A method of conditionally inducing a kdrl gene knockout in zebrafish for studying blood vessel growth

Abstract

The application discloses a method for conditionally inducing in zebra fish for researching kdrl (vegfr2) gene in blood vessel growth research, which comprises the following steps: (1) preparing a kdrl conditional knock-out strain by using non-homologous end connection; (2) crossing a transgenic strain for marking blood vessel endothelial cells with the kdrl conditional knock-out strain to establish a double-transgenic strain; and (3) injecting Cre mRNA into embryos generated by crossing the double-transgenic strain to realize kdrl knock-out, and observing and evaluating the abnormality of blood vessel growth through fluorescence.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a method for conditionally inducing kdrl gene knockout in zebrafish for studying angiogenesis. Background Technology

[0002] The zebrafish kdrl gene (vascular endothelial growth factor receptor 2, vegfr2, also known as flk1) is crucial for angiogenesis. Currently, the promoter of the kdrl gene can be used to specifically label vascular endothelial cells, indicating that the gene is specifically expressed in vascular endothelial cells. Studies using mutant strains of this gene also demonstrate the importance of kdrl for angiogenesis (see references 1 and 2).

[0003] Currently, there is a lack of a method for conditionally inducing kdrl gene knockout in zebrafish to study angiogenesis. Summary of the Invention

[0004] The purpose of this invention is to provide a method for studying angiogenesis by conditionally inducing kdrl knockout in zebrafish through manipulation of the kdrl gene combined with transgenic lines that label vascular endothelial cells.

[0005] The objective of this invention is achieved through the following technical solution: This invention utilizes a conditionally knocked-out kdrl zebrafish strain prepared by non-homologous end-joining, and studies the growth and development of blood vessels in vivo using a transgenic strain of labeled vascular endothelial cells and the Cre system, comprising the following steps:

[0006] (1) Find two specific recognition sites of nucleases at both ends of the 12th exon of zebrafish kdrl, namely the sgRNA1 target site and the sgRNA2 target site.

[0007] (2) Construct a knock-in plasmid with non-homologous ends. The knock-in plasmid contains a left homologous arm sequence and a right homologous arm sequence. The left arm contains one of the nuclease recognition sites, sgRNA1, and the right arm contains another nuclease recognition site, sgRNA2. The left and right arms contain the foreign gene sequence to be replaced, including the loxP sites flanking the 12th exon and a red fluorescent protein marker for cardiomyocytes that can be used for screening. The nuclease system is injected into zebrafish fertilized eggs by microinjection. The injected fertilized eggs are cultured into fish, and the conditional knockout of zebrafish is confirmed by fluorescence and genotyping.

[0008] (3) The transgenic line labeled with zebrafish vascular endothelial cells was crossed with the above-mentioned conditional knockout line, and double transgenic lines were obtained by fluorescence screening;

[0009] (4) Cre mRNA was injected into the embryos produced by the double transgenic inbreeding above. Three days later, the zebrafish embryos were used to identify the deletion of kdrl, observe the overall phenotype, and observe the phenotype of angiogenesis.

[0010] Further, in step (1), the nuclease is CRIPSR nuclease and Cas9 nuclease.

[0011] Further, in step (2), the nuclease system includes Cas9 protein or mRNA that produces Cas9 protein, sgRNA1 and sgRNA2, and kdrl knock-in plasmid.

[0012] Furthermore, in step (2), the target sequence of sgRNA1 is: Gtaaacagtctgtgaacccc; the target sequence of sgRNA2 is: Gtgagaggggtacagtacgg.

[0013] Further, in step (2), the left homologous arm sequence is shown as positions 7-692 in SEQ ID NO: 1, the right homologous arm sequence is shown as positions 2577-3873 in SEQ ID NO: 1, and the right arm contains the exogenous gene sequence that needs to be replaced, as shown as positions 693-2576 in SEQ ID NO: 1.

[0014] Further, in step (2), the left and right homologous arms of the knock-in plasmid with non-homologous ends are obtained by amplification using zebrafish genome as template and by adding restriction sites and protective bases to PCR primers; the sequence between the two loxP sites in the fourth exon is obtained by amplification using loxP-kdrl_exon12-frt fusion sequence using loxP and frt fusion sequence PCR primers as template, with restriction sites and protective bases added to the PCR primers; the red fluorescent protein sequence for cardiomyocyte markers that can be used for screening is obtained by amplification using loxP and frt fusion sequence PCR primers, with restriction sites and protective bases added to the PCR primers.

[0015] Furthermore, in step (2), donor plasmids are knocked in and zebrafish fertilized eggs are injected to screen and obtain conditional knock-in strains of tcf3a.

[0016] Further, in step (3), the zebrafish strain labeled with vascular endothelial cells is Tg(flk1:EGFP).

[0017] Beneficial effects: This method allows for in vivo and conditional studies of angiogenesis. This invention utilizes conditionally knocked-out KDR1 zebrafish, combined with transgenic zebrafish containing specifically labeled vascular endothelial cells, to effectively study angiogenesis in vivo by conditionally inducing and then knocking out KDR1.

[0018] The present invention has the following advantages:

[0019] (1) When the method provided by this invention is applied to the study of zebrafish blood vessel growth and development, the knockout of the kdrl gene can be induced at different times, and the role of kdrl in muscle blood vessel growth and development at different developmental stages can be studied. It is the latest method for applying inducible gene knockout technology to zebrafish blood vessel research.

[0020] (2) This invention uses a zebrafish live model and fluorescent protein labeling to observe the growth and development of myovascular endothelial cells. Attached Figure Description

[0021] For ease of explanation, the present invention will be described in detail below with reference to specific embodiments and accompanying drawings:

[0022] Figure 1 This is a schematic diagram illustrating the integration of the double loxP site into the zebrafish kdrl gene mediated by non-homologous recombination in this invention.

[0023] The zebrafish kdrl gene plays a crucial role in vascular network formation during early development (reference). sgRNA1 and sgRNA2 targets are indicated by red or blue arrows, respectively. In the kdrl conditional donor (kdrl-loxP-exon12-frt-SM-frt-loxP), two loxP sites and homologous arms (brown lines with double arrows) are added. The left and right arms are 686 bp and 1297 bp in length, respectively. To reduce the workload of densely selecting conditional alleles, a selection marker (SM, 1.2 kb) can be expressed as DsRed under the control of the myl7 promoter, with its transcription direction opposite to that of tcf3a. SM is also located lateral to the frt recombination site and can therefore be excised by Flp recombinase. The zebrafish kdrl has 30 exons, with E12 (the 12th exon) containing 109 bp. After co-injection of the donor with sgRNA1, sgRNA2, and zCas9 mRNA, endogenous E12 at the kdrl site was replaced by kdrl-loxP-exon12-frt-SM-frt-loxP. The short black arrows indicate the primers (F1, R1, F2, R2) used for validation.

[0024] Figure 2 PCR and phenotypic identification of the kdrl conditional knockout strain of the present invention after injection of flp and Cre mRNA;

[0025] (C) PCR identification of SM deletion at 3dpf in heterozygous embryos of the kdrl conditional knockout strain after injection of flp mRNA into the single-cell stage. (D) Injection of Cre mRNA (either "-Cre" or "+Cre") into heterozygous Ki(kdrl) embryos at the single-cell stage. f1 The progeny produced by incrossing were identified by PCR at 3 dpf (days post-fertilization) as having the deletion of exon 12 of the kDR1 gene. The red arrows indicate... Other products, in principle, are derived by Cre from the original. Obtained by excision of fragment. (E and F) 3dpf large double transgene [Tg(kdrl:EGFP); Ki(kdrl fl / + Bright-field (top) and confocal (bottom) images of juvenile fish produced by inbreeding. Cre mRNA injection or non-injection at the single-cell stage showed that Cre mRNA injection resulted in loss of DsRed expression in the heart (inset in E1) and vascular defects in the trunk (E2) and brain (E3). Scale bar: 250 μm (E1, F1), 100 μm (E2, E3, F2, F3). Detailed Implementation

[0026] The present invention is further described in detail through the following embodiments, but it should be noted that the scope of the present invention is not limited by these embodiments.

[0027] This invention utilizes a conditionally knocked-out kdrl zebrafish strain prepared by non-homologous end joining, and studies vascular growth and development in vivo using transgenic strains of vascular endothelial cells labeled with the Cre system, comprising the following steps:

[0028] (1) Find two specific recognition sites of nucleases at both ends of the 12th exon of zebrafish kdrl, namely sgRNA1 target site and sgRNA2 target site; the nucleases are CRIPSR nuclease and Cas9 nuclease.

[0029] (2) Construct a knock-in plasmid with non-homologous ends. The knock-in plasmid contains a left homologous arm sequence and a right homologous arm sequence. The left arm contains one of the nuclease recognition sites, sgRNA1, and the right arm contains another nuclease recognition site, sgRNA2. The left and right arms contain the foreign gene sequence to be replaced, including the loxP sites flanking the 12th exon and a red fluorescent protein marker for cardiomyocytes that can be used for screening. The nuclease system is injected into zebrafish fertilized eggs by microinjection. The injected fertilized eggs are cultured into fish, and the conditional knockout of zebrafish is confirmed by fluorescence and genotyping.

[0030] The nuclease system includes Cas9 protein or mRNA that produces Cas9 protein, sgRNA1 and sgRNA2, and kdrl knock-in plasmid.

[0031] The target sequence for sgRNA1 is: Gtaaacagtctgtgaacccc; the target sequence for sgRNA2 is: Gtgagaggggtacagtacgg.

[0032] The left homologous arm sequence is shown in positions 7-692 of SEQ ID NO: 1, the right homologous arm sequence is shown in positions 2577-3873 of SEQ ID NO: 1, and the exogenous gene sequence that needs to be replaced between the right arms is shown in positions 693-2576 of SEQ ID NO: 1.

[0033] The left and right homologous arms of the knock-in plasmid with non-homologous ends were obtained by amplification using zebrafish genome as a template and by adding restriction enzyme sites and protective bases to PCR primers; the sequence between the two loxP sites in the fourth exon was obtained by amplification of the loxP-kdrl_exon12-frt fusion sequence using loxP and frt fusion sequence PCR primers using zebrafish genome as a template and by adding restriction enzyme sites and protective bases to PCR primers; the red fluorescent protein sequence for cardiomyocyte markers that can be used for screening was obtained by amplification of the loxP-myl7-DsRed-pA-frt fusion sequence using loxP and frt fusion sequence PCR primers and by adding restriction enzyme sites and protective bases to PCR primers.

[0034] Donor plasmids were knocked in and zebrafish fertilized eggs were injected to screen for conditional knock-in strains of tcf3a.

[0035] (3) The transgenic line labeled with zebrafish vascular endothelial cells was crossed with the above-mentioned conditional knockout line, and double transgenic lines were obtained by fluorescence screening;

[0036] (4) Cre mRNA was injected into the embryos produced by the double transgenic inbreeding above. Three days later, the zebrafish embryos were used to identify the deletion of kdrl, observe the overall phenotype, and observe the phenotype of angiogenesis.

[0037] The zebrafish strain that was labeled with vascular endothelial cells was Tg(flk1:EGFP).

[0038] Example 1

[0039] The main design concept in this embodiment is as follows:

[0040] 1. Design guide RNAs that are specific to the sequences flanking the target region of the target gene.

[0041] 2. Using PDM-19T as the backbone, construct the donor plasmid. The plasmid consists of three parts: a left arm sequence, a foreign sequence, and a right arm sequence. The left arm sequence is the genomic sequence upstream of the 5' of the target region and contains the left-side guide RNA target sequence. The foreign sequence follows the left arm sequence. Next is the right arm, which is the 3' downstream sequence of the target region and contains the right-side guide RNA target sequence.

[0042] 3. The synthesized guide RNA and donor plasmid, along with the optimized zebrafish Cas9 mRNA, were microinjected into one-cell stage zebrafish fertilized eggs, and conditional knockout strains were further screened.

[0043] 4. Using transgenic lines labeled with zebrafish vascular endothelial cells, cross them with the above-mentioned conditional lines, and then screen transgenic zebrafish using fluorescence.

[0044] 5. Microinject Cre mRNA into embryos generated by double heterozygote inbreeding of kdrl conditionally knocked-out and Tg(flk1:EGFP) to identify and analyze the phenotype of angiogenesis and development in zebrafish.

[0045] Example 2

[0046] Materials and methods:

[0047] 1. Construct the knock-in donor plasmid loxP-kdrl_exon12-frt-SM-frt-loxP

[0048] Using the zebrafish genome and the DsRed plasmid that marks the zebrafish heart as templates, the loxP-kdrl_exon12-frt-SM-frt-loxP fusion sequence was amplified using PCR primers containing the loxP and frt fusion sequences. Enzyme restriction sites and protective bases were added to the PCR primers.

[0049] LF:ctcggtacctcagtgataacaaggcctgt(SEQ ID NO:3)

[0050] LR: tatGAGCTCcagtttacttcctggggttc (SEQ ID NO: 4)

[0051] MF: ctggagctcataacttcgtatagcatacattatacgaagttatataaatgggtatattgctcc (SEQ ID NO: 5)

[0052] MR: taagcatgcgaagttcctatactttctagagaataggaacttccaatcaaatcaatcaaatca (SEQ ID NO: 6)

[0053] SM-F:ttcgcatgcttaagatacattgatgagtt(SEQ ID NO:7)

[0054] SM-R:TATagatctGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCtcatccatccttttcatccc(SEQ ID NO:8)

[0055] RF:TTCagatctATAACTTCGTATAGCATACATTATACGAAGTTATtttcatagtaaaagtatgag (SEQ ID NO:9)

[0056] RR:caggtcgacatctcctgtcttcattttta(SEQ ID NO:10)

[0057] loxP is a sequence recognized by Cre recombinase, and the sequence between two loxPs in the same direction can be deleted by Cre enzyme.

[0058] The amplified sequences were sequentially ligated into the pMD-19T vector (purchased from Takara) to form the final donor plasmid.

[0059] 2. Synthesis of sgRNA and zCas9 mRNA

[0060] The zCas9-expressing plasmid pGH-T7-zCas9 was obtained from the School of Life Sciences, Peking University. After linearization with Xba I restriction enzyme, the plasmid was transcribed and purified using the mMACHINE T7 Ultra kit (Ambion) to obtain zCas9 mRNA.

[0061] The DNA sequences used to prepare different sgRNAs are shown below:

[0062] kdrl sgRNA1: Gtaaacagtctgtgaacccc (SEQ ID NO:11) (reverse strand);

[0063] kdrl sgRNA2: Gtgagaggggtacagtacgg (SEQ ID NO:12) (forward strand, on the justice strand);

[0064] The above sgRNA sequences were cloned into the BbsI site of the pT7-sgRNA plasmid (obtained from the School of Life Sciences, Peking University), and in vitro transcribed using the MAXIscript T7 Kit (Ambion). The transcription was then performed using mirVana. TM The miRNAIsolation Kit (Ambion) is used to recover and obtain guide RNA.

[0065] 3. Zebrafish strains and breeding

[0066] Adult zebrafish were cultured using an aquatic animal breeding system from Beijing Aisheng Company at a water temperature of 28℃, pH 7-8, and a photoperiod of 14 hours light / 10 hours dark. Embryos were cultured in a 10% Hank's solution. The solution composition (mmol) was as follows: 140 NaCl, 5.4 KCl, 0.25 Na₂HPO₄, 0.44 KH₂PO₄, 1.3 CaCl₂, 1.0 MgSO₄, and 4.2 NaHCO₃ (pH 7.2).

[0067] 4. Microinjection

[0068] zCas9 mRNA, sgRNA, and donor plasmid were injected together into one-cell-stage zebrafish zygotes via microinjection. Each zygote was injected with 1 nmol of fluid containing 600 ng / μl zCas9 mRNA, 100 ng / μl sgRNA, and 15 ng / μl donor plasmid. The zygotes developed directly into zebrafish under in vitro culture conditions (see 3. Zebrafish rearing). The injection concentration of CremRNA was 100 ng / μl.

[0069] 5. PCR verification of genome substitution

[0070] Genetic DNA was extracted from zebrafish embryos, and PCR was used to identify correct insertions and gene substitutions. The primers used were as follows:

[0071] kdrl-LF:TTGGCAGGGGTAAAGCACAG (SEQ ID NO: 13);

[0072] DsRed-R:CCCACAACGAGGACTACACC (SEQ ID NO:14);

[0073] DsRed-F:CCCTTGGTCACCTTCAGCTT(SEQ ID NO:15);

[0074] kdrl-RR:AACGTGCCACTTGACATCCA (SEQ ID NO:16);

[0075] 6. Confocal imaging

[0076] Confocal imaging was performed using an FV1000 confocal microscope (Olympus, Japan), acquiring continuous fluorescence images along the Z-axis using a light sectioning technique with either a 20x or 40x water microscope (NA, 0.80). All images were captured at a resolution of 1024×1024 or 800×600. The structural morphology was then reconstructed using ImageJ software (NIH).

[0077] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents. sequence list <110> Nanjing Xinjia Pharmaceutical Technology Co., Ltd. <120> A method for conditionally inducing kdrl gene knockout in zebrafish to study angiogenesis. <130> 2020 <160> 15 <170> SIPOSequenceListing 1.0 <210> 1 <211> 6538 <212> DNA <213> Artificial sequences (nucleotide sequences of the left and right homologous arms) <400> 1 ggtacctcag tgataacaag gcctgtttaa aagggttgga tttgtttaga gcgaattcct 60 ttctgtcacc tcatataaat tttccagctc tgtgaacaac aggctggtat ggtccatctc 120 aaatggtgcc ttttaaccat agaatgagaa atggccactt aaagacaaag taggaaggtc 180 attctaaatt gctgacaagg tcatcagaga aatgattaga aaagcttgat gtactttaat 240 gtgtaatgtc attacaggtt gagcctggtg aacattgtgt tgatcaattg aatttcagac 300 caatatttca atgcctagtt aaatagatt ggtaaggcaa atagatggaa acatgcctgc 360 tttctcatgt atatttttgt gcagtgtgcc attaaaaaa atcggcttca tgtaagacta 420 aacaacgaca tgccattgca ctacatcagc tccacagatt tacattaacc aaactccaca 480 cctcatttca gtctgttcaa cagtataacg ttgtgtacaa gagaaattct aagctttgta 540 aaaaattct ttgcattaaa tatgagtgtt gtacatcttt acaaactaaa acagaaaaac 600 attaaaata cctgttgttc agagccaacg ctgtatttct tcagtttcaa ataagtctta 660 taaacagtct gtgaacccca ggaagtaaac tggagctcat aacttcgtat agcatacatt 720 atacgaagtt atataaatgg gtatattgct ccagaaatac acccagagtg tttcatacct 780 ttgatgtgac ggccaagaaa acagatgtag ttgaaactg aaaacagagc ccagtaatct 840 ggtctcgtgc caaaaacctg catcattatt atgtctactt aggctattaa tgagttccag 900 ttgaatggta acaatattaa gcctggcatt ttaaatgtgt atgaggaaat tacatgggac 960 gtggacatgc cttctgtgat ttatgagatg tgaaaagttg tgttattacg ggttaaagaa 1020 tattttgatt aacacttcta ataatctttt ctcatcctct tagactataa gtaccctggt 1080 ggtgaaaaca gctaatgtgt ctggggtata ctcctgtaca gcaaggaatg aacttggcaa 1140 ccggaccatg agaatccctt tttatgtgga tggtatgtta gtcattttat atgtactgaa 1200 cgttaatgtc acatgttatt tgtggttttg tggcatatag atggtctgat ttgattgatt 1260 tgattggaag ttcctattct ctagaaagta taggaacttc gcatgctaa gatacattga 1320 1380 1440 1500 aaacctctac aaatgtggta tggctgatta tgatctagag tcgcggccgc tacaggaaca 1560 ggtggtggcg gccctcggcg cgctcgtact gctccacgat ggtgtagtcc tcgttgtggg 1620 aggtgatgtc cagcttggag tccacgtagt agtagccggg cagctgcacg ggcttcttgg 1680 ccatatagat agacttgaac tccaccaggt agtggccgcc gtccttcagc ttcagggcct 1740 tgtggatctc gcccttcagc acgccgtcgc gggggtacag gcgctcggtg gaggcctccc 1800 agcccatagt cttcttctgc attacggggc cgtcggaggg gaagttcacg ccgatgaact 1860 tcaccttgta gatgaaggag ccgtcctgca gggaggagtc ctgggtcacg gtcaccacgc 1920 cgccgtcctc gaagttcatc acgcgctccc acttgaagcc ctcggggaag gacagcttct 1980 tgtagtcggg gatgtcggcg gggtgcttca cgtacacctt ggagccgtac tggaactggg 2040 gggacaggat gtcccaggcg aagggcaggg ggccgccctt ggtcaccttc agcttggcgg 2100 tctgggtgcc ctcgtagggg cggccctcgc cctcgccctc gatctcgaac tcgtggccgt 2160 tcacggagcc ctccatgcgc accttgaagc gcatgaactc cttgatgacg tcctcggagg 2220 aggccatacc ggttcactgt ctgctttgct gttggtctgg gctcctgggt cactgactta 2280 ctaatggagt ctttatgtat gaggactctt atcatttgtt cttctataaa ggtctgcagt 2340 gtttctgttc gtcccctaca tggacaccca gagcctccta aatacaggag ccctgataac 2400 tgcacaagtg ctcagattcc agcagggtgg aaaatgagat aaagtgtgca gatgggggagg 2460 gggacgtgaa tgagagattt gagggatgaa areatggat gagaagttcc tattctctag 2520 aaagtagg aacttcagat ctataacttc gtatagcata cattatacga agttattttc 2580 atagtaaaag tatgagaggg gtacagtacg gtggtcgaga gcatcttcat ccctttgaca 2640 gtacacttgt tgtaaattag tcacaacaaca aacaagtaaa gaacgcgca gcaaattgat 2700 cacaacactt gcaaatattc acgtaacaca acggaaatgt ttctagtgga ttaaaaaaca 2760 tgacggaccc tgctgagata tggatgtgtt attatgctgt gactgttgct cattaaagtg 2820 attggtggtc tttgtttgta tctctcggcc accttcgtac agtggcgtag cggcaattgt 2880 aaaagtgggt gactgctgta tgtgacataa aggttaagca taatcatttg cttttttttt 2940 ttaaattaag gtataattcc ttaaaatatt gctgatcagt tcccaaacag tgccttaaaa 3000 tagtcagttc ccttttttat acaaatttca ctagttaggg catagcagta aatatttaaa 3060 agactaaaat tttataaagc atacttaggc aacaaacgac agcagaacct gatggacaaa 3120 tcttgaaaat tatttatggg gggcatgaca attataaggg ttggagaaca cgggtggaaa tattggagat aggtaaaaaa aaaaagtgct aacatgcaaa ctccacacag aaatgcccac tggtccagcc aggacttaa ccgaagagct tctcactgtg tggcaacaac tgagccattg tgctgcccct ttattttcag attachment attachment caatttctt gcaactttta tgtttatggt tgtcactata catgatctgt atgtcagcta ttctgaaaga aatgttttta tatatttaaa tgtatatttt gcatccttga ttgtttcagc tgttcagagc actatgtgtt 3480. ttattacatg gtgaattctg gctgacttct cgcctgtcaa cttaagcttg tgattgagca gtattggtgt taaataaa gttcctcact ctaggcaaaa acatgcaaat gtagttcctg ttcttctgct ccactctgga ttggactcag gcactatat gccaactcct gttttaaaat gaatcacttt tatttgtcgc tgaccagggt caaatgtttc tgaaatgaga aacccattca cccagttatg tgtgtcggct gtcagacttt tcaaagctgc ttagattaga 3840. aaaatgagct gcggtaaaca gcagccgtgg tttggagagg tgtaaaaaat gagaactgtg caataaaaat gaagacagga gatgtcgacc tgcaggcatg caagcttggc 3900 gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa 3960 catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac 4020 attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca 4080 ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc 4140 ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc 4200 aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 4260 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 4320 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 4380 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 4440 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 4500 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 4560 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 4620 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 4680 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 4740 ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 4800 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 4860 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 4920 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 4980 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 5040 aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat 5100 ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 5160 tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg 5220 ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 5280 tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt 5340 aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt 5400 gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 5460 tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 5520 cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 5580 tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 5640 ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac 5700 cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 5760 actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 5820 ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 5880 aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 5940 ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 6000 atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 6060 tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag 6120 gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 6180 ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 6240 gtcagcgggt gttggcgggt gtcggggctg gcttaactat gcggcatcag agcagattgt 6300 actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 6360 catcaggcgc cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc 6420 ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt 6480 aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgaat tcgagctc 6538 <210> 2 <211> 29 <212> DNA <213> Artificial sequence (LF) <400> 2 ctcggtacct cagtgataac aaggcctgt 29 <210> 3 <211> 29 <212> DNA <213> Artificial sequence (LR) <400> 3 tatgagctcc agtttatacttc ctggggttc 29 <210> 4 <211> 63 <212> DNA <213> Artificial sequence (MF) <400> 4 ctggagctca taacttcgta tagcatacat tatacgaagt tatataaatg ggtatattgc 60 tcc 63 <210> 5 <211> 63 <212> DNA <213> Artificial sequences (MR) <400> 5 taagcatgcg aagttcctat actttctaga gaataggaac ttccaatcaa atcaatcaaa 60 tca 63 <210> 6 <211> 29 <212> DNA <213> Artificial sequence (SM-F) <400> 6 ttcgcatgct taagatacat tgatgagtt 29 <210> 7 <211> 63 <212> DNA <213> Artificial sequence (SM-R) <400> 7 tatagatctg aagttcctat actttctaga gaataggaac ttctcatcca tccttttcat 60 ccc 63 <210> 8 <211> 63 <212> DNA <213> Artificial sequence (RF) <400> 8 ttcagatcta taacttcgta tagcatacat tatacgaagt tattttcata gtaaaagtat 60 gag 63 <210> 9 <211> 29 <212> DNA <213> Artificial sequence (RR) <400> 9 caggtcgaca tctcctgtct tcattttta 29 <210> 10 <211> 20 <212> DNA <213> Artificial sequence (kdrl sgRNA1) <400> 10 gtaaacagtc tgtgaacccc 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence (kdrl sgRNA2) <400> 11 gtgagagggg tacagtacgg 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence (kdrl-LF) <400> 12 ttggcagggg taaagcacag 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence (DsRed-R) <400> 13 cccacaacga ggactacacc 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence (DsRed-F) <400> 14 cccttggtca ccttcagctt 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence (kdrl-RR) <400> 15 aacgtgccac ttgacatcca 20

Claims

1. A method for conditionally inducing kdrl gene knockout in zebrafish for studying angiogenesis, characterized in that... Includes the following steps: (1) Find two specific recognition sites of nucleases at both ends of the 12th exon of zebrafish kdrl, namely the sgRNA1 target site and the sgRNA2 target site. (2) Construct a knock-in plasmid with non-homologous end ligation. The knock-in plasmid contains a left homologous arm sequence and a right homologous arm sequence. The left arm contains one nuclease recognition site, sgRNA1, and the right arm contains another nuclease recognition site, sgRNA2. The nucleotide sequence of the foreign gene to be replaced is located between the left and right arms, including the loxP sites flanking the 12th exon and a cardiomyocyte marker, red fluorescent protein, which can be used for screening. The target sequence of sgRNA1 is: Gtaaacagtctgtgaacccc; the target sequence of sgRNA2 is: Gtgagaggggtacagtacgg. The nucleotide sequence of the left homologous arm is shown as positions 7-692 in SEQ ID NO: 1, and the nucleotide sequence of the right homologous arm is shown as positions 2577-3873 in SEQ ID NO:

1. The nucleotide sequence of the foreign gene to be replaced is located between the right arms as shown in SEQ ID NO:

1. The sequence is shown in positions 693-2576 of NO: 1; the left and right homologous arms of the knock-in plasmid with non-homologous ends are obtained by using the zebrafish genome as a template and adding restriction enzyme sites and protective bases to the PCR primers; the sequence between the two loxP sites in the fourth exon is obtained by using the zebrafish genome as a template and adding restriction enzyme sites and protective bases to the PCR primers to obtain the loxP-kdrl_exon12-frt fusion sequence; the sequence of red fluorescent protein used as a marker for cardiomyocytes for screening is obtained by adding restriction enzyme sites and protective bases to the PCR primers to obtain the loxP-myl7-DsRed-pA-frt fusion sequence; the sequence of red fluorescent protein used as a marker for cardiomyocytes for screening is obtained by adding restriction enzyme sites and protective bases to the PCR primers to obtain the loxP-myl7-DsRed-pA-frt fusion sequence. (3) Microinject the nuclease system into zebrafish fertilized eggs, wherein the nuclease system includes Cas9 protein or mRNA, sgRNA1, sgRNA2 and kdrl knock-in plasmid that produce Cas9 protein; (4) The injected fertilized eggs were cultured into fish, and the kdrl conditional knockout zebrafish were confirmed by fluorescence and genotyping identification. (5) Using the known transgenic line Tg(flk1:EGFP) that labels zebrafish vascular endothelial cells in the prior art, hybridize with the above-mentioned conditional knockout line, and obtain double transgenic lines by fluorescence screening; (6) Cre mRNA was injected into the embryos produced by the double transgenic inbreeding above. Three days later, the zebrafish embryos were used to identify the deletion of kdrl, observe the overall phenotype, and observe the phenotype of angiogenesis.

Images