCas-CDA were spot-seeded on LB agar plates to isolate single colonies. Eight randomly selected clones were sequenced and aligned. The translated amino acid sequence is shown at the bottom of each nucleotide sequence. The frequency of each sequence is shown as the number of clones. The box and inverted box show the target sequence and PAM sequence, respectively. ORF numbering is shown at the top. Mutated sites are emphasized with black shading and mutated bases are emphasized with bold. Mutated codons are underlined.

[0051] [ Figure 4 ] Figure 4 The mutation frequencies evaluated according to drug resistance are shown. (a) The frequencies of galK mutagenesis and 2-DOG resistance are shown. DH5α cells simultaneously expressing non-targeting sgRNA (vector) or ssRNA targeting galK_9 and dCas-CDA were serially diluted, spot-inoculated on agar plates containing or not containing 2-DOG in M63 medium, and the colonies were counted. (b) The frequencies of rpoB mutagenesis and rifampicin resistance are shown. Cells simultaneously expressing non-targeting sgRNA (vector) or ssRNA targeting rpoB_1 and dCas-CDA were serially diluted, spot-inoculated on LB agar plates containing or not containing rifampicin, and the colonies were counted. The frequency of drug resistance is calculated as the number of resistant colonies relative to the number of unselected colonies. The dots represent 4 independent experiments, and the boxes show the 95% confidence interval of the geometric mean obtained by t-test analysis.

[0052] [ Figure 5 ] Figure 5Gain-of-function mutagenesis of the rpoB gene is shown. (a) Sequence alignment showing rpoB mutations induced by dCas-CDA. DH5α cells expressing both sgRNA targeting rpoB_1 and dCas-CDA were spotted on LB agar plates to isolate single colonies. Eight randomly selected clones were sequenced and sequenced. The translated amino acid sequence is shown at the bottom of each nucleotide sequence. The frequency of each sequence is shown as the number of clones. Boxes and inverted boxes show the target sequence and PAM sequence. ORF numbers are shown at the top. Mutated sites are emphasized with black shading, and mutated bases and amino acids are emphasized with bold. Mutated codons are underlined. (b) The results of whole genome sequence analysis of cells mutagenized with rpoB as the target are shown. Whole genome sequencing was performed on three independent clones selected by rifampicin. Sequence coverage is calculated as the total base pairs of the sequence mapped to the 4,631 Mbp genome sequence of E. coli BW25113. Parental / variable mutations are shown as the number of mutants obtained by subtracting common parental mutations from mutants detected at a frequency of more than 50%, including insertions, deletions, single nucleotide variants (SNVs) and multiple nucleotide variants (MNVs). The detected mutations show the number of mutations (count), genomic loci (regions / genes), reference genomic sequences (references) and mutant alleles (alleles). Variant calling is performed as described in the examples. (c) Shows the sequence surrounding the detected mutation listed in (b). Mutated sites are emphasized with gray shading, and mutated bases and amino acids are emphasized with bold.

[0053] [ Figure 6 ] Figure 6 The presence or absence of UGI-LVA and the mutation sites and frequencies when sgRNAs of different lengths are used are shown. Target sequences longer than 20 nt (galK_8, 9, 11, and 13) were tested using dCas-CDA (white bars on the left) or dCas-CDA-UGI-LVA (black bars on the right) and analyzed by deep sequencing. The averages of three independent experiments are plotted. The gray shading and inverted boxes show the galK target sequence and PAM, respectively. The mutated bases are underlined.

[0054] [ Figure 7 ] Figure 7The effect of target sequence characteristics on the position and frequency of mutations induced by target-AID is shown. Cells expressing dCas-CDA and each targeting sgRNA were analyzed by deep sequencing. The target sequence (length 20nt or as shown) is the upper (+) or lower (-) DNA chain of the galK ORF, and missense (M) or nonsense (N) mutations are introduced as expected. The corresponding ORF number (position) is shown. The mutation frequency of the base position of the peak was obtained as the average of 3 independent experiments (emphasized in gray shading in the sequence). Base positions with mutation frequencies >50%, 10-50% or <10% are distinguished according to the depth of gray.

[0055] [ Figure 8 ] Figure 8 Figure 2 shows the effect of target length on the mutational spectrum. (a) Shows the mutation frequency of target sequences of various lengths in gsiA. The target sequence containing PolyC at a distal site was edited by dCas-CDA-UGI-LVA and analyzed by deep sequencing. The mutation spectrum of sgRNAs with a length of 18nt, 20nt, 22nt, or 24nt is distinguished by the shades of gray. The average of 3 independent experiments is shown. The inverted box shows the PAM. The mutated bases are underlined. (b) Shows the mutation frequency of targets in ycbF and yfiH. The target is set on the lower chain. The mutation spectrum of sgRNAs with a length of 18nt, 20nt, or 22nt is shown in the same way as (a). (c) Shows the averaged mutation spectrum for each sgRNA length for (a) and (b). Peak positions are numbered.

[0056] [ Fig. 9 ] Fig. 9Showing multiple mutagenesis in the galK gene. (a) Showing the non-specific mutagenesis effect evaluated according to rifampicin resistance. Cells expressing each protein (vector, dCas, dCas-CDA, dCas-CDA-LVA, or dCas-CDA1-UGI-LVA) and the tandem-sgRNA unit targeting the target galK_10-galK_11-galK_13 were co-spotted on LB agar plates with or without rifampicin, and the frequency of non-specific mutations was evaluated. The dots represent at least 3 independent experiments, and the boxes show the 95% confidence intervals of the geometric mean obtained by t-test analysis. (b) Showing the frequency of multiple mutations in the target induced in the target region. Eight clones randomly selected from (a) were sequenced for 3 loci as the target, showing the frequencies of single, double, or triple mutant clones. (c and d) Showing the sequence alignment of mutants. A single target (galK_10, galK_11, or galK_13) (c) or triple target (d) was mutated using dCas-CDA-UGI-LVA. Eight randomly selected clones were sequenced for sequence alignment. The boxes and inverted boxes show the target sequence and PAM sequence, respectively. The mutated sites are emphasized with black shading and bold letters.

[0057] Fig.10 Fig.10 Showing multiple mutagenesis. (a) Showing a schematic diagram of 2 plasmids for multiple mutagenesis (a modified vector expressing dCas-CDA-UGI-LVA and plasmid pSBP80608 containing 2 tandem repeat sgRNA-units each containing 3 targeting sgRNAs). (b) Showing the sequence alignment of the target region. Eight randomly selected clones were sequenced and aligned in each target region. The clone numbers are shown on the left side of the sequence. The boxes and inverted boxes show the target sequence and PAM. The mutated sites and bases are emphasized with black shading and bold letters.

[0058] Fig.11 Fig.11 Showing simultaneous disruption of multiple copies of the transposase gene. Using dCas-CDA-UGI-LVA to simultaneously target IS1, 2, 3, and 5. The sgRNAs were designed to introduce stop codons into the common sequences of the same type of transposase. Alignment was performed for all sequences except those that could not be amplified from the DH10B reference genome. The translated amino acid sequences are shown above each common sequence. The genomic regions of each sequence are shown on the left. All target sequences were designed on the complementary strand, and the corresponding regions were aligned (matched) with the complementary PAM sequences (inverted). The mutated bases are emphasized with black shading.

[0059] Fig.12 Fig.12 ​​​​​​The method of isolating and confirming cells edited by IS is shown. The isolation of clones and confirmation of sequences are carried out in stages. The isolated clones are numbered and displayed in the top row of each table, and sequence analysis is performed at the IS site shown in the left column. The genotype is determined based on the Sanger sequence map to be confirmed as the target mutation (mut), no mutation (wt), or a heterogeneous genotype of mut and wt (hetero).

[0060] [ Fig.13 ] Fig.13 A schematic diagram showing the yeast expression vector (background: pRS315 vector) used in Example 5. In the figure, Gal1p shows the GAL1-10 promoter. DETAILED DESCRIPTION

[0061] 1. Complex for genome editing and nucleic acid encoding the complex

[0062] The present invention provides a genome editing complex and a nucleic acid encoding the complex, wherein the complex is obtained by combining a nucleic acid sequence recognition module with a protein degradation tag, and the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in double-stranded DNA. In one embodiment of the genome editing complex of the present invention, a complex of a nucleic acid that can modify a target site is provided, which is a complex further combined with a nucleic acid modification enzyme (i.e., a nucleic acid sequence recognition module, a nucleic acid modification enzyme, and a protein degradation tag). In one embodiment, in order to improve the modification efficiency of double-stranded DNA, the complex can be further combined with a base excision repair inhibitor. In addition, in another embodiment of the genome editing complex of the present invention, a complex that can regulate the expression of a gene encoded by double-stranded DNA near the target site is provided, and the complex is at least combined with a nucleic acid sequence recognition module and a protein degradation tag. In one embodiment, the complex can be further combined with a transcriptional regulatory factor. Hereinafter, a complex that is combined with at least any one of a nucleic acid modification enzyme, a base excision repair inhibitor, and a transcriptional regulatory factor and a complex that is not combined with any one are sometimes collectively referred to as "the complex of the present invention" or "the genome editing complex", and a complex that is combined with a nucleic acid modification enzyme is sometimes particularly referred to as a "nucleic acid modification enzyme complex". In addition, nucleic acids encoding these complexes may be collectively referred to as "nucleic acids of the present invention".

[0063] In the case of introducing the nucleic acid of the present invention into a host bacterium (e.g., Escherichia coli) for the purpose of replication without modifying DNA for the purpose of culturing, when the complex is expressed by the nucleic acid unplanned, the complex will also be rapidly degraded by the protein degradation tag, so the toxicity to the host bacterium can be suppressed at a low level. In fact, in the case of introducing the nucleic acid of the present invention into a host bacterium for the purpose of replication of the nucleic acid, compared with the case of importing a nucleic acid that does not contain a protein degradation tag, the transformation efficiency of the host bacterium is shown in the following embodiments. Therefore, the nucleic acid of the present invention comprising a sequence encoding a protein degradation tag can be stably replicated in bacteria as a nucleic acid for genome editing of hosts other than bacteria (e.g., eukaryotes). Therefore, it is also useful to add a sequence encoding a protein degradation tag of the present invention on a vector for the purpose of genome editing in a host other than bacteria.

[0064] In the present invention, the "modification" of double-stranded DNA refers to a nucleotide (such as dC) on the DNA chain being converted into other nucleotides (such as dT, dA or dG), or a deletion, or a nucleotide or nucleotide sequence is inserted between a nucleotide on the DNA chain. Here, the modified double-stranded DNA is not particularly limited as long as it is a double-stranded DNA present in the host cell, and is preferably genomic DNA. In addition, the "target site" of double-stranded DNA refers to all or part of the "target nucleotide sequence" specifically recognized and bound by the nucleic acid sequence recognition module, or the vicinity of the target nucleotide sequence (either or both of the 5' upstream and 3' downstream). In addition, "target nucleotide sequence" refers to the sequence bound by the nucleic acid sequence recognition module in double-stranded DNA. In the present invention, the term "genome editing" is used in the sense of not only modifying double-stranded DNA, but also promoting or inhibiting the expression of genes encoded by double-stranded DNA near the targeting site.

[0065] In the present invention, "nucleic acid sequence recognition module" refers to a molecule or molecular complex that has the ability to specifically recognize and bind to a specific nucleotide sequence (i.e., target nucleotide sequence) on a DNA chain. In the case of using a nucleic acid modification enzyme complex, the nucleic acid modification enzyme and / or base excision repair inhibitor connected to the module can specifically act on the target site of the double-stranded DNA by binding to the target nucleotide sequence through the nucleic acid sequence recognition module.

[0066] In the present invention, "nucleic acid modification enzyme" refers to an enzyme that modifies DNA directly or indirectly by modifying nucleic acid, and can be a peptide fragment thereof as long as it has catalytic activity. As such a modification reaction of DNA, it can be listed as follows: a reaction of cutting a DNA chain catalyzed by a nucleic acid degrading enzyme (hereinafter also referred to as "DNA chain cutting reaction"); or a reaction catalyzed by a nucleic acid base transferase that is not directly accompanied by the cutting of a DNA chain, that is, a reaction in which a substituent on a purine or pyrimidine ring of a nucleic acid base is converted into another group or atom (hereinafter also referred to as "nucleic acid base conversion reaction") (e.g., a deamination reaction of a base); a reaction of hydrolyzing an N-glycosidic bond of DNA catalyzed by a DNA glycosylase (hereinafter also referred to as "absorptive reaction"), etc. As shown in the following examples, by adding a protein degradation tag to a nucleic acid modification enzyme complex containing a nucleic acid base transferase, the toxicity of the complex to host bacteria can be reduced. Therefore, even in genome editing using not only a nucleic acid base transferase but also a nucleic acid degrading enzyme that was previously difficult to apply to bacteria due to its strong toxicity, the technology of the present invention can be applied. Therefore, examples of nucleic acid modifying enzymes used in the present invention include nucleic acid degrading enzymes, nucleic acid base transferases, DNA glycosylases, etc. From the perspective of reducing cytotoxicity, nucleic acid base transferases and DNA glycosylases are preferred, and by using these enzymes, the targeted site can be modified without cutting at least one strand of the double-stranded DNA at the targeted site.

[0067] In the present invention, "protein degradation tag" refers to a peptide mainly composed of more than 3 residues of hydrophobic amino acids, which is added to the genome editing complex, and the half-life of the protein is shortened compared to the complex to which it is not added. As such amino acids, glycine, alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tryptophan can be listed. The protein degradation tag of the present invention only needs to contain 3 residues of any of these amino acids at the C-terminus, and there is no particular limitation on the composition other than that, and it can be a peptide composed of 3 residues of the amino acid. Peptides in which part or all of the above-mentioned hydrophobic amino acid residues are substituted by serine or threonine are also included in the protein degradation tag of the present invention. As the three residues of the above-mentioned amino acids, there are no particular limitations, and examples thereof include leucine-valine-alanine (LVA), leucine-alanine-alanine (LAA), alanine-alanine-valine (AAV), etc., which have been confirmed to have high effects in Escherichia coli and Pseudomonas putida (Andersen J.B. et al., Apll. Environ. Microbiol., 64: 2240-2246 (1998)), and three residues of amino acids containing serine include alanine-serine-valine (ASV), etc. In addition, the protein degradation tag containing three residues of these amino acids can be referred to the database of tm RNA tag peptides (e.g., tmRDB, http: / / www.ag.auburn.edu / mirror / tmRDB / peptide / peptide phylolist.html), etc.Specifically, YAASV (SEQ ID NO: 324), YALAA (SEQ ID NO: 325), ANDENYALAA (SEQ ID NO: 181) and AANDENYALAA (SEQ ID NO: 182) are known as tmRNA tag peptides for Escherichia coli; GKQNNLSLAA (SEQ ID NO: 183), GKSNNNFALAA (SEQ ID NO: 184), GKENNNFALAA (SEQ ID NO: 185), GKTNSFNQNVALAA (SEQ ID NO: 186), GKSNQNLALAA (SEQ ID NO: 187) and GKQNYALAA (SEQ ID NO: 188) are known as tmRNA tag peptides for Bacillus; ANDDNYALAA (SEQ ID NO: 189), ANDDQYGAALAA (SEQ ID NO: 190), ANDENYGQEFALAA (SEQ ID NO: 191) are known as tmRNA tag peptides for Pseudomonas. : The present invention relates to tmRNA tag peptides of Streptococcus bacteria, such as ANDETYGDYALAA (SEQ ID NO: 191), ANDETYGDYALAA (SEQ ID NO: 192), ANDETYGEYALAA (SEQ ID NO: 193), ANDETYGEETYALAA (SEQ ID NO: 194), ANDENYGAEYKLAA (SEQ ID NO: 195) and ANDENYGAQLAA (SEQ ID NO: 196); AKNTNSYALAA (SEQ ID NO: 197), AKNTNSYAVAA (SEQ ID NO: 198), AKNNTTYALAA (SEQ ID NO: 199), AKNTNTYALAA (SEQ ID NO: 200) and AKNNTSYALAA (SEQ ID NO: 201), etc., but are not limited to these. Regarding protein degradation tags, representative ones are composed of 3 to 15 amino acid residues, but are not limited to this range. In one embodiment, the protein degradation tag is composed of 3 to 5 amino acid residues. Those skilled in the art can select appropriate protein degradation tags according to the type of host bacteria, etc. In the present specification, unless otherwise specified, capital letters of the alphabet indicate single-letter symbols of amino acids, and amino acid sequences are described from left to right and from the N-terminus to the C-terminus.

[0068] In the present invention, "complex for genome editing" refers to a molecular complex comprising a complex obtained by connecting the above-mentioned nucleic acid sequence recognition module and a protein degradation tag, having a nucleic acid modification activity or expression regulation activity that is endowed with a specific nucleotide sequence recognition ability, and "nucleic acid modification enzyme complex" refers to a molecular complex comprising a complex obtained by connecting the above-mentioned nucleic acid sequence recognition module, a nucleic acid modification enzyme and a protein degradation tag, having a nucleic acid modification activity that is endowed with a specific nucleotide sequence recognition ability. The complex may be further connected to a base excision repair inhibitor. Here, the "complex" not only includes a complex composed of multiple molecules, but also includes a complex having molecules constituting the above-mentioned complex of the present invention in a single molecule, such as a fusion protein. Moreover, a complex in which a protein degradation tag is combined with a molecule or molecular complex in which a nucleic acid sequence recognition module and a nucleic acid modification enzyme form a whole and function, as in the case of restriction enzymes or CRISPR / Cas systems, is also included in the complex of the present invention. In addition, "encoding complex" includes the following two situations: encoding each molecule constituting the complex, and encoding a fusion protein having a constituent molecule in a single molecule.

[0069] The nucleic acid degrading enzyme used in the present invention is not particularly limited as long as it is an enzyme that can catalyze the above-mentioned reaction, and examples thereof include: nucleases (e.g., Cas effector proteins (e.g., Cas9, Cpf1), endonucleases (e.g., restriction enzymes), exonucleases, etc.), recombinases, DNA gyrase, DNA topoisomerase, transposase, etc.

[0070] As the nucleic acid base transfer enzyme used in the present invention, it is not particularly limited as long as it is an enzyme that can catalyze the above reaction, and for example, it can be listed as a deaminase belonging to the nucleic acid / nucleotide deaminase superfamily that catalyzes the deamination reaction of converting an amino group into a carbonyl group. Preferably, it is listed as a cytidine deaminase that can convert cytosine or 5-methylcytosine into uracil or thymine, adenosine deaminase that can convert adenine into hypoxanthine, and guanosine deaminase that can convert guanine into xanthine. As cytidine deaminase, it is more preferably listed as activation-induced cytidine deaminase (hereinafter also referred to as AID) as an enzyme that introduces mutations into immunoglobulin genes in acquired immunity (acquired immunity) of vertebrates.

[0071] The source of the nucleic acid base transferase is not particularly limited, and for example, PmCDA1 (Petromyzon marinus cytosine deaminase 1) derived from sea lamprey and AID (activation-induced cytidine deaminase; AICDA) derived from mammals (e.g., humans, pigs, cattle, horses, monkeys, etc.) can be used. For example, the nucleotide sequence and amino acid sequence of the cDNA of PmCDA1 can be referred to GenBank accession No. EF094822 and ABO15149, and the nucleotide sequence and amino acid sequence of the cDNA of human AID can be referred to GenBank accession No. NM_020661 and NP_065712. From the viewpoint of enzyme activity, PmCDA1 is preferred.

[0072] As the DNA glycosylase used in the present invention, it is not particularly limited as long as it is an enzyme that can catalyze the above reaction, and examples thereof include: thymine DNA glycosylase, oxoguanine transglucosylase, alkyladenine DNA glycosylase (e.g. yeast 3-methyladenine-DNA glycosylase (MAG1) etc.). The present inventors have previously reported that by using a DNA glycosylase with sufficiently low reactivity to DNA with a double helical structure without strain (unrelaxed DNA: unrelaxed DNA) in the DNA glycosylase, cytotoxicity can be reduced and the target sequence can be modified efficiently (International Publication No. 2016 / 072399). Therefore, as the DNA glycosylase, it is preferred to use a DNA glycosylase with sufficiently low reactivity to DNA with a double helical structure without strain. Examples of such DNA glycosylases include mutants of UNG (uracil-DNA glycosylase) having cytosine-DNA glycosylase (CDG) activity and / or thymine-DNA glycosylase (TDG) activity described in International Publication No. 2016 / 072399, and UDG mutants derived from vaccinia virus.

[0073] Specific examples of the above-mentioned UNG mutants include: yeast UNG1 N222D / L304A double mutant, N222D / R308E double mutant, N222D / R308C double mutant, Y164A / L304A double mutant, Y164A / R308E double mutant, Y164A / R308C double mutant, Y164G / L304A double mutant, Y164G / R308E double mutant mutant, Y164G / R308C double mutant, N222D / Y164A / L304A triple mutant, N222D / Y164A / R308E triple mutant, N222D / Y164A / R308C triple mutant, N222D / Y164G / L304A triple mutant, N222D / Y164G / R308E triple mutant, N222D / Y164G / R308C triple mutant, etc. When other UNGs are used instead of yeast UNG1, mutants in which the same mutations are introduced into the amino acids corresponding to the above mutants may be used. As UDG mutants derived from vaccinia virus, there can be listed: N120D mutant, Y70G mutant, Y70A mutant, N120D / Y70G double mutant, N120D / Y70A double mutant, etc. Alternatively, it can be a lyase (split enzyme), which is a DNA glycosylase divided into two fragments, and the design method is as follows: each fragment is combined with either side of the nucleic acid sequence recognition module divided into two to form two complexes, and if the two complexes are refolded, the nucleic acid sequence recognition module can be specifically combined with the target nucleotide sequence, and through the specific combination, the DNA glycosylase can catalyze the abasic reaction. Lyase, for example, can be designed and produced with reference to the records of International Publication No. 2016 / 072399, Nat Biotechnol.33(2):139-142(2015), PNAS 112(10):2984-2989(2015).

[0074] In the present invention, "base excision repair" is one of the DNA repair mechanisms possessed by organisms, and refers to a mechanism for repairing base damage by enzymatically cutting out the damaged part of the base and rejoining it. The damaged base is excised by DNA glycosylase, which is an enzyme that hydrolyzes the N-glycosidic bond of DNA, and the abasic site (apurinic / apyrimidic (AP) site: purine-deficient / pyrimidine-deficient (AP) site) generated as a result of the abasic reaction performed by the enzyme is treated by enzymes downstream of the base excision repair (BER) pathway, such as AP endonuclease, DNA polymerase, and DNA ligase. Examples of genes or proteins involved in these BER pathways include UNG (NM_003362), SMUG1 (NM_014311), MBD4 (NM_003925), TDG (NM_003211), OGG1 (NM_002542), MYH (NM_012222), NTHL1 (NM_002528), MPG (NM_002434), NEIL1 (NM_024608), NEIL2 (NM_003925), and MYH (NM_012222). )、NEIL3(NM_018248)、APE1(NM_001641)、APE2(NM_014481)、LIG3(NM_013975)、XRCC1(NM_006297)、ADPRT(PARP1)(NM_0016718)、ADPRTL2(PARP2)(NM_005484), etc. (The refseq number in which the nucleotide sequence information of each gene (cDNA) is registered is shown in brackets.), but are not limited to these.

[0075] In the present invention, "base excision repair inhibitor" refers to a protein that inhibits BER by inhibiting any stage of the above-mentioned BER pathway or inhibiting the expression of molecules mobilized by the BER pathway. The base excision repair inhibitor used in the present invention is not particularly limited as long as it is a substance that inhibits BER. From the perspective of efficiency, a DNA glycosylase inhibitor located upstream of the BER pathway is preferred. As the DNA glycosylase inhibitor used in the present invention, thymine DNA glycosylase inhibitor, uracil DNA glycosylase inhibitor, oxoguanine DNA glycosylase inhibitor, alkylguanine DNA glycosylase inhibitor, etc. can be listed, but it is not limited to these. For example, when cytidine deaminase is used as a nucleic acid modifying enzyme, it is suitable to use a uracil DNA glycosylase inhibitor because the repair of U:G or G:U mismatches of DNA generated by mutations is inhibited.

[0076] As such uracil DNA glycosylase inhibitors, there can be cited: uracil DNA glycosylase inhibitor (UGI) derived from PBS1 as Bacillus subtilis phage or uracil DNA glycosylase inhibitor (UGI) derived from PBS2 as Bacillus subtilis phage (Wang, Z. and Mosbaugh, DW (1988) J. Bacteriol. 170, 1082-1091), but not limited to these, as long as it is a mismatch repair inhibitor of the above-mentioned DNA, it can be used in the present invention. In particular, it is also known that UGI derived from PBS2 has the effect of not easily causing mutations or cutting and recombination other than C to T on DNA, so it is suitable to use UGI derived from PBS2.

[0077] As described above, in the base excision repair (BER) mechanism, if the base is excised by DNA glycosylase, the AP endonuclease will introduce a nick (gap) at the abasic site (AP site), and then the AP site will be completely excised by the exonuclease. If the AP site is excised, the DNA polymerase will re-make the base using the base of the opposite strand as a template, and finally the DNA ligase will fill the nick to complete the repair. It is known that mutant AP endonucleases that have lost their enzymatic activity but still retain the ability to bind to the AP site competitively inhibit BER. Therefore, these mutant AP endonucleases can also be used as base excision repair inhibitors of the present invention. There is no particular limitation on the source of the mutant AP endonuclease, for example, AP endonucleases derived from Escherichia coli, yeast, mammals (such as humans, mice, pigs, cattle, horses, monkeys, etc.) can be used. For example, the amino acid sequence of human Ape1 can be referred to Uniprot KB No. P27695. Examples of mutant AP endonucleases that have lost their enzymatic activity but still retain the ability to bind to the AP site include proteins in which the active site or the Mg binding site as a cofactor has been mutated. For example, in the case of human Ape1, the following can be mentioned: E96Q, Y171A, Y171F, Y171H, D210N, D210A, N212A, etc.

[0078] In the present invention, "transcription regulatory factor" refers to a protein or its domain that has the activity of promoting transcription of a target gene or the activity of inhibiting transcription of a target gene. Hereinafter, a factor that has the activity of promoting transcription is sometimes referred to as a "transcription activator", and a factor that has the activity of inhibiting transcription is sometimes referred to as a "transcription repressor".

[0079] The transcription activator used in the present invention is not particularly limited as long as it is a factor that can promote transcription of the target gene, and examples thereof include: the activation domain of HSV (herpes simplex virus) VP16, the p65 subunit of NFκB, VP64, VP160, HSF, P300 and Epstein-Barr virus (human herpes virus: Epstein-Barr Virus) RTA, and fusion proteins thereof, etc. The transcription repressor used in the present invention is not particularly limited as long as it is a factor that can inhibit transcription of the target gene, and examples thereof include: KRAB, MBD2B, v-ErbA, SID (including concatemers of SID (SID4X)), MBD2, MBD3, DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, MeCP2, ROM2 and AtHD2A, and fusion proteins thereof, etc.

[0080] The target nucleotide sequence in the double-stranded DNA recognized by the nucleic acid sequence recognition module of the complex of the present invention is not particularly limited as long as it can specifically bind to the module, and can be any sequence in the double-stranded DNA. The length of the target nucleotide sequence is mainly sufficient to specifically bind to the nucleic acid sequence recognition module. For example, in the case of introducing a mutation to a specific site in the genomic DNA of a mammal, the length is 12 nucleotides or more, preferably 15 nucleotides or more, and more preferably 17 nucleotides or more, depending on the size of its genome. There is no particular limit on the upper limit of the length, but it is preferably 25 nucleotides or less.

[0081] As the nucleic acid sequence recognition module of the complex of the present invention, for example, in addition to the CRISPR-Cas system in which at least one DNA cutting ability of the Cas effector protein is inactivated (hereinafter also referred to as "CRISPR-mutant Cas"), zinc finger motifs, TAL effectors and PPR motifs, restriction enzymes, transcription regulatory factors, RNA polymerases, etc., fragments of the DNA binding domain of proteins that can specifically bind to DNA can also be used, but are not limited to these. In the case of using a nucleic acid modification enzyme, a CRISPR-Cas system in which a nucleic acid sequence recognition module and a nucleic acid modification enzyme are integrated can be used (the Cas effector protein of this system maintains the activity of both sides of the DNA cutting ability). CRISPR-mutant Cas, zinc finger motifs, TAL effectors, PPR motifs, etc. can be preferably listed.

[0082] The zinc finger motif is a motif obtained by connecting 3 to 6 zinc finger units of different Cys2His2 types (one finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9 to 18 bases. The zinc finger motif can be prepared by known methods such as the Modular Assembly Method (Nat Biotechnol (2002) 20: 135-141), the OPEN Method (Mol Cell (2008) 31: 294-301), the CoDA Method (Nat Methods (2011) 8: 67-69), and the Escherichia coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701). For details on the preparation of the zinc finger motif, reference can be made to Japanese Patent No. 4968498.

[0083] TAL effectors have a repetitive structure of modules with about 34 amino acids as units, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVD) of a module. Since each module is highly independent, a specific TAL effector for a target nucleotide sequence can be produced only by joining the modules. TAL effectors have established methods for making using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), Golden Gate method (Nucleic Acids Res (2011) 39: e82) etc.), which can be relatively simple to design TAL effectors for target nucleotide sequences. For details on the production of TAL effectors, please refer to Japanese Patent Publication No. 2013-513389.

[0084] The PPR motif is composed of 35 amino acids and is composed of a series of PPR motifs that recognize one nucleic acid base, so that it recognizes a specific nucleotide sequence, and recognizes the target base only through the amino acids at the 1st, 4th and ii(-2) positions of each motif. Since it is independent of the motif composition and there is no interference from the motifs on both sides, a specific PPR protein for the target nucleotide sequence can be produced by simply joining the PPR motif, just like the TAL effector. For details on the production of the PPR motif, please refer to Japanese Patent Gazette No. 2013-128413.

[0085] Furthermore, when using fragments of restriction enzymes, transcriptional regulatory factors, RNA polymerases, etc., the DNA binding domains of these proteins are well known, and therefore, for example, a fragment containing the domain and having no DNA double-strand cleavage ability can be easily designed and constructed.

[0086] In the case of using a nucleic acid modification enzyme, any of the above-mentioned nucleic acid sequence recognition modules can be provided as a fusion protein with the above-mentioned nucleic acid modification enzyme and / or base excision repair inhibitor, or, protein binding domains such as SH3 domains, PDZ domains, GK domains, GB domains and their binding partners can be fused with nucleic acid sequence recognition modules and nucleic acid modification enzymes and / or base excision repair inhibitors, respectively, and provided in the form of a protein complex via the interaction of the domains with their binding partners. Alternatively, inteins can also be fused with nucleic acid sequence recognition modules and nucleic acid modification enzymes and / or base excision repair inhibitors, respectively, and the two are connected by the connection after each protein synthesis. The protein degradation tag can be combined with any one of the constituent molecules (nucleic acid sequence recognition module, nucleic acid modification enzyme and base excision repair inhibitor) of the nucleic acid modification enzyme complex, or it can be combined with multiple constituent molecules. In the case of using a transcriptional regulatory factor, as described above, the transcriptional regulatory factor can also be provided as a fusion protein with a nucleic acid sequence recognition module, or it can be combined with a nucleic acid recognition module via the above-mentioned protein binding domains and their binding partners. As described above, the protein degradation tag can be bound as a fusion protein, or can be bound to the genome editing complex or its constituent molecules via the above-mentioned protein binding domains and their binding partners. In addition, the protein degradation tag is preferably bound to the C-terminus of the genome editing complex or its constituent molecules.

[0087] The nucleic acid of the present invention can be modulated by a nucleic acid sequence recognition module, a protein degradation tag, and, if necessary, a nucleic acid modification enzyme and / or a base excision repair inhibitor or a transcriptional regulatory factor as a nucleic acid encoding their fusion protein; or, after being translated into a protein using a binding domain or an intein, the nucleic acid can be modulated in a form that can form a complex in a host cell as a nucleic acid encoding them respectively. Here, the nucleic acid can be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA, provided in the form of an expression vector configured under the control of a functional promoter in the host cell. In the case of RNA, it is preferably single-stranded RNA.

[0088] DNA encoding nucleic acid sequence recognition modules such as zinc finger motifs, TAL effectors, and PPR motifs can be obtained by any of the above methods for each module. DNA encoding sequence recognition modules such as restriction enzymes, transcriptional regulatory factors, and RNA polymerases can be synthesized into oligoDNA primers in a manner covering the region encoding the desired portion of the protein (including the portion of the DNA binding domain) based on their cDNA sequence information, and total RNA or mRNA components modulated by cells producing the protein are used as templates, and amplified by RT-PCR, so that cloning can be performed.

[0089] Similarly, DNA encoding nucleic acid modification enzymes and base excision repair inhibitors can be cloned by synthesizing oligoDNA primers based on the cDNA sequence information of the enzyme used, using total RNA or mRNA fractions prepared from cells producing the enzyme as templates, and amplifying by RT-PCR. For example, DNA encoding UGI derived from PBS2 can be cloned from mRNA derived from PBS2 by RT-PCR based on the DNA sequence registered in the NCBI / GenBank database (Accession No. J04434) by designing appropriate primers for the upstream and downstream of CDS.

[0090] The cloned DNA can be directly or as needed digested with a restriction enzyme, or an appropriate linker (e.g., GS linker, GGGAR linker, etc.), spacer sequence (e.g., FLAG sequence, etc.) and / or nuclear migration signal (NLS) (in the case where the target double-stranded DNA is mitochondrial or chloroplast DNA, it refers to each organelle migration signal) is added to modulate the protein encoding DNA. In addition, it can be further connected to the DNA encoding the nucleic acid sequence recognition module to modulate the DNA encoding the fusion protein.

[0091] The DNA encoding the genome editing complex of the present invention can also be constructed by chemically synthesizing a DNA chain, or by connecting a partially overlapping oligoDNA short chain synthesized by PCR or Gibson assembly method, to construct a DNA encoding its full length. The advantage of constructing a full-length DNA by combining with chemical synthesis or PCR or Gibson assembly method is that the codons used throughout the entire length of CDS can be designed in combination with the host into which the DNA is introduced. When expressing heterologous DNA, an increase in protein expression can be expected by converting its DNA sequence into a codon with a high frequency of use in the host organism. The data on the frequency of codon use in the host used can be, for example, the genetic code frequency database (http: / / www.kazusa.or.jp / codon / index.html) disclosed on the homepage of the (public foundation) Kazusa DNA Research Institute, or reference can be made to the literature recording the frequency of codon use in each host. With reference to the acquired data and the DNA sequence to be introduced, it is only necessary to convert the codons used in the DNA sequence with a low frequency of use in the host into codons encoding the same amino acid and with a high frequency of use.

[0092] An expression vector comprising a DNA encoding the complex of the present invention can be produced, for example, by ligating the DNA to the downstream of a promoter in an appropriate expression vector.

[0093] As expression vectors, plasmids derived from Escherichia coli (e.g., pBR322, pBR325, pUC12, pUC13), plasmids derived from Bacillus subtilis (e.g., pUB110, pTP5, pC194), plasmids derived from yeast (e.g., pSH19, pSH15), insect cell expression plasmids (e.g., pFast-Bac), animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo), bacteriophages such as λ phage, insect virus vectors such as baculovirus (e.g., BmNPV, AcNPV), animal virus vectors such as retrovirus, vaccinia virus, and adenovirus, etc. are used.

[0094] As a promoter, any promoter may be used as long as it is suitable for the promoter of the host used in gene expression. When using a nucleic acid degrading enzyme as a nucleic acid modifying enzyme, the survival rate of the host cell may be significantly reduced due to toxicity, so it is desirable to use an inducible promoter to increase the number of cells before induction begins. On the other hand, when using nucleic acid base transferase and DNA glycosylase as nucleic acid modifying enzymes or when nucleic acid modifying enzymes are not used, even if the complex of the present invention is expressed, sufficient cell proliferation can be obtained, so a constitutive promoter may also be used without restriction.

[0095] For example, when the host is an animal cell, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc. are used. Among them, CMV promoter, SRα promoter, etc. are preferred.

[0096] When the host is Escherichia coli, J23 series promoters (e.g., J23119 promoter), trp promoter, lac promoter, recA promoter, λP promoter, L Promoter, lpp promoter, T7 promoter, etc.

[0097] When the host is a bacterium of the genus Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc. are preferred.

[0098] When the host is yeast, Gal1 / 10 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferred.

[0099] When the host is an insect cell, polyhedrin promoter, P10 promoter, etc. are preferred.

[0100] When the host is a plant cell, CaMV35S promoter, CaMV19S promoter, NOS promoter, etc. are preferred.

[0101] As the expression vector, in addition to the above, an expression vector containing an enhancer, a splicing signal, a terminator, a poly A addition signal, a drug resistance gene, a nutrient requirement complementary gene or other selection marker, a replication origin, etc. can be used as desired.

[0102] RNA encoding the complex of the present invention can be prepared, for example, by using a vector containing DNA encoding each protein as a template and transcribing it into mRNA using a known in vitro transcription system.

[0103] The host bacteria for replicating the nucleic acid of the present invention are not particularly limited as long as they have a protein degradation system using tmRNA (ssrA). For example, Escherichia, Bacillus, Pseudomonas (e.g., Pseudomonas putida), Streptococcus (e.g., Streptococcus), Streptomyces, Staphylococcus, Yersinia, Acinetobacter, Klebsiella, Bordetella, Lactococcus, Neisseria, Aeromonas, etc. can be used. monas, Francisella, Corynebacterium, Citrobacter, Chlamydia, Haemophilus, Brucella, Mycobacterium, Legionella, Rhodococcus, Pseudomonas, Helicobacter, Salmonella, Staphylococcus, Vibrio, and Erysipelothrix.

[0104] Examples of Escherichia bacteria include Escherichia coli K12 / DH1 [Proc. Natl. Acad. Sci. USA, 60, 160 (1968)], Escherichia coli JM103 [Nucleic Acids Research, 9, 309 (1981)], Escherichia coli JA221 [Journal of Molecular Biology, 120, 517 (1978)], Escherichia coli HB101 [Journal of Molecular Biology, 41, 459 (1969)], Escherichia coli C600 [Genetics, 39, 440 (1954)], Escherichia coli DH5α, and Escherichia coli BW25113.

[0105] As the Bacillus bacteria, for example, Bacillus subtilis MI114 [Gene, 24, 255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)], etc. are used.

[0106] When a nucleic acid base transfer enzyme or a DNA glycosylase is used as a nucleic acid modifying enzyme, the nucleic acid modifying enzyme and / or the base excision repair inhibitor is provided in the form of a complex with the mutant Cas by the same method as the connection method with the above-mentioned zinc finger, etc. Alternatively, the nucleic acid base transfer enzyme and / or the base excision repair inhibitor and the mutant Cas can be combined using an RNA scaffold formed by MS2F6, PP7, etc. as RNA aptamers and their binding proteins. The guide RNA forms a complementary strand with the target nucleotide sequence, and then the mutant Cas is recruited to the tracrRNA to recognize the DNA cleavage site recognition sequence PAM (protospacer adjacent motif) (in the case of SpCas9, PAM is NGG (N is an arbitrary base) three bases, which can theoretically target anywhere on the genome), but it cannot cut one or two DNAs. Through the action of the nucleobase transferase or DNA glycosylase connected to the mutant Cas, the nucleobase conversion or abasic occurs at the target site (which can be appropriately regulated within the range of hundreds of bases containing all or part of the target nucleotide sequence), generating mismatches in the double-stranded DNA (for example, when using cytidine deaminases such as PmCDA1 or AID as nucleobase transferases, cytosine on the sense strand or antisense strand of the target site is converted to uracil, generating U:G or G:U mismatches) or abasic sites (AP sites). Various mutations are introduced due to errors in the BER system of the cell to be repaired. For example, when the mismatch or missing base is not correctly repaired, the base of the opposite chain is repaired to pair with the base of the converted chain (TA or AT in the above example), or when repaired, it is further replaced with other nucleotides (such as U→A, G), or a deletion or insertion of 1 to several dozen bases occurs, thereby introducing various mutations. By using a base excision repair inhibitor in combination, the BER mechanism in the cell is inhibited, the frequency of repair errors is increased, and the efficiency of mutation introduction can be improved.

[0107] Regarding zinc finger motifs, it is not easy to produce multiple zinc finger motifs that actually work because the efficiency of producing zinc fingers that specifically bind to target nucleotide sequences is low and the screening of zinc fingers with high binding specificity is complicated. Compared with zinc finger motifs, TAL effectors or PPR motifs have a high degree of freedom in target nucleic acid sequence recognition, but each time a huge protein needs to be designed and constructed according to the target nucleotide sequence, so there are still problems in terms of efficiency.

[0108] In contrast, the CRISPR-Cas system recognizes the target double-stranded DNA sequence through a guide RNA that is complementary to the target nucleotide sequence, so any sequence can be targeted by simply synthesizing an oligoDNA that can specifically form a hybrid with the target nucleotide sequence.

[0109] Therefore, in a more preferred embodiment of the present invention, a CRISPR-Cas system that maintains the activity of both DNA cleavage abilities, or a CRISPR-Cas system in which only one or both DNA cleavage abilities of Cas are inactivated (CRISPR-mutant Cas) is used as a nucleic acid sequence recognition module.

[0110] The nucleic acid sequence recognition module of the present invention using CRISPR-mutant Cas is provided in the form of a complex of a CRISPR-RNA (crRNA) having a sequence complementary to the target nucleotide sequence and a trans-activating RNA (tracrRNA) required for the recruitment of a mutant Cas effector protein when necessary and (if tracrRNA is required, it can be provided as a chimeric RNA with crRNA) mutant Cas effector protein. RNA molecules composed of crRNA alone or chimeric RNA of crRNA and tracrRNA that constitute a nucleic acid sequence recognition module in combination with a mutant Cas effector protein are collectively referred to as "guide RNA". The same is true when using a CRISPR / Cas system in which no mutations are introduced.

[0111] The Cas effector protein used in the present invention can form a complex with the guide RNA, recognize the target nucleotide sequence in the target gene and the protospacer adjacent motif (PAM) adjacent thereto and bind thereto, and is not particularly limited, and is preferably Cas9 or Cpf1. As Cas9, for example, Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence NGG (N is A, G, T or C. The same below)), Cas9 derived from Streptococcus thermophilus (Streptococcus thermophilus) (StCas9; PAM sequence NNAGAAW), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence NNNNGATT), etc., but are not limited to these. Preferably, it is SpCas9 with fewer PAM constraints (essentially 2 bases, which can theoretically target almost every place on the genome). In addition, as Cpf1, for example, Cpf1 derived from Francisella novicida (FnCpf1; PAM sequence NTT), Cpf1 derived from Acidaminococcus sp. (AsCpf1; PAM sequence NTTT), Cpf1 derived from Lachnospiraceae bacterium (LbCpf1; PAM sequence NTTT), etc. can be listed, but it is not limited to these. As a mutant Cas effector protein (sometimes referred to as mutant Cas) used in the present invention, any of a protein with inactivated cleavage ability of both strands of double-stranded DNA of the Cas effector protein and a protein with nickase activity inactivated for cleavage ability of only one strand can be used. For example, in the case of SpCas9, the following mutants can be used: the D10A mutant in which the Asp residue at position 10 is converted to an Ala residue, and the cleavage ability of the opposite strand of the strand forming a complementary strand with the guide RNA is lacking (therefore, it has nickase activity on the strand forming a complementary strand with the guide RNA); or the H840A mutant in which the His residue at position 840 is converted to an Ala residue, and the cleavage ability of the strand forming a complementary strand with the guide RNA is lacking (therefore, it has nickase activity on the opposite strand of the strand forming a complementary strand with the guide RNA), and its double mutant (dCas9). In addition, in the case of FnCpf1, the Asp residue at position 917 is converted to an Ala residue (D917A), or the Glu residue at position 1006 is converted to an Ala residue (E1006A), and the mutants lacking the cleavage ability of both strands can be used. As long as the cleavage ability of at least one strand of double-stranded DNA is lacking, other mutant Cas can also be used in the same way.

[0112] The DNA encoding the Cas effector protein (including mutant Cas, the same below) can be cloned from cells producing the enzyme using the same method as described above for the DNA encoding the base excision repair inhibitor. In addition, the mutant Cas can be obtained by introducing mutations into the DNA encoding the cloned Cas using a site-specific mutagenesis method known from the body to convert the amino acid residues at sites that are important for DNA cleavage activity (for example, in the case of SpCas9, the Asp residue at position 10 or the His residue at position 840 can be listed; in the case of FnCpf1, the Asp residue at position 917 or the Glu residue at position 1006 can be listed, but not limited to these) into other amino acids.

[0113] Alternatively, the DNA encoding the Cas effector protein can also be constructed in the form of a DNA having a codon usage suitable for expression in the host cell used, using the same method as described for the DNA encoding the nucleic acid sequence recognition module or the DNA encoding the DNA glycosylase, in combination with chemical synthesis or PCR or Gibson assembly.

[0114] The obtained DNA encoding the Cas effector protein, nucleic acid modification enzyme, base excision repair inhibitor and / or transcriptional regulatory factor can be inserted downstream of the promoter of the same expression vector as above according to the target cell.

[0115] On the other hand, the DNA encoding the guide RNA can be synthesized as follows: an oligoDNA sequence is designed and chemically synthesized using a DNA / RNA synthesizer, wherein the oligoDNA sequence comprises a nucleotide sequence complementary to the target nucleotide sequence (also referred to as a "targeting sequence" in this specification) and is connected to a crRNA sequence (for example, in the case of recruiting FnCpf1 as a Cas effector protein, a target sequence containing SEQ ID NO: 19, i.e., AAUU, can be used on the 5' side of the targeting sequence). UCUAC UGUU GUAGA U's crRNA, the underlined sequences form base pairs with each other to form a stem-loop structure), or a crRNA coding sequence and a known tracrRNA coding sequence when necessary (for example, in the case of recruiting Cas9 as a Cas effector protein, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt; SEQ ID NO: 18).

[0116] Here, the "target strand" refers to the strand that forms a hybrid with the crRNA of the target nucleotide sequence, and the strand that becomes single-stranded by forming a hybrid of the target strand and crRNA in the opposite strand is called the "non-target strand". In addition, it is presumed that the nucleic acid base conversion reaction usually occurs on the non-target strand that becomes single-stranded, so when the target nucleotide sequence is expressed by a single strand (for example, when the PAM sequence is labeled, or when the positional relationship between the target nucleotide sequence and the PAM is expressed, the sequence of the non-target strand is represented.

[0117] The length of the targeting sequence is not particularly limited, as long as it can specifically bind to the target nucleotide sequence, for example, 15 to 30 nucleotides, preferably 18 to 25 nucleotides. Although the selection of the target nucleotide sequence is limited by the presence of a PAM adjacent to the 3' side (in the case of Cas9) or the 5' side (in the case of Cpf1) of the sequence, according to the insights confirmed in the embodiments described below, the system of the present invention in which CRISPR-mutated Cas9 and cytidine deaminase are combined has the following regularity: as the target nucleotide sequence becomes longer, the easily substituted C shifts to the 5' end, so by appropriately selecting the length of the target nucleotide sequence (as the targeting sequence of its complementary chain), the site of the base that can be introduced into the mutation can be shifted. Thus, the restriction of PAM (NGG in SpCas9) can be at least partially eliminated, and the degree of freedom of mutation introduction is further improved.

[0118] Regarding the design of the targeting sequence, for example, when Cas9 is used as the Cas effector protein, a 20mer sequence adjacent to the 3' side of PAM (for example, NGG in the case of SpCas9) can be listed from the CDS sequence of the target gene by using a public guide RNA design website (CRISPR Design Tool, CRISPRdirect, etc.), and when C within 7 nucleotides is converted to T from its 5' end to the 3' direction, such a sequence that causes an amino acid change in the protein encoded by the target gene is selected for design. In addition, even when the length of the targeting sequence other than 20mer is used, an appropriate sequence can be selected. From these candidates, a candidate sequence with a small number of off-target sites in the target host genome can be used as a targeting sequence. In the case where the guide RNA design software used does not have the function of retrieving off-target sites of the host genome, for example, for 8 to 12 nucleotides on the 3' side of the candidate sequence (a seed sequence with high recognition ability of the target nucleotide sequence), the off-target site can be retrieved by performing a Blast search on the host genome.

[0119] The DNA encoding the guide RNA can also be inserted into the same expression vector as described above, but as a promoter, a polIII-based promoter (e.g., SNR6, SNR52, SCR1, RPR1, U3, U6, H1 promoter, etc.) and a terminator (e.g., PolyT sequence (T 6 sequence, etc.)).

[0120] The DNA encoding the guide RNA (crRNA or crRNA-tracrRNA chimera) can be chemically synthesized by designing an oligoRNA sequence, wherein the oligoRNA sequence is obtained by connecting a sequence complementary to the target strand of the target nucleotide sequence and a known tracrRNA sequence (in the case of recruiting Cas9) or a direct repeat sequence of crRNA (in the case of recruiting Cpf1).

[0121] 2. Method for modifying the target site of double-stranded DNA of host bacteria

[0122] The complex or nucleic acid of the present invention described in 1. is introduced into a host, particularly bacteria, and the host is cultured, so that the target site of the double-stranded DNA of the host can be modified, or the expression of the gene encoded by the double-stranded DNA near the target site can be regulated. Therefore, in another embodiment, a method for modifying the target site of the double-stranded DNA of bacteria (hereinafter also referred to as "the modification method of the present invention") is provided, which comprises the following steps: contacting the nucleic acid modification enzyme complex with the double-stranded DNA of the host bacteria, converting one or more nucleotides of the target site into one or more other nucleotides or deleting them, or inserting one or more nucleotides at the target site. By using a nucleic acid base transferase or a DNA glycosylase as a nucleic acid modification enzyme, the target site can be modified without cutting at least one strand of the double-stranded DNA at the target site. In addition, in another embodiment, the following method is provided: contacting the complex of the present invention with the double-stranded DNA of the host bacteria to regulate the transcription of the gene located near the target site.

[0123] The contact between the complex of the present invention and double-stranded DNA is carried out by introducing the complex or a nucleic acid encoding the complex into bacteria having the target double-stranded DNA (e.g., genomic DNA). Considering the efficiency of introduction and expression, it is more desirable to introduce the nucleic acid encoding the complex into bacteria rather than the genome editing complex itself so that the complex is expressed in the bacteria.

[0124] Examples of the bacteria used in the modification method of the present invention include the same bacteria as those used for nucleic acid replication in 1.

[0125] The expression vector can be introduced according to known methods (e.g., lysozyme method, competence method, PEG method, CaCl 2coprecipitation method, electroporation method, microinjection method, particle gun method, lipid transfection method, Agrobacterium method, etc.)

[0126] Escherichia coli can be transformed according to the method described in, for example, Proc. Natl. Acad. Sci. USA, 69, 2110 (1972) or Gene, 17, 107 (1982).

[0127] The vector can be introduced into Bacillus bacteria according to the method described in, for example, Molecular & General Genetics, 168, 111 (1979).

[0128] The bacteria into which the vector has been introduced can be cultured according to a known method depending on the type of bacteria.

[0129] For example, in the case of culturing Escherichia coli or Bacillus, as the culture medium used in the culture, a liquid culture medium is preferred. In addition, the culture medium preferably contains a carbon source, a nitrogen source, an inorganic substance, etc. required for the growth of the transformant. Here, as a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc. can be listed; as a nitrogen source, for example, inorganic or organic substances such as ammonium salts, nitrates, corn pulp, peptone, casein, meat extract, soybean meal, potato extract can be listed; as an inorganic substance, for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride, etc. can be listed. In addition, yeast extract, vitamins, growth promoting factors, etc. can be added to the culture medium. The pH of the culture medium is preferably about 5 to about 8.

[0130] As a medium for culturing Escherichia coli, for example, M9 medium containing glucose and casamino acids is preferred [Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York 1972]. If necessary, in order to effectively function the promoter, for example, a drug such as 3β-indole acrylic acid may be added to the medium. Escherichia coli is usually cultured at about 15 to about 43° C. Aeration or stirring may be performed as needed.

[0131] The culture of Bacillus bacteria is usually carried out at about 30 to 40° C. Aeration or stirring may be performed as necessary.

[0132] In addition, the present inventors have confirmed that when PmCDA1 is used as a nucleic acid modifying enzyme, the mutation introduction efficiency is increased by culturing animal cells or plant cells at a lower temperature than usual (e.g., 20 to 26°C, preferably about 25°C), and when culturing bacteria, culturing at the above low temperature is also preferred.

[0133] Introduction of RNA encoding the complex of the present invention into host bacteria can be performed by microinjection, lipofection, etc. RNA introduction can be performed once or repeatedly at appropriate intervals for a plurality of times (eg, 2 to 5 times).

[0134] The inventors also made sequence recognition modules for multiple target nucleotide sequences close to each other and used them simultaneously, thereby confirming using budding yeast that: compared with using a single nucleotide sequence as a target, the efficiency of mutation introduction has increased significantly, and the same effect can be expected even in bacteria. Its effect is that mutagenesis is achieved in the same way from the situation where part of the two target nucleotide sequences are repeated to the situation where the two are about 600bp apart. In addition, it can occur when the target nucleotide sequences are in the same direction (the target chain is the homologous chain) and when the two are relative (the two chains of the double-stranded DNA become the target chain).

[0135] In a preferred embodiment, it was confirmed that using the method of the present invention, mutations can be introduced into 6 positions simultaneously in the genomic DNA of bacteria ( Fig.10 ), the mutation introduction efficiency is very high. Therefore, in the modification method of the genome sequence of the present invention or the expression regulation method of the target gene, multiple DNA regions in completely different positions can be modified as targets, or the expression regulation of multiple target genes can be performed. Therefore, in a preferred embodiment of the present invention, two or more nucleic acid sequence recognition modules that specifically bind to different target nucleotide sequences (can be in one target gene, or in two or more different target genes. These target genes can be located on the same chromosome or plasmid, or on another chromosome or plasmid) can be used. In this case, each of these nucleic acid sequence recognition modules forms a complex with a protein degradation tag added with a nucleic acid modification enzyme and / or a base excision repair inhibitor, or a transcriptional regulatory factor. Here, nucleic acid modification enzymes, base excision repair inhibitors and transcriptional regulatory factors can use universal substances. For example, when the CRISPR-Cas system is used as a nucleic acid sequence recognition module, a complex (including fusion protein) of a Cas effector protein and a nucleic acid modification enzyme and / or a base excision repair inhibitor, or a transcriptional regulatory factor uses a common substance, and as a guide RNA-tracrRNA, two or more chimeric RNAs formed by two or more guide RNAs and tracrRNAs that form complementary chains with different target nucleotide sequences can be prepared for use. On the other hand, when a zinc finger motif or a TAL effector is used as a nucleic acid sequence recognition module, for example, a nucleic acid modification enzyme and / or a base excision repair inhibitor, or a transcriptional regulatory factor, and each nucleic acid sequence recognition module that specifically binds to different target nucleotides can be fused.

[0136] In order to express the complex of the present invention in the host bacteria, an expression vector containing the DNA encoding the complex is introduced into the host bacteria as described above, but in order to effectively introduce mutations or to fully regulate the expression of the target gene, it is desirable to maintain the expression of the genome editing complex for a certain period or more and at a certain level or more. From this perspective, it is reliable to integrate the expression vector into the host genome, but the continuous expression of the genome editing complex will increase the risk of off-target cutting, so it is preferably quickly excised after the mutation introduction is successfully achieved. As a means for excising the DNA integrated into the host genome, methods using the Cre-loxP system or methods using transposons can be cited.

[0137] Alternatively, a nucleic acid reaction occurs at a desired time, and the complex of the present invention is transiently expressed in the host bacteria only during the period required for modification of the fixed target site, thereby effectively achieving editing of the host genome while avoiding the risk of off-target cleavage. The period required for the nucleic acid modification reaction and modification of the fixed target site varies depending on the type of host bacteria or culture conditions, and requires at least several generations of cell division, so it is believed that about 2-3 days are required. Those skilled in the art can appropriately determine a suitable expression induction period based on the culture conditions used, etc. Within the range that no side effects are produced in the host bacteria, the expression induction period of the nucleic acid encoding the complex of the present invention can be extended beyond the above-mentioned "period required for modification of the fixed target site".

[0138] As a means for causing the complex of the present invention to be transiently expressed at a desired time or during a desired period, the following method can be cited: a construct (expression vector) is prepared that contains a nucleic acid encoding the complex (DNA encoding a guide RNA in a mutant CRISPR-Cas system, DNA encoding a Cas effector protein, and DNA encoding a nucleic acid modification enzyme and / or a base excision repair inhibitor or a transcriptional regulatory factor when necessary) in a form in which the expression period can be controlled, and the construct is introduced into a host. As a "form in which the expression period can be controlled", specifically, a form in which the nucleic acid encoding the complex of the present invention is placed under the control of an inducible regulatory region can be cited. There is no particular limitation on the "inducible regulatory region", and for example, an operon of a temperature-sensitive (ts) mutation repressor and an operator gene controlled by it can be cited. As a ts mutation repressor, for example, a ts mutant of the cI repressor derived from λ phage can be cited, but it is not limited thereto. In the case of the λ phage cI repressor (ts), it binds to the operator gene at 30°C or less (e.g., 28°C) to inhibit downstream gene expression, but dissociates from the operator gene at a high temperature of 37°C or more (e.g., 42°C), thereby inducing gene expression. Therefore, the host bacteria into which the nucleic acid encoding the complex of the present invention is introduced are usually cultured at 30°C or less, the temperature is raised to 37°C or more at an appropriate time and cultured for a certain period of time, the nucleic acid conversion reaction is carried out, and mutations are introduced into the target gene, and then the temperature is quickly returned to 30°C or less, so that the period of inhibiting the expression of the target gene can be minimized, and even when targeting essential genes for the host cell, editing can be performed efficiently while suppressing side effects.

[0139] In the case of utilizing temperature-sensitive mutations, for example, a temperature-sensitive mutant of a protein required for autonomous replication of a vector is carried on a vector containing a DNA encoding the complex of the present invention, so that after the complex is expressed, it cannot autonomously replicate quickly, and the vector naturally falls off with cell division. Examples of such temperature-sensitive mutant proteins include, but are not limited to, temperature-sensitive mutants of Rep101 ori required for replication of pSC101 ori. Rep101 ori (ts) can autonomously replicate the plasmid when it interacts with pSC101 ori at temperatures below 30°C (e.g., 28°C), but loses its function when it reaches 37°C or above (e.g., 42°C), and the plasmid cannot autonomously replicate. Therefore, by using it in combination with the cI repressor (ts) of the above-mentioned λ phage, transient expression of the complex of the present invention and excision of the plasmid can be performed simultaneously.

[0140] In addition, the DNA encoding the complex of the present invention is introduced into the host bacteria under the control of an inducible promoter (for example, lac promoter (induced by IPTG), cspA promoter (induced by cold shock), araBAD promoter (induced by arabinose), etc.), and the inducing substance is added to the culture medium (or removed from the culture medium) at an appropriate time to induce the expression of the complex. After culturing for a certain period of time, a nucleic acid modification reaction is carried out, and after introducing a mutation into the target gene, the expression induction is stopped, thereby achieving transient expression of the complex.

[0141] The present invention will be described below by way of examples, but the present invention is not limited to these examples.

[0142] Example

[0143] In the examples described below, experiments were performed as follows.

[0144] <Design of strains, plasmids, primers and targeting gRNA>

[0145] The Escherichia coli strain DH5α (F - endA1 supE44 thi-1 recA1 relA1 gyrA96 deoRphoA φ80dlacZ ΔM15 Δ(lacZYA-argF)U169, hsdR17(rK - ,mK + ), λ - )(TaKaRa-Bio), BW25113(lacI + rrnB T14 ΔlacZ WJ16 hsdR514 ΔaraBAD AH33 ΔrhaBAD LD78 rph-1 Δ(araB-D)567 Δ(rhaD-B)568ΔlacZ4787(::rrnB-3)hsdR514 rph-1) and Top10(F-mcrA Δ(mrr-hsdRMS-mcrBC)φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15galK16 rpsL(Str R )endA1λ - ) (Invitrogen). The plasmids and primers used in the examples are listed in Table 1 and Table 2, respectively. The oligo DNA pair for constructing the targeting gRNA vector was designed as follows: 5'-tagc-(target sequence)-3' and 5'-aaac-(reverse complementary sequence of the target sequence)-3'.

[0146] [Table 1-1]

[0147] Plasmids used in the examples

[0148] Display edited targets in italics

[0149]

[0150] [Table 1-2]

[0151]

[0152] [Table 2-1]

[0153] Primers used in the examples

[0154]

[0155] [Table 2-2]

[0156]

[0157] <Plasmid construction>

[0158] pCas9 and pCRISPR plasmids were obtained from Marraffini Laboratory (Non-patent Document 8) via Addgene. Nicking enzyme Cas9: nCas9 (D10A or H840A) and nuclease-deficient Cas9: dCas9 (D10A and H840A) (SEQ ID NOs: 1 and 2) were produced by PCR (Jinek, M et al., Science 337, 816-822 (2012).). PmCDA1 (SEQ ID NOs: 3 and 4) was fused to the C-terminus of nCas9 or dCas9 using a 121 amino acid peptide linker (SEQ ID NOs: 5 and 6) ( Figure 1 ).

[0159] The plasmid pScI_dCas9-PmCDA1_J23119-sgRNA containing the sgRNA unit (SEQ ID NO: 15) driven by the artificial constitutive promoter J23119 (BBa_J23119 in the registry for standard biological parts) (http: / / parts.igem.org / Part:BBa_J23119) (SEQ ID NO: 16) was amplified by PCR using primers p346 / p426. The sgRNA expression unit contains two BsaI restriction enzyme sites for inserting the target sequence. A pair of oligo DNAs containing the target sgRNA sequence was annealed and ligated to the pScI_dCas9-PmCDA1_sgRNA digested with BsaI.

[0160] pScI and pScI_dCas9 only have the λ operator and the operator-dCas9, respectively. pScI_dCas9-PmCDA1 has the dCas9-PmCDA1 gene. A degradation tag (LVA tag) and the UGI gene were added to the C-terminus of the dCas9-PmCDA1 gene to obtain the plasmids pScI_dCas9-PmCDA1-LVA and pScI_dCas9-PmCDA1-UGI-LVA, respectively.

[0161] The vector plasmid pTAKN-2 has the pMB1 replication origin corresponding to pSC101. The sgRNA unit with the promoter J23119 was cut out from the synthetic oligonucleotide using EcoRI-HindIII and connected to the pTAKN2 of the cloning vector. The plasmid with three tandem target sequences (pSBP804, galK_10-galK_11-gal_13; pSBP806, galK_2-xylB_1-manA_1; pSBP808, pta_1-adhE_3-tpiA_2) was constructed by Golden Gate assembly (Engler, C et al., PLoS One 4, (2009)) using BsaI digestion-connected PCR products. A plasmid (pSBP80608) with 6 different target sequences was constructed using Gibson assembly of PCR products amplified from pSBP808 (pta_1-adhE_3-tpiA_2 tandem sequence) by primers p597 / 598 and pSBP806 (vector and galK_2-xylB_1-manA_1 tandem sequence) by primers p599 / p600. For the IS editing plasmid, the sgRNA expression units were arranged in tandem in the order of IS1, IS2, IS3, and IS5.

[0162] <Mutagenesis assay>

[0163] DH5α or BW25113 cells chemically transformed with the target plasmid were cultured in 1 mL of SOC medium (2% Bacto tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO 4 and 20mM glucose). After culturing at 28°C for 2-3 hours, the cell culture was diluted 1:10 with 1ml of Luria-Bertani (LB) medium or terrific broth (TB), and antibiotics (chloramphenicol (25μg / ml) and / or kanamycin (30μg / ml)) were supplemented as needed. Use Maximizer (TAITEC) to proliferate overnight at 28°C and 100K rpm. The next day, the cell culture was diluted 1:10 with 1ml of medium again, cultured at 37°C for 6 hours for induction, and cultured at 28°C overnight. Then, the cell culture was serially diluted and inoculated on LB or TB agar plates supplemented with appropriate antibiotics, and cultured at 28°C overnight to form single colonies.

[0164] For positive selection of galK gene disruption, cells were grown in M63 minimal medium (2 g / L (NH 4 ) 2 SO 4 , 13.6g / L KH 2 PO 4 , 0.5mg / L FeSO 4 -7H 2 O, 1 mM MgSO 4 , 0.1 mM CaCl 2 and 10 μg / ml thiamine) (Warming, S. et al., Nucleic Acids Res. 33, 1-12 (2005).). To select for rifampicin resistance mutations in the rpoB gene, cells were propagated in LB medium containing 50 μg / ml rifampicin. For sequence analysis, colonies were randomly collected, directly amplified by PCR using appropriate primers, and analyzed by the Sanger method using a 3130XL genetic analyzer (Applied Biosystems). Statistical analysis was performed using t-test software (Microsoft).

[0165] <Whole genome sequencing>

[0166] BW25113 cells with each expression construct (dCas9, dCas9-PmCDA1-LVA-UGI, and dCas9-PmCDA1 with rpoB_1 target) were pre-cultured overnight, diluted 1:10 with 1 mL of LB medium, allowed to proliferate for 6 hours at 37°C for induction, and then cultured overnight at 28°C. The cells were spread on a plate medium containing rifampicin to isolate single colonies. Three independent colonies were inoculated on TB medium. Genomic DNA was extracted using the Wizard genomic DNA purification kit (Promega), and then fragmented by ultrasound using the Bioruster UCD-200 TS ultrasonic processing system (Diagenote) to obtain fragments with a size distribution of 500 to 1000 bp. The genomic DNA library was prepared using the NEBNext Ultra DNA library preparation kit for Illumina (New England Biolabs) and labeled with Dual Index Primer. Agencourt AMPure XP (Beckman Coulter) was used to size select the library, and a marker fragment with a length of 600-800bp was obtained. The size distribution was evaluated using the Agilent 2100 Bioanalyzer System (Agilent Technologies). DNA was quantified using the Qibit HS dsDNA HS Assay Kit and a fluorophotometer (ThermoFisher Scientific). In order to obtain a read length of 2×300bp with a coverage of about 20 times the expected genome size, sequencing was performed using the MiSeq Sequencing System (Illumina) and MiSeq Reagent Kit v3. Data analysis was performed using CLC Genomic Workbench 9.0 (CLC bio). Sequence reads were paired, duplicate reads within the read pair were merged, and trimmed with a maximum of 2 ambiguities according to a quality limit of 0.01.Reads were mapped to the reference genome of E. coli BW25113 according to the following settings (Masking mode = no masking, Mismatch cost = 2, Insertion cost = 3, Deletion cost = 3, Length fraction = 0.5, Similarity fraction = 0.8, Global alignment = No, Auto-detect paired distances = Yes, Nonspecific match handling = ignore). Local realignment was performed according to default settings (Realign unaligned ends = Yes, Multi-pass realignment = 2). Variants were called according to the following settings (Ignore positions with coverage = 1,000,000, Ignore broken pairs = Yes, Ignore Nonspecific matches = Reads, Minimum coverage = 5, Minimum count = 2, Minimum frequency = 50%, Base quality filter = No, Read detection filter = No, Relative read direction filter = Yes, Significance = 1%, Read position filter = No, Remove pyro-error variants = No). Output files were realigned using Excel (Microsoft).

[0167] <Deep Sequencing>

[0168] DH5α cells expressing gRNA targeting galK, gsiA, ycbF, or yfiH genes and dCas9-PmCDA1 or dCas9-PmCDA1-UGI-LVA were cultured overnight, diluted 1:10 with 1 mL of LB medium, and allowed to proliferate for 6 hours at 37°C for induction. Cell cultures were collected and genomic DNA was extracted. A fragment (~0.3 kb) containing the target region was directly amplified from the extracted genomic DNA using a primer pair (p685-p696). The amplicons were labeled with Dual Index Primer. An average of more than 30,000 reads per sample were analyzed using the MiSeq sequencing system. Sequence reads were paired, trimmed with a maximum of 2 ambiguities according to a quality limit of 0.01, and duplicate reads within read pairs were merged. Reads were mapped to the reference sequence individually according to the following settings (Maskingmode=no masking, Mismatch cost=2, Insertioncost=3, Deletion cost=3, Length fraction=0.5, Similarity fraction=0.8, Global alignment=No, Auto-detect paired distances=Yes, Nonspecific match handling=Map randomly). The output files were realigned using Excel.

[0169] Example 1 Deaminase-mediated mutagenesis of targets in E. coli

[0170] To evaluate whether deaminase-mediated mutagenesis of targets can be applied to bacteria, catalytically inert Cas9 (dCas: mutations of D10A and H840A) fused to cytosine deaminase PmCDA1 from P. marinus (sea lamprey) (Non-patent Document 11) was expressed under the temperature-inducible λ operator system (Wang, Y. et al., Nucleic Acids Res. 40, (2012)) and under the control of artificial constitutive promoter J23119 ( Figure 1(b)) A bacteria-targeted AID (target-AID) vector expressing CDA under a hybrid (sgRNA) of a target sequence-gRNA scaffold of 20 nucleotides (nt) was constructed. In eukaryotes, in order to achieve higher mutation efficiency, the nickase Cas9 (nCas: D10A mutation) can be used in combination with a deaminase (non-patent literature 10, 11), and low transformation efficiency was shown in plasmids expressing nCas (D10A)-CDA. This suggests that: in Escherichia coli, like the complete Cas9 nuclease, nCas (D10A)-CDA causes severe cell proliferation and / or cell death ( Figure 2 ). On the other hand, nCas(H840)-CDA showed high conversion efficiency similar to dCas or dCas-CDA, indicating that it was beneficial to cell proliferation or cell survival.

[0171] Next, in order to quantitatively evaluate the mutagenesis efficiency of the target, the galK gene with loss of function that can be actively selected by 2-deoxy-D-galactose (2-DOG), an analog of galactose, was used as a target. 2-DOG is catalyzed by galactokinase of the galK gene product and becomes a harmful compound (Warming, S. et al., Nucleic Acids Res. 33, 1-12 (2005).). It is known that target-AID induces mutations in the cytosine nucleotide (C) located at about the 15th to 20th base in the core region 16 to 19 bases upstream of the protospacer adjacent motif (PAM) sequence (non-patent document 11) ( Figure 1 (a)). Select a target sequence in the galK gene to introduce a stop codon ( Figure 3 ), compared to 2-DOG which induced almost 100% survival, suggesting a very efficient mutagenesis ( Figure 4 (a)). In the case of sequencing analysis of cells cultured in a medium without 2-DOG, mutations occurred in 6 of 8 colonies as expected. As expected, substitutions from C to T were observed at positions -17 and / or 20.

[0172] Next, we targeted rpoB, an essential gene encoding the β-subunit of RNA polymerase. It is known that if the gene function of rpoB is inhibited, cell proliferation will be inhibited or cell death will occur, but specific point mutations in the rpoB gene will confer rifampicin resistance (Jin, DJ et al., J. Mol. Biol. 202, 245-253 (1988).). The target sequence was designed to induce point mutations that confer rifampicin resistance ( Figure 5 (a)). There was no obvious proliferation inhibition, and transformed cells acquired rifampicin resistance at a frequency of almost 100% ( Figure 4(b)) By sequencing analysis of clones selected using a medium without rifampicin, substitution of C to T was confirmed at positions -16 and / or 17 of the PAM sequence (positions 1545 and 1546 of the rpoB gene) as expected. Figure 5 (a)). Whole genome sequencing was performed to evaluate the possibility of nonspecific mutagenic effects of target-AID in E. coli. Analysis of three independent clones expressing dCas-CDA and sgRNA targeting rpoB_1 revealed 0 to 2 unique base variants (single nucleotide variants; SNVs) at apparently unrelated genomic locations ( Figure 5 (b)). The adjacent sequences of the detected SNVs showed no similarity to the rpoB target sequence ( Figure 5 (c)).

[0173] Example 2 Effects of sgRNA length and uracil DNA glycosylase inhibitor on mutation frequency and location fruit

[0174] To comprehensively analyze mutation efficiency and location, deep sequencing analysis was performed using 18 target sequences of the galK gene ( Figure 6 , Figure 7 ). Seven targets showed high efficiency (61.7-95.1%) of mutagenesis, while five targets showed low efficiency (1.4-9.2%) of mutagenesis. The most effective mutation position was 17-20 bases upstream of PAM, which is consistent with previous studies in higher organisms. For example, sgRNAs with longer target sequences showed higher efficiency in galK_8 and galK_13, and lower efficiency in galK_9 and galK_11 ( Figure 6 , left bar) As can be appreciated, the mutation frequency also varies depending on the length of the target sequence.

[0175] In order to improve the mutation efficiency, the uracil DNA glycosylase inhibitor (UGI) derived from bacteriophage PBS2 (Zhigang, W et al., Gene 99, 31-37 (1991).) and the protein degradation tag (LVA tag) (Andersen, JB et al., Appl. Environ. Microbiol. 64, 2240-2246 (1998).) are fused to the C-terminus of dCas-CDA and introduced. UGI inhibits the removal of uracil (the direct product of cytosine deamination) from DNA (non-patent literature 10, 11), thereby promoting mutagenesis caused by cytidine deamination. The use of LVA tags shortens the half-life of dCas-CDA-UGI proteins that can be latently harmful if overexpressed, thereby protecting cells from damage, and it is expected to inhibit the generation of hybrid escape cells (escaper cells). In order to evaluate the nonspecific mutagenic effect, whole genome sequence analysis was performed on cells expressing dCas, dCas-CDA and dCas-CDA-UGI-LVA. dCas-CDA induced 0 to 2 SNV mutations, while dCas-CDA-UGI-LVA induced 21 to 30 mutations without positional shift throughout the genome (Tables 3 and 4).

[0176] [Table 3]

[0177] Whole-genome sequencing analysis of rifampicin-resistant mutants

[0178]

[0179] Whole genome sequencing was performed on rifampicin selected clones expressing each construct (dCas, dCas-CDA or dCas-CDA-LVA-UGI) without sgRNA. Biological triplicate samples of dCas-CDA and dCas-CDA-LVA-UGI are shown. Sequence coverage is calculated as the total number of base pairs mapped to 4,631Mbp of sequence throughout the E. coli BW25113 genome sequence. The list of unique mutations is shown in Table 4.

[0180] [Table 4]

[0181] List of unique SNV mutations

[0182] The details of SNVs detected by whole genome sequencing are shown in Table 3

[0183]

[0184] Regardless of the length and position of the target sequence, dCas-CDA-UGI-LVA showed strong mutagenesis at all target sites ( Figure 6, right bar), it is possible to compare the mutation spectra using sgRNAs of different lengths. The results show that in galK_9 and galK_11, the mutation spectrum extends toward the 5' end ( Figure 6 To further characterize the effect of sgRNA on the length of the target sequence, C-rich target sequences with lengths of 18 nt, 20 nt, 22 nt, and 24 nt were tested ( Figure 8 (a) and (b)). The mutation spectra of each of the five target sites remain consistent, showing a peak shift and window expansion toward the 5' end as the target sequence becomes longer ( Figure 8 (c)).

[0185] Example 3 Multiple mutagenesis

[0186] To perform multiple editing, tandem repeats of the sgRNA expression unit were integrated into a different plasmid from the modification plasmid. Plasmids targeting three sites of the galK gene (galK_10, galK_11, and galK_13) were constructed and simultaneously introduced into cells with a modification vector expressing dCas, dCas-CDA, dCas-CDA-LVA, or dCas-CDA1-UGI-LVA. First, the nonspecific mutagenesis effect was evaluated by analyzing the generation of rifampicin-resistant mutations ( Fig. 9 ). dCas-CDA showed an approximately 10-fold increase in mutation frequency compared to the background, while dCas-CDA-UGI-LVA showed a further 10-fold increase in mutation frequency compared to dCas-CDA. In dCas-CDA and dCas-CDA-LVA, although the efficiency is not sufficient to obtain triple mutants at the same time, one mutation can occur at any site, and at least no significant difference in the mutation rate of the target depending on the presence or absence of LVA has been confirmed. Therefore, it is shown that by adding LVA, nonspecific mutagenesis can be suppressed while maintaining the mutation efficiency. In addition, in dCas-CDA-UGI-LVA, when the results of each single target with 100% (8 / 8) mutation were compared with each target, although the mutation frequency was low ( Fig. 9 (c) and (d)), but in dCas-CDA-UGI-LVA, 5 out of 8 clones analyzed successfully induced triple mutations ( Fig. 9 (b) and (d)). Thus, it was shown that the combination of UGI and LVA can achieve high mutation efficiency while suppressing nonspecific mutagenesis.

[0187] Then, six different genes (galK, xylB (xylulose kinase), manA (mannose-6-phosphate isomerase), pta (phosphate acetyltransferase), adhE (aldehyde-alcohol dehydrogenase), and tpiA (triose phosphate isomerase) were targeted and a stop codon was introduced ( Fig.10 ). It was found that in cells expressing sgRNA and dCas-CDA-UGI-LVA targeting 6 different genes, 7 out of 8 clones had mutations introduced into all target loci ( Fig.10 ).

[0188] Example 4 Multiple copy gene editing by target-AID

[0189] Multiple copy factors occupy a considerable amount of genomic sequence. Unlike recombination or other methods involving genome cutting, Target-AID can edit multiple loci at once using the same sgRNA sequence without inducing genomic instability. To demonstrate this idea, four sgRNAs were used to simultaneously target the four major transfer factors (TE: IS1, 2, 3, and 5) in the E. coli genome. 10, 12, 5, and 14 loci for IS1, 2, 3, and 5 can be specifically amplified using unique PCR primers for each locus. The sgRNA is designed to include the universal sequence of the transposase gene of each TE, introducing a stop codon ( Fig.11 ). E. coli Top10 cells were transformed with two plasmids expressing dCas-CDA-UGI-LVA and four target sgRNAs, respectively. The sequence of isolation and verification of IS-edited cells is shown in Fig.12 , the details are described below. After double transformation and selection, the colonies were amplified by PCR, and sequencing was first performed at IS5-1, IS5-2, IS5-11, and IS5-12 sites. The efficiency of the IS5 target was determined to be poor. Among the 4 colonies analyzed, 1 colony contained 3 mutation sites and 1 heterologous genotype site (IS5-1). Then, the cells were suspended in a liquid culture medium, spread on a plate, and the colonies were separated again. Among the 8 colonies, 3 colonies contained mutations in IS5-1. For 2 of the colonies, further determination of the sequence of the remaining 24 IS loci showed that although all mutation sites were contained, 1 incomplete heterologous genotype site (IS5-5) was contained. Then, the cells were suspended and spread, and 4 clones of the 6 re-isolated clones containing mutations in IS5-5 were obtained. When sequencing one of the clones at the IS5 site, it was determined that it contained 1 heterologous genotype site (IS5-2). Eight clones were isolated again, and six of them contained mutations in IS5-2. Two clones were expanded on non-selective medium to obtain cells that had lost the plasmid. The genome of the cells was then extracted and sequenced, and mutations were confirmed at all IS sites ( Fig.11 ), in order to further evaluate the off-target effects of the entire genome, whole genome sequencing was performed. The results showed that 2 of the 34 potential off-target sites from the reference genome had mutations, and the reference genome contained consistent sequences within 1 to 8 bases close to the PAM (Table 5).

[0190] [Table 5]

[0191] List of IS off-target candidate sites evaluated by whole-genome sequencing

[0192]

[0193] The area shows the target site in the DH10B database. The chain shows the direction of the target sequence. The predicted off-target sequence is determined in the manner described in this specification. The mismatch shows the number of mismatches between the target sequence and the off-target sequence. The mismatched nucleotides are emphasized in bold. The gray box shows the frequency of mutations from C to T in each emphasized sequence.

[0194] Example 5 Comparison of E. coli transformation efficiency of expression vectors

[0195] Based on the pRS315 vector, yeast expression vectors encoding LbCpf1 (SEQ ID NOs: 326 and 327) as Cas effector proteins, YAASV and YALAA as protein degradation tags (vector 3685: Cpf1-NLS-3xFlag-YAASV (SEQ ID NO: 328), vector 3687: Cpf1-NLS-3xFlag-YALAA (SEQ ID NO: 329)), and a control vector without nucleic acid encoding a protein degradation tag (vector 3687: Cpf1-NLS-3xFlag (SEQ ID NO: 330)) were prepared. These vectors were used to verify the transformation efficiency of Escherichia coli. Fig.13 A schematic diagram of each vector is shown. As shown in Table 6 below, the DNA solution containing each vector was adjusted to 2ng / μl, and 1μl (2ng) of the DNA solution was added to 20μl of E. coli Top10 competent cells for transformation. After that, 200μl of SOC was added, and the culture was resumed at 37°C for 1 hour, placed on ice for 5 minutes to stop proliferation, and then 1μl of 50mg / ml Amp was added. A portion (1μl and 10μl) of the culture solution was diluted with TE, spread on an LB+Amp plate, cultured overnight at 37°C, and the number of colonies was counted. The results are shown in Table 6.

[0196] [Table 6]

[0197]

[0198] When using vectors 3685 and 3686 having nucleic acids encoding protein degradation tags, the transformation efficiency of E. coli was shown to be higher than when using control vector 3687. Therefore, by using a protein degradation tag, even when the vector is a vector for heterologous biological expression, it is expected that the replication efficiency will be improved when the vector is replicated in bacteria such as E. coli.

[0199] This application is based on Japanese Patent Application No. 2017-225221 (filing date: November 22, 2017) filed in Japan, the entire contents of which are incorporated herein by reference.

[0200] Industrial Applicability

[0201] According to the present invention, a low-toxic vector that can be stably amplified even in a host bacterium and a genome editing complex encoded by the vector are provided. According to the genome editing method using the vector and nucleic acid modification enzyme of the present invention, the gene of the host bacterium can be modified while suppressing non-specific mutations, etc. This method does not rely on host-dependent factors such as RecA, and is therefore applicable to a wide range of bacteria and is very useful.

Claims

1. A complex, which is a complex obtained by binding a nucleic acid sequence recognition module to a protein degradation tag, wherein the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in double-stranded DNA, and the protein degradation tag is composed of (i) a peptide containing three residues of a hydrophobic amino acid at the C-terminus or (ii) a peptide containing three residues of an amino acid at the C-terminus in which at least a part of the amino acid residues is substituted with serine, wherein the three amino acid residues are leucine-valine-alanine, leucine-alanine-alanine, alanine-alanine-valine or alanine-serine-valine, wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of Cas or both of the DNA cleavage abilities are inactivated, wherein the complex is a complex obtained by binding a CRISPR-Cas system to a protein degradation tag, wherein the complex is bound to a nucleic acid modification enzyme, the nucleic acid modification enzyme is a deaminase or a DNA glycosylase, and the complex is bound to a base excision repair inhibitor.

2. The complex according to claim 1, wherein The complex converts one or more nucleotides at the target site into one or more other nucleotides or deletes them, or inserts one or more nucleotides into the target site.

3. A nucleic acid encoding the complex according to claim 1 or 2.

4. A method for modifying a target site of a double-stranded DNA of a bacterium, or regulating the expression of a gene encoded by the double-stranded DNA near the site, the method comprising the following steps: A complex obtained by binding a nucleic acid sequence recognition module and a protein degradation tag is contacted with the double-stranded DNA, wherein the nucleic acid sequence recognition module specifically binds to a target nucleotide sequence in the selected double-stranded DNA, and the protein degradation tag is composed of (i) a peptide comprising three residues of a hydrophobic amino acid at the C-terminus or (ii) a peptide comprising three residues of an amino acid at the C-terminus in which at least a part of the amino acid residues is substituted with serine, wherein the three amino acid residues are leucine-valine-alanine, leucine-alanine-alanine, alanine-alanine-valine or alanine-serine-valine, wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of Cas or both of the DNA cleavage abilities are inactivated, wherein the complex is a complex obtained by binding a CRISPR-Cas system and a protein degradation tag, wherein the complex is bound to a nucleic acid modification enzyme, the nucleic acid modification enzyme is a deaminase or a DNA glycosylase, and the complex is bound to a base excision repair inhibitor.

5. The method of claim 4, wherein: The method comprises the following steps: converting one or more nucleotides at the target site into one or more other nucleotides or deleting them, or inserting one or more nucleotides at the target site.

6. The method according to claim 4 or 5, wherein Two or more nucleic acid sequence recognition modules that specifically bind to different target nucleotide sequences are used.

7. The method of claim 6, wherein: The above-mentioned different target nucleotide sequences exist in different genes.

8. The method according to claim 4 or 5, wherein The contact between the double-stranded DNA and the complex is performed by introducing a nucleic acid encoding the complex into bacteria having the double-stranded DNA.

Images