VpCas9 protein double-site mutant and application thereof in gene editing

Abstract

The invention discloses a VpCas9 protein double-site mutant and an application of the VpCas9 protein double-site mutant in gene editing. The invention firstly provides a homologue VpCas9 protein of Cas9, the amino acid sequence of the homologue VpCas9 protein is shown as SEQ ID No.5, and compared with SpCas9, the homologue VpCas9 protein has a better editing effect in the aspects of gene editing efficiency, PAM compatibility or specificity and the like; in order to further improve the gene editing effect of the VpCas9 protein in genome editing, the VpCas9 protein is subjected to double-site mutation, the VpCas9 protein double-site mutant is obtained, and compared with SpCas9 protein or VpCas9 protein, the VpCas9 protein double-site mutant has a better gene editing effect in genome editing, and the gene editing effect of the VpCas9 protein is improved. The method has an important application prospect in genome editing of plants, animals or microorganisms.

Description

Technical Field

[0001] The present invention relates to mutants of Cas9 protein and their applications, and particularly to double-site mutants of VpCas9 protein and their applications in gene editing, belonging to the field of mutants of VpCas9 protein and their applications. Background Art

[0002] Compared with gene editing technologies such as ZFN and TALEN, the CRISPR-Cas9 system can better recognize target genes, and the CRISPR-Cas9 system consists of crRNA and Cas9 protein, with a simple structure, and only a pair of primers need to be constructed. Therefore, the CRISPR-Cas9 gene editing technology has advantages such as higher editing efficiency, simpler operation, low cost, and wide editing range.

[0003] Currently, three types of CRISPR-Cas systems have been discovered: type I, type II, and type III. Among them, the components of the type II system are relatively simple, mainly relying on the Cas9 core protein. Under the mediation of RNA, the Cas9 protein can recognize the target sequence for cleavage, causing double-strand breaks (DSBs) in DNA. On this basis, various genetic operations such as gene targeting, gene site-directed insertion, and gene repair can be carried out at specific sites of the genome. However, existing Cas9 proteins and their mutants all have certain limitations to varying degrees in terms of editing efficiency, PAM (protospacer adjacent motif) compatibility, and specificity, which affect their effectiveness and flexibility in broader genome editing applications and urgently need to be improved. Summary of the Invention

[0004] One object of the present invention is to provide a double-site mutant of VpCas9 protein, a homolog of Cas9, and its encoding gene; Another object of the present invention is to provide a vector and a host cell containing the said encoding gene; A third object of the present invention is to provide a CRISPR-Cas system, the system comprising a VpCas9 mutant of Cas9; A fourth object of the present invention is to apply the VpCas9 protein mutant and the CRISPR-Cas system containing the VpCas9 protein mutant to gene editing, editing of target nucleic acids, gene cleavage, detection and / or diagnosis of target nucleic acids, or preparation of targeted gene therapy drugs, etc.

[0005] The above objects of the present invention are achieved by the following technical solutions: One aspect of the present invention is to provide a double-site mutant of VpCas9 protein, a homolog of Cas9; The present invention first provides a Cas9 homolog VpCas9 protein, whose amino acid sequence is shown in SEQ ID No.5. The present invention mines and transforms Cas9 through a deep learning model to obtain a Cas9 homolog VpCas9 protein, which has better editing effects in gene editing efficiency, PAM compatibility or specificity than SpCas9. In order to improve the gene editing effect of VpCas9 protein in genome editing, the present invention performs a double-site mutation on the VpCas9 protein to obtain a VpCas9 protein double-site mutant with better gene editing effect in genome editing.

[0006] In a preferred specific embodiment of the present invention, the VpCas9 protein double-site mutant is obtained by subjecting the amino acid sequence shown in SEQ ID No. 5 to any one of V623I-I439L, V623I-E372K or V623I-I526V double-site mutations; wherein the amino acid sequences of the double-site mutants V623I-I439L, V623I-E372K, and V623I-I526V are shown in SEQ ID No. 11, SEQ ID No. 12, and SEQ ID No. 13, respectively.

[0007] In the present invention, the double-site mutant "V623I-I439L" means that the amino acid at position 623 of the amino acid sequence shown in SEQ ID NO.1 is mutated from valine (Val, V) to isoleucine (Ile, I) and the isoleucine (Ile, I) at position 439 is mutated to leucine (Leu, L); the descriptions of the remaining double-site mutants of the present invention are also deduced accordingly.

[0008] Another aspect of the present invention is to provide a gene encoding a double-site mutant of the VpCas9 protein.

[0009] Another aspect of the present invention is to provide a vector, which contains the coding gene and a regulatory element operably connected to the coding gene; wherein the vector can be selected from an expression vector, a cloning vector or a shuttle vector, etc.

[0010] In a preferred embodiment, the regulatory element is selected from one or more of a promoter, a terminator, an enhancer, a transposon, a leader sequence or a marker gene.

[0011] Another aspect of the present invention is to provide a CRISPR-Cas system, which includes a Cas protein and at least one sgRNA; the Cas protein can bind to the sgRNA, and the sgRNA includes a direct repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, wherein the Cas protein is a double-site mutant of the VpCas9 protein.

[0012] Another aspect of the present invention provides a kit for gene editing or gene cleavage, which includes the above-mentioned double-site mutant of the VpCas9 protein, or a polynucleotide encoding the double-site mutant of the VpCas9 protein, or a vector containing the polynucleotide sequence, or a CRISPR-Cas system containing the above-mentioned double-site mutant of the VpCas9 protein.

[0013] Another aspect of the present invention is to apply the double-site mutant of the VpCas9 protein, or a polynucleotide encoding the double-site mutant of the VpCas9 protein, or a vector containing the polynucleotide sequence, or a CRISPR-Cas system containing the above-mentioned double-site mutant of the VpCas9 protein, or a kit for gene editing or gene cleavage to aspects such as gene editing, gene targeting, gene cleavage, target nucleic acid detection and / or diagnosis, or preparation of targeted gene therapy drugs.

[0014] In a specific embodiment of the present invention, the gene editing, gene targeting or gene cleavage is carried out intracellularly and / or extracellularly; the gene editing or editing of the target nucleic acid includes modifying genes, knocking out genes, mutating genes or changing the expression level of gene products, etc.

[0015] In a specific embodiment of the present invention, the corresponding operations of the gene editing, gene targeting or gene cleavage can be carried out in prokaryotic cells or eukaryotic cells.

[0016] In the present invention, the Cas9 is mined and modified through a deep learning model, and finally the homologous VpCas9 protein of Cas9 is screened. The VpCas9 protein has better editing effects in terms of gene editing efficiency, PAM compatibility or specificity, etc.; further through sequence screening and optimization design, a double-site mutant with higher editing efficiency and extended PAM compatibility is obtained. Compared with the VpCas9 protein or the SpCas9 protein, the double-site mutants provided by the present invention have better gene editing effects in genome editing; the double-site mutant of the VpCas9 protein provided by the present invention has application prospects in genome editing of plants, animals or microorganisms.

[0017] Term definitions involved in the present invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

[0018] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides in single-stranded or double-stranded form, and their polymers. Unless specifically restricted, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically restricted, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs (such as phosphorothioates, phosphoroamidates, etc.) used in antisense technology. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as the explicitly specified sequences. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue ( Mol Cell. Probes 8:91-98 (1994)).

[0019] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, a description of a polypeptide applies equally to a description of a peptide and a description of a protein, and vice versa. The term applies to both naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked by covalent peptide bonds.

[0020] The terms "mutation" and "mutant" have their ordinary meanings herein, referring to a genetic, naturally occurring, or introduced change in a nucleic acid or polypeptide sequence, and their meanings are the same as those commonly known to persons skilled in the art.

[0021] The term "recombinant host cell line" or "host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f - mating, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrating vector such as a plasmid or can be integrated into the host genome. The host cell can be a prokaryotic cell or a eukaryotic cell.

[0022] The term "operatively connected" refers to a functional connection between two or more elements, and the operatively connected elements may be adjacent or non-adjacent.

[0023] The term "target sequence" refers to a polynucleotide targeted by the guide sequence in the gRNA, such as a sequence complementary to the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote the formation of the CRISPR / Cas complex (including the Cas protein and the gRNA). Description of the Drawings

[0024] Figure 1 Results of protein purification of SpCas9 and VpCas9; wherein, "Sp" is SpCas9 and "Vp" is VpCas9.

[0025] Figure 2 Results of detection of PAM and cleavage pattern; A) PAM preference of SpCas9; B) cleavage pattern of SpCas9; C) PAM preference of SpCas9; D) cleavage pattern of SpCas9.

[0026] Figure 3 Results of detection of in vitro nucleic acid fragment cleavage efficiency; A) Gel images of detection of nucleic acid fragment cleavage efficiency of SpCas9 and VpCas9; B) Grayscale analysis of the generated small fragments by imageJ.

[0027] Figure 4 Results of design of VpCas9 mutants and detection of qPCR activity; A) 12 single-point mutants were designed according to the CasMiner characteristic matrix of VpCas9 and the conserved matrix of PSAP; B) Process of detecting Cas9 editing efficiency by qPCR; C) Editing activities of 12 single-point mutants; D) Editing activities of double-point mutants; In subfigure D), t-test was used to verify whether there was a significant difference between the wild type and the mutants, ns, P>0.05; *, P<0.05.

[0028] Figure 5 Schematic diagram of a gene editing vector constructed with the mCherry gene as the target site in a transgenic maize material carrying the mCherry gene.

[0029] Figure 6 Electrophoresis diagram of the PCR amplification results of DNA extracted from protoplasts.

[0030] Figure 7 Statistical results of the editing method and editing efficiency of a transgenic maize material carrying the mCherry gene using a gene editing vector. Detailed Description of the Invention

[0031] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the described embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0032] Experimental Materials and Methods 1. Model Prediction The protein sequence data collected was predicted using the CasMiner (Registration Number: 2023SR0464752) software, and potential new Cas9 sequences were screened out for further analysis based on the model scores of the sequences.

[0033] 2. Protein Expression and Purification The recombinant plasmid containing the target gene and His tag was heat-shock transformed into the competent cells of Escherichia coli BL21(DE3), and positive monoclonal colonies were obtained through positive identification. Then, the positive monoclonal colonies were placed in 50 mL of LB (lysogeny broth) medium containing kanamycin (50 μg / mL) and cultured in a constant temperature shaker at 37 °C and 200 rpm until the OD600 value was between 0.6 and 0.8. Then, 20 μL of 1 mol / L IPTG was added. Subsequently, the bacterial liquid system was placed under low-temperature induction conditions of 16 °C and 200 rmp for 18 hours. The cells were collected at 8000 rmp for 10 minutes and resuspended in 8 mL of 20 mmol / L phosphate (PB) buffer (pH = 7.0). Then, the cells were disrupted by ultrasonic waves with a power of 35 W, disrupted for 4 seconds and paused for 4 seconds, and disrupted on an ice-water mixture for a total of 10 minutes. The supernatant after disruption was centrifuged at 8000 rmp and 4 °C for 30 minutes. Subsequently, after elution with NTA40 buffer (containing 40 mmol / L imidazole), the eluate of NTA200 buffer (containing 200 mmol / L imidazole) was directly collected. The collected eluate was dialyzed overnight and concentrated with polyethylene glycol 8000 (PEG800), and finally the target protein could be obtained.

[0034] 3. PAM Preference Determination The PAM library and sgRNA were diluted to 200 ng / μL and 2 pmol / μL respectively. Then, the purified Cas9 protein was quantified using a BCA protein quantification kit and diluted to 100 ng / μL. In the presence of Mg 2+Add 8 pmol (4 uL) of sgRNA and 300 ng of Cas9 protein to the reaction solution, react at 37 °C for 10 minutes to form an RNP complex. Then add 200 ng of the PAM library fragment and react at 37 °C for 20 minutes. Next, add a terminator containing 0.5% SDS, 150 mmol / L EDTA, and pH = 8.0 to terminate the reaction. Finally, perform next-generation sequencing on the reaction system.

[0035] 4. In vitro cleavage of the target fragment In the reaction solution containing Mg 2+ Add 8 pmol (4 uL) of sgRNA and 300 ng of Cas9 protein, react at 37 °C for 10 minutes to form an RNP complex. Then add 200 ng of the nucleic acid fragment to be cleaved to the RNP system and react at 37 °C for 20 minutes. Finally, perform nucleic acid electrophoresis and analyze the cleavage results of Cas9 using imageJ.

[0036] 5. qPCR detection of cleavage efficiency Add 2500 ng of the genome of BMLacZ engineered Escherichia coli containing the cleavage fragment to the RNP system, then inject sterile water to 20 μL and digest at 37 °C for 20 minutes. After diluting the digestion system 125-fold, add 1 μL of the diluted solution to the qPCR reaction system. Finally, perform the reaction and fluorescence detection in a real-time fluorescence quantitative PCR instrument. Calculate 2 -ΔΔCt to reflect the gene editing efficiency of Cas9.

[0037] Experimental Example 1 Gene mining and protein expression and purification of VpCas9 protein 1. Gene mining of VpCas9 protein In this experiment, predictive analysis was performed on the "representative genomes" from the EMBL database (https: / / progenomes.embl.de / data / repGenomes / progenomes3.proteins.representatives.fasta.bz2). Potential Cas9s were screened by setting the sequence length range to 1301 - 1400 amino acid residues, and the number of Repeats in the genomes corresponding to Cas9 was analyzed using the CRISPR Recognition Tool (CRT). Finally, a sequence with a probability of 99.9703%, 56 Repeats, and originating from Vagococcus penaei strain CD276T, 633807.SAMN06245872.BW732_04735, was screened out and named VpCas9. The predictive analysis data are shown in Table 1.

[0038] Table 1 Prediction and analysis results of CasMiner

[0039]

[0040] Among them, the amino acid sequence of VpCas9 protein is shown as SEQ ID No.5, and the amino acid sequence of SpCas9 protein is shown as SEQ ID No.6.

[0041] 2. Expression and purification of VpCas9 protein The protein sequence of VpCas9 was codon-optimized for Escherichia coli strains and the sequence was inserted between NdeI and XhoI of pET-28a, and a TAA stop codon was added to the 3' end of the VpCas9 coding sequence. The designed vector retained a His tag His-His-His-His-His-His (HHHHHH) upstream of the protein sequence for subsequent purification tags.

[0042] The results of expression and purification are as Figure 1 shown, demonstrating that the proteins of SpCas9 and VpCas9 were successfully expressed and purified in this experiment.

[0043] Experimental Example 2 Verification experiment on PAM and cleavage mode of VpCas9 A 150 bp PAM fragment with 5'-NNNNN-3' and the corresponding sgRNA were synthesized. The PAM library sequence is shown as the following SEQ ID No.7: GGTGAAGAGAACAACATGGCTATTATTAAGGAGTTCATGCGTTTTAAGGTCCACATGGAGGGTTCCGTTAACGGTCATGAATTTgaaattgagggtgagggtgaNNNNAGACCATACGAAGCTTTTCAAACTGCTAAGTTGAAGGTCACC (SEQ ID No.7).

[0044] The sgRNA sequence of SpCas9 is shown as the following SEQ ID No.8: gaaattgagggtgagggtgaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttttt (SEQ ID No.8).

[0045] The sgRNA sequence of VpCas9 is shown as SEQ ID No.9 below: gaaattgagggtgagggtgaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTTAGTCCGTAAGCAACTATTCTAGTGGCACTGTCTCGGTGCtttttt (SEQ ID No.9).

[0046] Subsequently, the results of the PAM and cleavage pattern were analyzed.

[0047] The test results are as Figure 2 shown. The test results found that VpCas9 has an NGGV PAM (N: A / T / C / G, V: G / T). The first three bases of NGG in this PAM are the same as those of SpCas9, while VpCas9 shows a more obvious preference for guanine (G) and thymine (T) at the fourth position of the PAM ( Figure 2 A, 2C), thus introducing additional base restrictions. By analyzing the sequencing fragments, it was found that similar to SpCas9, VpCas9 produced significant double-strand cleavage activity at -3 to -4 nt upstream of the PAM, generating cleavage nicks of 75.52% and 76.91% in the target sequence (TS) and non-target sequence (NTS), respectively ( Figure 2 B, 2D).

[0048] Test Example 3 Detection Test of the Basic Cleavage Ability of VpCas9 To further detect the basic cleavage ability of VpCas9 and SpCas9, a nucleic acid fragment with a length of 1,657 bp was designed. This nucleic acid fragment can be cleaved into 600 bp and 1,057 bp, and can be used to detect the cleavage activity of VpCas9 and SpCas9 in vitro. The nucleotide sequence of this nucleic acid fragment is shown as SEQ ID No.10.

[0049] The detection results are as Figure 3 shown: The results of the small fragment in vitro cleavage experiment showed that VpCas9 and SpCas9 can use each other's sgRNA to cleave the nucleic acid fragment ( Figure 3 A), and VpCas9&Vp-sgRNA showed the largest gray value ( Figure 3 B), which also indicated that VpCas9 has an in vitro cleavage efficiency comparable to that of SpCas9.

[0050] Test Example 4 Design of Mutants of VpCas9 and Detection Test of the Cleavage Efficiency of Mutants To further improve the activity of VpCas9, mutant design of VpCas9 was carried out in this experiment. First, the protein sequence of VpCas9 was submitted using jackhmmer, and homologous sequences of VpCas9 were retrieved from the UniRef90 database. Second, the features of the homologous sequences were extracted using Grad-CAM of CasMiner, and the feature matrices were summed and divided by the number of homologous sequences as the feature matrices to assist in the mutation of VpCas9. At the same time, the conserved (functional) matrix of VpCas9 was obtained through position-specific amino acid probability (PSAP). The score differences (Diff) between the optimal mutants and the wild type at each site in the feature matrix and the conserved (functional) matrix were calculated respectively. Under the condition of ensuring the consistency of the optimal mutants at the same site, the top 12 single-site mutation points (total score less than 30) were selected by sorting and adding the two Diffs as candidate mutation points, and the process is as shown in Figure 4 Figure A; To more precisely detect the editing efficiency of VpCas9 mutants, the qPCR method was used to detect the editing efficiency of Cas9, and the principle is as shown in Figure 4 Figure B.

[0051] The analysis results showed that the editing activities of 9 out of the 12 designed mutants (VpCas9-V623I, VpCas9-E372K, VpCas9-T437P, VpCas9-I526V, VpCas9-F573L, VpCas9-D1080G, VpCas9-S438F, VpCas9-I439L, VpCas9-A110D) were improved compared with the wild type. Among them, the mutant VpCas9-V623I had the best cleavage activity ( Figure 4 Figure C).

[0052] Based on the best single-site mutation VpCas9-V623I, mutation sites with better efficiency than the wild type were further stacked on this basis, and 8 double-site mutants were designed and their activities were verified. Finally, it was found that the editing activities of three double-site mutants were significantly improved compared with VpCas9-V623I ( Figure 4 Figure D), and these three double-site mutants were VpCas9-V623I-I439L (VPM2-1), VpCas9-V623I-E372K (VPM2-2), and VpCas9-V623I-I526V (VPM2-3).

[0053] Among them, the amino acid sequence of VpCas9-V623I-I439L (VPM2-1) is shown in SEQ ID No. 11, the amino acid sequence of VpCas9-V623I-E372K (VPM2-2) is shown in SEQ ID No. 12, and the amino acid sequence of VpCas9-V623I-I526V (VPM2-3) is shown in SEQ ID No. 13.

[0054] Experimental Example 5 Application Test of Three Double-Site Mutants of VpCas9 in Gene Editing of Transgenic Maize Materials Transgenic material: Transgenic maize material with mCherry gene; Three double-site VpCas9 protein mutants tested: VpCas9-V623I-I439L (VPM2-1), VpCas9-V623I-E372K (VPM2-2), VpCas9-V623I-I526V (VPM2-3).

[0055] 1. Construction of CRISPR / Cas9 Gene Knockout Vector 1.1 Primers The designed primer sequences are shown in Table 2.

[0056] Table 2 Primer Sequences

[0057] 1.2 sgRNA Sequence Screening According to the off-target effect score and targeting activity parameters, two sgRNA sequences with higher editing efficiency were selected for mCherry: sgRNA1: GGAGCGCGTGATGAACTTCGAGG (SEQ ID No. 24); sgRNA2: GGAACAGTACGAACGCGCCGAGG (SEQ ID No. 25); 1.3 Vector Construction The steps for vector construction are as follows: 1. The vector backbone was modified using the 62sk vector, and Thermo Fisher's rapid restriction endonuclease Sna BⅠ and Not1. Digest the vector. The digestion system is to use 1 μL of fast digestion enzyme for every 1 μg of vector plasmid, place it in a 37°C metal bath for 30 minutes, and then perform agarose gel electrophoresis later. 2. The ZmU6 promoter and sgRNA are synthesized by the company. The Cas9 and mutant gene sequences are PCR amplified using the prokaryotic vector plasmid as a template, and the amplified samples are subjected to agarose gel electrophoresis. 3. The concentration of the agarose gel used is 1.2%, and it is prepared using TAE buffer. Run the electrophoresis apparatus at 130 V for 30 minutes. 4. After the DNA electrophoresis is completed, quickly cut the gel containing the vector backbone and other target DNA fragments under ultraviolet light, try to remove the liquid on the gel surface, and remove the excess gel. Put it into a clean centrifuge tube and weigh it. If the gel weighs 100 mg, it can be regarded as 100 μL (100 mg ≈ 100 μL). 5. Add 3 times the volume of solution GSB, melt the gel in a 55°C water bath for 6 - 10 minutes, mix intermittently (2 - 3 minutes) to ensure that the gel block is completely melted. 6. Wait for the melted gel solution to cool to room temperature, add it to the centrifugal column and let it stand for one minute, centrifuge at 10000×g for 1 minute, and discard the effluent. 7. Add 650 μL of solution WB, centrifuge at 10000×g for 1 minute, and discard the effluent. Centrifuge at 10000×g for 1 - 2 minutes to completely remove the residual WB. 8. Place the centrifugal column in a clean centrifuge tube, open the lid and let it stand for 1 minute to volatilize the residual ethanol completely. Add 30 - 50 μL of deionized water (pH > 7.0) to the center of the column, let it stand at room temperature for 1 minute, and centrifuge at 10000×g for 1 minute to elute the DNA. 9. Recombine the above elements onto the vector respectively by the method of homologous recombination. The recombination system used is 10 μL, including 5 μL of recombinase mix and a total of 5 μL of vector and fragment. Incubate it on a 50°C metal bath for 15 minutes. 10. The recombinant product obtained in the previous step needs to be transferred into DH5α. Take 4 tubes of 100 μL of competent cells, melt them on ice, add the recombinant product, mix gently, and let it stand on ice for 30 minutes. 11. Heat shock in a 42°C water bath for 45 seconds, quickly transfer it to an ice bath, and let it stand for 2 minutes. Then add 500 μL of antibiotic-free LB liquid medium to the centrifuge tube and resuscitate at 37°C / 200 rpm for 60 minutes. 12. Spread it on a solid medium containing kana antibiotic and culture it upside down in a 37°C incubator overnight. 13. The next day, pick monoclonal colonies into LB liquid medium for culture. Try to select round monoclonal colonies that are far apart and smooth, send them to a sequencing company for sequencing, and save the bacterial liquid after it is correct. Thus, the four gene knockout vectors SpCas9-mCherry, VpCas9-mCherry, VPM2-1-mCherry (VpCas9-V623I-I439L), VPM2-2-mCherry (VpCas9-V623I-E372K), and VPM2-3-mCherry (VpCas9-V623I-I526V) required for the experiment are obtained.

[0058] 2. Protoplast transformation 2.1 Preparation of stock solutions: 1. 0.8 M mannitol (50 mL): Weigh 7.3 g of mannitol and dissolve it in water, then make up the volume to 50 mL; 2. 1 M CaCl₂·2H₂O (50 mL): Weigh 7.35 g of CaCl₂·2H₂O and dissolve it in water, then make up the volume to 50 mL; 3. 0.2 M MES (10 mL): Weigh 0.390 g of MES and dissolve it in water, then make up the volume to 10 mL, and adjust the pH to 5.7; 4. 2 M KCl (5 mL): Weigh 0.746 g of KCl and dissolve it in water, then make up the volume to 5 mL; 5. 2 M NaCl (20 mL): Weigh 2.338 g of NaCl and dissolve it in water, then make up the volume to 20 mL; 6. 2 M MgCl₂·6H₂O (10 mL): Weigh 4.066 g of MgCl₂ and dissolve it in water, then make up the volume to 10 mL; 40% PEG-Ca 2+ : Prepare 4 mL according to Table 3, and prepare it 1 h in advance; Table 3 40% PEG-Ca 2+

[0059] W5 buffer: Prepare 200 mL according to Table 4 and store it at 4°C; Table 4 W5 buffer

[0060] MMg solution: Prepare 100 mL according to Table 5 and store it at 4°C.

[0061] Table 5 MMg solution

[0062] Enzyme solution: 1.5% Cellulase R10 (W / V); 0.4% Macerozyme R10 (W / V); 0.4 M D-mannitol; 20 mM KCl; 20 mM MES (pH 5.7); Heat it in a 55°C water bath for 10 min; After cooling to room temperature, add 10 mM CaCl₂; 0.1% BSA; Filter through a 0.45 μm filter.

[0063] 2.2 Preparation and transformation of maize mesophyll protoplasts The method for preparing and transforming maize mesophyll protoplasts is as follows: 1. Take the middle part of the second leaf of maize etiolated seedlings and cut it into strips of 0.5 - 1 mm with a blade; 2. Transfer the cut leaf filaments into a petri dish containing enzyme solution and digest at room temperature for 3 - 4 h in the dark (30 rpm on a horizontal shaker); 3. Add an equal volume of W5 to the petri dish, mix well, filter the enzyme solution through a 200 - mesh filter, centrifuge at 100 g for 1 min to precipitate the protoplasts; 4. Aspirate the enzyme solution, resuspend the precipitate with pre - cooled W5 buffer, and place it on ice for 30 min; 5. Take the above protoplast suspension and drop it onto a 0.1 mm hemocytometer; 6. After the protoplasts fill the counting chamber, observe under an ordinary optical microscope and measure the concentration of protoplasts with a cell counting chamber: calculate the number of protoplasts in the 4 corner large grids and the central large grid (a total of 5 large grids); 7. Calculate the number of protoplasts according to the formula, the number of protoplasts = the average number of total protoplasts in 5 large grids × 10 4 ; 8. Centrifuge the protoplasts at 4℃, 100 g for 1 min to precipitate; 9. Aspirate the supernatant, add MMg solution to make the final concentration of protoplasts about 10 6 cells / mL; 10. Prepare 20 - 40 μg (20 μL) of purified plasmid; 11. Add 200 μL of protoplasts and gently flick to mix; 12. Add 220 μL of 40% PEG - Ca 2+ solution and gently flick to mix; 13. Place at room temperature for 30 min; 14. Add 880 μL of buffer W5 and gently flick to mix; 15. Centrifuge at room temperature, 100 g for 1 min; 16. Aspirate the supernatant, add 1 mL of W5 buffer; 17. Incubate in the dark at room temperature for 12 - 16 h for DNA extraction.

[0064] 2.3 DNA Extraction The DNA extraction steps are as follows: 1. Add 500 μL of CTAB (VC 0.02 mg / 200 mL has been added) to the protoplasts and mix well; 2. Place the centrifuge tube in a 65℃ water bath for about 30 min, take it out and cool to room temperature, add 500 μL of chloroform, mix well and let it stand for 5 min; 3. Centrifuge at 12,000 rpm for 10 min, take the supernatant to a new centrifuge tube; 4. Add an equal volume of isopropanol, mix well and let it stand at room temperature for 5 min; 5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant; 6. Add 500 μL of 70% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 5 min to remove ethanol; 7. Air - dry the precipitate and add 30 μL of sterilized water to dissolve the DNA.

[0065] 2.4 PCR Amplification (1) Design primers according to the conventional PCR primer design principle (18 - 22 nt).

[0066] (2)The editing site should be within 10 - 100 bp of the forward or reverse primer, and the amplification length is 150 - 300 bp.

[0067] Add a bridging sequence to the front end of the forward primer reads1: 5’- CTTTCCCTACACGACGCTCTTCCGATCT-3’ (SEQ ID No.26) Add a bridging sequence to the front end of the reverse primer reads2: 5’- GTTCCTTGGCACCCGAGAATTCCA -3’ (SEQ ID No.27) mCherry1F: CTTTCCCTACACGACGCTCTTCCGATCTTCCTGTCCCCTCAGTTCATG (SEQ ID No.28); mCherry1R: GTTCCTTGGCACCCGAGAATTCCAGTAGATGAACTCGCCGTCCT (SEQ ID No.29); mCherry2F: CTTTCCCTACACGACGCTCTTCCGATCTAGACCACCTACAAGGCCAAG (SEQ ID No.30); mCherry2R: GTTCCTTGGCACCCGAGAATTCCA TTACAGCTCGTCATGAGAT (SEQ ID No.31).

[0068] (3)Using the DNA extracted from maize protoplasts as a template, perform PCR amplification with the primers "mCherry1F" and "mCherry1R, mCherry2R". For the protoplast DNA with the first editing site and two editing sites, perform PCR amplification with the three primers "mCherry1F" and "mCherry1R, mCherry2R". For the second editing site, perform PCR amplification with "mCherry2F" and "mCherry2R" to distinguish the number of reads with editing and without editing.

[0069] (4)PCR program: 95℃ for 3 min, (98℃ for 15 sec, 56℃ for 20 sec, 68℃ for 5 sec) for 32 cycles, 68℃ for 10 min.

[0070] 2.5 Purification of PCR products Use the DNA Gel Quick Purification Kit from Beijing TransGen Biotech Co., Ltd. for DNA gel recovery. The specific steps are as follows: (1) Add GSB solubilization solution to the centrifuge tube containing the agarose gel block, with a volume 3 times that of the gel block. Place the centrifuge tube on a 55°C metal bath and heat for 6 - 10 minutes. Take out the centrifuge tube every 2 minutes, shake it well, and observe whether the gel block has completely melted; (2) After the gel block has completely melted, take out the centrifuge tube and cool it to room temperature; (3) Use a pipette to aspirate the gel solution into the adsorption column. The adsorption column is placed in the collection tube, and centrifuged at 12000 rpm at room temperature for 1 minute. Discard the effluent and put the adsorption column back into the collection tube; (4) Add 600 μL of WB solution (add 80% anhydrous ethanol before use) to the adsorption column, centrifuge at 12000 rpm at room temperature for 1 minute, discard the effluent, and put the adsorption column back into the collection tube; (5) Centrifuge at 12000 rpm at room temperature for 2 minutes to completely remove the ethanol in the adsorption column. Place the adsorption column in a 1.5 mL centrifuge tube, open the lid, and let it stand for 5 minutes; (6) Add 30 μL of ddH2O to the adsorption column and let it stand for 2 minutes; (7) Centrifuge at 12000 rpm at room temperature for 1 minute to elute the recovered DNA. The recovered product can be stored at -20°C.

[0071] 2.6 Library construction process (1) After accurately quantifying the genomic DNA using the Qubit® 4.0 DNA Assay Kit to determine the amount of DNA to be added in the PCR reaction. Introduce Illumina bridge PCR compatible primers. Prepare the reaction system shown in the following table in a sterile PCR tube (200 μL): Table 6 PCR reaction system

[0072] (2) Gently pipette or vortex to mix evenly, and briefly centrifuge to spin the reaction solution to the bottom of the tube. 3. Place the PCR tube in the PCR instrument for amplification. The PCR reaction conditions are: 95°C, 3 min →→ (94°C, 20 sec → 55°C, 20 sec → 72°C, 30 sec) 5 →→ 72°C, 5 min →→ 10°C, ∞.

[0073] 3. Experimental results 3.1 Design two target sites for mCherry, use SpCas9 as a control, construct spCas9, VpCas9 and their mutant vectors. The schematic diagrams of the constructed vectors are shown in Figure 5 .

[0074] 3.2 Protoplast transformation was performed on the correctly obtained plasmid, and protoplasts were collected to extract DNA, followed by PCR amplification. The electrophoresis pattern of the PCR amplification product is shown in Figure 6 . Samples 1-15 are the results of triple-primed double-site amplification, and the sample names are: 4Bsp-1, Vp-B-1, M2-1-B-1, M2-2-B-1, M2-3-B-1, 4Bsp-2, Vp-B-2, M2-1-B-2, M2-2-B-2, M2-3-B-2, 4Bsp-3, Vp-B-3, M2-1-B-3, M2-2-B-3, M2-3-B-3. Samples 16-30 are the results of double-primed amplification of the second site, and the sample names are: 2-2-4BSP-1, 2-2-VP-B-1, 2-2-M2-1-B-1, 2-2-M2-2-B-1, 2-2-M2-3-B-1, 2-2-4BSP-2, 2-2-VP-B-2, 2-2-M2-1-B-2, 2-2-M2-2-B-2, 2-2-M2-3-B-2, 2-2-4BSP-3, 2-2-VP-B-3, 2-2-M2-1-B-3, 2-2-M2-2-B-3, 2-2-M2-3-B-3.

[0075] 3.3 Determination of the concentration of the gel-extracted product To obtain a uniform long-cluster effect and high-quality sequencing data, a Qubit® 4.0 fluorescence quantifier was used for concentration determination, and the sample concentrations all met the experimental requirements.

[0076] Table 7 Concentrations of the recovered products

[0077] 3.4 Analysis of sequencing results By analyzing the editing results, three cases of fragment deletion and single-site editing were found. Through the statistical analysis of the editing efficiency results, the overall editing efficiencies of VpCas9, VPM2-1, VPM2-2, and VPM2-3 were all higher than that of SpCas9. Among them, the overall editing efficiency of VPM2-2 was the highest ( Figure 7 ).

Claims

1. A double-site mutant of VpCas9 protein, characterized in that, The double-site mutant is a double-site mutant obtained by performing any one of the double-site mutations of V623I-I439L, V623I-E372K, or V623I-I526V on the amino acid sequence of the VpCas9 protein shown in SEQ ID No.5; wherein, the amino acid sequences of the double-site mutants V623I-I439L, V623I-E372K, and V623I-I526V are shown in SEQ ID No.11, SEQ ID No.12, and SEQ ID No.13, respectively.

2. The coding gene of the double-site mutant according to claim 1.

3. A carrier, characterized in that, The vector contains the coding gene according to claim 2 and regulatory elements operably linked to the coding gene.

4. The carrier according to claim 3, characterized in that, The vector is selected from any one of expression vectors, cloning vectors, or shuttle vectors.

5. A recombinant host cell containing the vector according to claim 3 or 4.

6. A CRISPR-Cas system, the system comprising a Cas protein and at least one sgRNA; the Cas protein being capable of binding to the sgRNA, the sgRNA comprising direct repeat sequences and a spacer sequence capable of hybridizing with a target nucleic acid, characterized in that, The Cas protein is a double-site mutant of the VpCas9 protein according to claim 1.

7. A kit for gene editing or gene cleavage, characterized in that, The kit includes the double-site mutant of the VpCas9 protein according to claim 1, the coding gene according to claim 2, the vector according to claim 3 or 4, or the CRISPR-Cas system according to claim 6.

8. Use of the double-site mutant of the VpCas9 protein according to claim 1, the coding gene according to claim 2, the vector according to claim 3 or 4, or the CRISPR-Cas system according to claim 6 in gene editing, editing of target nucleic acids, or gene cleavage.

9. The application according to claim 8, wherein The gene editing or editing of target nucleic acids includes modifying genes, knocking out genes, mutating genes, or changing the expression level of gene products; the gene editing, editing of target nucleic acids, or gene cleavage is performed in prokaryotic cells or eukaryotic cells for corresponding operations.

10. Use of the double-site mutant of the VpCas9 protein according to claim 1, the coding gene according to claim 2, the vector according to claim 3 or 4, or the CRISPR-Cas system according to claim 6 in the preparation of drugs for detecting target nucleic acids or in the preparation of drugs for targeted gene therapy.

Images