New floury endosperm genes, molecular markers and their uses

Abstract

The present invention relates to markers for determining the floury endosperm trait and uses thereof. According to the present invention, the primer set for single nucleotide polymorphism (SNP) sites described in the present invention can be used to simply and accurately identify the floury endosperm of all rice varieties, especially japonica rice lines, at the early stage of breeding. Specifically, the floury endosperm evaluation of rice varieties can be used to screen early breeding lines or single F2 plants. In addition, the present invention can also be extended to processed products with rice as the main raw material.

Description

Technical Field

[0001] The invention relates to a gene of a new sequence for determining rice flour endosperm traits, a molecular marker for detection and its use, and a detection method. Background Art

[0002] Rice is the main source of income for farmers, accounting for 70% of South Korea's domestic agricultural income, but due to the westernization of dietary structure and the increase in consumption of functional grains, rice consumption continues to decline. According to data from the Korean Statistics Bureau in 2017, the annual per capita rice consumption decreased from 136.4kg in 1970 to 61.9kg in 2016, and the rice planting area decreased from 1.218 million hectares in 1975 to 779,000 hectares in 2016, which made the production base very fragile.

[0003] Wheat is a staple food crop like rice. Wheat can be made into flour after milling, and flour can be processed into food. That is, the wheat industry can be clearly divided into the "raw material industry" such as breeding and milling, and the "food industry" that develops and supplies a variety of processed products. Therefore, wheat is considered to be a crop with great potential in market expansion and added value. As for rice, in addition to making rice cakes, it can also produce about 300 kinds of processed foods, but in fact, about 220,000 tons of rice are used for processing in Korea (100,000 tons are imported and 120,000 tons are produced domestically), which is less than 5% of the total production. Most companies buy polished rice and grind it into rice flour, so the quality of rice flour varies, and the sales of rice products (about 1 trillion won in 2006) are only 2% of the beverage and food manufacturing industry (sales of 49 trillion won).

[0004] Since rice grains are very hard, wet grinding is often used in Korea, that is, the rice is ground after being soaked in water. However, when wet grinding is used, about 500 liters of rice water will be produced to produce 100 kg of rice flour, which has the problem of causing environmental pollution. In addition, in order to make the rice flour circulate, additional processes must be added to sterilize and dry the rice flour. Therefore, the processing cost of rice flour using wet grinding (500-700 won / kg) is more than twice that of dry grinding (200-300 won / kg). In recent years, with the addition of a large number of production equipment, semi-wet grinding technology has been partially put into use, but it has not completely solved the problem of increased production costs.

[0005] In order to produce competitive high-quality rice flour, in addition to the grinding method, the size of the powder particles (particle size) after grinding must also be considered. Since the physical and chemical properties of dough or processed products are largely controlled by the particle size distribution, it is very important to construct and maintain the particle size of rice flour according to the purpose. Generally, according to the physical properties of rice flour, the finer the powder, the smaller the change in dough hardness and the better the water absorption during dough mixing. Therefore, the finer the rice flour particles, the higher its quality and the higher the circulation price. However, due to the high hardness of rice grains, when using the low production cost dry grinding method, if you want to obtain fine particles of rice flour, you need greater mechanical force, which will cause the proportion of damaged starch granules to increase rapidly. Damaged starch granules will cause changes in the physical and chemical properties of the dough, which will lead to a decrease in the quality of rice flour. In recent years, technologies such as jet milling (Jet Mill) and turbine milling (Turbo Mill) have been developed to finely grind rice flour, but the burden of early equipment investment costs and production costs is large.

[0006] In summary, in order to successfully build a bulk raw material supply system centered on rice flour in South Korea to promote the development and consumption of rice processed foods, it is necessary to: 1) significantly reduce the cost of wastewater treatment in the rice flour production process and the cost of drying and sterilization before circulation; and 2) provide a specific solution that can crush rice to a micro-particle level and reduce the damage to starch granules. Considering the production cost, 1) the process is simple; 2) the grinding time is short; 3) dry grinding that produces almost no wastewater is more advantageous. In addition, in South Korea, dry grinding equipment for grinding wheat has formed a considerable scale, which can significantly reduce the cost of setting up production equipment.

[0007] Under the above technical background, research on the development of rice varieties with floury endosperm traits and related genetic markers has been actively carried out (Korean Patent No. 10-1226485), but it is still very limited.

[0008] Summary of the invention

[0009] Technical issues to be solved

[0010] The present invention is used to solve the above technical problems, and its purpose is to provide a new gene for determining the floury endosperm trait of rice, a protein encoded by the gene, a composition and a kit for identifying the floury endosperm trait based on the gene, and a method for identification.

[0011] The technical problems to be solved by the present invention are not limited to the problems mentioned above, and a person skilled in the art can clearly understand other problems not mentioned through the following description.

[0012] Technical solutions to the problem

[0013] To achieve the above-mentioned object of the present invention, the present invention provides a cytosolic pyruvate orthophosphate dikinase (cyOsPPDK) gene for determining the floury endosperm trait of rice as shown in SEQ ID No.2.

[0014] According to another aspect of the present invention, a recombinant vector comprising the gene is provided.

[0015] According to another aspect of the present invention, a transformant comprising the gene or the recombinant vector is provided.

[0016] The transformant may be rice.

[0017] According to another aspect of the present invention, a plant comprising the gene is provided.

[0018] According to another aspect of the present invention, a rice comprising the gene is provided.

[0019] According to another aspect of the present invention, a composition for identifying floury endosperm traits based on the cyOsPPDK gene is provided, which comprises a reagent capable of detecting a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0020] The base of the SNP marker present at the position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0) is A or T.

[0021] The reagent capable of detecting the single nucleotide polymorphism is a probe that specifically hybridizes to a polynucleotide or its complementary polynucleotide; or a primer that can amplify it, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the 19,722,254 bp position of chromosome 5 of the rice reference genome (IRGSP1.0).

[0022] The reagent capable of detecting the single nucleotide polymorphism is a primer set consisting of a forward primer shown in SEQ ID No. SEQ ID No. 3 and a reverse primer shown in SEQ ID No. 4; or a primer set consisting of an external forward primer shown in SEQ ID No. 5, an external reverse primer shown in SEQ ID No. 6, an internal forward primer shown in SEQ ID No. 7, and an internal reverse primer shown in SEQ ID No. 8.

[0023] According to another aspect of the present invention, a kit for identifying the floury endosperm trait based on the cyOsPPDK gene is provided, which comprises a composition for identifying the floury endosperm trait.

[0024] According to another aspect of the present invention, a method for identifying powdery endosperm traits based on the cyOsPPDK gene is provided, comprising the step of identifying a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0025] The base of the single nucleotide polymorphism (SNP) marker present at the corresponding position of 19,722,254 bp on chromosome 5 of the rice reference genome (IRGSP 1.0) is A or T.

[0026] The method for identifying the floury endosperm trait also includes: step (a), using genomic DNA separated from the sample as a template, reacting with a probe that specifically hybridizes with a polynucleotide or a polynucleotide complementary thereto; or a primer that can amplify the polynucleotide, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the position of 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0); and step (b), confirming the reactant.

[0027] The primers are a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4; or a primer set consisting of an external forward primer shown in SEQ ID No.5, an external reverse primer shown in SEQ ID No.6, an internal forward primer shown in SEQ ID No.7, and an internal reverse primer shown in SEQ ID No.8.

[0028] The method for identifying the floury endosperm trait further comprises the step of treating the reaction product of step (b) with a restriction enzyme.

[0029] The restriction enzyme is Hinf I.

[0030] The method for identifying the floury endosperm trait also includes: step (a), using genomic DNA separated from a sample as a template, reacting a polynucleotide or its complementary polynucleotide with a primer to achieve amplification, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of a polymorphic site of a single nucleotide polymorphism marker at a position corresponding to 19,722,254 bp of chromosome 5 of a rice reference genome (IRGSP 1.0); and step (b), confirming the amplified reactant.

[0031] The method for identifying the floury endosperm trait also includes: step (a'), using the genomic DNA separated from the sample as a template to perform a hybridization reaction with a probe that specifically hybridizes with the polynucleotide or its complementary polynucleotide, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0032] Effects of the Invention

[0033] According to the present invention, the new gene for determining the floury endosperm trait of rice described in the present invention can be used as the main target gene for developing plants with floury endosperm traits, and its single nucleotide polymorphism (SNP) can simply and accurately identify whether multiple rice varieties express floury endosperm traits in the early stage of breeding. Specifically, it can be used for plant floury endosperm evaluation in the screening stage of early breeding lines or single F2 plants. In addition, it can also be extended to processed products with rice as the main raw material, and can be used in the processing industry of processed rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1a : is an accompanying drawing showing the mapping-based FLO4-4 variant replication. In (A), the molecular markers and the number of recombinants are displayed using the precise genetic map of the FLO4-4 locus. The 33kb virtual contig consisting of the overlapping parts of the two BAC clones is distinguished by the electronic positioning (e-Landings) of two important markers in the rice reference genome (Os-Nipponbare-Reference-IRGSP-1.0). In (B), the comparison of the FLO4-4 gene structure and cDNA sequence can be shown as the base variation of exon 8 G->A, and the wild-type Gly-404 is induced to Asp-404 in FLO4-4. In the accompanying drawings, the white box represents the untranslated region, the black box represents the coding region, and the solid line represents the intron.

[0035] Figure 1b The figure shows the results of confirming single nucleotide polymorphism sites by comparing the base sequences of the PPDK1 (OS05G0405000-02) gene of Namil and Namil(SA)-FLO2.

[0036] Figure 2 The figure shows the sequences of candidate dCAPs primer sets for amplifying the explored single nucleotide polymorphism sites of Namil or Namil(SA)-FLO2 in dCAPS Finder 2.0.

[0037] Figure 31 is a diagram showing the base sequence of the fragment amplified by the dCAPs primer set according to the present invention and the restriction enzyme (HinfI) treatment site.

[0038] Figure 4 It is a figure which shows the electrophoresis result of Milyang No. 23, Namil and Namil (SA)-FLO2 (S542), using the method using the dCAPs primer set and restriction enzyme according to the present invention.

[0039] Figure 5 FIG. 1 is a diagram schematically showing the base sequence positions of the fragments amplified by the four-primer ARMS primer set according to the present invention.

[0040] Figure 6 1 is a diagram showing the following results based on the four-primer ARMS primer set according to the present invention: (a) the base sequence of the amplified fragment; and (b) the electrophoresis results of Miyang No. 23, Namil, and Namil (SA) -FLO2 (S542).

[0041] Figure 7 It is a figure showing the electrophoresis result of the hybridization progeny of Miryang 23 and Namil (SA)-FLO2, using the method using the dCAPs primer set and restriction enzyme according to the present invention.

[0042] Figure 8is a drawing showing the electrophoresis results of japonica rice varieties with similar genetic backgrounds, using the method using the primer set and restriction enzyme according to the present invention (1. Anmi, 2. Aranghyangchal, 3. Baekjinju, 4. Baekogkhal, 5. Boramchal, 6. Boramchan, 7. Borami, 8. Boseok, 9. Boseokchal, 10. Boseokheukchal, 11. Cheongnam, 12. Chindeul, 13. Chucheong, 14. Dabo, 15. Danmi, 16. Danpyeng, 17. Deuraechan, 18. Dodamssal, 19. Dongjin, 20. Dongjin 1, 21. Dongjinchal, 22. Geonganghongmi, 23. Geonyang 2, 24. Goami, 25. Goami 2. 26.Goami4, 27.Haepum, 28.Haiami, 29.Hanam, 30.Hanmaeum, 31.Heukjinmi, 32.Heukhyang, 33.Heukjinju, 34.Heuknam, 35.Heukseol, 36.Hongjinju, 37.Hopum, 3 8.Hwangkeumnuri, 39.Hwaseong, 40.Hwawang, 41.Hwayeong, 42.Hyangnam, 43.Hyeonpum, 44.Ilmi, 45.Ilpum, 46.Jukjinju, 47.Jukjinjuchal, 48.Heukhyangchal).

[0043] Fig. 9 It is a figure showing the electrophoresis result of the hybridization progeny of Miryang 23 and Namil (SA)-FLO2, using the method using the four-primer ARMS primer according to the present invention.

[0044] Fig.10is an accompanying drawing showing the electrophoresis results of japonica rice varieties with similar genetic backgrounds, using the method using the four-primer ARMS primer set according to the present invention (1. Anmi, 2. Aranghyangchal, 3. Baekjinju, 4. Baekogkhal, 5. Boramchal, 6. Boramchan, 7. Borami, 8. Boseok, 9. Boseokchal, 10. Boseokheukchal, 11. Cheongnam, 12. Chindeul, 13. Chucheong, 14. Dabo, 15. Danmi, 16. Danpyeng, 17. Deuraechan, 18. Dodamssal, 19. Dongjin, 20. Dongjin1, 21. Dongjininchal, 22. Geonganghongmi, 23. Geonyang 2, 24. Goami, 25. Goami2, 26. Goami 4. 27.Haepum, 28.Haiami, 29.Hanam, 30.Hanmaeum, 31.Heukjinmi, 32.Heukhyang, 33.Heukjinju, 34.Heuknam, 35.Heukseol, 36.Hongjinju, 37.Hopum, 38.Hwa ngkeumnuri, 39.Hwaseong, 40.Hwawang, 41.Hwayeong, 42.Hyangnam, 43.Hyeonpum, 44.Ilmi, 45.Ilpum, 46.Jukjinju, 47.Jukjinjuchal, 48.Heukhyangchal).

[0045] Fig.11 : is a figure showing the results of phenotypic analysis of Namil(SA)-flo2(S542) and Namil according to the present invention. Brown rice and cross-sectional views of Namil(SA)-flo2 and Namil are shown. Also, an electron microscope image of mature endosperm is shown. As indicated by the red arrow, starch granules are loosely filled with Namil(SA)-flo2. The yellow box shows the magnified area (indicated by a box in the 500 μm scale photo).

[0046] Fig.12 is a figure showing the results of analyzing FLO4-4 expression between Namil and Namil(SA)-flo2 at 10 DAF, wherein the values ​​shown are mean±SD (n=3). DETAILED DESCRIPTION

[0047] Hereinafter, the present invention will be described in detail.

[0048] The present invention provides a novel sequence gene that determines the floury endosperm trait of rice. The novel sequence gene of the present invention is a cytosolic pyruvateorthophosphate dikinase (cyOsPPDK) gene shown in SEQ ID No. 2 that determines the floury endosperm trait of rice.

[0049] The term "floury endosperm" used in the present invention refers to a mutation having a milky and opaque appearance similar to glutinous rice, and having the characteristics of loosely arranged starch granules. Dry and wet grinding are mostly used in rice flour manufacturing. Among them, dry grinding has a simple process, but has the disadvantage of increasing damaged starch granules; on the contrary, wet grinding has good processability, but has the limiting factors of time and cost consumption in the soaking and drying processes. In order to contribute to the activation of the rice processing industry, it is necessary to develop a variety of varieties for processing with corresponding characteristics for different uses and varieties with excellent flour-making properties, and such floury endosperm traits are important characteristics to overcome the shortcomings of existing dry grinding.

[0050] On the one hand, the Namil (SA) -FLO2 rice plant of the present invention refers to the following line: the mutation is induced by immersing Namil seeds in a dilute solution of sodium azide (NaN3) which acts as a chemical mutagen, and the Namil seeds are grown to plants (M1) through germination and seedling stages, and the offspring are developed to M7 by systematic breeding after harvesting M2 seeds from the M1 plants, thereby obtaining a genetically fixed mutant line. Compared with the existing Namil, the Namil (SA) -FLO2 has a similar straight chain-branch starch content composition, but its grain hardness is lower than that of ordinary rice, and high-quality rice flour with uniform powder quality and less damaged starch grains can be obtained by dry grinding. However, there is currently no technology for simply and accurately identifying the above varieties at the early stage of breeding, and specifically, the relevant gene markers are not known.

[0051] To this end, the inventors of the present invention analyzed the base sequence of the Namil (SA)-FLO2 rice variety, identified the gene that determines the floury endosperm trait (Experimental Example 1), and identified the single nucleotide polymorphism site closely related to the floury endosperm trait (Experimental Example 2). In addition, the inventors first developed a primer set targeting the single nucleotide polymorphism site, and experimentally proved that the technology using the primer set of the present invention can effectively identify the floury endosperm trait of rice varieties of the Japonica rice line.

[0052] The powdery endosperm trait of the present invention is determined by the PPDK gene of the new sequence. The pyruvate orthophosphate dikinase (PPDK) can reversibly convert pyruvate, ATP and orthophosphate and perform multiple functions in various plant cells, and encode PPDK proteins (cyOsPPDK and chOsPPDK, respectively) targeting the cytosol and chloroplasts. The chOsPPDK mRNA is structurally expressed in the photosynthetic apparatus, and the cyOsPPDK is only expressed in rice seeds (grains) grown after pollination. Generally, during the growth period of rice seeds, the cyOsPPDK is most strongly expressed in the milky stage, and the cyOsPPDK protein expression level is the highest about 10 days after pollination. After that, after the translation of threonyl-phosphorylation and protein decomposition, the cyOsPPDK protein level and activity all show a rapid decline according to the combined mechanism. In Nipponbare, the full-length genome of cyOsPPDK is 7656 bp, the cDNA includes 19 exons and is 2649 bp, and encodes a protein of 882 amino acids.

[0053] The cyOsPPDK of the present invention includes a variation of the wild-type cyOsPPDK gene, and thereby determines the floury endosperm trait of rice. The allele of the cyOsPPDK gene of the present invention is a recessive gene. The variant gene cyOsPPDK of the present invention maintains a high level of expression compared to the wild type during the grain filling stage after the milky stage (10 days after pollination).

[0054] In particular, there is a single nucleotide polymorphism (SNP) of G->A at the 8th exon site of the cyOsPPDK gene of the present invention (variation from C to T in the allele), and thus, in the amino acid sequence of the protein encoded by the cyOsPPDK gene of the present invention, there is a variation from glycine (G, Gly) to aspartic acid (D, Asp) (corresponding to the amino acid at position 404 of the single nucleotide polymorphism). As a result, the expression and activity of the protein can be maintained during the rice filling period while participating in the growth of rice seeds, thereby showing the powdery endosperm trait. From this aspect, the cyOsPPDK of the present invention can refer to a cyOsPPDK variant gene, a cyOsPPDK variant protein or a cyOsPPDK mRNA variant gene. In the present invention, the variant gene that determines the powdery endosperm trait is named cyOsPPDK, Namil (SA)-flo2, flo7 or FLO4-4, and the above names can refer to each other.

[0055] The cyOsPPDK gene of the present invention is represented by SEQ ID No. 2 and is deposited in GenBank with accession number MG267058.

[0056] The position of the cyOsPPDK gene of the present invention can be indicated based on the Rice Annotation Project Database (RAP-DB, http: / / rapdb.dna.affrc.go.jp / viewer / gbrowse / irgsp1 / ?name=chr02%3A1..105000). The cyOsPPDK gene locus of the present invention exists between BAC clones OSJNBb0006J12 and OJ1174_H11, and the floury endosperm trait is determined by the single nucleotide polymorphism (G->A) of the 8th exon of the cyOsPPDK variant gene.

[0057] The single nucleotide polymorphism is shown by comparison with the rice reference genome (IRGSP 1.0), which exists at the corresponding position of 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0), and its position corresponds to base 4055 in the gene sequence shown in SEQ ID No.1.

[0058] The term "gene" of the present invention refers to a genetic unit as a factor determining a trait, and can be regarded as a nucleic acid molecule or polynucleotide encoding a protein. The gene of the present invention may include a base sequence that is substantially homologous to the base sequence of SEQ ID No. 2 above. The substantially homologous base sequence described in the present invention refers to the following base sequence: any sequence different from the base sequence of the present invention is arranged so that it corresponds to the base sequence of the present invention to the greatest extent, and then the arranged sequence is analyzed using a program commonly used in the art (e.g., DNASIS and ClustalX), wherein the sequence contains a single nucleotide polymorphism present in the gene of the present invention while maintaining a minimum homology of 80%, more preferably a minimum homology of 90%, and most preferably a minimum homology of 95%.

[0059] According to another aspect of the present invention, a recombinant vector comprising the gene is provided. The vector system of the present invention can be constructed using a variety of methods known in the art, and specific methods are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

[0060] The vector of the present invention may be a typical vector for cloning or a vector for expression. In addition, the vector of the present invention may use prokaryotic cells or eukaryotic cells as hosts.

[0061] In the present invention, the vector is used as a binary vector for modifying traits, and can permanently express foreign genes in introduced plants. The vector is prepared by effectively linking a gene encoding a target protein downstream of a promoter.

[0062] The vector of the present invention is constructed by inserting the promoter of the present invention and the base sequence (gene) encoding the protein downstream of the promoter, using the existing vector for protein expression as the basic framework. In order to express the target gene, the recombinant vector may include a specific promoter.

[0063] According to another aspect of the present invention, the present invention provides a transformant comprising the gene or vector.

[0064] The term "transformant" in the present invention includes individuals after the gene of the present invention is inserted into the host as an exogenous gene according to genetic engineering methods; it also includes the following individuals, that is, in order to breed offspring individuals including the powdery endosperm trait determined based on the gene of the present invention, at least one individual including the gene of the present invention is hybridized with other individuals, thereby producing individuals of offspring strains having the gene of the present invention.

[0065] The transformant of the present invention can be prepared according to a method generally known in the art.

[0066] According to a preferred embodiment of the present invention, the transformant is a plant, more preferably rice.

[0067] Based on this aspect, the present invention can provide a cyOsPPDK variant gene; or a rice having the sequence shown in SEQ ID No.2.

[0068] In a specific example of the present invention, the gene that can determine the floury endosperm trait is the variant cyOsPPDK, and the floury endosperm shape is determined based on the single nucleotide polymorphism (G->A or C->T) of the 8th exon of the variant cyOsPPDK gene.

[0069] From this aspect, according to another aspect of the present invention, single nucleotide polymorphisms for novel sequence genes that determine floury endosperm traits can be provided.

[0070] Specifically, based on the information of the rice reference genome (IRGSP 1.0) and the transcriptome information of the PPDK1 candidate gene on chromosome 5, the base sequences of 19,718,785-19,726,340 (7,556 bp) within PPDK1 of Namil and FLO4-4 (Namil (SA) -flo2) of the present invention were analyzed according to the base sequence of OS05G0405000-02 (19,718,538-19,737,605 bp), and compared with the reference genome Nipponbare (IRGSP 1.0). As a result, 1 SNP was found between Namil and Namil (SA) -flo2, and the SNP was present at the corresponding position of 19,722,254 bp on chromosome 5 of the rice reference genome (IRGSP 1.0), which corresponds to SEQ ID No.1 (polynucleotide sequence derived from Namil, ch5:19,726,340-19,718,785) or base 4055 in the sequence of SEQ ID No.2, base 4093 in SEQ ID No.9.

[0071] More specifically, the base of the SNP marker at the corresponding position of 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0) may be A. More specifically, the G at position 4055 in the polynucleotide sequence of SEQ ID No. 1 and position 4093 in the polynucleotide sequence of SEQ ID No. 9 is replaced by A, whereby, in the protein sequence encoded by the gene, glycine (Gly, G) as an amino acid is mutated into aspartic acid (Asp, D), thereby resulting in the powdery endosperm trait.

[0072] Thus, in the single nucleotide polymorphism, the G at position 4055 of the polynucleotide sequence shown in SEQ ID No. 1 is changed to A, or the G at position 4093 of the polynucleotide sequence shown in SEQ ID No. 9 is changed to A.

[0073] In the term "Single Nucleotide polymorphism (SNP)" used in the present invention, "polymorphism" refers to the presence of two or more alleles in one locus, and a single nucleotide polymorphism is defined as a polymorphic site where only a single base is different. In addition, "allele" refers to multiple forms of a gene present in the same locus on the same chromosome, and SNP has bialleles.

[0074] The single nucleotide polymorphism of the present invention can be used to identify the floury endosperm trait. According to another aspect of the present invention, a composition for identifying the floury endosperm trait based on the gene of claim 1 is provided, which comprises a reagent capable of detecting a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0075] The composition for identifying the floury endosperm trait according to the present invention can be used to identify the floury endosperm trait of all rice varieties including japonica rice lines. According to a specific example, the floury endosperm of the Namil mutant offspring line Namil (SA)-FLO2 can be identified, but the invention is not limited thereto. In addition, the composition can be applied not only to offspring lines of hybridization of two or more rice varieties, but also to the processed products produced with the aforementioned rice varieties as the main raw materials.

[0076] The reagent capable of detecting the single nucleotide polymorphism is a probe that specifically hybridizes to a polynucleotide or its complementary polynucleotide; or a primer that can amplify it, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the 19,722,254 bp position of chromosome 5 of the rice reference genome (IRGSP1.0).

[0077] The term "primer" used in the present invention is a base sequence with a short free 3' hydroxyl group at the terminal, which can form a complementary template and base pair, and a short sequence that acts as the starting point of the replication template chain. The length of the primer varies according to the purpose of use, and is usually composed of 15 to 30 bases. The primer sequence does not need to be completely complementary to the template, and its degree of complementarity should be enough to hybridize with the template. The primer can amplify a DNA fragment, and the DNA fragment has a polymorphic site by hybridizing with a DNA sequence containing the polymorphic site.

[0078] According to the purpose of the present invention, the primers are capable of amplifying single nucleotide polymorphism sites closely related to the powdery endosperm trait. As a non-limiting example, the primers can be a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4; or a primer set consisting of an external forward primer shown in SEQ ID No.5, an external reverse primer shown in SEQ ID No.6, an internal forward primer shown in SEQ ID No.7, and an internal reverse primer shown in SEQ ID No.8.

[0079] Alternatively, the reagent capable of detecting the single nucleotide polymorphism can be a probe that specifically hybridizes to a polynucleotide or its complementary polynucleotide; or a primer that can amplify it, wherein the polynucleotide consists of 10 to 300 consecutive nucleic acid sequences including a single nucleotide polymorphism site present at position 4055 of the polynucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2, or at position 4093 of the polynucleotide sequence shown in SEQ ID No.9.

[0080] According to a specific example of the present invention, the reagent can be a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4; or a primer set consisting of an external forward primer shown in SEQ ID No.5, an external reverse primer shown in SEQ ID No.6, an internal forward primer shown in SEQ ID No.7, and an internal reverse primer shown in SEQ ID No.8.

[0081] Alternatively, preferably, the primer set can be composed of any base sequence having more than 80% homology, more preferably more than 90% homology, further preferably more than 95% homology, and most preferably more than 99% homology with the respective base sequences shown in SEQ ID No.3 and SEQ ID No.4, and the primer set can include, without restriction, the base sequence for amplifying the aforementioned single nucleotide polymorphism site.

[0082] Preferably, the primer set can be composed of any base sequence having more than 80% homology, more preferably more than 90% homology, further preferably more than 95% homology, and most preferably more than 99% homology with the respective base sequences shown in SEQ ID No.5 to SEQ ID No.8, and the primer set can include, without restriction, the base sequence for amplifying the aforementioned single nucleotide polymorphism site.

[0083] Primer or probe of the present invention can be synthesized using phosphoramidite solid support method or other known methods. This type of nucleotide sequence can also be modified using many known means in the art. The non-limiting examples of the above modifications include: methylation, capping, replacement of one or more natural nucleotides with homologues, and modifications between nucleotides, such as by uncharged linkers (such as, methylphosphonate, phosphotriester, phosphoramidate, carbamate) or charged linkers (such as phosphorothioate, phosphorodithioate etc.).

[0084] And, according to another aspect of the present invention, a kit for identifying floury endosperm traits based on the cyOsPPDK (cytosolic pyruvate orthophosphate dikinase) gene for determining floury endosperm traits of rice is provided, comprising the composition for identifying floury endosperm traits.

[0085] According to the kit of the present invention, in addition to the composition, it can also additionally contain DNA polymerase, dNTP, and PCR buffer that are helpful for performing PCR reaction. In addition, the kit of the present invention can also include components required for performing electrophoresis to confirm whether the PCR product is amplified, or a reference table for identifying known varieties. In addition, the kit can also include known components that are helpful for probe reaction.

[0086] Furthermore, according to another aspect of the present invention, there is provided a method for identifying the powdery endosperm trait based on the gene of claim 1, the method comprising the step of confirming a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0087] The single nucleotide polymorphism may exist at position 4055 of the polynucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2; or at position 4093 of the polynucleotide sequence shown in SEQ ID No.9.

[0088] The method for identifying the properties of floury endosperm of the present invention utilizes the components in the composition for identifying the properties of floury endosperm described above. Therefore, in order to prevent the description from being too complicated, descriptions of the commonly applicable contents are omitted.

[0089] The base of the polymorphic site is confirmed by hybridizing a nucleic acid sample separated from a sample with a probe capable of amplifying the polymorphic site of a single nucleotide polymorphic marker or detecting the single nucleotide polymorphic marker.

[0090] For example, the polymorphic site can be amplified using polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription amplification, autonomous sequence replication and nucleic acid sequence-dependent amplification (NASBA).

[0091] For the method of confirming the base of polymorphic site, its non-limiting example includes: sequencing analysis, microarray hybridization, allele specific PCR (allele specific PCR), dynamic allele specific hybridization (dynamic allele-specific hybridization, DASH), PCR extension analysis, single-stranded conformation polymorphism (SSCP), restriction fragment length polymorphism polymerase chain reaction analysis (PCR-RFLP), TaqMan technology, SNPlex platform (Applied Biosystems), mass spectrometry (such as Sequenom's MassARRAY system), mini sequencing method (mini-sequencing), Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), molecular inversion probe technology (Molecular Inversion Probe, such as Affymetrix's gene chip) and Bead chip (Illumina's HumanOmni2.5-8). For example, the base of polymorphic site can be confirmed using SNP chip. SNP chip refers to a DNA microarray that can confirm the base of hundreds of thousands of SNPs at one time.

[0092] Sequencing analysis can use a general method for determining the base sequence, and can be performed using an automated genetic analyzer. In addition, allele-specific PCR refers to a PCR method for amplifying the DNA fragment where the SNP is located using a primer set, wherein the primer set includes a primer designed with the base where the SNP is located as the 3' end. The principle of the method is as follows: For example, in the case where a specific base is replaced from G to A, when PCR is performed using a primer including G as the 3' terminal base and a reverse primer capable of amplifying a DNA fragment of an appropriate size, the base of the SNP can be amplified normally and a band at the desired position can be observed when it is G. When the base is replaced with A, the primer can complementarily bind to the template DNA, but the 3' end cannot complementarily bind, so amplification cannot be performed normally. DASH can be performed by conventional methods, preferably by methods such as Prince et al.

[0093] PCR extension analysis first uses primers to amplify DNA fragments containing single nucleotide polymorphism bases, then inactivates all nucleotides in the reaction by dephosphorylation, and then performs primer extension reaction by adding SNP-specific extension primers, dNTP mixtures, dideoxynucleotides, reaction buffer and DNA polymerase. At this time, the extension primer uses the base in the 5' direction next to the SNP base as the 3' end, and excludes nucleic acids with the same base as dideoxynucleotides from the dNTP mixture, wherein the dideoxynucleotides are selected from the base types representing SNP. For example, when A is replaced to G, dGTP, dCTP and TTP mixtures, and ddATP are added to the reaction, then the primer on the replaced base is extended by DNA polymerase, and the primer extension reaction is terminated by ddATP at the position where the A base first appears after several bases. If the replacement does not occur, the extension reaction is terminated at this position, so the base type with SNP can be identified by comparing the length of the extension primer.

[0094] In this case, when the extension primer or dideoxynucleotide is fluorescently labeled, the fluorescence can be detected using a gene analyzer used in general sequencing (e.g., ABI's 3700 model), thereby detecting the SNP; when unlabeled extension primers and dideoxynucleotides are used, the molecular weight can be measured using matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) technology, thereby detecting the SNP.

[0095] As a specific example of the present invention, the method for identifying the floury endosperm trait comprises the following steps: (a) using genomic DNA separated from a sample as a template, and performing PCR with a probe that specifically hybridizes to a polynucleotide or its complementary polynucleotide; or a primer that can amplify it, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the position of 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0); and step (b), confirming the reaction product amplified by the PCR, thereby identifying whether the sample individual has the floury endosperm trait. When the PCR reaction product result is the same as that of an individual (Namil (SA) -FLO2) having the cyOsPPDK gene, the plant individual of the sample has the floury endosperm trait.

[0096] Alternatively, according to another specific example of the present invention, the method for identifying the floury endosperm trait further includes the following steps: (a') using the genomic DNA isolated from the sample as a template and reacting with a probe that specifically hybridizes to a polynucleotide or its complementary polynucleotide, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the position of 19,722,254 bp of chromosome 5 of the rice reference genome (IRGSP 1.0).

[0097] The method for identifying the floury endosperm trait further comprises the step of treating the amplified product of step (b) with a restriction enzyme. More specifically, the restriction enzyme may be Hinf I. When the PCR amplification reaction product is sheared into two or more fragments by the restriction enzyme treatment, it can be determined to have the floury endosperm trait. However, the type of restriction enzyme and its reaction state may vary depending on the designed primer characteristics.

[0098] As a specific example of the present invention, the reagent capable of detecting single nucleotide polymorphism in (a) can be a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4; or a primer set consisting of an external forward primer shown in SEQ ID No.5, an external reverse primer shown in SEQ ID No.6, an internal forward primer shown in SEQ ID No.7, and an internal reverse primer shown in SEQ ID No.8.

[0099] The sample of the present invention can be obtained from all rice varieties (candidate varieties) including the Japonica rice line or the Namil mutant progeny line Namil (SA)-FLO2. In addition, the sample of the present invention can also be obtained from processed products made from the above rice varieties as main raw materials.

[0100] In the present invention, genomic DNA can be isolated from a sample using a method commonly used in the art, such as the SDS extraction method, the CTAB separation method (Cetyltrimethyl Ammonium Bromide), or a commercially available DNA extraction kit.

[0101] The PCR in the present invention can use any method for amplifying the single base polymorphism site in the above-mentioned candidate varieties or samples, and its non-limiting example includes any one selected from the group consisting of real-time PCR, qRT-PCR or multiplex PCR. At the same time, the PCR product can be additionally treated with a restriction enzyme, wherein the restriction enzyme can be Hinf I, but is not limited thereto.

[0102] In the present invention, the step of confirming the PCR amplification product can be performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited to the above methods. As one of the methods for detecting the amplification product, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylimide gel electrophoresis can be used according to the size of the amplification product.

[0103] Below, preferred embodiments are provided to help understand the present invention. However, the following embodiments are only used to understand the present invention and are not used to limit the content of the present invention.

[0104] Example

[0105] Preparation and methods of the experiment

[0106] Example 1. Preparation of experimental plants and materials

[0107] DNA of Namil and Namil(SA)-FLO2 with powdery endosperm traits were separated by CTAB separation method (Murray & Thomason, 1980) after collecting young leaves. The separated DNA was detected by 0.8% agarose gel electrophoresis, quantified by NanoDrop spectrometer (Thermo Fisher Scientific, USA), and diluted to 5 ng / μl for PCR.

[0108] The F2 population of Namil(SA)-FLO2 / Milyang 23 and the parental lines were cultivated at the experimental base of Pusan ​​National University in South Korea. In order to accurately map the floury endosperm gene, the F 3:4 Family. According to the manufacturer's guidelines, use Total genomic DNA was extracted from fresh leaves of all genotypes using the Plant II kit (MACHEREY-NAGEL GmbH & Co. KG, Germany).

[0109] Preparation Example 2. Resequencing and Development of Molecular Markers

[0110] The total genome of Namil(SA)-flo2 and Miyang 23 was resequenced at an average coverage of 75 times using the Illumina HiSeq 2500 sequencing system platform (Illumina Inc., USA). The raw sequence reads were sorted relative to the rice reference genome (IRGSP 1.0) (Kawahara et al., 2013). In order to prepare the gene map related to floury endosperm, SNPs with no missing values, minor allele frequency (MAF)>0.05, and genotype calls for parental sequences were used. In order to narrow down the target sites, SNPs were selected using Oligo7.0 software, and 8 cleavage amplified polymorphic sequence (CAPS) markers were developed.

[0111] Preparation Example 3. Preparation of a precise genetic map for determining floury endosperm

[0112] The F2 progeny in which the genomic region between RM18624 and RM18639 is heteroplasmic were grown as F3 progeny. Then, the F3 plants were self-pollinated to obtain F 3:4 Seeds. Strip parental lines and 96 randomly selected F 3:4 The endosperm of the recombinants was visually observed after the husk, and the genotype was determined using 8 CAPS markers. The open reading frame (ORF) of the corresponding region and the function of the region are published in the MSU Rice Genome Annotation Project Database (http: / / rice.plantbiology.msu.edu / ).

[0113] PCR was performed in a total reaction volume of 20 μl, which contained 10 ng of DNA template, 10 pmol of each primer, 1×PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100 and 1.5 mM MgCl2], 0.2 mM dNTP, and 1 unit of Taq DNA polymerase (Nurotics, Korea). PCR was performed using an MJ Research PTC-100 thermal cycler (Waltham, Massachusetts, USA) under the following conditions: 94°C pre-denaturation for 5 minutes; 94°C for 30 seconds, 36 cycles in total; 58°C annealing for 30 seconds; 72°C extension for 1 minute; and finally 72°C extension for 10 minutes. PCR products were sheared with restriction enzymes (New England Biolabs). The sheared PCR products containing the CAPS marker were detected using the WatCut program (http: / / watcut.uwaterloo.ca / template.php?act=snp_new). The cleavage products were separated on a 3% polyacrylamide gel using 6 M urea and 1X TAE at 80 V and analyzed using Molecular Gel Doc TM Visualization was performed using the XR system (Bio-Rad Laboratories, Inc., USA).

[0114] Preparation Example 4. Gene cloning and mutation location identification

[0115] The coding sequences of cyOsPPDK in Namil(SA)-flo2 and Namil were compared using CLC Sequence Viewer 7. To confirm the variant site, a HinfI restriction enzyme site was added to the floury endosperm variant Namil(SA)-flo2 using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / ).

[0116] The 161 bp fragment containing the mutation site in Namil(SA)-flo2 and Namil was PCR amplified using primers F (CCCAGGTGATGCAGGTGAG; SEQ ID No. 32) and R (GCACAGGTCTTGGACATTGC; SEQ ID No. 33). The PCR product was sheared with HinfI (New England Biolabs) in a total volume of 15 μl solution, wherein the solution included: 5 μl of PCR product, 1.5 μl of 10X NEBuffer, 0.5 μl of HinfI, and 8 μl of ultrapure water, and then incubated at 37°C for 2 hours. The sheared products were separated in 4% agarose rose gel. The dCAPS marker was also used for F 3:4 Co-segregation analysis of the family and 48 Korean rice varieties with respective endosperm phenotypes. Total genomic DNA of the CyOsPPDK gene was cloned in three overlapping regions using primers designed based on the cyOsPPDK gene sequence of Nipponbare.

[0117] [Table 1]

[0118]

[0119] Preparation Example 5. Isolation of Total RNA and qRT-PCR Analysis

[0120] Total RNA was isolated from rice grains of Namil and Namil(SA)-flo2 at 10 days after flowering (DAF) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Genomic DNA was removed with DNase I (QIAGEN, Hilden, Germany) and reverse transcribed using the RNA to cDNA EcoDry Premix Kit (Clontech, Mountain View, CA, USA).

[0121] qRT-PCR was performed using the QuantiNova SYBR Green RT-PCR kit (QIAGEN, Hilden, Germany) with a Rotor-Gene Q instrument (QIAGEN, Hilden, Germany) under the following PCR conditions. 95°C for 10 min; followed by 95°C for 10 sec (40 cycles); 60°C for 20 sec. The fold change relative to Namil was calculated. The fold derivation results are the mean ± SD of 3 replicates, and rice actin 1 (OsACT1; Os03g0718150) was used as an internal control group. qRT-PCR primers (qOsPPDKB) were designed based on the coding sequence of FLO4-4, and the primers in Table 1 were used.

[0122] Experimental Example 1 Identification of genes that determine floury endosperm traits

[0123] Experimental Example 1-1. Map of loci associated with floury endosperm

[0124] The total genome of Namil(SA)-flo2, which was resequenced in the preparation, was sequenced with reference to the indica rice variety Miyang 23. A total of 2604 SNPs were confirmed in all target regions. Eight CAPS markers were designed using the genome sequence between RM18624 and RM18639 as a template (Table 2), and F 3:4 Genotype analysis was performed on 60 floury endosperm individuals and 36 normal individuals from the family. Various comparisons were made between the genotypes of the recombinants and the phenotypes of their offspring.

[0125] [Table 2]

[0126]

[0127] Since the candidate bases related to the floury endosperm of the present invention are found to be regulated by recessive genes, if the genotype of the CAPS marker of the floury endosperm individual is consistent with that of Miyang 23 or a heterozygous genotype, it is determined that the flanking region of the CAPS marker is not the target gene position. In addition, in individuals with wild-type endosperm, if the genotype of the CAPS marker is the same as that of Namil (SA)-flo2, it is also determined that the gene position is not the target gene position.

[0128] like Figure 1a and Figure 1b As shown, individuals with heterozygous genotypes and floury endosperm for CAPS 5-8 and individuals with Namil (SA)-flo2 genotypes and normal endosperm for CAPS1-4 were identified. A 33 kb region at both ends of the target region marked with CAPS 8 markers and RM18639 was marked on the map with BAC clones OJ1174_H11 and OSJNBb0006J12.

[0129] Experimental Example 1-2. Analysis of candidate genes for floury endosperm

[0130] According to RAP-DB (Rice Annotation Project Database, http: / / rapdb.dna.affrc.go.jp / viewer / gbrowse / irgsp1 / ?name=chr02%3A1..105000), four genes were predicted as target gene candidates in the above 33 kb region ( Figure 1aAmong them, Os05g0404500 encodes a hypothetical protein, Os05g0404700 is a functional gene similar to the methylation binding protein gene MBD1, Os05g0404901 encodes a conserved hypothetical protein, and Os05g0405000 is a PPDK gene.

[0131] In Namil(SA)-flo2, a G / A SNP was confirmed in exon 8 of PPDK in sequencing of four candidate genes and wild-type Namil ( Figure 1b ). To analyze the PPDK transcriptome type of rice seeds at the filling stage, the three primers in Table 1 were used to additionally confirm the PPDK of Namil(SA)-flo2 and Namil with the primer combinations PF2 / PR3 (cyOsPPDK) and PF3 / PR3 (chOsPPDK) (Kang et al., 2005).

[0132] The cyOsPPDK base sequences of Namil (SA)-flo2 and Namil were compared with the base sequence of Nipponbare. As a result, in addition to the SNP in the coding region between Namil (SA)-flo2, 9 SNPs in the intron region; 6 insertion and deletion markers (InDels) were found in the 2 SNPs in the intron region and the coding region with homologous mutations. The recessive floury endosperm-related gene according to the new sequence of the present invention was named Floury4-4 (FLO4-4). The full-length coding sequences of Namil (SA)-flo2 and Namil's FLO4-4 are deposited in the gene bank with the accession numbers MG267058 and MG267056, respectively.

[0133] [Table 3]

[0134]

[0135] Experimental Example 1-3. Analysis of expression characteristics of floury endosperm-related genes

[0136] Using dCAPS markers, the effect of the FLO4--4 gene on the variation in floury grain ratio was confirmed in 94 F2 samples from the cross between Namil(SA)-flo2 and Namil(Namil) (Mo et al. 2013).

[0137] qRT-PCR was used to examine the transcriptome patterns of FLO4-4 in rice during the grain filling period. The relative expression level of FLO4-4 in Namil(SA)-flo2 was much higher than that in Namil( Fig.11), indicating that FLO4-4 expression is related to the filling stage, and this means that the texture difference of grains originates from the FLO4-4 allele. Taken together, the above results indicate that FLO4-4 is the locus responsible for the floury endosperm of rice.

[0138] Experimental Example 2. Determination of single nucleotide polymorphism sites associated with floury endosperm traits

[0139] Experimental Example 2-1. Determination of single nucleotide polymorphism sites by comparing the base sequences of the PPDK1 (OS05G0405000-02) gene of Namil and Namil (SA)-FLO 2

[0140] According to the information of the rice reference genome (IRGSP 1.0), the transcriptome information of the candidate gene PPDK1 located on chromosome 5 was determined, and sequencing primers were synthesized according to the base sequence of OS05G0405000-02 (19718538-19737605 bp, http: / / ensembl.gramene.org / Oryza_sativa / Transcript / Summary?db=core;g=OS05G0405000;mr=5:19725828-19725829;r=5:19718000-19733014;t=OS05T0405000-02;tl=FRpMRF4sd5cjS Kwa-7218-3304471). Specifically, the primer set in Table 1 below was used to amplify DNA fragments in three regions, and then 17 sequencing primers were used to perform base sequence analysis.

[0141] The base sequence of the region (7556 bp) corresponding to OS05G0405000-02 (reverse strand) in PPDK1 of Namil and Namil(SA)-FLO2 was analyzed. The results are shown in Table 2 below. Compared with the reference genome Nipponbare (IRGSP 1.0), 6 InDels and 11 SNPs were found in Namil, 6 InDels and 12 SNPs were found in Namil(SA)-FLO2, and 1 SNP was found between Namil and Namil(SA)-FLO2.

[0142] In addition, if Figure 1bAs shown, the SNP associated with the powdery endosperm trait found corresponds to the 19,722,254 bp position in the IRGSP reference genome, which is "G" in Namil and "A" in Namil(SA)-FLO2. It can be confirmed that the amino acid sequence of OS05G0405000-02 (reverse chain) has changed from glycine (Gly, G) to aspartic acid (Asp, D).

[0143] Experimental Example 2-2. Preparation of a primer set for identifying the floury endosperm trait of Namil(SA)-FLO2

[0144] 1. Preparation of dCAPs Primer Set

[0145] Using dCAPS Finder 2.0( http: / / helix.wustl.edu / dcaps / dcaps.html) dCAPs primers were prepared for the SNPs identified in Example 1. The 60 bp base sequence information around the discovered SNP was used to search for 1 bp mismatch primers, thereby Figure 2 As shown in Table 4, 14 primers for cutting the forward sequence of Namil and 7 primers for cutting the reverse sequence of Namil were confirmed by dCAPS Finder 2.0. In addition, 4 primers for cutting the forward sequence of Namil(SA)-FLO2 and 5 primers for cutting the reverse sequence of Namil(SA)-FLO2 were also searched. Finally, as shown in Table 4, a primer set that can stably react the cut Namil(SA)-FLO2 with floury endosperm trait with restriction enzyme (Hinf I) was selected.

[0146] [Table 4]

[0147] Primers Sequence information Flo2-Hinf IF CCCAGGTGATGCAGGTGAG(SEQ ID No.3) Flo2-Hinf IR GCACAGGTCTTGGACATTGC(SEQ ID No.4)

[0148] The total volume of the PCR reaction was 20 μl, which contained 10 ng of DNA, 5 pmol of forward and reverse primers, 0.2 mM dNTP mix, 1X PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1.5 mM MgCl2] and 1 unit of Taq DNA polymerase (Nurotics, Korea). The reaction was carried out using a thermal cycler (Waltham, USA) as follows: pre-denaturation at 95°C for 5 min; 35 cycles of 95°C for 20 s, 61°C for 30 s, and 72°C for 60 s, and finally 72°C for 10 min.

[0149] On the one hand, Hinf I, which cuts at the 5'...GAGTC...3' site, is used as a restriction enzyme, such as Figure 3As shown, Namil was not cleaved by the restriction enzyme, while Namil(SA)-FLO2 could be cleaved by the restriction enzyme because the SNP had the GAGTC sequence. When the restriction enzyme treatment was performed, the total volume was 15 μl, in which 1X enzyme buffer [50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg / ml BSA], 10 ng PCR product, and 5 U Hinf I (NEB, UK) were used. Thermal cycler (Waltham, USA) was used to react at 37°C for 120 minutes. The products were electrophoresed using Flagment analyzer (FA) to identify the genotype.

[0150] The results are shown in Table 5 and Figure 4 As shown, 161 bp of Namil(SA)-FLO2, Namil, and the reference genome (IRGSP 1.0, Nipponbare) were amplified, but due to the Hinf I restriction enzyme, Namil(SA)-FLO2 was cut into a 17,154 bp form, while Namil and the reference genome (IRGSP 1.0, Nipponbare) were not cut.

[0151] [Table 5]

[0152]

[0153] That is, through the above differences, it can be seen that the powdery endosperm traits of the Namil mutant offspring lines can be effectively identified.

[0154] 2. Preparation of Four-primer ARMS Primer Set

[0155] Use Primer1 (for Four primers The primers for ARMS-PCR were developed by using the service of http: / / primer1.soton.ac.uk / primer1.html, which can omit the step of treating the discovered SNP with a restriction enzyme. Using the 940 bp base sequence information and SNP (G / A) information including the SNP identified in Example 1 (Andrew Collins and Xizyi Ke. The Open Bioinformatics Journal, 2012, 55-58.), as shown in Table 6 below, a primer set capable of identifying the SNP of Namil (SA)-FLO2 having the floury endosperm trait without the need for restriction enzyme treatment was selected.

[0156] [Table 6]

[0157]

[0158] Specifically, when PCR was performed using the FLO2 four-primer ARMS-PCR primers, as shown in Tables 7 and Figure 5 As shown, Namil having the G allele showed a 635 bp PCR fragment based on FLO2-exo-F and FLO2-exo-R and a 307 bp fragment based on FLO2-inner-F (G) and FLO2-exo-R combined with the G allele, whereas FLO2 having the A allele showed a 635 bp fragment based on FLO2-exo-F and FLO2-exo-R and a 368 bp fragment based on FLO2-inner-R (A) and FLO2-exo-F combined with the A allele.

[0159] [Table 7]

[0160] Flo2 Namil Japan Sunshine (IRGSP 1.0) PCR fragment size (bp) 368+635 307+635 307+635

[0161] The PCR reaction was carried out in a total volume of 20 μl, which contained 10 ng of DNA, 5 pmol of four primers, 0.2 mM dNTP mix, 1X PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1.5 mM MgCl2] and 1 unit of Taq DNA polymerase (Nurotics, Korea). Thermocycler (Waltham, USA) was used for the following reactions: 95°C pre-denaturation for 5 minutes; 95°C for 20 seconds, 59°C for 30 seconds, 72°C for 60 seconds, for a total of 35 cycles, and finally 72°C for 10 minutes. The results were analyzed by electrophoresis using 4% agarose gel, and the genotype was determined.

[0162] The results are as follows Figure 6 As shown, by using the prepared FLO2 four-primer ARMS-PCR primers to perform PCR, a Namil (SA)-FLO2 specific fragment can be obtained. In other words, it was found that these differences can also effectively identify the floury endosperm traits of the Namil mutant progeny lines.

[0163] Experimental Example 2-3. Verification of primer effects for identifying floury endosperm traits of Namil(SA)-FLO2

[0164] 1. Verify the effect of dCAPs primer set

[0165] From the F2 individuals of the hybrid of Namil (SA) and FLO2 Miyang 23, seeds were harvested from individuals with heteroplasmic morphology at the locus related to chromosome 5 described in the previous study and cultivated to obtain a segregating group of offspring. After harvesting, the seeds were evaluated for endosperm traits and sown, and DNA was extracted from the plants for genotype evaluation. In addition, in order to confirm the screening effect in a group with a similar genetic background, DNA of 48 domestic japonica rice varieties (1. Anmi, 2. Aranghyangchal, 3. Baekjinju, 4. Baekogkhal, 5. Boramchal, 6. Boramchan, 7. Borami, 8. Boseok, 9. Boseokchal, 10. Boseokheukchal, 11. Cheongnam, 12. Chindeul, 13. Chucheong, 14. Dabo, 15. Danmi, 16. Danpyeng, 17. Deuraechan, 18. Dodamssal, 19. Dongjin, 20. Dongjin 1, 21. Dongjinchal, 22. Geonganghongmi, 23. Geonyang 2, 24. Goami, 25. Goami 2, 26. Goami 4. 27.Haepum, 28.Haiami, 29.Hanam, 30.Hanmaeum, 31.Heukjinmi, 32.Heukhyang, 33.Heukjinju, 34.Heuknam, 35.Heukseol, 36.Hongjinju, 37.Hopum, 38.Hwa ngkeumnuri, 39.Hwaseong, 40.Hwawang, 41.Hwayeong, 42.Hyangnam, 43.Hyeonpum, 44.Ilmi, 45.Ilpum, 46.Jukjinju, 47.Jukjinjuchal, 48.Heukhyangchal).

[0166] For the 38 hybrid progenies of Miyang 23 and Namil (SA)-FLO2, 2:4 Plants were analyzed under the same conditions as in Example 2, using Miyang 23 and Namil (SA)-FLO2 as parents and Namil as the original variety for mutation as a comparison variety. The results are as follows Figure 7As shown, type A refers to the residue not cut by restriction enzyme Hinf I, and type B refers to the residue cut by restriction enzyme Hinf I into 17 bp and 154 bp. Miyang 23 and the original variety Namil used for mutation showed type A, and Namil (SA)-FLO2, which is floury endosperm, showed type B. In addition, the hybrid offspring F 2:4 The genotype of the plant showed heterozygous and type A results in 19 individuals with normal endosperm, indicating that F 2:4 The normal phenotype in the plant is dominant to the floury endosperm. Therefore, the genotype of the 19 individuals whose endosperm showed the floury trait was all type B.

[0167] In addition, 48 japonica rice varieties were analyzed under the same conditions as in Example 2, using Miyang 23 and Namil (SA)-FLO2 as parents and Namil as a mutant as a comparison variety. Figure 8 As shown, it was confirmed that Namil (SA)-FLO2 having a floury endosperm trait showed type B, and the remaining 47 species all showed type A. From these results, it can be seen that the SNP according to the present invention and the dCAPs primers used therefor can effectively identify floury traits.

[0168] 2. Verify the effect of the four-primer ARMS primer set

[0169] Among the F2 individuals of the hybrid of Namil (SA)-FLO2 Miyang 23, seeds were harvested from individuals with heteroplasmic morphology at the chromosome 5-related loci described in the previous study and cultivated to obtain a segregating group of offspring. After harvesting, the seeds were evaluated for endosperm traits and sown, and DNA was extracted from the plants for genotype evaluation. In addition, in order to confirm the screening effect in a group with a similar genetic background, DNA of 48 domestic japonica rice varieties in South Korea (the same as in Example 3-1) was purchased from the National Institute of Food Science and Technology of Korea.

[0170] For the 38 hybrid progenies of Miyang 23 and Namil (SA)-FLO2, 2:4 Plants were analyzed under the same conditions as in Example 2, using Miyang 23 and Namil (SA)-FLO2 as parents and Namil as the original variety for mutation as a comparison variety. The results are as follows Fig. 9 As shown, the results of individuals showing normal endosperm were Miyang 23 type (307bp+635bp) or heterozygous (307bp+368bp+635bp), and individuals with powdery endosperm traits all showed FLO2 type (368bp+635bp) fragments.

[0171] In addition, 48 japonica rice varieties were analyzed under the same conditions as in Example 2, using Miyang 23 and Namil (SA)-FLO2 as parents and Namil as the original variety for mutation as comparison varieties. The results are as follows: Fig.10 As shown, only the 368 bp + 635 bp fragment was observed from Namil (SA)-FLO2 showing the floury endosperm trait. It can be seen that the SNP according to the present invention and the four-primer ARMS primer used therefor can effectively identify the floury endosperm trait.

[0172] The above description of the present invention is only for example, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or basic features of the present invention. Therefore, the above embodiments are only for illustration in all aspects and are not intended to limit the present invention.

Claims

1. A SNP molecular marker associated with rice floury endosperm traits, characterized in that: The nucleotide sequence of the molecular marker is SEQ ID No. 2, and the SNP site at base 4055 of SEQ ID No. 2 is G / A. If the SNP site is A, the plant has the floury endosperm trait, and if the SNP site is G, the plant does not have the floury endosperm trait.

2. A composition for identifying floury endosperm traits, characterized in that: A reagent for detecting a single nucleotide polymorphism marker present at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0, wherein the base of the SNP marker present at the position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0 is A, and the SNP site being A indicates a powdery endosperm trait, wherein the reagent capable of detecting the single nucleotide polymorphism is a primer set consisting of a forward primer shown in SEQ ID No. 3 and a reverse primer shown in SEQ ID No. 4, which are capable of amplifying a polynucleotide or its complementary polynucleotide, and a restriction enzyme HinfI, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0; or, wherein the reagent capable of detecting the single nucleotide polymorphism is an external forward primer shown in SEQ ID No. 5, an external reverse primer shown in SEQ ID No. 6, an external forward primer shown in SEQ ID No. 7, an external reverse primer shown in SEQ ID No. 8, an external reverse primer shown in SEQ ID No. 9, an external reverse primer shown in SEQ ID No. 10, an external reverse primer shown in SEQ ID No. 11, an external reverse primer shown in SEQ ID No. 12, an external reverse primer shown in SEQ ID No. 13, an external reverse primer shown in SEQ ID No. 14, an external reverse primer shown in SEQ ID No. 15, an external reverse primer shown in SEQ ID No. 16, an external reverse primer shown in SEQ ID No. 17, an external reverse primer shown in SEQ ID No. 18, an external reverse primer shown in SEQ ID No. 19, an external reverse primer shown in SEQ ID No. 20, an external reverse primer shown in SEQ ID No. 21, an external reverse primer shown in SEQ A primer set consisting of the internal forward primer shown in No.7 and the internal reverse primer shown in SEQ ID No.

8.

3. A kit for identifying floury endosperm traits, characterized in that: Comprising the composition of claim 2.

4. A method for identifying floury endosperm traits, characterized in that: The method comprises the steps of confirming a single nucleotide polymorphism marker existing at a position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0, The base of the single nucleotide polymorphism marker present at the position corresponding to 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0 is A, and the base A corresponds to the floury endosperm trait; The method for identifying the powdery endosperm trait further comprises: step (a), using the genomic DNA separated from the sample as a template, and reacting with primers of a specific amplification polynucleotide or a complementary polynucleotide thereof, wherein the polynucleotide comprises 10 to 300 consecutive nucleic acid sequences of bases corresponding to the position of 19,722,254 bp of chromosome 5 of the rice reference genome IRGSP 1.0; and step (b), confirming the reactants, The primers are a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4; or a primer set consisting of an external forward primer shown in SEQ ID No.5, an external reverse primer shown in SEQ ID No.6, an internal forward primer shown in SEQ ID No.7, and an internal reverse primer shown in SEQ ID No.8; and when the primers are a primer set consisting of a forward primer shown in SEQ ID No.3 and a reverse primer shown in SEQ ID No.4, the method for identifying the floury endosperm trait further comprises the step of treating the reactant of step (b) with a restriction enzyme Hinf I.

Images