Nanoparticles for detecting methotrexate concentration and preparation method and application thereof

Abstract

The invention relates to the technical field of detection and analysis, and discloses a nanoparticle for detecting the concentration of methotrexate as well as a preparation method and application of the nanoparticle. The nanoparticles disclosed by the invention comprise hairpin DNA which is connected with the gold nanoparticles and is provided with a marking group and aptamer chain DNA which can be specifically recognized by methotrexate, and the aptamer chain DNA and walking chain DNA are hybridized into double-chain DNA which is connected to a magnetic bead, on one hand, the concentration of MTX is measured by marking a DNA chain of a fluorophore and collecting a fluorescence signal; on the other hand, after sodium chloride is added into the gold nanoparticles without DNA protection, the color of the gold nanoparticles changes under a high-salt condition, and the concentration of MTX is measured by collecting ultraviolet values. According to the nanoparticles provided by the invention, all parts interact with one another, signals are amplified, the effect of double detection of MTX concentration is exerted, and a powerful strategy is provided for accurately mastering the drug concentration in real time and improving the treatment safety and effect.

Description

Technical Field

[0001] The present invention relates to the technical field of detection and analysis, and in particular to a nanoparticle for dual detection of methotrexate concentration, a preparation method and application thereof. Background Art

[0002] The National Academy of Clinical Biochemistry (NACB) of the United States defines POCT (Point-of-care testing) as "a laboratory test performed near the subject by a person who has not received clinical laboratory science training or by the subject himself; it is any test performed outside the traditional central laboratory". POCT is a testing technology with great potential. It is fast, simple, efficient, low-cost, and has the advantages of short testing cycle and small amount of specimens. At the same time, its reagents are stable and easy to store and carry. It has been widely used in clinical practice and even in self-testing. It can directly and quickly obtain reliable results, which can save valuable time for doctors to further diagnose and treat.

[0003] Methotrexate (MTX, 2,4-diamino-n10-methylphenoylglutamate) is a folate antagonist that has been widely used to treat various cancers. [4] , leukemia, lymphoma and osteosarcoma; at the same time, low-dose MTX is also widely used in the treatment of inflammatory diseases such as rheumatoid arthritis, psoriasis, lupus, etc. In addition, MTX is also used to treat autoimmune diseases (including rheumatoid arthritis, Crohn's disease and psoriasis), ectopic pregnancy and medical abortion. The concentration of MTX in human serum varies over time, and there are large differences between individuals. For the treatment of diseases without precise dose control, low-dose MTX may cause irreversible damage to non-cancerous cells and tissues. As the 48-hour MTX level increases, the complications of lymphoma patients with high-dose MTX increase significantly. Therefore, it is necessary to detect the blood concentration of MTX, which should not exceed 0.1μM in 72 hours, 1μM in 48 hours, and 10μM in 24 hours.

[0004] Traditional blood drug concentration monitoring includes liquid chromatography, liquid chromatography-mass spectrometry, immunoassay, and fluorescence polarization immunoassay. These methods have the disadvantages of complex operation, expensive instruments, and low sensitivity. However, POCT blood drug concentration monitoring has the advantages of rapid response, helping patients to understand their own drug treatment more clearly, reducing the waste of medical resources, providing personalized treatment, and improving safety, which makes up for the shortcomings of traditional methods for monitoring MTX concentration. Therefore, it is necessary to explore and develop blood drug concentration detection technology suitable for POCT, such as magnetic separation-assisted DNAzyme walker nanoparticles for rapid detection of MTX concentration, so as to achieve rapid, accurate, and low-cost detection. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention provides a nanoparticle for dual detection of methotrexate concentration, and a preparation method and application thereof. On the one hand, the MTX concentration is measured by collecting fluorescence signals by labeling the DNA chain of the fluorophore; on the other hand, the gold nanoparticles that have lost DNA protection aggregate and change color under high salt conditions after adding sodium chloride, and the MTX concentration is measured by collecting ultraviolet values. The nanoparticles provided by the present invention interact with each other, amplify the signal, and exert the effect of dual detection of MTX concentration, providing a powerful strategy for real-time and accurate grasp of drug concentration and improving treatment safety and effect.

[0006] The scheme of the present invention is as follows:

[0007] In a first aspect, the present invention provides a nanoparticle for dual detection of methotrexate (MTX) concentration, wherein the nanoparticle comprises gold nanoparticles, hairpin DNA and double-stranded DNA.

[0008] Further, the double-stranded DNA includes two DNA strands that are fully or partially complementary and paired. In a specific embodiment of the present invention, the two DNA strands are partially complementary and paired. Preferably, the double-stranded DNA includes a methotrexate aptamer strand (AP strand) and a walking strand (Walking strand). Further, the methotrexate aptamer strand (AP strand) is at least used to bind to methotrexate, and more preferably, the methotrexate aptamer strand (AP strand) includes a sequence that specifically recognizes and binds to methotrexate. The walking strand includes a DNAzyme sequence, a sequence complementary to the MTX aptamer strand, and a sequence complementary to the hairpin DNA. More preferably, the DNAzyme sequence is at least used to cut the hairpin DNA; the sequence complementary to the MTX aptamer strand is close to the 3' end of the walking strand (Walking strand); the sequence complementary to the hairpin DNA is at least used to specifically bind to the hairpin DNA when the walking strand is released to form a single-stranded state. More preferably, the sequence of the methotrexate aptamer strand (AP strand) is shown as SEQ ID NO.1; and the sequence of the walking strand (Walking strand) is shown as SEQ ID NO.2.

[0009] Ap strand (SEQ ID NO.1):

[0010] ACAACTCTCGGGCGAACGCGGGATGTTTGGGGGACCCACGTTCGCCCTTCTCTCA ACA;

[0011] Walking strand (SEQ ID NO.2):

[0012]

[0013] Furthermore, the underlined sequence of the walking strand "TCCGAGCCGGTCGAA" is the catalytic center of 8-17 DNAzyme, and the bold part and It is a sequence that complementarily pairs with the hairpin DNA when it binds.

[0014] Further, the hairpin DNA (H-(7+9) strand) in the nanoparticle includes a cleavage site of RNA, preferably, the cleavage site of RNA is embedded in the stem of the hairpin DNA, and more preferably, the cleavage site of RNA contains at least one adenine ribonucleotide. More preferably, the hairpin DNA also includes a labeling group, and preferably, the labeling group includes at least one of a fluorescent group and an azide group. More preferably, the hairpin DNA (H-(7+9) strand) also includes a thiol group (-SH), more preferably, the gold nanoparticle is connected to the hairpin DNA via an Au-S bond, more preferably, the labeling group and the gold nanoparticle are located on both sides of the RNA cleavage site, more preferably, the hairpin DNA also includes a sequence that is complementary to the walking strand, and more preferably, the sequence of the hairpin DNA (H-(7+9) strand) is as shown in SEQ ID NO.3.

[0015] H-(7+9)strand (SEQ ID NO.3)

[0016]

[0017] Among them, SH- is a thiol group, which is connected to the gold nanoparticles through an Au-S bond, FAM is a fluorescent labeling group, rA represents adenine ribonucleotide, which is the cleavage site of RNA; the bold part and It is a sequence that complementarily pairs with the walking chain when it binds.

[0018] Furthermore, the aptamer chain in the double-stranded DNA releases the walking chain after specifically binding to methotrexate, and the walking chain specifically binds to the hairpin DNA through a sequence complementary to the hairpin DNA, and the DNAzyme sequence recognizes the cleavage site of the RNA in the hairpin DNA and cuts the hairpin DNA to release the labeling group, and the gold nanoparticles and the labeling group are used to count the concentration of methotrexate.

[0019] Furthermore, the nanoparticles further include magnetic beads, to which functional DNA chains are connected. Preferably, the functional DNA chains include the double-stranded DNA. More preferably, the magnetic beads are connected to the double-stranded DNA via biotin. More preferably, the magnetic beads are connected to the walking strand of the double-stranded DNA.

[0020] The second aspect of the present invention provides the use of the nanoparticles in detecting the concentration of methotrexate in a liquid and / or in preparing a product for detecting the concentration of methotrexate. Preferably, the liquid includes at least one of body fluid and aqueous solution. Preferably, the use in detecting the concentration of methotrexate in a liquid includes the use in POCT rapid detection of methotrexate concentration. Further, the product for detecting the concentration of methotrexate includes at least one of an instrument, a kit and a reagent for detecting methotrexate.

[0021] The third aspect of the present invention provides a kit for dual detection of methotrexate (MTX), the kit comprising the nanoparticles, and common reagents, including a reaction buffer and a washing reaction solution;

[0022] Further, the buffer comprises PBS buffer; further, the PBS buffer comprises 0.15M NaCl, 7.6mM Na 2 HPO 4 , 2.4 mM NaH 2 PO 4 , 10 mM MgCl 2 , adjusted to pH 7.4.

[0023] A fourth aspect of the present invention provides a method for preparing the nanoparticles, comprising the following steps:

[0024] (1) Preparation of double-stranded DNA: The aptamer strand and the walking strand were mixed in a PBS buffer at a molar ratio of 2:1 to 4:1, reacted at 90 to 100°C for 5 to 10 min, and then quickly placed at room temperature for 30 to 40 min to anneal;

[0025] (2) Preparation of hairpin DNA: The hairpin DNA was dissolved in PBS buffer, reacted at 90-100°C for 5-10 min, and then naturally cooled to room temperature for annealing.

[0026] Furthermore, the PBS buffer consists of 0.15M NaCl, 7.6mM Na 2 HPO 4 , 2.4 mM NaH 2 PO 4 , 10 mM MgCl 2 , adjusted to pH 7.4.

[0027] Furthermore, the method further comprises the step of mixing the gold nanoparticles with the annealed hairpin DNA H-(7+9) strand at a ratio of 1:150 to 1:250 to prepare DNA-functionalized gold nanoparticles; further, the method further comprises the step of mixing the magnetic beads washed with PBS buffer with double-stranded DNA and PBS buffer to prepare DNA-functionalized magnetic beads. In a specific embodiment of the present invention, the specific steps are as follows:

[0028] Preparation of double-stranded DNA: The aptamer strand and the walking strand were mixed in a PBS buffer at a molar ratio of 2:1, reacted at 95°C for 5 min, and then quickly placed at room temperature for 30 min to anneal;

[0029] Preparation of hairpin DNA: The hairpin DNA was dissolved in PBS buffer, reacted at 95°C for 5 min, then naturally cooled to room temperature for annealing.

[0030] Furthermore, the PBS buffer consists of 0.15M NaCl, 7.6mM Na 2 HPO 4 , 2.4 mM NaH 2 PO 4 , 10 mM MgCl 2 , adjusted to pH 7.4.

[0031] Furthermore, the method also includes the step of mixing gold nanoparticles with annealed hairpin DNA H-(7+9) strand at a ratio of 1:200 to prepare DNA-functionalized gold nanoparticles; further, the method also includes the step of mixing magnetic beads washed with PBS buffer with double-stranded DNA and PBS buffer to prepare DNA-functionalized magnetic beads.

[0032] The beneficial effects of the present invention include but are not limited to:

[0033] 1. In the present invention, a dual-detection nanoparticle of methotrexate is provided. On the one hand, the nanoparticle releases the walking chain after the MTX aptamer on the walking chain in the double-stranded DNA specifically binds to MTX, and the DNAzyme in the walking chain specifically recognizes the cleavage site of the RNA in the hairpin DNA to cut the hairpin structure, thereby releasing the fluorescent signal carried in the hairpin DNA; on the other hand, after the hairpin DNA is cut, the gold nanoparticle loses the protection of the functional DNA, sodium chloride is added to the gold nano solution, the solution color changes, and the MTX concentration is detected by the dual mode of fluorescence and colorimetry. The nanoparticle provides a powerful strategy for MTX concentration detection, and has great potential for rapid and sensitive detection of drug concentration.

[0034] 2. The present invention also verifies the sensitivity and specificity of the method for detecting the concentration of methotrexate using the nanoparticles of the present invention. The detection line of the nanoparticles of the present invention for detecting methotrexate is as low as 0.0097 μM. In actual application, the deviation RSD of the detection results of different batches of samples is less than 5%. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0036] Figure 1 Schematic diagram of dual detection of MTX concentration by nanoparticles of the present invention.

[0037] Figure 2 The UV-visible absorption spectra of AuNPs and AuNP-hairpin DNA (H-(7+9) strand) in Example 2 of the present invention.

[0038] Figure 3 (A) The standard linear calibration curve of H-(7+9) strand-FAM in Example 3 of the present invention; (B) The fluorescence spectrum of AuNP-H-(7+9) strand-FAM after incubation with DTT. The error bars represent the standard deviation of the results of three independent experiments.

[0039] Figure 4 The polyacrylamide gel electrophoresis diagram (A) in Example 1 of the present invention, wherein lane M: 20 bp DNA ladder; lane 1: AP strand; lane 2: Walking strand; lane 3: H-(7+9) strand; lane 4: product band after annealing of AP strand and Walking strand; lane 5: band after reaction of AP strand, Walking strand and MTX; lane 6: AP strand, Walking strand, MTX, H-(7+9) strand and Mg 2+ Bands after reaction; Lane 7: AP strand, Walking strand, H-(7+9) strand and Mg 2+ Fluorescence emission spectra of the reacted bands (B) under different conditions: positive system with MTX (orange curve); negative system without MTX (green curve).

[0040] Figure 5 The effects of various experimental conditions on the fluorescence signal intensity and FF in Example 4 of the present invention are shown in FIG. 0The histogram shows the fluorescence intensity of the system with and without MTX, and the curve shows the FF 0 The ratio of F and F 0 Represents the fluorescence intensity with or without MTX; (A) dS-MB volume (B) reaction time (C) Mg 2+ Concentration (D) Molar ratio of H-FAM and AuNPs.

[0041] Figure 6 The fluorescence spectra of the device (A) at different MTX concentrations and the net fluorescence signal value F–F in ​​Example 5 of the present invention are shown in FIG. 0 with MTX concentration; the inset shows F–F 0 The linear relationship between F and the logarithm of MTX concentration. 0 The fluorescence intensity in the presence or absence of MTX is shown. Error bars represent the standard deviation of three measurements.

[0042] Figure 7 (A) is the UV value of the device at different MTX concentrations in Example 5 of the present invention; (B) the change of UV value Abs with MTX concentration; the inset shows the linear relationship between the UV value Abs and the logarithm of the MTX concentration; the error bar represents the standard deviation of the three measurement results; Figure (C) is the change in color of gold nanoparticles after reacting with different concentrations of MTX. The color change after adding sodium chloride gradually becomes lighter from left to right.

[0043] Figure 8 (A) The fluorescence intensity of the blank group, interfering drug group, MTX and mixed group in Example 6 of the present invention; (B) The UV value of the blank group, interfering drug group, MTX and mixed group; The MTX concentration is 100 μM, and the concentrations of other drugs are all 1000 μM. The error bars represent the standard deviation of the measurement results of three independent experiments. DETAILED DESCRIPTION

[0044] The present invention is described in detail below with reference to examples, but the present invention is not limited to these examples. Unless otherwise specified, the raw materials and catalysts in the examples of the present invention are purchased through commercial channels.

[0045] It should be noted that the details of the present invention are known to those skilled in the art. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The experimental steps that are not recorded in detail refer to "Molecular Cloning Laboratory Manual" (Edited by (US) MR Green (Michael R. Green), (US) J. Sambrook (Joseph. Sambrook), fourth edition), pathophysiological experiments, online databases, etc.

[0046] "Pharmaceutically acceptable carriers" are recognized in the art and include pharmaceutically acceptable materials, compositions or vehicles suitable for administering the compounds of the present invention to mammals. The carriers include liquid or solid fillers, diluents, excipients, solvents or encapsulating materials that participate in carrying the subject matter or transferring it from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate, powdered tragacanth, malt, gelatin, talc, excipients such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; and other nontoxic, compatible substances used in pharmaceutical formulations.

[0047] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0048] The experimental reagents and instruments used in the embodiments of the present invention are as follows:

[0049] 1. Experimental reagents: The DNA sequences required for the preparation of nanoparticles in the present invention are shown in Table 1 and were synthesized and purified by Sangon Biotechnology Co., Ltd. (Shanghai, China). Sodium citrate was purchased from Keyuan Biochemical Co., Ltd. (China). Dithiothreitol, chloroauric acid and methotrexate were purchased from Bid Pharmaceuticals (China). Sodium chloride, disodium hydrogen phosphate and sodium dihydrogen phosphate were purchased from Hushi Company (China). Human serum was obtained from the Provincial Hospital Affiliated to Shandong First Medical University and stored at -20°C. All chemical reagents used in this experiment were of analytical grade, and the solutions used were prepared using ultrapure water (>18.25MΩ·cm) prepared by Millipore Milli-Q (USA) system.

[0050] 2. Experimental instruments: All UV-visible absorption spectra were measured by TU-1901 Beijing Puxi General Instrument Co., Ltd. (China). All fluorescence emission spectra were collected using FL970 fluorescence spectrometer purchased from Shanghai Tianmei Scientific Instrument Co., Ltd. (China). AuNPs were synthesized and cleaned using 85-1A magnetic stirrer purchased from Gongyi Yuhua Co., Ltd. (China), 84-1 magnetic stirring temperature control electric heating mantle purchased from Shandong Hualu Co., Ltd. (China) and 5415D centrifuge purchased from Eppendorf (Germany). Electrophoresis was run by JY300C electrophoresis device purchased from Junyi Co., Ltd. (China), and imaging was performed by UniversalHoodⅡ exposure instrument purchased from BIO-RAD (USA). Drugs were weighed by FA1004 (HANGPING) balance. Samples were shaken and mixed by four-dimensional rotary mixer BE-1100 purchased from Kylin-Bell. DNA annealing was performed by dry thermostat K30 purchased from Aosheng (China).

[0051] Embodiment 1

[0052] 1. Preparation of nanoprobes:

[0053] The nanoprobe is synthesized based on the principle of complementary base pairing. The aptamer chain and the walking chain assemble double-stranded DNA. The walking chain contains DNAzyme, and the sequence near the 3' end is complementary to the MTX aptamer chain. The hairpin structure is a specially designed hairpin DNA with an RNA cleavage site embedded in the stem.

[0054] The preparation method of AP-Walking is as follows: the aptamer chain and the walking chain are mixed in a PBS buffer (0.15 M NaCl, 7.6 mM Na 2 HPO 4 ,2.4mM NaH 2 PO 4 , pH 7.4), vortexed, reacted in a metal bath at 95°C for 5 min, and then the reaction mixture was quickly placed at room temperature for 30 min. The synthesized AP-Walking can be stored at 4°C for later use.

[0055] The preparation method of H(7+9) strand is as follows: hairpin DNA is dissolved in PBS buffer (0.15M NaCl, 7.6mM Na 2 HPO 4 ,2.4mM NaH 2 PO 4 , pH 7.4), reacted in a metal bath at 95°C for 5 min, then naturally cooled to room temperature to form a hairpin structure and stored at 4°C for later use.

[0056] Table 1: Nanoparticle DNA sequences

[0057]

[0058] Note: AP strand The sequence for complementary pairing between the aptamer chain and the walking chain;

[0059] Walking strand TCCGAGCCGGTCGAA The sequence is the catalytic center of 8-17 DNAzyme; rA in H-(7+9) strand represents adenine ribonucleotide; the bold part is the base complementary sequence.

[0060] 2. Feasibility verification

[0061] First, polyacrylamide gel electrophoresis (PAGE) experiments were used to verify the assembly process of AP-Walking in the above step, the possibility of AP being recognized by MTX, and the hairpin DNA being cut.

[0062] like Figure 4 As shown in A, the bands in lanes 1, 2, and 3 represent AP strand, Walking strand, and H-(7+9) strand, respectively. After the AP strand and Walking strand were mixed and reacted, a higher band appeared in lane 4, indicating that the two can hybridize to form a double-stranded structure. After MTX was added to lane 5, a new lower band appeared compared to lane 4, proving that AP was successfully recognized by MTX. Lane 6 added H-(7+9) strand and magnesium ions on the basis of lane 5, and a lower band appeared, proving that AP was successfully recognized and H-(7+9) strand was cut to form hairpin fragments. Lane 7, hairpin structure and magnesium ions were added on the basis of lane 4, and no new bands appeared, proving that the device cannot be started without MTX, so MTX is the key to the device startup. The gel electrophoresis results show that the DNA sequence design in the present invention is feasible, AP is successfully recognized by MTX, and hairpin DNA is successfully cut by Walking strand.

[0063] Yin-Yang group fluorescence

[0064] First, 15 μL of ds-MB and a series of different concentrations of MTX (5.0 μL) were mixed and shaken in PBS buffer solution, and incubated on a four-dimensional rotating mixer at room temperature for 3.0 h to ensure that AP was recognized by MTX and unlocked the blocked Walking Strand. Subsequently, the liquid was removed under an external magnetic field, and ds-MB and 5.0 nM AuNP-H (7+9) were mixed in PBS buffer (0.15 M NaCl, 7.6 mM Na 2 HPO 4, 2.4 mM NaH 2 PO 4 , 10 mM MgCl 2， pH 7.4) and mix well, a total of 140 μL, and incubate on a four-dimensional rotating mixer at 37°C for 3.0 h. Finally, after the reaction is completed, ds-MB is separated under the action of an external magnetic field, 60 μL of the mixed liquid is centrifuged at 12000rpm for 25 min, and the supernatant is measured by a fluorescence spectrophotometer in the range of 515nm-650nm, with an excitation wavelength of 488nm, and the fluorescence value at 523nm is recorded. The slit width of excitation and emission is 5nm, and 700V is the photomultiplier tube voltage. 1.75M NaCl is added to 80 μL of the mixed liquid, and the UV value is measured by a UV spectrophotometer. The results are as follows. Figure 4 As shown in B, there is a lower fluorescence signal in the negative group without MTX (green curve), and MTX is an important factor in starting the device. When MTX is not present, the AP strand cannot specifically bind to MTX, thereby blocking the Walking strand, so the Walking strand cannot cut H-(7+9), and the DNAzyme cleavage reaction cannot be triggered, so the fluorescence background signal is low. When 100μM MTX is added, the positive group (orange curve) has a very strong fluorescence signal, proving that MTX can specifically bind to the aptamer sequence, the Walking strand cuts the H-(7+9) strand, and the device is started. A large number of hairpin structures are cut, thus generating a large number of fluorescence signals.

[0065] Embodiment 2

[0066] 1. Synthesis and characterization of gold nanoparticles

[0067] AuNPs with a particle size of 13 nm were synthesized by reducing chloroauric acid with sodium citrate. 45 mL of ultrapure water was heated to boiling, and 5.0 mL of 10 mM chloroauric acid solution was quickly added under rapid stirring. After stirring for 2 minutes, 5.0 mL of 38.8 mM sodium citrate solution was quickly added, and the color changed from light yellow to colorless, then to black, and finally to wine red. Subsequently, the mixture was stirred rapidly for 10 minutes, and then the heat source was removed, stirred slowly, cooled naturally to room temperature, filtered through a 0.22 μm porous microfiltration membrane, and stored in a refrigerator at 4 ° C away from light. The absorbance value was measured at 519 nm, and the molar absorptivity index was 2.7×10 8 Lmol -1 cm -1 , calculate the AuNPs concentration.

[0068] 2. Construction of DNA-functionalized gold nanoparticles and magnetic beads

[0069] DNA-functionalized gold nanostructures

[0070] First, the H-(7+9) strand sequence was heated at 95°C for 5.0 min and then slowly cooled to room temperature to form a hairpin structure. Subsequently, 20.8 μL of 100 μM SH-DNA was mixed with 6.78 μL of TCEP solution, wrapped with tin foil and incubated on a four-dimensional rotary mixer at room temperature for 2.0 h to activate the thiol group. 10.4 nM 1000 μL AuNPs was mixed with annealed H-(7+9) strand (TCEP pretreatment) at a ratio of 1:200, and after slow stirring for 16 h, phosphate buffer (0.2 M, pH = 7.4) was added to a final concentration of 10 mM, and then 2.0 M NaCl solution was added dropwise 8 times to a final concentration of 0.15 M, once every 45 minutes. After stirring for 24 h, the solution was centrifuged for 25 min at 12,000 rpm, the supernatant was discarded, and the precipitate was washed with PBS (0.15 M NaCl, 7.6 mM Na 2 HPO 4 , 2.4 mM NaH 2 PO 4 ) solution to dissolve the precipitate, repeat this process 3 times to remove the salt solution and the DNA not modified on the surface of the gold nanoparticles, and finally resuspend the obtained AuNP-H in the buffer solution to obtain the DNA functionalized gold nanoprobe, which was stored in a refrigerator at 4 degrees in the dark for later use. The UV spectra of AuNP-H-(7+9)s and AuNPs were analyzed by UV spectrophotometer. The results are as follows Figure 2 As shown, the maximum absorption peak of bare AuNPs is at 519nm, and the ultraviolet maximum absorption peak of AuNP-H(7+9) is red-shifted to 523nm. The results show that the surface of AuNPs has been successfully modified with DNA.

[0071] Construction of DNA-functionalized magnetic beads

[0072] The Walking strand and the AP strand were mixed in a PBS buffer solution with a molar ratio of 1:2 in pH = 7.4, reacted at 95°C for 5 min, and then reacted at room temperature for 30 min to anneal to form a double-stranded structure. Then, 8 EP tubes were taken, and the magnetic beads (5.0 μL) were washed 4 times with 100 μL of PBS buffer solution in each tube, and the washed magnetic beads were resuspended in 80 μL of PBS solution. Next, 10 μL of double-stranded DNA, 5 μL of magnetic beads and 15 μL of PBS were mixed, and the mixture was reacted on a four-dimensional rotating mixer at room temperature for 2.0 h. Finally, the magnetic beads were washed with PBS to remove unmodified DNA, and the dS-MB was dispersed in 15 μL of PBS solution and stored at 4°C for use. All separations were completed with the aid of an external magnetic field.

[0073] Embodiment 3

[0074] The amount of DNA modified on a single AuNP

[0075] First, the fluorescence spectra of a series of H-(7+9) with different concentrations were measured, and the standard linear calibration curve and linear equation F = 4.744C were drawn. FAM-H(7+9) +150(R 2 =0.9974), such as Figure 3 As shown in A. 1.0M DTT was added to the AuNP-H-(7+9) solution to a final concentration of 20mM. The solution was reacted on a four-dimensional rotating mixer at room temperature for 12h to reduce SH to dissociate DNA from the gold nanoparticles. After that, the solution was centrifuged at 12000rpm for 25min, and the supernatant solution was taken to measure the fluorescence intensity by a fluorescence spectrometer, as shown in FIG. Figure 3 As shown in Figure B, an obvious fluorescence signal appeared in the supernatant of the sample after DTT treatment, which showed that the FAM-labeled hairpin DNA had been successfully modified on the surface of AuNPs. The molar concentration of H-(7+9) released from gold nanoparticles was calculated based on the calibration curve of H-(7+9). The number of H-(7+9) modified on each AuNP was obtained by calculating the concentration ratio of AuNPs to H-(7+9). According to the fluorescence value at 523nm and the standard curve, the concentration of H-(7+9) modified on 1nM AuNPs was 79.9nM, and the number of hairpin structures loaded on each AuNP was about 80.

[0076] Embodiment 4

[0077] Optimization of experimental conditions

[0078] Some important experimental parameters were optimized. In the figure, the curve represents FF 0 , the bar graph F represents the positive group with MTX, F 0 The negative group represents the absence of MTX, and the bar graph shows the changes in fluorescence intensity of the positive and negative systems with experimental conditions.

[0079] First, the volume of magnetic beads has an important influence on the reaction. Figure 5 As can be seen from A, as the volume of the magnetic beads increases, FF 0 The best result is 15 μL, and then the volume of magnetic beads is increased. 0 Therefore, 15 μL was selected as the optimal volume for subsequent experiments. Similarly, metal ions are the key to affecting catalytic reactions. 2+ Effect of concentration on catalytic activity. When the magnesium ion concentration is 10 mM, FF 0 Reach the maximum ( Figure 5B), 10mM was selected as the optimal reaction concentration. Next, the reaction time had an important influence on the device and was optimized. Figure 5 C observed that the reaction time was 3h when FF 0 The highest reaction time was 3h, and the optimal reaction time was 3h. At the same time, the ratio of H-(7+9) strand to AuNPs is also a very important factor. Figure 5 D, it was found that when the reaction ratio of H-(7+9) strand to gold nanoparticles was 200:1, FF 0 The highest is selected as the optimal reaction ratio. In summary, the present invention uses the magnetic bead volume of 15 μL, the magnesium ion concentration of 10 mM, the reaction time of 3 h, and the reaction ratio of H-(7+9) strand to gold nanoparticles of 200:1 as the optimal conditions for the experiment.

[0080] Embodiment 5

[0081] Dual-mode detection sensitivity investigation

[0082] The principle of the dual detection of MTX concentration by the nanoparticles of the present invention is as follows Figure 1 As shown, on the one hand, the fluorescence signal is collected to measure the MTX concentration by labeling the DNA chain of the fluorophore; on the other hand, the gold nanoparticles without DNA protection aggregate and change color under high salt conditions after adding sodium chloride, and the MTX concentration is measured by collecting the ultraviolet value. The nanoparticles provided by the present invention interact with each other, amplify the signal, and play the effect of dual detection of MTX concentration, which provides a powerful strategy for real-time and accurate grasp of drug concentration and improving treatment safety and effect.

[0083] 1. Sensitivity - Fluorescence

[0084] By collecting the fluorescence signals of different concentrations of MTX at 523 nm, Figure 6 In A, it can be seen that the fluorescence signal gradually and steadily increases with the increase of MTX concentration. Figure 6 B is the net fluorescence signal at 523 nm, F – F 0 The relationship between the net signal F–F 0 It has a good linear relationship with the logarithm of MTX concentration, and the linear regression equation is F–F 0 =209.6lgC MTX +512.6(R 2 =0.9953), and the detection limit of MTX by this method (fluorescence) can be as low as 0.0243 μM by the 3σ principle. The above results show that the present invention has good analytical ability for MTX.

[0085] 2. Sensitivity-UV

[0086] Under the same conditions, the UV values ​​of MTX at the maximum wavelength were collected for different concentrations. Figure 7 B shows the relationship between UV value and different concentrations of MTX. From the inset, it can be seen that within the range of MTX concentration 0.01-100 μM, the logarithm of UV value and MTX concentration can obtain a good linear relationship, and the linear regression equation is A = -0.05704lgC MTX +0.2446, R 2 is 0.9903, and the detection limit of MTX by this method can be as low as 0.0097μM. Figure 7 As shown in A, as the MTX concentration increases, the UV value gradually decreases. Figure 7 C can be observed that the color of MTX concentration changes from 0, 0.01, 0.1, 1, 10, 100 μM, from pink to light. The results show that the present invention can achieve fluorescence and colorimetric dual-mode detection of MTX.

[0087] Embodiment 6

[0088] Specificity investigation

[0089] In Tris-HCl buffer solution, various interfering drugs (GM, VA, CF, OME, PNC, and a mixture of interfering drugs and MTX) with a concentration of 10 times that of MTX were reacted with 15 μL of ds-MB for 3.0 h. The liquid was removed, and ds-MB was mixed with 5.0 nM AuNP-H (7+9) in PBS buffer (0.15 M NaCl, 7.6 mM Na 2 HPO 4 , 2.4 mM NaH 2 PO 4 , 10 mM MgCl 2， pH7.4) and mix well, a total of 140 μL, and incubate on a four-dimensional rotating mixer at 37°C for 3.0 h. Finally, after the reaction is completed, ds-MB is separated under the action of an external magnetic field, 60 μL of the mixed liquid is centrifuged at 12000rpm for 25 min, and the supernatant is measured by a fluorescence spectrophotometer in the range of 515nm-650nm, with an excitation wavelength of 488nm, and the fluorescence value at 523nm is recorded. The slit width of excitation and emission is 5nm, and 700V is the photomultiplier tube voltage. 1.75M NaCl is added to 80 μL of the mixed liquid, and the UV value is measured by a UV spectrophotometer.

[0090] from Figure 8As can be seen from A, the fluorescence intensity generated by the response and interference drugs of the present invention is almost the same as that of the blank sample, and after adding 100 μM MTX, the fluorescence intensity of the system increases significantly, and the fluorescence intensity does not decrease after adding the interfering substance to the system containing MTX. At the same time, the ultraviolet absorbance of the interfering drug and the blank sample is significantly higher than that of the MTX group and the mixed group ( Figure 8 B), the color of the interfering drug and the blank group is redder than that of the MTX group and the mixed group. This result shows that the dual-mode detection strategy of the present invention has satisfactory specificity, can specifically respond to the fluorescence signal and color change generated by MTX, and can identify MTX from complex samples.

[0091] Embodiment 7

[0092] The authenticity and reliability of the analysis results of the present invention were evaluated, and MTX samples of three concentrations of 0.05 μM, 0.5 μM and 10 μM were selected for precision and reproducibility experiments. By collecting fluorescence signals and ultraviolet absorbance, and converting them into actual concentrations according to the standard curve, the relative standard deviation (RSD) was calculated. As shown in Table 2, the fluorescence and ultraviolet RSDs of three samples of the same batch were 2.61%, 3.45% and 3.57%, 4.85%, 1.32% and 4.09%, respectively, indicating that this strategy has good analytical accuracy. As shown in Table 3, three different batches of samples at the same concentration were measured within 3 days, and the corresponding fluorescence and ultraviolet RSDs were 4.65%, 4.10% and 2.26%, 1.60%, 1.84% and 3.99%, respectively, indicating that this strategy has good analytical reproducibility.

[0093] Table 2

[0094]

[0095] Table 3

[0096]

[0097] Embodiment 8

[0098] The present invention is used in human serum

[0099] Three different concentrations of MTX (0.050μM, 0.500μM and 10.00μM) were added to the human serum sample diluted 10 times, and fluorescence and UV detection were performed after the reaction was complete. By measuring three sets of parallel samples at each concentration, as shown in Table 4, the corresponding recoveries were calculated to be 94.0%, 101%, 102% and 102%, 98.2%, 103%, respectively, and the RSDs were 3.62%, 2.88%, 1.36% and 2.83%, 5.74%, 1.80%, respectively. The above results show that the nanocarrier designed by us has good anti-interference ability for the detection of MTX and is suitable for sensitive analysis in complex biological matrices.

[0100] Table 4

[0101]

[0102]

[0103] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nanoparticle for dual detection of methotrexate (MTX) concentration, characterized in that: The nanoparticles include gold nanoparticles, hairpin DNA and double-stranded DNA.

2. The nanoparticle according to claim 1, characterized in that The double-stranded DNA comprises two fully or partially complementary paired DNA strands, preferably, the double-stranded DNA comprises a methotrexate aptamer strand (AP strand) and a walking strand (Walking strand), further, the methotrexate aptamer strand (AP strand) is at least used to bind to methotrexate, the walking strand comprises a DNAzyme sequence, a sequence complementary to the MTX aptamer strand and a sequence complementary to the hairpin DNA, more preferably, the DNAzyme sequence is at least used to cut the hairpin DNA; the sequence complementary to the MTX aptamer strand is close to the 3' end of the walking strand (Walking strand); the sequence complementary to the hairpin DNA is at least used to specifically bind to the hairpin DNA when the walking strand is released to form a single-stranded state, more preferably, the sequence of the methotrexate aptamer strand (AP strand) is shown in SEQ ID NO.1; the sequence of the walking strand (Walking strand) is shown in SEQ ID NO.2: SEQ ID NO.1: ACAACTCTCGGGCGAACGCGGGATGTTTGGGGGACCCACGTTCGCCCTTCTCTCA ACA; SEQ ID NO.2: The underlined sequence "TCCGAGCCGGTCGAA" in SEQ ID NO.2 is the catalytic center of 8-17 DNAzyme, and the bold part and It is a sequence that complementarily pairs with the hairpin DNA when it binds.

3. The nanoparticle according to claim 1, characterized in that The hairpin DNA (H-(7+9) strand) includes an RNA cleavage site. Preferably, the RNA cleavage site is embedded in the stem of the hairpin DNA. More preferably, the RNA cleavage site contains at least one adenine ribonucleotide. More preferably, the hairpin DNA also includes a labeling group. More preferably, the labeling group includes at least one of a fluorescent group and an azide group. More preferably, the hairpin DNA (H-(7+9) strand) also includes a thiol group (-SH). More preferably, the gold nanoparticles are connected to the hairpin DNA via an Au-S bond. More preferably, the labeling group and the gold nanoparticles are located on both sides of the RNA cleavage site. More preferably, the hairpin DNA also includes a sequence that is complementary to the walking strand. More preferably, the sequence of the hairpin DNA (H-(7+9) strand) is as shown in SEQ ID NO.3: In the sequence shown in SEQ ID NO.3, SH- is a thiol group, which is connected to the gold nanoparticles through an Au-S bond; rA represents adenine ribonucleotide, which is the cleavage site of RNA; FAM is a fluorescent labeling group; the bold part and It is a sequence that complementarily pairs with the walking chain when it binds.

4. The nanoparticle according to claim 1, characterized in that The aptamer chain in the double-stranded DNA releases the walking chain after specifically binding to methotrexate. The walking chain specifically binds to the hairpin DNA through a sequence complementary to the hairpin DNA, and the DNAzyme sequence recognizes the cleavage site of the RNA in the hairpin DNA and cuts the hairpin DNA to release the labeling group. The gold nanoparticles and the labeling group are used to count the concentration of methotrexate.

5. The nanoparticle according to claim 1, characterized in that The nanoparticles further include magnetic beads, to which functional DNA chains are connected. Preferably, the functional DNA chains include the double-stranded DNA. More preferably, the magnetic beads are connected to the double-stranded DNA via biotin. More preferably, the magnetic beads are connected to the walking strand of the double-stranded DNA.

6. Use of the nanoparticles as described in any one of claims 1 to 5 in detecting the concentration of methotrexate in a liquid and / or in preparing a product for detecting the concentration of methotrexate. Preferably, the liquid comprises at least one of body fluid and aqueous solution. Preferably, the use in detecting the concentration of methotrexate in a liquid comprises use in POCT rapid detection of methotrexate concentration. Further, the product for detecting the concentration of methotrexate comprises at least one of an instrument, a kit, and a reagent for detecting methotrexate.

7. A kit for dual detection of methotrexate (MTX), characterized in that: The kit comprises the nanoparticles according to any one of claims 1 to 5, and common reagents, including a reaction buffer and a washing reaction solution; Furthermore, the buffer comprises PBS buffer; further, the PBS buffer is obtained by adjusting pH to 7.4 with 0.15M NaCl, 7.6mM Na2HPO4, 2.4mM NaH2PO4, and 10mM MgCl2.

8. A method for preparing the nanoparticles according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) Preparation of double-stranded DNA: The aptamer strand and the walking strand were mixed in a PBS buffer at a molar ratio of 2:1 to 4:1, reacted at 90 to 100°C for 5 to 10 min, and then quickly placed at room temperature for 30 to 40 min to anneal; (2) Preparation of hairpin DNA: The hairpin DNA was dissolved in PBS buffer, reacted at 90-100°C for 5-10 min, and then naturally cooled to room temperature for annealing.

9. The method according to claim 8, characterized in that The PBS buffer is prepared by adjusting the pH value to 7.4 with 0.15 M NaCl, 7.6 mM Na2HPO4, 2.4 mM NaH2PO4, and 10 mM MgCl2.

10. The method according to claim 8, characterized in that The method further comprises the following steps: The gold nanoparticles and the annealed hairpin DNA H-(7+9) strand were mixed at a ratio of 1:150 to 1:250 to prepare DNA-functionalized gold nanoparticles; The magnetic beads washed with PBS buffer were mixed with double-stranded DNA and PBS buffer to prepare DNA-functionalized magnetic beads.

Images