Nucleic acid molecules for pseudouridylation

Abstract

The present invention relates to a nucleic acid molecule for pseudouridylation of a target uridine in a target RNA in a mammalian cell, wherein the nucleic acid molecule comprises a guide region capable of forming a partially double-stranded nucleic acid complex with a target RNA comprising the target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylation enzyme, wherein the guide region helps to position the target uridine in the partially double-stranded nucleic acid complex so that it can be converted into pseudouridine by the mammalian pseudouridylation enzyme.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62 / 648,648, filed on March 27, 2018; the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy was created on March 21, 2019, is named PQR_021WO_SL25.txt, and is 32,768 bytes in size. Technical Field

[0005] The present invention relates to the field of medicine. More specifically, the present invention relates to the field of pseudouridylation, in which RNA molecules in cells are targeted by nucleic acid molecules, such as oligonucleotides, to recruit pseudouridine synthase to convert specific uridines present in the RNA sequence into pseudouridines. More specifically, the present invention relates to oligonucleotides and intron-embedded snoRNAs that promote pseudouridylation of uridines in target RNAs and methods of using the same. Background Art

[0006] Pseudouridine (ψ) is the most abundant post-transcriptionally modified nucleotide in stable RNAs, including tRNA, rRNA, snRNA, and mRNA, accounting for approximately 5% of total ribonucleotides. The conversion of uridine to ψ (pseudouridilation) requires two distinct chemical reactions: the cleavage of the C1′-N1 sugar bond and the creation of a new carbon (C1′-C5) bond that reattaches the base to the sugar. Pseudouridilation is a true isomerization reaction that generates additional hydrogen bond donors, thereby affecting a variety of functional aspects based on the type of RNA carrying ψ and the position in the RNA sequence, such as protein synthesis, increased stop codon readthrough, and frameshifting (Yu and Meier, 2014, RNA Biology 11: 1483-1494). Figure 1 The structures of uridine and ψ are shown. Many mRNAs ψ are located in coding regions and most of them respond to environmental stresses, indicating their functional importance (Carlile et al., 2014, Nature 515: 143-146).

[0007] In eukaryotes and archaea, pseudouridylation is introduced into other proteins by box H / ACA ribonucleoproteins (RNPs), each of which contains a unique small RNA (box H / ACA RNA, one of the two major classes of small nucleolar RNAs, or ‘snoRNAs’) and four core proteins (NAP75 / dyskerin / Cbf5, Nhp2, Nopl0, and Gar1). NAP75 / dyskerin / Cbf5 catalyzes the chemical reaction that converts the target uridine to ψ. The RNA component acts as a guide to specify the target uridine for pseudouridylation through base-pairing interactions with its substrate RNA (Ge and Yu, 2013, Trends Biochem Sci 38(4):210-218). Based on this guide-substrate base pairing scheme, Karijolich and Yu (2011, Nature 474: 395-398) designed an artificial cassette H / ACA RNA to introduce ψ into mRNA at a premature stop codon (PTC) in S. cerevisiae. They demonstrated that ψ was indeed incorporated into TRM4 mRNA at the PTC. Notably, pseudouridylated PTCs promote nonsense suppression by altering ribosomal decoding (Fernandez et al., 2013, Nature 500: 107-110; Wu et al., 2015, Methods in Enzymology 560: 187-217; US 8,603,457). Using a similar strategy, other studies have shown that artificial H / ACA RNA can site-specifically pseudouridylate pre-mRNA after microinjection into Xenopus oocytes (Chen et al., 2010, Mol Cell Biol 30:4108-4119). In both examples, the artificial H / ACA RNA was modified to alter the loop used as a guide sequence, but otherwise the snoRNAs were unchanged and remained full-length.

[0008] Mammalian H / ACA snoRNAs are usually embedded (localized) in the intronic regions of pre-mRNAs of protein-coding genes. During transcriptional elongation, several proteins that play a role in pseudouridylation, such as Nop10, dyskerin or Nhp2, bind to nascent H / ACA snoRNA sequences, in particular to their structural core motifs. After splicing, the guide RNA is processed by debranching and exonucleolytic processing to form RNA-protein complexes called "small nuclear ribonucleoproteins" (snRNPs or snRNP complexes). Once in mature form, these particles are transported from the transcription site to the site where they are functionally active in pseudouridylation, mainly in the nucleolus, but also in Cajal bodies. During the spliceosome assembly process, these snRNPs are sequentially recruited to the pre-mRNA substrate, on which short RNA-RNA hybrids will form, which can specify pseudouridylation sites. Compared to box C / D snoRNAs, which are usually located 60-90 nucleotides upstream of the 3' splice site and encoded in relatively small introns, box H / ACA snoRNAs have no preference for the 5' or 3' end of the intron and can be present in small or very large introns. Leverette et al. (1992, Cell 71 (7): 1215-1221) proposed that some snoRNAs can be present in the intron region of pre-mRNA. Kiss and Filipowicz (1995, Genes Dev 9 (11): 1411-1424) proposed that a given snoRNA sequence can be excised from the intron region of any given actively spliced ​​mRNA and fully processed. To demonstrate the feasibility of this approach, they artificially inserted several snoRNAs (U17a, U17b and U19) into the second intron of the human β-globin gene and expressed the resulting vectors in fibroblast-like cells. After transfection, they found that the artificial, internalized snoRNA was correctly processed from the human β-globin intron and the globin pre-mRNA was correctly spliced. Notably, this did not occur when the guide RNA sequence was artificially inserted into the exon. Darzacq et al. (2002, EMBO J 21(11); 2746-2756) demonstrated that other guide RNAs could be inserted into the second intron of the human β-globin gene using an expression vector under the control of the cytomegalovirus (CMV) promoter and delivered to mammalian cells by transfection.

[0009] Despite the above, and the fact that snoRNA can be delivered to cells and processed from intronic regions, to the best of the inventors' knowledge, none have been shown to use snoRNA for targeted pseudouridylation in mammalian systems. Artificial H / ACA snoRNAs described in the prior art are typically in the range of about 140 nt, and they are composed of RNA, which makes them prone to being very unstable in vivo. Therefore, it remains a challenge to manufacture and deliver such molecules in a therapeutic setting. Summary of the invention

[0010] The present invention relates to a nucleic acid molecule for pseudouridylation of a target uridine in a target RNA in a mammalian cell, wherein the nucleic acid molecule comprises a guide region capable of forming a partially double-stranded nucleic acid complex with a target RNA comprising the target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding a mammalian pseudouridylation enzyme, wherein the guide region helps to position the target uridine in the partially double-stranded nucleic acid complex so that it is converted into pseudouridine by the mammalian pseudouridylation enzyme. Preferably, the pseudouridylation enzyme is part of a ribonucleoprotein (RNP) complex capable of acting on H / ACA-snoRNA. In one embodiment of the present invention, the nucleic acid molecule is shorter than a wild-type H / ACA snoRNA and comprises one or more nucleosides and / or internucleoside bonds that are not naturally modified compared to the wild-type H / ACA snoRNA. In a particularly preferred aspect, the nucleic acid molecule comprises one of the two hairpin structures corresponding to the wild-type H / ACA snoRNA, preferably the hairpin structure at the 3′ terminal portion of the wild-type H / ACA snoRNA, more preferably, wherein the 5′ terminal nucleotide corresponds to the nucleotide from the region between the two hairpin structures of the wild-type H / ACA snoRNA.

[0011] In another embodiment, the present invention relates to a nucleic acid molecule according to the present invention, wherein the nucleic acid molecule is located in an intron sequence from which it is expressed, and wherein the intron sequence is located between an upstream exon A sequence and a downstream exon B sequence. Preferably, the exon A / intron / exon B sequence is present in a vector, preferably a plasmid or a viral vector.

[0012] In a further embodiment, the invention relates to a nucleic acid molecule according to the invention, wherein the nucleic acid molecule is present in a vector such as a plasmid, and wherein the nucleic acid molecule is transcribed from a CMV or pol-III promoter, preferably a U6 or H1 promoter.

[0013] In a particularly preferred aspect, the present invention relates to a nucleic acid molecule according to the present invention, wherein the guide region is capable of forming a partial double-stranded complex with a target RNA, which target RNA comprises a mutation associated with a genetic disease, preferably wherein the mutation leads to a premature stop codon (PTC), wherein the PTC is the cause of the genetic disease, and wherein the target uridine is present in the PTC.

[0014] In another embodiment, the present invention relates to a method for converting uridine in a target RNA molecule into pseudouridine, comprising the following steps: contacting a target RNA comprising target uridine with a nucleic acid molecule according to the present invention in the presence of a pseudouridylinase or RNP complex, thereby converting the uridine, preferably wherein the pseudouridylinase or RNP complex is present in a mammalian cell, preferably a human cell.

[0015] The present invention also relates to a vector comprising an intron sequence located between an upstream exon A sequence and a downstream exon B sequence, wherein the exon A sequence and the exon B sequence are genes that are not natural genes for the intron sequence, and wherein the intron sequence comprises a snoRNA sequence encoding a nucleic acid molecule comprising a guide region capable of forming a partially double-stranded nucleic acid complex with a target RNA comprising a target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase in a cell to form a functional RNP complex, wherein the guide region correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted to pseudouridine by the RNP complex. Preferably, the vector is a plasmid or a viral vector.

[0016] The present invention further relates to a method for converting uridine in a target RNA molecule into pseudouridine in a cell, preferably a human cell, comprising the steps of: administering a vector according to the present invention to the cell; allowing transcription of the exon A / intron / exon B sequence; allowing splicing and formation of a snoRNA positioned in the intron; and allowing the snoRNA to form a partially double-stranded nucleic acid complex with the target RNA molecule, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase to form a functional RNP complex, wherein the snoRNA correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted to pseudouridine by the RNP complex. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The structures of uridine and pseudouridine (ψ) are shown. The hydrogen bond acceptor (a) and hydrogen bond donor (d) sites are shown.

[0018] Figure 2A list of residues involved in guide RNA attachment is shown. The residue numbers reported in the H / ACA box RNP particle structure (PDB ID 2HVY) are followed by single-letter amino acid codes. Atoms that may be involved in hydrogen bond formation are marked after the residue numbers. The left and right figures report the amino acids of the archaeal P. furiosus H / ACA box RNP that have the ability to contact and hydrogen bond with the RNA oxygen-phosphate backbone and bases. The open circles represent potential hydrogen bonds with the RNA sugar-phosphate backbone, while the solid circles represent potential hydrogen bonds with RNA bases. Residues Nop10 and L7ae belonging to Cbf5 homologous proteins are represented by asterisks, &, and #, respectively. As shown in the left and right figures, the sequence of the human guide region is: 5′-GGGUCCGCCUUGAGUGCCCGGGUGAGAAGCAUGAUCCCGGGUAAUUAUGGCGGACCCACAG-3′ (SEQ ID NO: 4).

[0019] Figure 3 The positions of the detected H / ACA in Pyrococcus furiosus snoRNA are shown with respect to the conservation of the hydrogen bond interaction network. Figure 2 The open circles (left panel) and filled circles (right panel) indicate RNA backbone positions that tolerate PS bonds and 2′-OMe modifications, respectively (without disrupting potential intermolecular linkages). The open circles refer to PS bonds tolerated on the 3′ side of the nucleotide immediately adjacent to the circle.

[0020] Figure 4 The basic structure of human H / ACA ACA19 snoRNA (A) binding to a native target sequence in 28S rRNA is shown, wherein the target nucleotide is shown in its pseudouridylated form (ψ). The snoRNA contains two hairpin structures (in which the internal target binding loop is located), as well as an H-box between the hairpins and an ACA box at the 3′ end. The sequence of this full-length wild-type ACA 19 snoRNA is shown below, where the H-box is underlined (boxed in the figure) and the ACA box is in bold (boxed in the figure):

[0021]

[0022] The two 28S rRNA sequences are as follows: 5′-aaagugaagaaau u caaugaagcgcggg-3′ (SEQ ID NO: 6; U3709; left guide) and 5′-gaauccgacug u uuaauuaaaaca-3' (SEQ ID NO: 7; U3618; right guide region) In both 28s rRNAs, the uridine converted to a pseudo-U is underlined.

[0023] The basic structure of a shortened pseudouridylated guide RNA as described herein is given on the right (B) and has the following sequence, which differs at the 5′-end due to residual nucleotides from the transcript, and which differs in the target loop due to the sequence of the target mRNA being different from the 28s rRNA sequence (SEQ ID NO: 7):

[0024] 5'-GGAAUUGAAGGCUGGUUCGCAGUAUAACUAUAAAUAGUAAUGCUGCCUGGUCCUUCAGACAAAA-3' (SEQ ID NO: 8).

[0025] Figure 5 Results of pseudouridylation assays of radiolabeled substrate RNAs without guide (as negative control), or with indicated amounts of shortened pseudouridylated guide RNA or full-length ACA19 snoRNA are shown. U and ψ indicate the migration of uridine and pseudouridine in thin layer chromatography, respectively.

[0026] Figure 6 Four ACA19 pseudouridylation editing oligonucleotides (psEONs) are shown, all of which have the sequence of SEQ ID NO: 8 and the positions of the introduced chemical modifications: black dots represent 2′-OMe modifications on the ribose moiety of the nucleotide, and open dots represent PS modifications of the internucleoside linkage.

[0027] Figure 7 Results of pseudouridylation using four ACA19 psEONs with corresponding guide RNAs (no chemical modification) as positive controls and negative controls (no guide RNA) are shown. U and ψ indicate the migration of uridine and pseudouridine in thin layer chromatography, respectively.

[0028] Figure 8 Four CFTR-G542X psEONs (with the guide pocket sequence changed to the target CFTR substrate in the same ACA19 backbone) are shown along with the locations of the introduced chemical modifications: black dots indicate 2′-OMe modifications on the ribose moiety of the nucleotide and open dots indicate phosphorothioate modifications of the internucleoside linkage. The sequences of all four psEONs are:

[0029] 5'-GGAAUUGAAGGCCCUUCUGCAGUAUAACUAUAAAUAGUAAUGCUGCAAGAACCCUUCAGACAAAA-3' (SEQ ID NO: 9).

[0030] Fig. 9The results of pseudouridylation using four CFTR-G542X psEONs with corresponding guide RNA (no chemical modification) as positive control and no guide RNA as negative control are shown. U and ψ represent the migration of uridine and pseudouridine in thin layer chromatography, respectively.

[0031] Fig.10 Four Idua-W392X psEONs (Idua-A, Idua-B, Idua-C and Idua-D from left to right) are shown along with the locations of the introduced chemical modifications: black dots represent 2′-OMe modifications of the ribose moiety of the nucleotide, and open dots represent PS modifications of the internucleoside linkages.

[0032] The sequences for all four psEONs are:

[0033] 5'-GGAAUUGAAGGCUCUGCCGCAGUAUAACUAUAAAUAGUAAUGCUGCGAGUUGUCCUUCAGACAAAA-3' (SEQ ID NO: 10).

[0034] Fig.11 The results of pseudouridylation using four Idua-W392X psEONs (Idua-A, Idua-B, Idua-C, and Idua-D) with corresponding guide RNA (without chemical modification) as positive control, and no guide RNA as negative control are shown. U and ψ represent the migration of uridine and pseudouridine in thin layer chromatography, respectively.

[0035] Fig.12 A schematic diagram of the pugIntron-IDUA construct is shown, showing the introduction of a 131nt pugIntron insert between a SalI site at the 5' end and a Pstl site at the 3' end, with a 92nt exon 1 (E1) and a 223nt exon 2 (E2) of the human β-globin gene upstream and downstream, respectively. Transcription is driven by a CMV promoter.

[0036] Fig.13 Shown as Fig.12 The complete nucleotide sequence of the pugIntron-mlDUA plasmid shown (SEQ ID NO: 11) with the guide RNA to be spliced. The plasmid sequence is given in lowercase letters. The 131nt guide RNA is given in uppercase letters. The guide RNA is spliced ​​together with the 10nt upstream and the 23nt downstream. The upstream 92nt exon 1 ( Fig.12 E1) and downstream 223nt exon 2 ( Fig.12 The E2 in FIG. 1 is given in uppercase and bold. The recognition sites for the SalI and PstI restriction enzymes are underlined.

[0037] Fig.14 The complete sequence of the target pFLAG-GL39-IDUA swap expression vector is shown (SEQ ID NO: 12; derived from pFLAG2CMV2-HBB). The 33 nt mIDUA PTC region is shown in bold and the TAG premature stop codon is underlined.

[0038] Fig.15 RT PCR analysis of β-globin mRNA in HEK293 cells transfected with substrate plasmid "GL39-IDUA swap" with or without pugIntronOpt-IDUA is shown. The GL39 arrow indicates the product observed after RT-PCR. Lanes 1 and 3 represent 15 PCR cycles, and lanes 2 and 4 represent 18 PCR cycles. Globin mRNA levels were normalized by the 5S control (lower arrow) and found to be 0.00437 in lane 2 and 0.1617 in lane 4. The induced guide RNA modification (here pseudouridylation) inhibits NMD and upregulates intact mRNA levels 37-fold.

[0039] Fig.16 Western blot analysis of tagged globin in HEK293 cells transfected with substrate FLAG-GL39-IDUA swap plasmid and guide pug-Intron-IDUA plasmid is shown. Cells were transfected with 250 ng substrate and 2.5 pg guide using PEI at 100% confluence.

[0040] Fig.17 Results of primer extension experiments are shown using total RNA obtained from HEK293T cells transfected with the substrate GL39-IDUA swap plasmid and pugtron-IDUA as a guide RNA expression plasmid or pug-CFTR as a negative control plasmid. RNA was treated with CMC and primer extension was performed using a globin-specific primer and a U6-specific primer as controls. The position of the 92nt product terminating in the ψ-CMC residue is indicated by an arrow. This region is shown again in the enlarged panel. GL39+72 is a hG1193-209AS globin-specific primer. 90, 76, and 67 are size references from a pBR322-MspI digest (NEB#N3032).

[0041] Fig.18RT-PCR products of total RNA obtained from cells transfected with GL39-IDUA swap substrate plasmid and pugIntron-IDUA guide RNA expression plasmid or Cy3-IDUA-A psEON (where the guide RNA is not intron embedded) are shown. The GL39-IDUA arrow indicates the product observed after RT-PCR. The 5S control is also indicated by an arrow. No differences were observed when the cells were washed (washed) or when the medium was retained on the cells after transfection (retained). RT indicates reverse transcriptase (+ yes, or - no).

[0042] Fig.19 RT-PCR analysis of CFTR mRNA from HEK293 cells transfected with a substrate plasmid carrying the CFTR-G542X mutation, with no guide (lanes 2 and 3 to the right of the ladder), negative control pugCFTR (lanes 6 and 7 to the right of the ladder), and guide snoRNA carrying plasmid pugIntCFTR (lanes 4 and 5 to the right of the ladder) is shown. The arrows indicate the products observed after RT-PCR. Lane 1 after the ladder represents PCR without RT. Lanes 2, 4 and 6 represent the products after 20 PCR cycles, and lanes 1, 3, 5 and 7 represent the products obtained after 23 cycles. The lower figure shows the 5S control after 15 and 18 PCR cycles, respectively (instead of 20 and 23). The presence of the guide RNA expressed from pugIntCFTR clearly leads to NMD inhibition, as stronger PCR product signals are observed. DETAILED DESCRIPTION

[0043] It is known in the art that full-length H / ACA RNA (snoRNA) can be used to site-specifically convert target uridines to pseudouridines (ψ). By changing the nucleic acid sequence of the two main loops that serve as the natural substrate RNA, it has been shown that in yeast and Xenopus systems, other sequences besides the natural sequence can be pseudouridylated. The inventors of the present invention wished to perform targeted pseudouridylation with target RNAs with potential therapeutic targets in mammalian systems, and asked themselves whether it was possible to produce smaller pseudouridylated guide RNAs that still had catalytic activity and might even increase pseudouridylation. Most importantly, the inventors wanted to know whether it was possible to increase the stability and / or specificity of such smaller oligonucleotides by chemical modification. If this works, they could potentially be used as pharmaceutically active compounds in vivo for use in therapeutic settings. Such guides could potentially be used to treat any genetic disease in which uridines (perhaps representing mutations) are converted to ψ, thereby affecting the content of translated proteins or affecting splicing, or increasing (or decreasing) the amount of proteins translated from the generated mRNA. In view of the relatively low efficiency of H / ACA snoRNA in pseudouridylation as shown in the art to date, there remains a need to improve the efficacy and pharmacokinetic properties of pseudouridylation guides. The present invention relates to such pseudouridylation guide compounds (also referred to herein as pseudouridylation editing oligonucleotides, or psEONs) that are shorter (in terms of nucleotide length) than those used to date in the art, which carry one or more chemical modifications that affect pseudouridylation efficiency or are embedded in intronic regions to enable effective delivery to mammalian cells. According to another embodiment, a nucleic acid sequence is provided, which is or comprises a guide for targeted pseudouridylation, which is expressed as a pol-III expression construct using a pol-III promoter such as U6 or H1. Such a nucleic acid molecule can be provided as an expression construct in a plasmid or viral vector such as an AAV vector, etc.

[0044] The median length of the initially identified ("full-length") H / ACA RNAs is 133 nucleotides and forms an evolutionarily conserved hairpin-hinge-hairpin-tail secondary structure with a consensus ANANNA sequence in the hinge region (H-box) and an ACA triplet at three positions just 3' from the 3' end (ACA box). The target uridine can be identified by protruding two 3-10 nucleotide long antisense elements from the ridges of one or both hairpins (pseudouridylation pockets) 5' and 3' of the upper stem. These two elements hybridize to a sequence 5' and one nucleotide 3' of the target uridine, thereby framing it. This positions the target uridine 14-15 nucleotides from the H or ACA box.

[0045] There are many chemical modifications in the production of (single-stranded and / or antisense) recombinant oligonucleotides. In the search for improved properties, the inventors of the present invention found that the 2′-O-methyl (2′-OMe) modification of the ribose moiety of the nucleotide is not only compatible with targeted pseudouridylation, but also surprisingly, leads to efficient site-specific pseudouridylation of more target mRNA molecules. Another surprising discovery is that phosphorothioate (PS) internucleoside bonds are also compatible with targeted pseudouridylation. (Non-natural) chemical modifications, such as a combination of 2′-OMe ribose and PS internucleoside bonds, can also be used without disrupting the binding or catalytic (pseudouridylation) activity of the enzyme. The inventors have determined preferred sites. Although 2′-OMe and PS and many chemical modifications are known to have certain beneficial properties in antisense oligonucleotides and siRNA, such as increased nuclease stability or other pharmacokinetic properties, their compatibility with pseudouridylation is unknown and unpredictable, not to mention their enhanced effect on catalysis. Therefore, in addition to finding ways to shorten these artificial guide RNAs, the inventors have also discovered chemical modifications to them to exert improved pharmacokinetic and pharmacodynamic properties. These and other advantages will become clear through the disclosure of the present invention.

[0046] The present invention relates to a nucleic acid molecule capable of forming a double-stranded complex with a target RNA molecule in a system (e.g., a cell extract, a cell, a tissue or an organ (e.g., on a chip), an organism, preferably of mammalian origin), and capable of forming a functional (i.e., capable of pseudouridylation) RNA protein (RNP) complex, wherein the target RNA molecule comprises a target uridine for conversion to ψ, wherein the nucleic acid molecule (a) is shorter than a natural H / ACA snoRNA (preferably about half the length of a natural H / ACA snoRNA or shorter) and / or (b) comprises a (non-natural) chemical modification of one or more nucleotides or internucleoside bonds. Such nucleic acid sequences according to the present invention will also be referred to herein as "pseudouridylation editing oligonucleotides" or simply "psEONs".

[0047] A preferred embodiment is a shortened form of the H / ACA snoRNA that contains only one hairpin with a guide loop (as opposed to the two such hairpins typically found in the natural H / ACA RNA structure and artificial snoRNA described in the art). Another preferred embodiment is a nucleic acid molecule that contains at least one nucleotide with a 2′-OMe ribose modification and at least one PS internucleoside linkage modification. More preferred are shortened nucleic acid molecules with non-natural ribose and / or non-natural internucleoside linkage modifications.

[0048] The psEON according to the present invention is preferably a synthetic oligonucleotide. The psEON according to the present invention is preferably an oligoribonucleotide (all RNA), and may also contain DNA. Alternatively, especially when composed only of nucleotides or bonds that can be expressed in a biological system, the psEON can be expressed in situ, such as from a plasmid or viral vector. In addition, psEONs can be a mixture of biological expression components and synthetic components (such as tags or connectors). psEON can be used as is ("naked"), or conjugated with other components (such as ligands for targeting, uptake and / or intracellular transport). psEON can be used in an aqueous solution (usually a pharmaceutically acceptable carrier and / or solvent), or can be prepared using a transfection agent, liposome or nanoparticle form (such as SNALP, LNP, etc.). Such a preparation may include a functional ligand to enhance bioavailability, etc.

[0049] Among the wide variety of noncoding RNAs, small nucleolar RNAs are divided into two categories: box C / D and box H / ACA snoRNAs. Both contribute to the modification of post-transcriptional ribosomal RNAs. Using endogenous RNP enzymes, synthetic oligonucleotides can potentially mimic the guiding H / ACA snoRNA and bind to RNA targets, allowing uridine to be converted to ψ in a site-specific manner. In order to convert uridine to ψ in RNA targets, as shown for the first time in this article, chemically modified oligonucleotides similar to H / ACA snoRNA can recruit endogenous RNP enzymes. In order to design such psEONs, it is described here how to use a combined approach based on experimental data, structural analysis, and energy minimization of atomic-scale models. The length of the ACA19 RNA sequence was minimized, and the function was detected using an in vitro enzymatic method (as described below). The structural analysis was based on information published by Li and Ye (2006, Nature 443: 302-307). In the H / ACA box RNP from P. furiosus (an archaeal species), only three proteins directly interact with the guide RNA, which in turn has a stem-loop structure. These proteins are likely tRNA pseudouridine synthase B, ribosome biogenesis protein Nop10, and 50S ribosomal protein L7ae. The structure-based oligonucleotide design used in the present invention is divided into different parts: an overview of the hydrogen bonding network, a step-by-step analysis of protein structural conservation in different archaeal-eukaryotic organisms, the insertion of chemical modifications within the H / ACA box snoRNA (thus monitoring potential steric clashes), and energy minimization of an atomic-scale model including 2′-OMe and PS bonds.

[0050] Two types of hydrogen bonds are distinguished. The first group connects the phosphate oxygen backbone of RNA to proteins. The second group connects residues to oligonucleotide bases. Generally, these two groups of interactions are considered nonspecific and specific in the art, respectively. The crystal structure of the H / ACA box RNP from Pyrococcus furiosus is the only structure of an RNA-bound pseudouridylated protein assembly currently available in the art. The free structure of the Cbf5-Nop10-Gar1 complex from Saccharomyces cerevisiae (Li et al., 2011, Genes Dev 25: 2409-2421) emphasizes the important structural similarities about the protein arrangement of the two systems. Superposition of different H / ACA box RNP protein structures was performed using the superposition program of TINKER (Pappu et al., 1998, J Phys Chem B 102: 9725-9742). This conservative structural arrangement suggests that RNA binding can be supported by similar interactions. Although the transposition of structural requirements (for guide RNA attachment) from archaea to eukaryotes is not easy, the extrapolation of this analysis is still valuable with the support of primary sequence alignment, secondary and tertiary structure comparison. In the crystal structure of the H / ACA box RNP, the guide RNA mainly contacts three proteins, Cbf5, Nop10 and L7ae. The primary sequence alignment of these three proteins with the corresponding homologs from humans, yeast and archaea showed high similarity (data not shown). In addition, the secondary structures of all three proteins from yeast and archaea appear similar to those found in the primary sequence alignment. Since there is no structural information for human Cbf5, Nop10 and Nhp2 (homologous to archaeal L7ae) proteins, their secondary structures were predicted using the protein secondary structure prediction server (JPred) and compared with the predicted secondary structures of the corresponding proteins from yeast and archaea. The comparison showed that all three proteins have very similar secondary structures. Furthermore, the identified amino acid residues of all three proteins that contact the guide RNA in the H / ACA box RNP appear to be very conserved in their human and yeast homologs, suggesting that all three proteins may recognize their guide RNA in a very similar manner.

[0051] To define the important anchoring points between guide RNA and protein, the three-dimensional features of the bound RNA were investigated. Therefore, independently of the choice of the primary sequence for the design of therapeutic RNA, the same three-dimensional structure as in the presented archaeal system was required. This statement mainly applies to the common RNA part covered by the homologous proteins observed in both systems, namely Cbf5 and Nop10. To expand the validity of the analysis, a polypeptide chain equivalent to the Pyrococcus furiosus L7ae protein was identified in different eukaryotic organisms (homologous proteins in yeast and humans). Obviously, the direct transposition of structural information from archaeal to yeast organisms is somewhat speculative and local variations may occur. The density of specific contacts is higher near the ACA motif and at the junction between the upper stem and the minimal loop. The last element corresponds to the tetra-loop in yeast. Interestingly, the secondary structural arrangement proposed for the shortened ACA19 guide RNA does not correspond to the three-dimensional features and constraints detected in the archaeal H / ACA box RNP. However, the flexibility of the oligonucleotide seems to be a key parameter for anchoring and the ACA19 guide RNA may undergo conformational adjustments to fit the protein complex.

[0052] To support structure-based oligonucleotide design and facilitate the transfer of intermolecular hydrogen bonding maps to eukaryotes, the list of residues involved in guide RNA attachment is as follows Figure 2 As shown. Amino acids interacting with the RNA oxygen-phosphate backbone and bases of the archaeal H / ACA box RNP are reported on the left and right panels, respectively. 70% of contacts between bases and proteins involve amino and carboxyl groups of residues, suggesting that a limited set of conserved residues can drive base recognition. However, 85% of RNA backbone binding is mediated by amino acid side chains. Remarkably, the Nop10 unit only interacts nonspecifically with the guide oligonucleotide (and therefore, not with the base). The analysis must consider further primary sequence alignments between homologous proteins in different organisms. Some conserved residues may support nucleotide-protein contacts that are critical for the function of therapeutic oligonucleotides. In addition, predicted secondary structure elements may help to account for some potential variations in local RNA conformation.

[0053] Initial structural studies paved the way for the implementation of relevant chemical modifications that support oligonucleotide function in vivo. Classically, in the first stages of therapeutic oligonucleotide design, it has been demonstrated in the art that 2′-OMe modified sugar moieties and PS bonds contribute to increased resistance to RNase activity, favor protein binding and promote uptake. However, it has never been proposed or shown that such modifications can be used in the context of the pseudouridylation enzyme complex and that such modifications are compatible with protein binding and catalysis. Figure 3As shown, the positions of H / ACA within the Pyrococcus furiosus RNA were examined with respect to the conservation of the hydrogen-bonding interaction network. Chemical modifications to the H / ACA RNA model were introduced, which were considered to be involved in the functionalization of therapeutic oligonucleotides. The generation of an atomic-scale model was achieved by inserting chemical modifications into the archaeal stem-loop RNA using the Avogadro software. The energy consumption of the obtained H / ACA box RNP model could be minimized using the Amber99plus GBSA force field applied in the TINKER software package (Pappu et al., 1998). Figure 3 In the left panel, open circles indicate positions where PS bonds can be tolerated without disrupting the protein-RNA hydrogen bond network. In the right panel, solid circles show positions where insertion of 2′-OMe groups should not interfere with RNA recognition (no steric hindrance). It should be noted that the intra-RNA hydrogen bond network may support stabilization of the oligonucleotide, but this was not evaluated.

[0054] The present invention relates to a nucleic acid molecule for pseudouridylation of a target uridine in a target RNA in a mammalian cell, wherein the nucleic acid molecule comprises a guide region capable of forming a partially double-stranded nucleic acid complex with a target RNA comprising the target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding a mammalian pseudouridylation enzyme, wherein the guide region helps to locate the target uridine to the partially double-stranded nucleic acid complex so that it is converted into a pseudouridine by the mammalian pseudouridylation enzyme. The partially double-stranded nucleic acid complex is preferably RNA / RNA. The RNA / RNA complex is capable of recruiting or engaging a pseudouridylation enzyme, which is preferably naturally present in a mammalian cell, and in another embodiment, can be introduced into a mammalian cell together with the nucleic acid molecule. Preferably, the mammalian cell in which pseudouridylation occurs is a human cell. In a preferred aspect, the pseudouridylation enzyme is part of a ribonucleoprotein (RNP) complex capable of acting on an H / ACA-snoRNA. In a particularly preferred aspect, the nucleic acid molecule is shorter than a wild-type H / ACA snoRNA and comprises one or more nucleosides and / or internucleoside bonds that are non-naturally modified compared to the wild-type H / ACA snoRNA. Non-natural means that the modification does not naturally occur in the wild-type snoRNA. The modification is preferably introduced to make the nucleic acid molecule more stable against degradation by RNases. In another preferred aspect, the nucleic acid molecule of the present invention comprises one of the two hairpin structures of the wild-type H / ACA snoRNA, preferably a hairpin structure at the 3′ terminal portion of the wild-type H / ACA snoRNA, more preferably wherein the 5′ terminal nucleotide corresponds to the nucleotide in the region between the two hairpin structures from the wild-type H / ACA snoRNA. According to the nucleic acid molecule of the present invention, more preferably, the nucleic acid comprising a single guide region is preferably composed of 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 nucleotides. When the nucleic acid molecules according to the present invention comprise non-natural modifications, in one embodiment, the non-natural modifications include modifications in the ribose moiety, preferably wherein the 2'-OH of the sugar moiety is substituted. The particularly preferred modification of the ribose moiety is 2'-OMe and / or 2'-MOE substitution. The technician can apply a variety of modifications, depending on the efficiency with which the nucleic acid molecules of the present invention can be pseudouridylated in a particular cell and / or in the case of a particular pseudouridylation enzyme. On the other hand, the nucleic acid molecules comprise one or more non-natural internucleoside bonds, such as phosphorothioate (PS) bonds.

[0055] The present invention also relates to a nucleic acid molecule according to the present invention, wherein the nucleic acid molecule is located in an intron sequence expressing it, and wherein the intron sequence is located between an upstream exon A sequence and a downstream exon B sequence. The intron may contain (in addition to the nucleic acid molecule of the present invention, containing a guide region) additional nucleotides. Since the guide region is expressed from an intron sequence, such additional nucleotides can be selected to provide the most efficient expression from the intron. Preferably, the exon A / intron / exon B sequence is present in a vector, preferably a plasmid or a viral vector. Such a vector can be used to deliver the exon-intron-exon sequence to a cell. Other introns and exons may be present in such a vector. In a particularly preferred embodiment, the exon A sequence (upstream of the intron carrying the nucleic acid encoding the nucleic acid molecule (expressed after transcription)) comprises exon 1 of the human β-globin gene or consists of it, and the exon B sequence (downstream of the intron carrying the nucleic acid encoding the nucleic acid molecule (expressed after transcription)) comprises exon 2 of the human β-globin gene or consists of it. The skilled person is aware that the vector can carry DNA or RNA, and is generally used to express the nucleic acid molecule of the present invention after the vector is processed in the cell into which it is introduced. This is generally achieved by transcribing the DNA or RNA present in the vector. The preferred vector is a viral vector (which can be used to infect the target cell to be treated) or a plasmid, which can be introduced into the cell in a variety of ways known to those skilled in the art. In a preferred embodiment, the nucleic acid molecule located in the intron is substantially full-length pugU2-34 / 44snoRNA. Basically means that even if one or more nucleotides may be different from the exact wild-type pugU2-34 / 44 sequence, the snoRNA is also active. Using the teachings of the present disclosure, the skilled person can determine whether the substantially full-length snoRNA is active in pseudouridylation. As disclosed herein, when the snoRNA is located in an intron, the nucleic acid molecule is preferably present in a vector such as a plasmid, and wherein the nucleic acid molecule is transcribed by a CMV or pol-III promoter, preferably a U6 or H1 promoter. When the nucleic acid comprises a single guide region, it can also be administered in free form (or "naked," without a carrier), or delivered to the cell by other means (e.g., liposomes or nanoparticles) or by iontophoresis.

[0056] In a particularly preferred embodiment, the guide region present in the nucleic acid molecule of the present invention is capable of forming a partially double-stranded (RNA / RNA) complex with a target RNA that contains a mutation associated with a genetic disease. A non-limiting but preferred example of such a mutation results in a premature termination codon (PTC), wherein the PTC is the cause of the genetic disease, and wherein the target uridine is in the PTC. By using the means and methods of the present invention, the target uridine in such a PTC is converted to a pseudouridine, and then the correct reading of the reading frame during the translation process is achieved, thereby providing (partially or fully) a functional full-length protein.

[0057] In one embodiment of the present invention, the nucleic acid molecules according to the present invention are used to treat, prevent, delay or improve cystic fibrosis, Hurler Syndrome, alpha-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, albinism, amyotrophic lateral sclerosis, asthma, beta thalassemia, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, epidermolysis bullosa, Fabry disease, factor V Leiden-related disease, familial adenoma, Adenomatous), polyposis, galactosemia, Gaucher's Disease, glucose-6-phosphate dehydrogenase deficiency, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-Nyne syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy type I and II, neurofibromatosis, Niemann-Pick disease type A, B, and C, NY-esol-related cancers, Peutz-Jeghers syndrome, phenylketonuria, Pompe's disease, primary ciliary disease Ciliary Disease, prothrombin mutation-associated disease (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff's disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt's Disease, Tay-Sachs Disease, Usher Syndrome, X-linked immunodeficiency, Sturge-Weber Syndrome, or cancer.

[0058] In another embodiment, the present invention relates to a method for converting uridine in a target RNA molecule into pseudouridine, comprising the steps of contacting a target RNA comprising the target uridine with a nucleic acid molecule according to the present invention in the presence of a pseudouridylinase or RNP complex, and thereby allowing the uridine to be converted, preferably wherein the pseudouridylinase or RNP complex is present in a mammalian cell, preferably a human cell. In a preferred method according to the present invention, the pseudouridylinase or RNP complex is naturally present in a mammalian cell.

[0059] In yet another embodiment, the present invention relates to a vector comprising an intron sequence located between an upstream exon A sequence and a downstream exon B sequence, wherein the exon A sequence and the exon B sequence are genes that are not natural genes for the intron sequence, and wherein the intron sequence comprises a snoRNA sequence encoding a nucleic acid molecule comprising a guide region capable of forming a partial double-stranded nucleic acid complex (RNA / RNA) with a target RNA comprising a target uridine, wherein the partial double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase in a cell to form a functional RNP complex, wherein the guide region correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted to pseudouridine by the RNP complex. In a preferred vector, the snoRNA is substantially full-length pugU2-34 / 44snoRNA. It is also preferred that in such a vector, the exon A sequence comprises or consists of exon 1 of a human β-globin gene, and the exon B sequence comprises or consists of exon 2 of a human β-globin gene. Preferred vectors are plasmids and viral vectors. The vector according to the present invention is preferably used to treat, prevent or ameliorate any one or more of the diseases listed herein.

[0060] The present invention also relates to a pharmaceutical composition comprising a nucleic acid molecule according to the present invention or a vector according to the present invention and one or more pharmaceutically acceptable carriers, stabilizers or solvents. Suitable pharmaceutically acceptable carriers are well known to those skilled in the art.

[0061] In another embodiment, the present invention relates to a method for converting uridine in a target RNA molecule into pseudouridine in a cell, preferably a human cell, comprising the following steps: administering a vector according to the present invention to the cell; allowing transcription of exon A / intron / exon B sequences; allowing splicing and forming a snoRNA positioned in an intron; allowing the snoRNA to form a partially double-stranded nucleic acid complex with the target RNA molecule, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase to form a functional RNP complex, wherein the snoRNA correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted into pseudouridine by the RNP complex. The present invention also relates to a mammalian cell comprising a nucleic acid molecule according to the present invention or a vector according to the present invention. In yet another embodiment, the present invention relates to the use of the nucleic acid molecule of the present invention in the preparation of a medicament for treating one or more diseases listed herein.

[0062] In a particularly preferred but non-limiting embodiment, the present invention relates to a nucleic acid molecule according to the present invention for use in the treatment of cystic fibrosis (CF), in another more preferred embodiment, the present invention relates to a nucleic acid molecule according to the present invention for use in the treatment of CF, wherein the PTC is as shown in Table 1, more preferably G542X (UGA), W1282X (UGA), R553X (UGA), R1162X (UGA), Y122X (UAA), W1089X, W846X and W401X mutations are modified by pseudouridylation to codons encoding amino acids, thereby allowing translation into full-length proteins. For example, it is well established in the art that both ψAA and ψAG codons are translated into serine or threonine, while ψGA is translated into tyrosine or phenylalanine, rather than being considered as a stop codon (Karijolich and Yu, 2011). Therefore, pseudouridylation of the PTC to any of these ψ-containing codons will result in read-through during translation, or in other words, inhibiting the termination of protein translation and / or potential degradation of the mRNA due to nonsense-mediated decay. Thus, in a preferred aspect, the present invention relates to a nucleic acid molecule according to the present invention, such as a psEON as outlined herein, for use in the treatment of CF, wherein said nucleic acid molecule is capable of converting the uridine present in the PTC in the CFTR (pre) mRNA to ψ, wherein the PTC leads to premature translation termination and ultimately to the disease. Thus, in another aspect, the present invention relates to the use of a nucleic acid molecule according to the present invention in the preparation of a medicament for the treatment or prevention of a disease, preferably CF. In yet another embodiment of the present invention, it relates to a method for pseudouridylation of at least one target uridine present in the PTC of a target RNA in a cell, the method comprising the following steps: providing a nucleic acid molecule according to the present invention to a cell; allowing the cell to take up the nucleic acid molecule (e.g., when carried by a delivery vector); allowing the nucleic acid molecule according to the present invention to anneal to the target RNA; allowing the RNP guided by the guide RNA to pseudouridylate the target uridine in the target RNA to ψ; preferably, wherein the last step comprises assessing whether a functional, extended, full-length and / or wild-type protein is present when the target uridine is located in the PTC; assessing whether the splicing of the pre-mRNA is altered by pseudouridylation; or using a functional readout, wherein the target RNA following the pseudouridylated target molecule encodes a functional, full-length, extended and / or wild-type protein. Preferably, the cell to be pseudouridylated using the methods and means of the present invention is a human cell. In a preferred embodiment, the psEON according to the present invention (especially when administered in a "naked" form) comprises at least 50 nucleotides and is shorter than 100 nucleotides, more preferably shorter than 60 nucleotides.

[0063] It will be apparent to those skilled in the art that the present invention allows for the combination of different nucleic acid molecules according to the present invention designed for different target uridines in the same or different target RNA targets. Different nucleic acid molecules according to the present invention can be used simultaneously in a single composition or in separate compositions, or used sequentially. Nucleic acid molecules, such as pSONs according to the present invention, can be combined with other forms of treatment (including other forms of oligonucleotide treatment). The examples provided herein are intended to illustrate the present invention and are not to be construed in any way as limiting the present invention.

[0064] Table 1. List of PTC mutations in human CFTR that can be targeted for pseudouridylation using nucleic acid molecules according to the invention.

[0065]

[0066]

[0067] An important aspect of the present invention is that the psEON, although not embedded in an intronic sequence, contains one or more nucleotides having one or more modifications of a sugar or nucleobase moiety, or having one or more internucleoside bonds that are modified. Thus, a single nucleotide of a psEON may have one or more than one sugar or base modification. Within a psEON, one or more nucleotides may have such a sugar or base modification, and one or more internucleoside bonds may have a modification. For example, a sugar modification may include a 2'-O-alkyl modification (e.g., a 2'-OMe modification), a base modification may include replacement of a cytidine base with a 5-methylcytosine, and an internucleoside bond modification may include replacement of a phosphodiester bond with a (non-naturally occurring) PS bond.

[0068] The psEON of the present invention preferably comprises a single guide region, more preferably, the guide region is located in the 3′ terminal portion of the wild-type H / ACA snoRNA. Thus, a preferred aspect of the present invention is that the psEON comprises a single hairpin structure (relative to the wild-type in which the snoRNA comprises two hairpin structures), wherein the hairpin structure in the psEON represents the hairpin of the 3′ portion in the wild-type H / ACA snoRNA, and wherein the 5′ end of the psEON begins anywhere between the two stems found in the wild-type H / ACA snoRNA, and preferably comprises some additional nucleotides not present in the stem structure. Preferably, in one aspect, the psEON of the present invention does not comprise a complete H box at its 5′ end, but comprises a wild-type ACA box at its 3′ end. In another preferred aspect, it does comprise a complete H box at the 5′ end, but lacks a complete ACA box at the 3′ end. This is consistent with the known interactions of the pseudouridine synthase dyskeratin, two of which bind to the natural H / ACA snoRNA, one binding to the 5′ hairpin and the H box, and the other binding to the 3′ hairpin and the ACA box.

[0069] The improved feature of pSEN of the present invention is to use specific nucleotide modifications at predetermined sites to ensure stability and appropriate protein binding and pseudouridylation activity. These changes can be altered and can include modifications in the main chain of pSEN, the sugar moiety of the nucleotide, and the nucleobase. They can also be variably distributed throughout the pSEN sequence, depending on the target and secondary structure. Specific chemical modifications may be required to support the interaction of different amino acid residues in the RNA binding domain. For example, PS bonds and / or 2′-OMe modifications between nucleotides can be tolerated in certain parts of pSEN, while in other parts, they should be avoided so as not to destroy the key interactions between the enzyme and phosphate and / or 2′-OH groups. Based on the prior knowledge in the art and based on the teachings of the present disclosure, those skilled in the art will be able to determine whether a certain position in pSEN is suitable for 2′-OMe modification, or determine whether a certain internucleoside bond should or should not have PS modification. Modifications should also be selected to prevent pSEN degradation. In target sequences that are not suitable for editing, specific nucleotide modifications may also be necessary for enhancing pseudouridylation activity for substrate RNA.

[0070] In one aspect, the present invention relates to pseudouridylation editing guide RNAs that can be delivered while being embedded in artificial introns flanking exons of designated and / or specifically selected genes. Thus, the guide RNA can be expressed in mammalian cells from a vector such as a plasmid or viral vector carrying the exon-intron-exon sequence. As first demonstrated by the inventors of the present invention, targeted pseudouridylation can be obtained in a sequence-specific manner using intron-embedded guide RNAs. This approach can now potentially be used to promote, for example, PTC inhibition as a novel therapy in genetic diseases caused by PTC mutations.

[0071] The present invention is exemplified by, but not limited to, reversing the effects of nonsense stop mutations that normally lead to translation termination and mRNA degradation (via nonsense-mediated decay, see below). On the other hand, targeted pseudouridylation can serve as a means of recoding uridine-containing codons as a means of modulating protein function via amino acid substitutions (e.g., in key protein regions such as protein kinase active centers).

[0072] As known in the art, pseudouridylated guide RNA sequences (Box H / ACA guide RNAs noRNAs) naturally expressed in mammalian cells are usually processed from pre-mRNA introns. The assembly process is carried out by binding several proteins with pseudouridylation functions to the Box H / ACA guide RNA to form snRNPs. This process occurs during transcription and before splicing. After the intron containing the guide RNA is spliced ​​and debranched, the processing nuclease degrades the intron at its 5′ and 3′ ends. However, the bound snRNP protein protects the Box H / ACA guide RNA sequence from degradation, thereby allowing the formation of a mature snRNP complex. The snoRNA sequence can be inserted into the intron of a gene that is not (or may be) its natural environment, such as human β-globin (Kiss and Filipowicz, 1995), while still obtaining a fully mature snRNP. According to the present invention, the pseudouridylated editing guide RNA can be embedded in a non-host intron flanking the exon of the gene. A non-limiting example of a human gene for this purpose is the β-globin gene. Such constructs can be administered to and expressed in mammalian cells in a therapeutic setting, for example by using a plasmid or viral vector to express a fully functional cassette H / ACA snoRNA carrying in its pseudouridylation pocket a nucleotide sequence complementary to a specific sequence of a target RNA region.

[0073] One of the consequences of mutations that lead to PTCs in gene coding sequences is a reduction in mRNA levels. This is due to a mechanism called nonsense-mediated decay (NMD), which is a cellular surveillance mechanism in mammals that prevents transcripts from being translated without being properly processed. It is estimated that one-third of genetic diseases are the result of mutations that lead to PTCs (e.g., CF, retinitis pigmentosa (RP), and beta-thalassemia). Under normal circumstances, exon junction complexes (EJCs) are formed during splicing. These EJCs are then replaced by ribosomes in the first round of translation. On the other hand, when the PTC is located more than 50-54 nucleotides upstream of the last EJC, the NMD pathway is triggered by the formation of a termination complex composed of EJC-associated NMD factors. When this occurs in the pioneer phase of the first round of translation and the ribosome coexists with at least one EJC downstream of its position, this triggers decapping and 5' to 3' exonuclease activity as well as deadenylation of the tail and 3' to 5' exonuclease-mediated transcript decay. Therefore, in order to address the above genetic diseases or any disease caused by similar mutations, it is crucial to inhibit this pathway in a gene-specific and sequence-specific manner. The present invention is exemplified by recoding the PTC, which results in an increase in mRNA levels and readthrough of the translation of the recoded mRNA into a full-length protein. To assess NMD inhibition, known NMD inhibition reporter gene assays can be used (Zhang et al., 1998, RNA 4(7): 801-815), and translational readthrough of genes carrying the PTC can also be assessed. As exemplified herein, the 39th position of exon 2 is recoded. th The human β-globin gene carrying a nonsense mutation at a codon is used as a target sequence. Without correction, this nonsense mutation results in lower mRNA abundance (a result of NMD) and truncated proteins. As shown herein, correction of the mutation by targeted pseudouridylation allows full-length protein to be translated from mRNA and inhibits the NMD pathway due to increased mRNA levels. The inventors of the present invention introduced a 131nt pseudouridylation editing oligonucleotide sequence at the position of the original 130nt intron 1-2 of the human β-globin gene (between exon 1 and exon 2). The intron-embedded guide RNA sequence has a splice donor site located upstream (directly downstream of exon 1), a branch site, a polypyrimidine tract (a region rich in Py), and a splice acceptor ( Fig.12 ). The skilled person will appreciate that the PTC region of the human β-globin construct can be replaced with other target RNAs of interest or therapeutic relevance. As shown herein, by way of example only, the mmIDUA-W392X stop mutation is introduced into the 39 of the human β-globin gene. thThe results showed that this PTC can be successfully pseudouridylated using an editing guide RNA that is embedded in the intron of a non-native host gene in a sequence-specific manner. Targeted pseudouridylation leads to increased mRNA levels (i.e., NMD inhibition) and synthesis of full-length protein.

[0074] When SnoRNAs are embedded in intron sequences, they can be used for pseudouridylation in cells after exon-intron-exon sequences are applied to cells. This can be in the form of naked nucleic acids. Another way in which this construct (exon-intron-exon sequence) can be delivered to cells (in vitro, in vitro or in vivo) is by using a delivery vector such as a viral vector. A preferred viral vector is based on adeno-associated virus (AAV). Another preferred viral vector is, for example, a retroviral vector, such as a lentiviral vector, etc. Similarly, plasmids, artificial chromosomes, and plasmids for targeted homologous recombination and integration in the human genome of cells can be appropriately applied to deliver snoRNA as defined herein.

[0075] Typically, when snoRNA is delivered by a viral vector, it is in the form of an RNA transcript, which contains the sequence of the oligonucleotide according to the present invention in a portion of the transcript. The AAV vector according to the present invention is a recombinant AAV vector, and refers to an AAV vector comprising a portion of an AAV genome, a portion of the AAV genome comprising an exon-intron-exon sequence according to the present invention encapsidated in a protein shell of a capsid protein derived from an AAV serotype. A portion of the AAV genome may include an inverted terminal repeat (ITR) derived from an adeno-associated virus serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, etc.). The protein shell composed of capsid proteins can be derived from an AAV serotype, such as AAV1, 2, 3, 4, 5, 6, 7, 8, 9, etc. The protein shell may also be referred to as a capsid protein shell. The AAV vector may have one or preferably all wild-type AAV gene deletions, but may still include functional ITR nucleic acid sequences. Functional ITR sequences are essential for the replication, rescue and packaging of AAV virions. The ITR sequence may be a wild-type sequence, or may have at least 80%, 85%, 90%, 95% or 100% sequence identity with the wild-type sequence, or may be changed by, for example, insertion, mutation, deletion or substitution of nucleotides, as long as they remain functional. In this article, functionality refers to the ability to package the genome into the capsid and then allow it to be expressed in the host cell or target cell to be infected. In the context of the present invention, the capsid protein shell may have a serotype different from the AAV vector genome ITR. Therefore, the AAV vector according to the present invention may be composed of a capsid protein shell, i.e., an icosahedral capsid, which comprises a capsid protein (VP1, VP2 and / or VP3) of an AAV serotype, such as AAV serotype 2, and the ITR sequence contained in the AAV2 vector may be any of the above-mentioned AAV serotypes, including AAV2 vectors. Thus, an "AAV2 vector" comprises a capsid protein shell of AAV serotype 2, while, for example, an "AAV5 vector" comprises a capsid protein shell of AAV serotype 5, either of which can encapsidate any AAV vector genome ITR according to the invention with a capsid protein shell. Preferably, the recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2, 5, 8 or AAV serotype 9, wherein the AAV genome or ITR present in the AAV vector is derived from AAV serotype 2, 5, 8 or AAV serotype 9; such AAV vectors are referred to as AAV2 / 2, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV5 / 2, AAV5 / 5, AAV5 / 8, AAV5 / 9, AAV8 / 2, AAV8 / 5, AAV8 / 8, AAV8 / 9, AAV9 / 2, AAV9 / 5, AAV9 / 8 or AAV9 / 9 vectors.

[0076] More preferably, the recombinant AAV vector according to the present invention comprises a capsid protein shell of AAV serotype 2, and the AAV genome or ITR present in the vector is derived from AAV serotype 5; such a vector is referred to as an AAV2 / 5 vector. More preferably, the recombinant AAV vector according to the present invention comprises a capsid protein shell of AAV serotype 2, and the AAV genome or ITR present in the vector is derived from AAV serotype 8; such a vector is referred to as an AAV2 / 8 vector. More preferably, the recombinant AAV vector according to the present invention comprises a capsid protein shell of AAV serotype 2, and the AAV genome or ITR present in the vector is derived from AAV serotype 9; such a vector is referred to as an AAV2 / 9 vector. More preferably, the recombinant AAV vector according to the present invention comprises a capsid protein shell of AAV serotype 2, and the AAV genome or ITR present in the vector is derived from AAV serotype 2; such a vector is referred to as an AAV2 / 2 vector. Preferably, a nucleic acid molecule represented by a selected nucleic acid sequence and having an exon-intron-guide RNA-intron-exon sequence according to the present invention is inserted between the AAV genome or ITR sequences as described above, for example, an expression construct comprising expression regulatory elements operably linked to a coding sequence and a 3′ termination sequence. "AAV auxiliary function" generally refers to the corresponding AAV function required for AAV replication and packaging provided to the AAV vector in trans. AAV auxiliary functions are a supplement to the AAV functions lacking in the AAV vector, but they lack the AAV ITR (provided by the AAV vector genome). AAV auxiliary functions include two main ORFs of AAV, namely the rep coding region and the cap coding region or sequences substantially identical in function thereof. Rep and Cap regions are well known in the art. AAV auxiliary functions can be provided to an AAV auxiliary construct, which can be a plasmid.

[0077] The helper constructs may be introduced into the host cell prior to or simultaneously with the introduction of the AAV genome present in the AAV vector as defined herein, for example by transformation, transfection or transduction. Thus, the AAV helper constructs of the invention may be selected so that they produce, on the one hand, the desired combination of serotypes of the capsid protein shell for the AAV vector and, on the other hand, the desired combination of serotypes of the AAV genome present in the replication and packaging of the AAV vector. The "AAV helper virus" provides other functions required for AAV replication and packaging.

[0078] Suitable AAV helper viruses include adenovirus, herpes simplex virus (e.g., type 1 and type 2 HSV) and vaccinia virus. As described in US 6,531,456, other functions provided by the helper virus can also be introduced into host cells by vectors. Preferably, the AAV genome present in the recombinant AAV vector according to the present invention does not contain any nucleotide sequence encoding viral proteins, such as the rep (replication) or cap (capsid) genes of AAV. The AAV genome may further include markers or reporter genes, such as genes encoding antibiotic resistance genes, fluorescent proteins (e.g., gfp), or genes encoding products (e.g., lacZ, aph, etc.) that can be detected and / or selected in other ways as known in the art, enzymatically or otherwise. The preferred AAV vector according to the present invention is an AAV vector, preferably an AAV2 / 5, AAV2 / 8, AAV2 / 9 or AAV2 / 2 vector.

[0079] Definitions of Terms Used in This Article

[0080] As used herein, the terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" (the nucleobase in inosine) refer to the nucleobases themselves.

[0081] The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," "pseudouridine," and "inosine" refer to a nucleobase linked to a (deoxy)ribosyl sugar.

[0082] The term "nucleoside" refers to a nucleobase linked to a (deoxy)ribosyl sugar.

[0083] The term "nucleotide" refers to the respective nucleobase-(deoxy)ribosyl-phosphate linker, as well as any chemical modification of the ribose moiety or the phosphate group. Thus, the term will include nucleotides containing a locked ribosyl moiety (comprising a 2'-4' bridge containing a methylene group or any other group known in the art), including nucleotides containing linkers of phosphodiester, phosphotriester, (di)phosphorothioate, methylphosphonate, phosphoramidate linkers, and the like.

[0084] Sometimes the terms adenosine and adenine, guanosine and guanine, cytosine and cytidine, uracil and uridine, thymine and thymidine, inosine and hypoxanthine are used interchangeably to refer to the corresponding nucleobase, nucleoside or nucleotide. Pseudouridine is often referred to as ψ, or as 5-ribosyluracil.

[0085] Sometimes the terms "nucleobase", "nucleoside" and "nucleotide" are used interchangeably unless the context clearly requires otherwise. The terms "ribonucleoside" and "deoxyribonucleoside" or "ribose" and "deoxyribose" are used in the art.

[0086] Whenever "oligonucleotide" is mentioned, both oligoribonucleotides and deoxyoligoribonucleotides are intended, unless the context indicates otherwise. Whenever "oligoribonucleotide" is mentioned, it may contain the bases A, G, C, U or I. Whenever "deoxyoligoribonucleotide" is mentioned, it may contain the bases A, G, C, T or I. In a preferred aspect, the EON of the present invention is an oligoribonucleotide, which may contain chemical modifications and may include deoxynucleotides (DNA) at certain specific positions.

[0087] Whenever a nucleotide in an oligonucleotide construct is mentioned, such as cytosine, it includes 5-methylcytosine, 5-hydroxymethylcytosine, pyrrolocytidine and β-D-glucosyl-5-hydroxy-methylcytosine; when adenine is mentioned, it includes 2-aminopurine, 2,6-diaminopurine, 3-deazaadenosine, 7-deazaadenosine, 8-azidoadenosine, 8-methyladenosine, 7-aminomethyl-7-deazaguanosine, 7-deazaguanosine, N6-methyladenine and 7-methyladenine; when uracil is mentioned, it includes 5-methoxyuracil, 5-methyluracil, dihydrouracil, pseudouracil and thienouracil, dihydrouracil, 4-thiouracil and 5-hydroxymethyluracil; when guanosine is mentioned, it includes 7-methylguanosine, 8-aza-7-deazaguanosine, thienoguanosine and 1-methylguanosine.

[0088] Whenever a nucleoside or nucleotide is mentioned, ribofuranose derivatives are included, such as 2'-deoxy, 2'-hydroxy and 2'-O-substituted variants such as 2'-O-methyl (2'-OMe), as well as other modifications including 2'-4' bridged variants.

[0089] Whenever referring to an oligonucleotide, the bond between the two mononucleotides can be a phosphodiester bond as well as modifications thereof including phosphodiester, phosphotriester, (di)phosphorothioate, methylphosphonate, phosphoramidate linkers and the like.

[0090] The term "comprising" encompasses "including" as well as "consisting of", for example a composition "comprising X" may consist of X only, or may include additional components, such as X+Y.

[0091] The term "about" in relation to a numerical value x is optional and means, for example, x ± 10%.

[0092] The word "substantially" does not exclude "completely", for example a composition "substantially free of Y" may be completely free of Y. Where relevant, the word "substantially" may be omitted from the definition of the present invention.

[0093] As used herein, the term "complementary" refers to the fact that the nucleic acid molecule according to the present invention hybridizes with the target RNA sequence and / or its own internal sequence, particularly the sequence in the hairpin structure under physiological conditions. The term does not mean that each nucleotide in the nucleic acid molecule has a perfect match with its opposite nucleotide in the target sequence or in the hairpin structure. In other words, although the nucleic acid molecule according to the present invention can be complementary to the target sequence, there may be mismatches, swings and / or protrusions between the nucleic acid molecule of the present invention and the target sequence, but under physiological conditions, the nucleic acid molecule still hybridizes with the target sequence so that the cellular enzyme can convert the target uridine into ψ. Therefore, the term "substantially complementary" also means that despite the presence of mismatches, swings and / or protrusions, the nucleic acid molecule according to the present invention has enough matching nucleotides with the target sequence, so that the nucleic acid molecule hybridizes with the target RNA under physiological conditions. As shown herein, the nucleic acid molecule can be complementary, but it can also contain one or more mismatches, swings and / or protrusions with the target sequence, as long as the nucleic acid molecule of the present invention can hybridize with its target under physiological conditions.

[0094] The term "downstream" in relation to a nucleic acid sequence refers to the sequence further along the 3' direction; the term "upstream" is the opposite. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon in the sense strand, but downstream of the stop codon in the antisense strand.

[0095] When "hybridization" is mentioned, specific hybridization is generally referred to, and non-specific hybridization is excluded. Using techniques well known in the art, specific hybridization can be performed under selected experimental conditions to ensure that the most stable interaction between the probe and the target is that the probe and the target have at least 70%, preferably at least 80%, and more preferably at least 90% sequence identity.

[0096] The term "mismatch" as used herein refers to the relative nucleotides in the double-stranded RNA complex that do not form a perfect base pair according to the Watson-Crick base pairing rules. Mismatched base pairs are GA, CA, UC, AA, GG, CC, UU base pairs. In some embodiments, the nucleotide molecules according to the present invention contain less than 4 mismatches, such as 0, 1, 2 or 3 mismatches. Wobble base pairs are GU, IU, IA and IC base pairs.

[0097] The term "splicing mutation" refers to a mutation in a gene encoding a pre-mRNA, wherein the splicing mechanism is disturbed in removing introns from the pre-mRNA and is dysfunctional in the sense of abnormal splicing (e.g., by forming a dysfunctional protein or by preventing the translation of a fully functional protein due to the absence of a functional protein). As discussed herein, such dysfunctional proteins are often rapidly degraded and do not have any functional activity, and the mRNA of abnormal splicing can also be rapidly degraded. In a preferred aspect, the splicing mutations targeted by the nucleic acid molecules of the present invention and by the methods of the present invention are present in the human CFTR gene. Those skilled in the art know how to determine whether to restore normal splicing.

[0098] Free (or naked) psEONs according to the invention may almost entirely be chemically modified, for example by providing nucleotides with 2'-O-methylated sugar moieties (2'-OMe) and / or with 2'-O-methoxyethyl sugar moieties (2'-MOE).

[0099] Various chemistries and modifications are known in the field of oligonucleotides, which can be easily used according to the present invention. Conventional internucleoside bonds between nucleotides can be changed by mono-thioation or di-thioation of phosphodiester bonds, producing thiophosphates or dithiophosphates, respectively. Other modifications of internucleoside bonds are possible, including amidation and peptide connectors. In a preferred aspect, the psEON of the present invention has one, two, three, four, five, six or more thiophosphate bonds between the terminal nucleotides of the psEON (thus, preferably at the 5' and 3' ends), which means that in the case of three thiophosphate bonds, the final 4 nucleotides are connected accordingly. It will be appreciated by those skilled in the art that the number of such bonds can vary at each end, depending on the target sequence, or based on other aspects, such as toxicity. However, one aspect of the present invention is that the psEON does contain one or more PS bonds between any position of its terminal seven nucleotides.

[0100] The ribose can be modified by replacing the 2′-O moiety with a lower alkyl (C1-4, such as 2′-OMe), alkenyl (C2-4), alkynyl (C2-4), methoxyethyl (2′-methoxyethoxy; or 2′-O-methoxyethyl; or 2′-O-MOE) or other substituents. Preferred substituents for the 2′-OH group are methyl, methoxyethyl or 3,3′-dimethylallyl. The latter is known to have properties that inhibit nuclease sensitivity due to its bulkiness, while improving hybridization efficiency. Alternatively, locked nucleic acid sequences (LNA) can be used, which contain a 2′-4′ intramolecular bridge (usually a methylene bridge between the 2′ oxygen and the 4′ carbon) bond inside the ribose ring. Purine nucleobases and / or pyrimidine nucleobases can be modified to change their properties, for example by amination or deamination of the heterocycle. Other modifications that may be present in the psEON of the present invention are 2′-F modified sugars, BNA and cEt. The exact chemistry and format may depend on different oligonucleotide constructs and different applications, and can be addressed according to the preconceptions and preferences of those skilled in the art.

[0101] 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides.

[0102] Examples of chemical modifications in psEONs of the invention as described above are modifications of the sugar moiety, including by cross-linking substituents within the sugar (ribose) moiety (e.g., in LNA or locked nucleic acids, BNA, cEt, etc.), by replacing the 2'-O atom with an alkyl (e.g., 2'-O-methyl), alkynyl (2'-O-alkynyl), alkenyl (2'-O-alkenyl), alkoxyalkyl (e.g., 2'-O-methoxyethyl, 2'-MOE) group, etc., which have the above-mentioned lengths, etc. In the context of the present invention, sugar "modifications" also include 2' deoxyribose (as in DNA). In addition, the phosphodiester groups of the backbone can be modified by thiolation, dithiolation, amidation, etc. to produce internucleoside bonds such as phosphorothioates, phosphorodithioates, phosphoramidates, etc. The internucleoside bonds can be replaced in whole or in part by peptide bonds to produce peptide nucleic acid sequences, etc. Alternatively, or in addition, the nucleobases can be modified by (de)amination to produce inosine or 2'6'-diaminopurine, etc. A further modification may be methylation of C5 in the cytidine portion of the nucleotide to reduce the potential immunogenicity known to be associated with CpG sequences.

[0103] The extent of recruitment and redirection of resident pseudouridylated entities in cells can be modulated by the dose and dosing schedule of snoRNA. This is determined by experimentalists (in vitro) or clinicians, typically in phase I and / or II clinical trials.

[0104] The present invention relates to the modification of target RNA sequences in eukaryotic, preferably metazoan, more preferably mammalian cells. In principle, the present invention can be used with cells of any mammalian species, but preferably with human cells. The present invention can be used for cells from any organ such as skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, etc. The present invention is particularly suitable for modifying sequences in cells, tissues or organs related to the disease state of (human) subjects, such as when human subjects suffer from CF. Such cells include but are not limited to epithelial cells of the lungs. The cells can be located in vitro or in vivo. An advantage of the present invention is that it can be used with in situ cells in living organisms, and can also be used with cells in culture. In some embodiments, the cells are treated in vitro and then introduced into living organisms (e.g., reintroduced into the organisms from which they originally came). The present invention can also be used to edit target RNA sequences in cells in so-called organoids. Organoids can be considered as three-dimensional in vitro produced tissues, but driven by specific conditions to produce independent, isolated tissues (e.g., see Lancaster and Knoblich. 2014, Science 345 (6194): 1247125). In a therapeutic setting, they are beneficial because they can be obtained from the patient's cells in vitro, and then the organoids can be reintroduced into the patient as autologous material with a lower probability of rejection than conventional transplants. The cells to be treated will usually have genetic mutations. Mutations can be heterozygous or homozygous. The present invention will typically be used to modify point mutations.

[0105] The present invention is used to change the target RNA sequence in eukaryotic cells by using oligonucleotides, which can target the site to be edited and recruit RNA editing entities resident in the cell to perform editing reactions. The target RNA sequence may include mutations that people may wish to correct or change, such as point mutations (conversions or transversions). The target RNA can be any cell or viral RNA sequence, more typically a precursor mRNA or an mRNA with a protein coding function. The target sequence is endogenous to eukaryotic organisms, preferably mammals, and more preferably human cells.

[0106] The amount of nucleic acid administered, the dose, and the dosing schedule can vary with the cell type, the disease to be treated, the target population, the mode of administration (e.g., systemic vs. local), the severity of the disease, and the acceptable level of side effects, but these can and should be evaluated by trial and error during in vitro studies in preclinical and clinical trials. These experiments are particularly simple when the modified sequence results in a phenotypic change that is easily detected. It is possible that higher doses of nucleic acid will compete for binding to the nucleic acid editing entity within the cell, thereby depleting the amount of entity free to participate in pseudouridylation, but routine dosing experiments will reveal any such effects for a given nucleic acid molecule and a given target.

[0107] A suitable test technique involves delivering the nucleic acid molecule according to the present invention to a cell extract, a cell line or a test organism, and then taking a biopsy sample at each time point. The sequence of the target RNA can be evaluated in the biopsy sample, and the ratio of cells with modification can be easily tracked. After performing the test once, the knowledge can be retained, and it can be delivered in the future without obtaining a biopsy sample. Therefore, the method of the present invention can include the step of identifying the presence of the desired change in the target RNA sequence of the cell, thereby verifying that the target RNA sequence has been modified. When the protein encoded by the target RNA sequence is, for example, an ion channel, the change can be evaluated according to the level (length, glycosylation, function, etc.) of the protein or certain functional readings (such as (inducible) current). In the case of CFTR function, it is known to those skilled in the art to evaluate the recovery or acquisition of function by using Ussing chamber assay or NPD test in mammals (including people).

[0108] After pseudouridylation occurs in the cell, the modified RNA may be diluted over time, e.g., due to cell division, limited half-life of the edited RNA, etc. Thus, in actual treatment, the methods of the invention may involve repeated delivery of oligonucleotides until sufficient target RNA has been modified to provide a clear benefit to the patient and / or the benefit is maintained over time.

[0109] The nucleic acid sequences of the invention (oligonucleotides, modified snoRNA; psEON; vectors, such as those described herein with exon-intron-exon sequences, pol-II or pol-III driven expression constructs) are particularly suitable for therapeutic use, and therefore, the invention provides a pharmaceutical composition comprising an oligonucleotide or vector of the invention and a pharmaceutically acceptable carrier or solvent. In some embodiments of the invention, the pharmaceutically acceptable carrier or solvent may simply be a saline solution. This may be effectively isotonic or hypotonic, particularly for pulmonary delivery. The invention also provides a delivery device (e.g., a syringe, an inhaler, a nebulizer) comprising the pharmaceutical composition of the invention.

[0110] The present invention also provides an oligonucleotide of the present invention, as described herein, for use in a method of altering a target RNA sequence in a mammal, preferably a human cell. Similarly, as described herein, the present invention provides a nucleic acid molecule, such as an oligonucleotide of the present invention or an expression construct or vector, for use in the preparation of a medicament for altering a target RNA sequence in a mammal, preferably a human cell.

[0111] The present invention also relates to a method for pseudouridylation of at least one specific target uridine present in a target RNA sequence in a cell, the method comprising the steps of: providing a nucleic acid molecule according to the present invention to a cell; allowing the cell to take up the nucleic acid molecule (or a vector carrying the encoding nucleic acid molecule sequence); annealing the nucleic acid molecule to the target RNA sequence; allowing the formation of a pseudouridylation-functional RNP with the incorporated introduced guide RNA, thereby pseudouridylating the target uridine in the target RNA sequence to ψ; and optionally identifying the presence of ψ in the RNA sequence. The nucleic acid molecule (e.g., psEON) can be made and delivered as such, but, as disclosed herein, it can also be embedded in an intron sequence from which it is spliced ​​in the cell to function in pseudouridylation.

[0112] The nucleic acid molecules according to the present invention are introduced into cells by general methods known to those skilled in the art. After pseudouridylation, the reading of the effect (change in the target RNA sequence) can be monitored in different ways. Therefore, the identification step of determining whether the desired pseudouridylation of the target uridine has actually occurred generally depends on the position of the target uridine in the target RNA sequence, and the effect caused by the presence of uridine (point mutation, PTC). Therefore, in preferred aspects, depending on the final effect of U to ψ conversion, the identification step includes: assessing the presence of functional, extended, full-length and / or wild-type proteins; assessing whether the splicing of the pre-mRNA is changed due to pseudouridylation; or using a functional readout, wherein the target RNA after pseudouridylation encodes a functional, full-length, extended and / or wild-type protein. Functional assessment for each disease mentioned herein will generally be performed according to methods known to the technician.

[0113] Nucleic acid molecules, such as pseudouridylation editing oligonucleotide (psEON) expression constructs or vectors according to the present invention, are suitably administered in an aqueous solution (e.g., saline) or suspension, which optionally contains additives, excipients and other ingredients compatible with pharmaceutical use, and the concentration of nucleic acid molecules is 1ng / ml to 1g / ml, preferably 10ng / ml to 500mg / ml, more preferably 100ng / ml to 100mg / ml. The dosage can be suitably in the range of about 1μg / kg to about 100mg / kg, preferably between about 10μg / kg to about 10mg / kg, more preferably between about 100μg / kg to about 1mg / kg. Administration can be by inhalation (e.g., by atomization), intranasal, oral, injection or infusion, intravenous, subcutaneous, intradermal, intracranial, intravitreal, intramuscular, intratracheal, intraperitoneal, rectal, etc. Administration can be in solid form, powder, pill form, or any other form compatible with human pharmaceutical use. The present invention is particularly useful in treating genetic diseases such as CF.

[0114] In some embodiments, nucleic acid molecules, such as pSEON, expression constructs or vectors can be delivered systemically, but more typically the oligonucleotides are delivered to cells in which the phenotype of the target sequence appears. For example, mutations in CFTR cause CF that is primarily visible in lung epithelial tissue, so for CFTR target sequences, it is preferred that the oligonucleotide constructs are specifically delivered directly to the lungs. This can be conveniently achieved by using a nebulizer to inhale, for example, powders or aerosols. Particularly preferred is a nebulizer using a so-called vibrating mesh, including PARI eFlow (Rapid) or i-neb from Respironics. It can be expected that the inhalation delivery of the oligonucleotide construct according to the present invention can also effectively target these cells, which can lead to the alleviation of gastrointestinal symptoms also associated with CF in the case of CFTR gene targeting. In some diseases, the thickness of the mucus layer increases, resulting in reduced absorption of drugs by the lungs. One such disease is chronic bronchitis, and another example is CF. A variety of mucus standardization agents can be used, such as DNase, hypertonic saline or mannitol, which can be purchased under the name of Bronchitol. When mucus standardizing agents are used in combination with pseudouridylated oligonucleotide constructs, such as psEON constructs according to the present invention, they can increase the effectiveness of those drugs. Therefore, it is preferred that the oligonucleotide constructs according to the present invention are administered to a subject, preferably a human subject, in combination with a mucus standardizing agent, preferably those described herein. In addition, the administration of the oligonucleotide constructs according to the present invention can be combined with the administration of small molecules used to treat CF, such as enhancer compounds, such as Kalydeco (ivacaftor; VX-770) or corrector compounds, such as VX-809 (lumacaftor) and / or VX-661. Alternatively, or in combination with mucus standardizing agents, delivery in mucus permeable particles or nanoparticles can be used to effectively deliver pseudouridylated molecules to epithelial cells, such as the lungs and intestines. Therefore, the oligonucleotide constructs according to the present invention are administered to a subject, preferably a human subject, preferably using delivery in mucus permeable particles or nanoparticles. Patients with diseases such as cystic fibrosis often experience chronic and acute lung infections. Antibiotic treatment can reduce bacterial infection and symptoms, such as mucus thickening and / or biofilm formation. Antibiotics used in combination with the oligonucleotide constructs according to the present invention can improve the effectiveness of pseudouridylation, because the oligonucleotide constructs are more easily introduced into target cells. Therefore, the oligonucleotide constructs according to the present invention are administered to a subject, preferably a human subject, preferably in combination with antibiotic treatment to reduce bacterial infection and symptoms thereof, such as mucus thickening and / or biofilm formation. Antibiotics can be administered systemically or topically or both together.For use in CF patients, the oligonucleotide constructs according to the invention or the packaged or complexed oligonucleotide constructs according to the invention may be combined with any mucus normalizer such as DNase, mannitol, hypertonic saline and / or antibiotics and / or small molecules for the treatment of CF such as enhancer compounds (e.g. ivacaftor) or corrector compounds (e.g. lumacaftor and / or VX-661). To increase access to target cells, Broncheo-Alveolar Favage (BAF) may be applied to cleanse the lungs prior to administration of the oligonucleotides according to the invention.

[0115] Example

[0116] Example 1: Design of pseudouridylation guide oligonucleotides derived from the structure of small nucleolar RNA (snoRNA) for converting specific uridines in the ACA19 target RNA to ψ.

[0117] The inventors of the present invention questioned whether it is possible to induce pseudouridylation using a shortened box H / ACA snoRNA. To this end, a pseudouridylation guide RNA was designed in which the 5′ hairpin and most of the H box of the full-length ACA19 snoRNA were removed ( Figure 4 ). Shortened guide RNAs and full-length snoRNAs were generated by in vitro transcription using T7 RNA polymerase. For testing in cell lysates, the guide RNAs were transcribed using T7 RNA polymerase (in [α- 32 These guide short substrate RNAs were generated by in vitro transcription in the presence of [γ-UTP] or by ligation of the two parts. For the latter, first, the 5′ hydroxyl group of the synthetic RNA oligonucleotide terminated with pseudouridylation at the 5′ end of uridine was cleaved with [γ- 32 The 5′ end of the radiolabeled RNA oligonucleotide is then linked to the 3′ hydroxyl group of another RNA oligonucleotide to form a substrate RNA. This is accomplished by annealing the RNA oligonucleotide to a 30-nt bridging DNA oligonucleotide, so that the 5′ half (15nt) of the bridging DNA oligonucleotide base pairs with the 3′ RNA fragment and the 3′ half (l5-nt) of the bridging DNA oligonucleotide base pairs with the 5′ RNA fragment, and then providing them with T4 DNA ligase to covalently link the RNA oligonucleotides. The sequence of the linked radiolabeled RNA substrate is 5′-AGGGGAACCCCACAG U CGAACCAAAACAAA-3' (SEQ ID NO: 1), where the target uridine (containing a radioactive phosphate on its 5' side) is underlined. The substrate RNA is then purified from other nucleic acids by isolating it, cutting it from a denaturing polyacrylamide gel, eluting it from the gel, and finally concentrating it by ethanol precipitation.

[0118] To prepare cell lysates for testing pseudouridylation, HeLa cells were grown to 80-100% confluence in DMEM with 10% FBS on standard 10-cm cell culture dishes, and then they were harvested by scraping and washed with phosphate-buffered saline. Afterwards, 200 μl of extraction buffer (25% glycerol, 0.42 M NaCl, 1.5 mM MgCl) was added to the cells. 2 , 0.2 mM EDTA, 20 mM HEPES (pH 7.9), 0.5 mM DTT and 0.5 mM phenylmethane-sulfonyl fluoride). Then vortex for 30 seconds 3 times in the presence of sterile glass beads, incubate on ice for 30 seconds after each oscillation. Cell debris is removed by centrifugation, and the supernatant is collected for pseudouridylation assay.

[0119] For pseudouridylation assays, 200 mM Tris-HCl, pH 8.0, 200 mM ammonium acetate, 10 mM MgCl 2 , 4mM DTT and 0.2mM EDTA incubation buffer, supplemented with 200ng full-length H / ACA snoRNA or shortened guide RNA, substrate RNA according to its relative radioactivity (5000 counts per minute), 250ng yeast tRNA and HeLa cell extract (final concentration of 20%), mixed and incubated at 37°C for 40 minutes. RNA was then isolated from the reaction by phenol-chloroform extraction and ethanol precipitation. RNA was then incubated with P1 nuclease (-300ng) in 20mM sodium acetate buffer (pH 5.2) at 37°C for 1 hour to degrade RNA and release individual nucleotides. They were then separated by thin layer chromatography (isopropanol: HCl: water in a solvent volume ratio of 70:15:15, respectively), and the radioactive nucleotides were then imaged by autoradiography. Due to the different migration of labeled uridine and pseudouridine, the conversion of labeled substrate uridine to pseudouridine can be clearly observed for both full-length H / ACAsnoRNA and shortened guide RNA. Figure 5 showed that when shortened pseudouridylated guide oligonucleotides were used, the efficiency of pseudouridylation was at least comparable to that observed with the full-length version of the guide RNA.

[0120] Then, it was investigated whether the chemical modifications performed in the shortened ACA19 guide RNA were compatible with target RNA binding and the formation of a catalytically active pseudouridylation complex. The positions of the chemical modifications were selected as described herein. The substrate RNAs used and the experimental assays were the same as those described above for comparing full-length H / ACAs noRNA or shortened guide RNAs. Figure 6Four ACA19 pseudouridylation editing oligonucleotides (psEONs) are shown along with the locations of the introduced chemical modifications: black dots represent 2′-OMe modifications on the ribose moiety of the nucleotide, open dots indicate PS modifications of the linkage between the two ribose sugars. Figure 7 Results of pseudouridylation using four ACA19 psEONs with corresponding guide RNAs (lacking chemical modifications) as positive controls and no guide RNA as negative control are shown. U and ψ indicate the migration of uridine and pseudouridine in thin layer chromatography, respectively. Clearly, the chemically modified psEONs are able to support the conversion of uridine to pseudouridine, and the first psEON even provides a stronger pseudouridylation signal compared to the positive control. The enhanced effect may be due to specific interactions between the chemical modifications of the psEONs in the enzymatically active complex, or to other effects, such as increased resistance to nucleases in cell lysates, each of which may contribute to pseudouridylation efficiency and / or rate.

[0121] Example 2: Design of psEONs for converting specific uridines in the premature stop codon of human CFTR.

[0122] It was investigated whether the uridine in the premature termination codon (PTC) in the human CFTR gene can be converted to ψ. For example, the CFTR-G542X mutation was selected. The test process is as described in Example 1.

[0123] The substrate RNA was constructed similarly to Example 1 (two parts were connected), and the final target sequence was 5′-GACAAUAUAGUUCUU U GAGAAGGUGGAAUC-3' (target uridine is underlined; SEQ ID NO: 2).

[0124] Figure 8 Four CFTR-G542X psEONs and the locations of their introduced chemical modifications are shown: black dots represent 2′-OMe modifications on the ribose moiety of the nucleotide, open dots indicate PS modifications at the linkage between the two ribose sugars. Fig. 9 Results of pseudouridylation using four CFTR-G542X psEONs with corresponding guide RNAs (lacking chemical modifications) as positive controls and no guide RNA as negative controls are shown. U and ψ indicate the migration of uridine and pseudouridine in thin layer chromatography, respectively. The results clearly show that three of the four psEONs outperformed the positive control, again indicating that chemical modifications at the indicated positions increase the rate and / or efficiency of pseudouridylation in mammalian cell lysates.

[0125] Example 3: Design of snoRNA for converting specific uridine in premature stop codon in mouse Idua RNA.

[0126] It was investigated whether the uridine in the PTC in the mouse Idua RNA could be converted into ψ. As an example, the Idua-W392X mutation in the mouse RNA was chosen, which corresponds to the human IDUAW402X mutation known to cause Hurler Syndrome. For this purpose, a substrate RNA was constructed similarly to Example 1 (two-part ligation), the final sequence of which was 5′-GAUGGAGAACAACUC U AGGCAGAGGUCUCA-3' (the target uridine is underlined; SEQ ID NO: 3).

[0127] Fig.10 Four Idua-W392X psEONs and the positions of the introduced chemical modifications are shown: black dots represent 2′-OMe modifications on the ribose moiety of the nucleotide, open dots indicate PS modifications of the linkage between the two ribose sugars. Fig.11 Results for pseudouridylation using four Idua-W392X psEONs with the corresponding guide RNA (lacking chemical modification) as positive controls and no guide RNA as negative control are shown. U and ψ indicate the migration of uridine and pseudouridine in thin layer chromatography, respectively. Here, the intensity of the negative control is very low due to the loss of sample in the precipitation step after the pseudouridylation reaction. However, the results clearly show that all psEONs are able to support the conversion of uridine to pseudouridine, even better than the positive control, again indicating that chemical modifications at the indicated positions increase the rate and / or efficiency of pseudouridylation in mammalian cell lysates.

[0128] Example 4: Targeted pseudouridylation of vectors containing premature stop codons using intron-embedded guide RNA.

[0129] Cloning of Exon 1 / Intron-Guide RNA-Intron / Exon 2 constructs "pugIntron-IDUA" and "pugIntronOpt-IDUA":

[0130] The pugIntron-IDUA plasmid construct was based on the original backbone pdRLuc-Gi (Woeller et al., 2008. EMBO Reports 9(5): 446-451) and was generated by PCR amplification and site-directed mutagenesis using Agilent's PfuUltra II fusion HS DNA polymerase. The pugIntron plasmid was generated by first inserting restriction sites SalI and PstI into the first intron of human β-globin in the parental pdRLuc-G1 vector. The following primers were used: SDMI-GLintron1-Sal-Pst: 5'-GTAAGTCGACGAATTCTGCAGGCTGCTGGT GG-3' (SEQ ID NO: 13) and SDM2-GLintron1-Sal-Pst: 5'-GCCTGCAGA ATTCGTCGACTTACCTGCCCAGG-3' (SEQ ID NO: 14). Guide RNA was then generated by PCR using the following SalI / PstI containing primers (which also included an additional Py-rich splice sequence): pug-intron-EwdSalI: 5'-GTTGTCGAC GTGGGAGATTCT-3' (SEQ ID NO: 15) and pug-intron-RevExPstI: 5'-AATCTGCAGG GGAAAAGAGAGAGTCAACCTGTCTGCCTCGT-3' (SEQ ID NO: 16). First, the SalI-HindIII fragment of the parent vector was inserted into an intermediate vector (pEGFP-C3) using the SalI-HindIII site located downstream of the PstI restriction enzyme site but still located in the intron region. The guide RNA PCR product digested with SalI-PstI was then inserted into the intermediate vector. Finally, the SalI-HindIII fragment was cloned back into the pugIntron expression parent vector. Fig.12 The construct with an upstream CMV promoter, exon 1 (E1) and exon 2 (E2) in the intronic part and the pugIntron-IDUA insert is shown, and the SalI and PstI sites are indicated. Fig.13The sequence of the entire pugIntron-IDUA plasmid is shown (SEQ ID NO: 11). A further optimized version of this construct (creating a more appropriate 3' splice site sequence) was made by running PCR using pug-intron-FwdSalI as the forward primer (see above) and the following primer as the reverse primer (two additional nucleotides compared to the pug-intron-RevExPstI reverse primer (see above), creating an alternative 5'-AC-3' sequence at the 3' splice site, underlined): pug-intronOPT-RevExPstI: 5'-AATCTGCAGGGGAAAAGAGAGAGTCA GTACCTGTCTGCCTC-3' (SEQ ID NO:21). The above cloning steps were repeated to generate the optimized plasmid pugIntronOpt-IDUA, the complete sequence of which is given in SEQ ID NO:22 (compared to SEQ ID NO:11, it contains an additional 5'-AC-3' directly downstream of the intron). The negative control pugCFTR is the original version of the guide RNA used for the pugIntron PCR template. The construct was made from three overlapping DNA oligonucleotides whose backbones were derived from pugU2-34 / 44 for CFTR: pug-NBD1-FlHindIII 5′-ATTAAGCTTGT GTGGGAGATTCTTCTTCGGACAGAGAGAAACTCTGCTGTG-3′ (SEQ ID NO:27), pug-NBD1-Rl 5′-CTGCTGTGTCTGAAAGAAGATCTCCCTATAGTGACCCTGCCTTACCTTCTCCGGGAC GAA-3′ (SEQ ID NO:28), and pug-NBD1-R2BamHI 5′-ATGGATCCACCTGTCTGCC TCGTATTCTTCCGTTACGATTTCTCTCATTTCGTCCCGG-3′ (SEQ ID NO:29), and for IDUA: pug-mmidua-FlHindIII 5′-ATTAAGCTTGTGTGGGAGATTCTGCCTCGGACAGAGAGAAACTCT GCTGTG-3′ (SEQ ID NO: 30), pug-mmidua-R1 5′-TTCGTCCCGGGGCAGAGAAGGCAGG GTCACTATAGGGAGATCAACTCTCAGACACAGCAG-3′ (SEQ ID NO: 31) and pug-mmidua-R2BamHI 5′-ATGGATCCACCTGTCTGCCTCgtaAACTCCCGTTACGATTTCTCTCATTTCGTCCCGG-3′ (SEQ ID NO: 32). Then, the three PCR products were digested with HindIII and BamHI and cloned into pcDNA3.1 / Zeo(+).

[0131] Cloning of the target plasmid "GL-IDUA swap" containing the human β-globin gene carrying the mmIDUA-W392X PTC mutation:

[0132] Constructs expressing the human β-globin gene were used as target sequences for pseudouridylation (WT and TER; Woeller et al., 2008). In the TER version of the plasmid, which contains the PTC in globin codon 39, site-directed mutagenesis was performed using PfuUltra II Fusion HS DNA polymerase according to the manufacturer's protocol (Agilent Technologies) to replace the target sequence (as a substrate for the guide RNA) with the CFTR-G542X mutation (used as a negative control target plasmid) and the mmIDUA-W392X mutation (target for the pugIntron-IDUA plasmid). In order to replace the 33nt nonsense region (15 positions before and after the PTC (3nt)) in the original pFLAG2CMV2-HBB construct with the 33nt mmIDUA-W392X target sequence ( Fig.14 The following primers were used for amplification: SDM-GL39-SWAPto-mmidua-1: 5′-TGGTGGATGGAGAACAACTCTAGGCAGAGGTCTCAAAGTTTGGGGATCTGTCCACTCC-3′ (SEQ ID NO: 17) and SDM-GL39-SWAPto-mmidua-2: 5′-CCAAACTTTGAGACCTCTGCCTAGAGTTGTT CTCCATCCACCAGCAGCCTAAGGGTGG-3′ (SEQ ID NO: 18). To generate a replacement plasmid containing the CFTR-G542X mutation (GL-CFTRswap), the following primers were used: SDM-GL39-SWAPto-NBD1-1 5′-TGGTGGACAATATAGTTCTTTGAGAAGGTGGAATCACATTTGGGGATCTGTCCACTCC-3′ (SEQ ID NO:33) and SDM-GL39-SWAPto-NBD1-2 5′-CCAAATGTGATTCCACCTTCTC AAAGAACTATATTGTCCACCAGCAGCCTAAGGGTGG-3′ (SEQ ID NO:34).

[0133] Cell culture and transfection protocols:

[0134] HEK293T and HeLa cells were cultured in DMEM + 10% FBS. Transient transfection was performed using 1 mg / mL (pH 7) of polyethyleneimine HCl PEI MAX 40000 (PolySciences) as a stock solution. Cells were grown to high confluence (90-100%) in a 6-well culture dish. To prepare the transfection solution, 150 μL of Opti-MEM (serum-free) was mixed with 9 μL of PEI stock solution, and the resulting mixture was incubated at room temperature for 5 minutes. Afterwards, 100 ng of substrate plasmid DNA (wild type or containing PTC) and 2 μg of plasmid DNA expressing guide RNA were added to the above PEI / culture medium mixture. The resulting solution was incubated at room temperature for 15 minutes, and then the mixture was added directly to each well.

[0135] RT-PCR:

[0136] HEK293T cells were transfected with the GL39-IDUAswap substrate plasmid with or without the plasmid expressing the pugIntronOpt-IDUA guide as described above. TM Total RNA was isolated using the PCR amplification kit (Invitrogen). Reverse transcription was performed using AMV reverse transcriptase (Promega) and then using Green Master Mix (Promega) was used to amplify the RT product by PCR using 15 to 23 cycles. Pseudouridylated target mRNA was detected using RT-PCR and the following primers: forward primer: RLuc-Gl exl S4: 5′-TCTGCCGTTACTGCCCTGTG-3′ (SEQ ID NO: 19) and reverse primer: PE-mmiduaPTC+16: 5′-CTTTGAGACCTCTGCC-3′ (SEQ ID NO: 20). For normalization, 5S rRNA was detected using the following primer pair: 5SFwd: 5′-GCCATACCACCCTGAACG-3′ (SEQ ID NO: 23) and 5SRev: 5′-AGCTTCCGAGAT CAGACGAG-3′ (SEQ ID NO: 24). RT-PCR products were separated by gel electrophoresis and quantified by ImageStudio Lite (LI-COR). The results are shown in Fig.15, indicating that when HEK293T cells were transfected with pugIntronOpt-IDUA plasmid (here pugIntOptlDUA) and target plasmid GL39-IDUA swap (here GL39IDUA), RT-PCR products using the above primers (given by arrow GL39) could be detected after 18 cycles but not after 15 cycles. When the GL39-IDUAswap plasmid was not transfected with a guide RNA plasmid expressing an intron, almost no product was detected. This indicates that in these cells, the amount of mRNA from the GL39-IDUAswap plasmid was higher than when the guide RNA was not introduced. In fact, guide-induced RNA pseudouridylation inhibited NMD and upregulated intact mRNA levels by 37 times (lane 2 was 0.00437; lane 4 was 0.1617, normalized by 5S control). It was therefore concluded that the guide RNA (from the pugIntronOpt-IDUA plasmid) was able to provide read-through, thereby inhibiting NMD, and pseudouridylation occurred. Similar results were obtained after 20 to 23 PCR cycles and when a plasmid carrying the CFTR-G542X mutation was used as substrate and pugIntCFTR was used as a delivery vector for expressing the guide RNA, see Fig.19 Here, the following primers were used: NBD1PSU-202Fwd: 5′-CTGGAGCCTTCAGAGG-3′ (SEQ ID NO: 35) and NBD1PSU+40(491-509)Rev: 5′-GCTCTTGCTAAAGAAATTC-3′ (SEQ ID NO: 36).

[0137] Detection of full-length protein by western blotting:

[0138] The same transfected HEK293T cells used for RNA extraction and subsequent RT-PCR (as described above) to determine NMD inhibition were used to generate whole cell lysates. They were in 500 μL NET2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet TMP40). The cell lysate was used for ultrasonic treatment (10 seconds at level 2) and then centrifuged (17,000xg for 20 minutes at 4°C) to remove cell debris. The supernatant was used as total protein and protein analysis was performed. Anti-DYKDDDDK Magnetic Agarose (ThermoScientific) was used to immunoprecipitate ectopically expressed FLAG-tagged proteins from total protein. The pulled-down and immunoprecipitated proteins were separated on 15% SDS-PAGE, immunoblotted, and the antibodies were detected by SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific). FLAG-tagged proteins were detected using monoclonal antibody ANTI-FLAG M2, clone M2 (F1804, SIGMA) as primary antibodies and goat anti-mouse IgG (H&L) [HRP], pAb (A10093, Genscript) as secondary antibodies. Tubulin housekeeping gene was detected for normalization purposes (primary antibody: Tubulin-β, rabbit polyclonal antibody #RB-9249-P0 (Thermo Scientific); secondary antibody: anti-rabbit IgG, HRP-linked antibody #7074S (Cell Signaling)).

[0139] The results are shown in Fig.16 In. The position of the full-length protein FLAG-GL39-IDUAswap is indicated by an arrow. Lane 1 represents HEK293T cells transfected with the substrate FLAG-GL39-IDUAswap plasmid alone. Lane 2 represents HEK293T cells transfected with the substrate FLAG-GL39-IDUAswap plasmid + pugIntronOpt-IDUA plasmid providing a vector as a guide RNA. Obviously, the abundance of FLAG-GL39-IDUA increased significantly, indicating that pseudouridylation occurred in the UAG stop codon present in the RNA transcribed from the substrate plasmid and was read through during translation. This shows that the inventors of the present invention use endogenous (naturally occurring) RNA editing (pseudouridylation) enzymes and provide such cells with guide RNAs derived from their natural environment (intron sequences) to pseudouridylate target sequences in cells in vivo.

[0140] Detection of pseudouridylation

[0141] To confirm NMD inhibition (detected by RT-PCR, see above and Fig.15 ) and the appearance of the full-length FLAG-tagged protein (detected by Western blot, see above and Fig.16) is the result of authentic pseudouridylation obtained by using a target plasmid containing a premature stop codon and an intron-borne guide RNA for pseudouridylation, using a CMC-modified primer extension method previously described by Adachi et al. (2019, Methods Mol Biol 1870: 219-235). This multistep method is based on pseudouridine-specific acylation using the reagent CMC (or CMCT: N-cyclohexyl-N′-(2-morpholinoethyl)carbodiimide methyl p-toluenesulfonate) that preferentially modifies pseudouridine bases. Although bases such as uridine, inosine, and guanosine residues are also initially derivatized, pseudouridine can be detected because only pseudouridine remains acetylated, while the remaining derivatized bases are hydrolyzed back to their native chemical form after a mild base treatment step. The method for mapping the position of pseudouridine is through a primer extension reaction, in which the bulky size of the CMC at the pseudouridine residue prevents reverse transcription, thereby terminating primer extension at one nucleotide before the CMC-pseudouridine site. Since natural RT terminations can also occur as artifacts generated by strong secondary structures, negative controls (without CMC derivatization) were run in parallel to identify these anomalies. This reagent is used to locate the positions of all known pseudouridine residues in the transcriptome of human cells (Carlile et al., 2014. Nature 515(7525): 143-146). To this end, HEK293T cells were transfected with the substrate FLAG-GL39-IDUA swap plasmid together with the pugIntron-IDUA plasmid or pug-CFTR used as a negative control, because the CFTR-specific guide RNA should not be able to pseudouridylate the IDUA target U in the stop codon. Total RNA was extracted as described above. 20 μg of total RNA was used for CMC treatment and then primer extension was performed with the globin-specific primer: hG1193-209AS: 5′-CCGAGCACTTTCTTGCC-3′ (SEQ ID NO: 25). 10 μg of total RNA was used for primer extension of U6 snRNA control, and the U6-specific primer used was: hU6-86-105AS: 5′-AATATGGAACGCTTCACGAA-3′ (SEQ ID NO: 26). Fig.17The arrow indicates the position of the product where primer extension is stopped due to the presence of the ψ-CMC residue. This only occurs in cells treated with CMC and transfected with the GL39-IDUA swap substrate plasmid and the pugIntron-IDUA guide RNA expression plasmid (enlarged image). No band was detected in cell samples transfected with GL-IDUA swap and the pug-CFTR plasmid expressing the negative control guide RNA. The position of the ψ residue relative to the primer used for primer extension is exactly known (92 bases). These results clearly show that pseudouridylation occurs in HEK293T cells that were transfected with a target plasmid carrying a premature stop codon in the IDUA context and co-transfected with a plasmid carrying a snoRNA in the intron that, once spliced ​​from the intron sequence, is able to target the substrate sequence and specifically pseudouridylate the U in the UAG stop codon.

[0142] Example 5: mRNA levels are increased after treatment with intron-embedded guide RNA and psEON.

[0143] In addition to what was shown in Example 4, it was then tested whether pseudouridylation could also be produced after transfection of psEON in cells using the substrate GL-IDUA swap plasmid as outlined in detail herein. To this end, HEK293T cells at 90-100% confluence were transfected in 6-well dishes with 500 ng of the GL-IDUA swap substrate plasmid and 2.5 μg of the pugIntron-IDUA guide RNA expression plasmid using PEI or with 100 pmol of the Cy3-IDUA-A psEON oligonucleotide. Four days after transfection, the cells were washed and incubated for 24 h. Total RNA was isolated as described above and RT-PCR was performed as described above, except that 21 cycles were performed for all samples. The RT-PCR products were separated by gel electrophoresis. The results are shown in Fig.18 . These show that when no DNA was transfected (meaning there was no plasmid or psEON on the transfected substrate plasmid), no GL39 RT-PCR product was detected, although the 5S control was abundant. However, after co-transfection of the pugIntron-IDUA guide RNA expression plasmid, and after co-transfection with Cy3-iDUA-ApsEON, the product was detectable, indicating that mRNA read-through occurred and NMD was inhibited. This shows that the inventors were able to obtain pseudouridylation not only by using intron-embedded guide RNAs, but also using the short psEONs of the present invention.

[0144] Incorporated by Reference

[0145] The entire disclosure of each patent and scientific article referred to herein is incorporated by reference for all purposes.

[0146] Equivalent

[0147] The present invention may be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the foregoing embodiments should be considered illustrative in all respects, rather than limiting the invention described herein. Therefore, the scope of the present invention is indicated by the appended claims rather than by the foregoing description, and all changes within the meaning and scope of the equivalents of the claims are intended to be included therein.

Claims

1. A nucleic acid molecule for pseudouridylation of a target uridine in a target RNA in a mammalian cell, wherein the nucleic acid molecule is composed of the hairpin structure of the H / ACA snoRNA shown in SEQ ID NO:8, wherein the nucleic acid molecule is capable of forming a partially double-stranded nucleic acid complex with the target RNA comprising the target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylation enzyme, wherein a guide region of the nucleic acid molecule helps to position the target uridine in the partially double-stranded nucleic acid complex so that it can be converted into pseudouridine by the mammalian pseudouridylation enzyme. 2 . The nucleic acid molecule of claim 1 , wherein the pseudouridylation enzyme is part of a ribonucleoprotein (RNP) complex capable of acting on H / ACA-snoRNA.

3. A nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid molecule comprises one or more nucleosides and / or internucleoside bonds that are non-naturally modified relative to wild-type H / AC As noRNA.

4. The nucleic acid molecule of claim 3, wherein the non-natural modification comprises a modification in a ribose moiety.

5. The nucleic acid molecule of claim 4, wherein the 2'-OH of the sugar moiety is substituted. The nucleic acid molecule according to claim 5 , wherein the substituent is 2′-OMe or 2′-MOE.

7. The nucleic acid molecule of claim 3, wherein the nucleic acid molecule comprises one or more non-natural internucleoside bonds.

8. The nucleic acid molecule of claim 7, wherein the non-natural internucleoside linkage is a phosphorothioate linkage.

9. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is located in an intron sequence expressing the same, and wherein the intron sequence is located between an upstream exon A sequence and a downstream exon B sequence.

10. The nucleic acid molecule of claim 9, wherein the exon A / intron / exon B sequence is present in a vector. The nucleic acid molecule according to claim 10 , wherein the vector is a plasmid or a viral vector. 12 . The nucleic acid molecule according to claim 9 , wherein the exon A sequence is exon 1 of a human β-globin gene, and the exon B sequence is exon 2 of a human β-globin gene.

13. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is present in a vector, and wherein the nucleic acid molecule is transcribed from a CMV or pol-III promoter.

14. The nucleic acid molecule of claim 13, wherein the vector is a plasmid.

15. The nucleic acid molecule according to claim 13, wherein the nucleic acid molecule is transcribed from a U6 or H1 promoter.

16. The nucleic acid molecule according to claim 1 or 2, wherein the guide region is capable of forming a partially double-stranded complex with the target RNA, and the target RNA contains a mutation associated with a genetic disease.

17. The nucleic acid molecule of claim 16, wherein the mutation results in a premature stop codon (PTC), wherein the PTC is a cause of a genetic disease, and wherein the target uridine is present in the PTC.

18. The nucleic acid molecule according to claim 1 or 2, for use in treating, delaying or ameliorating cystic fibrosis, Hurler syndrome or mucopolysaccharidosis.

19. Use of a nucleic acid molecule according to any one of claims 1 to 18 in the preparation of a preparation for converting uridine in a target RNA molecule into pseudouridine, wherein a target RNA comprising target uridine is contacted with the nucleic acid molecule in the presence of a pseudouridylinase or an RNP complex, thereby converting the uridine.

20. The use according to claim 19, wherein the pseudouridylinase or RNP complex is present in mammalian cells.

21. The use according to claim 20, wherein the mammalian cell is a human cell.

22. The use according to any one of claims 19 to 21, wherein the pseudouridylinase or RNP complex naturally occurs in mammalian cells.

23. A vector comprising an intron sequence located between an upstream exon A sequence and a downstream exon B sequence, wherein the exon A sequence and the exon B sequence are genes that are not native genes for the intron sequence, wherein the intron sequence comprises a nucleic acid molecule as described in any one of claims 1-18, and wherein the intron sequence comprises a snoRNA sequence encoding a pugU2-34 / 44 snoRNA, wherein the pugU2-34 / 44 snoRNA is capable of forming a partially double-stranded nucleic acid complex with a target RNA comprising a target uridine, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase in a cell to form a functional RNP complex, wherein the guide region of the nucleic acid molecule correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted into pseudouridine by the RNP complex.

24. The vector according to claim 23, wherein the exon A sequence is exon 1 of the human β-globin gene, and the exon B sequence is exon 2 of the human β-globin gene.

25. The vector according to claim 23 or 24, wherein the vector is a plasmid or a viral vector.

26. The vector according to any one of claims 23 to 25, for use in treating or improving cystic fibrosis, Hurler's syndrome or mucopolysaccharidosis.

27. A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1 to 18 or the vector of any one of claims 23 to 26, and one or more pharmaceutically acceptable carriers, stabilizers or solvents.

28. Use of a vector according to any one of claims 23 to 26 in the preparation of a preparation for converting uridine in a target RNA molecule into pseudouridine in a cell, wherein: - administering to said cells said vector; - Transcription of exon A / intron / exon B sequences occurs; - splicing occurs and forms the pugU2-34 / 44 snoRNA localized in the intron; and - the pugU2-34 / 44 snoRNA forms a partial double-stranded nucleic acid complex with the target RNA molecule, wherein the partially double-stranded nucleic acid complex is capable of binding to a mammalian pseudouridylinase to form a functional RNP complex, wherein the pugU2-34 / 44 snoRNA correctly positions the target uridine so that it is converted by the RNP complex, and wherein the target uridine is converted into pseudouridine by the RNP complex.

29. The use according to claim 28, wherein the cell is a human cell.

30. A mammalian cell comprising the nucleic acid molecule of any one of claims 1 to 18 or the vector of any one of claims 23 to 26.

Images