Method for molecular marker-assisted breeding of high-embryo-part-chromogenic corn haploid induction line and primers thereof
By using InDel molecular markers and specific primers to detect tightly linked allelic variations, the problem of insufficient embryo coloration in maize haploid inducible lines was solved, enabling rapid screening of haploid inducible lines with enhanced embryo coloration and improving breeding efficiency.
Patent Information
- Application Number
- CN202511798326.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-02-27
AI Technical Summary
The existing maize haploid induction lines have insufficient embryo coloration ability, which means that the effectiveness of haploid identification is affected by genetic background and environmental factors.
Using InDel molecular markers and their specific primers, tightly linked allelic variants SNP1, SNP2, SNP3, Indel 1, SNP4, and SNP5 were detected by PCR to rapidly identify maize embryo chromogenic haploid inducible lines.
This method enables rapid, simple, and efficient screening of haploid inducible lines with high anthocyanin content in the embryo and obvious color development, thereby improving breeding efficiency.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and particularly relates to a method for breeding a high-embryo-color maize haploid inducer line and primers thereof. BACKGROUND
[0002] Maize is one of the most important crops in the world, and the world maize production reached 1.217 billion tons in 2024. In order to obtain different hybrid maize varieties every year, different inbred lines are often needed, and the use of double haploid (DH) technology to accelerate the breeding of inbred lines is a method for greatly improving breeding efficiency. The DH technology generates haploid plants from tissue culture or in vivo induction, and then the haploids are identified and chromosome doubled to obtain inbred lines. This process usually only takes two to three generations, greatly shortening the breeding cycle. At present, the main method for identifying haploids is based on the color marker of the maize inbred line (Navajo), and the maize haploid seeds induced by the inbred line containing the marker only show purple endosperm and colorless embryo. R1-nj
[0003] Although the marker is currently applied in most inducer lines, it still has some limitations in identifying haploids. Genetic background and environmental factors can reduce the effectiveness of identifying haploids based on the marker. R1-nj Therefore, it is necessary to develop some new identification markers, enhance the accumulation of anthocyanins in the embryo of the grain, improve the color of the embryo, and thus improve the identification ability. R1-nj SUMMARY
[0004] The main problem to be solved by the present application is the insufficient color of the embryo of the maize haploid inducer line.
[0005] In order to solve the above problems, the present application provides a method for breeding a high-embryo-color maize haploid inducer line and primers thereof.
[0006] The present application first provides the use of an InDel molecular marker or a substance for detecting the InDel molecular marker, wherein the InDel molecular marker is a double-stranded DNA molecule with a nucleotide sequence of SEQ ID No: 4 at positions 139 to 172 of one strand; and the use can be any of the following: (1) identifying or assisting in identifying a maize embryo color-enhanced haploid inducer line; (2) screening or breeding a maize embryo color-enhanced haploid inducer line; (3) maize breeding; (4) preparing a product for identifying or assisting in identifying a maize embryo color-enhanced haploid inducer line; (5) preparing a product for screening or breeding a maize embryo color-enhanced haploid inducer line.
[0007] In the above application, the substance contains PCR primers for amplifying the corn genomic DNA fragments containing the InDel molecular marker.
[0008] The two haplotypes Hap1 and Hap2 of the corn variety can be identified by using the substance, and the two haplotypes exist closely linked allelic variations: SNP1, SNP2, SNP3, Indel 1, SNP4, and SNP5. The SNP1 site is located at the 45th position of SEQ ID No: 4, and the base type is A or G; the SNP2 site is located at the 51st position of SEQ ID No: 4, and the base type is C or A; the SNP3 site is located at the 68th position of SEQ ID No: 4, and the base type is T or C; the Indel 1 site is an insertion-deletion mutation at the 139th to 172nd positions of SEQ ID No: 4, and the insertion sequence is 5'-TCCTAATTAGTTCCTAAAATATCAATAATGAGGC-3'; the SNP4 site is located at the 173rd position of SEQ ID No: 4, and the base type is C or T; and the SNP5 site is located at the 215th position of SEQ ID No: 4, and the base type is T or G.
[0009] The genotype of the Hap1 is AACCTTDDCCTT, i.e., the base type of the SNP1 site is A, the base type of the SNP2 site is C, the base type of the SNP3 site is T, the Indel 1 site is a deletion type at the 139th to 172nd positions of SEQ ID No: 4 (referred to as a DD genotype), the base type of the SNP4 site is A, and the base type of the SNP5 site is C.
[0010] The genotype of the Hap2 is GGAACCIITTGG, i.e., the base type of the SNP1 site is G, the base type of the SNP2 site is A, the base type of the SNP3 site is C, the Indel 1 site is an insertion type at the 138th to 172nd positions of SEQ ID No: 4 (referred to as a II genotype), the base type of the SNP4 site is T, and the base type of the SNP5 site is G.
[0011] Since the two haplotypes exist closely linked allelic variations, the haplotype of the corn can be determined by identifying whether the insertion fragment (5'-TCCTAATTAGTTCCTAAAATATCAATAATGAGGC-3') of the Indel 1 site exists, i.e., performing PCR detection on the corn sample to be tested to quickly identify the genotype or haplotype of the corn by linkage group band type (length of the PCR product).
[0012] In the application, the PCR primer is a primer pair, the primer pair is composed of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the corn genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the corn genomic DNA.
[0013] In the application, the sequence of the forward primer is SEQ ID No: 1, and the sequence of the reverse primer is SEQ ID No: 2.
[0014] The application further provides a method for breeding corn, which is breeding corn with the nucleotide sequence of SEQ ID No: 4 in the corn genomic DNA amplified by the primer pair as a parent, and the purpose of the breeding is to breed corn varieties of embryo color enhancement and haploid induction.
[0015] The application further provides a method for identifying or assisting in identifying corn embryo color enhancement and haploid induction, detecting the genotype of the molecular marker in the genome of the corn to be identified, and determining whether the corn to be tested is a corn embryo color enhancement and haploid induction line according to the genotype: The genotype is bb genotype, BB genotype and Bb genotype; 1) If the PCR amplification product of the sample to be tested contains only the DNA fragment with the nucleotide sequence of SEQ ID No: 4, the genotype is BB genotype; 2) If the PCR amplification product of the sample to be tested contains only the DNA fragment with the nucleotide sequence of SEQ ID No: 3, the genotype is bb genotype; 3) If the PCR amplification product of the sample to be tested appears a hybrid band type, i.e. the PCR amplification product contains both SEQ ID No: 4 and SEQ ID No: 3, the genotype is Bb genotype; The corn embryo of the BB genotype has stronger color than the corn of the bb genotype.
[0016] In the application, method and product, the substance can be reagents and / or instruments required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single-stranded conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele-specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.
[0017] The present application also provides products containing the aforementioned substance for detecting the InDel molecular marker, which are any of the following: C1) products for detecting the polymorphism or genotype of the molecular marker related to the maize embryo color-enhanced haploid inducer line; C2) products for identifying or assisting in identifying the maize embryo color-enhanced haploid inducer line; C3) products for maize breeding.
[0018] In the aforementioned products, the substance can be D1), D2) or D3) as follows: D1) the substance is a primer composition for amplifying a fragment of maize genomic DNA comprising the molecular marker; D2) the substance is a PCR reagent containing the primer composition of D1); D3) the substance is a kit containing the primer composition of D1) or the PCR reagent of D2).
[0019] In the aforementioned applications, methods and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with nucleic acid or protein sequences, as long as the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without a label (e.g., the sequence is read directly).
[0020] Further, the substance is a primer composition consisting of SEQ ID No: 1 and SEQ ID No: 2.
[0021] The present application also provides the aforementioned InDel molecular marker.
[0022] Herein, the maize can be a maize variety or a maize inbred line.
[0023] Further, the maize can be maize haploid inducer line 2121-8 or haploid inducer line CHOI4, or the offspring of a cross between the two.
[0024] In this article, the breeding purpose can include cultivating the maize haploid inducer line with enhanced embryo anthocyanin coloration.
[0025] The present application can be applied to maize breeding and accelerate the breeding process by screening the maize haploid inducer line with high embryo anthocyanin content and obvious coloration through the InDel molecular marker. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 It is an agarose electrophoresis chart. Lanes 1-3 are 2121-8; lanes 4-12 correspond to the single plant type corresponding to the genotype band consistent with one of lanes 1-3.
[0027] Figure 2 It is an agarose electrophoresis chart. Lanes 1-3 are 2121-8; lanes 4-12 correspond to the single plant type corresponding to the genotype band consistent with one of lanes 1-3.
[0028] Figure 3 It is a crude embryo anthocyanin content solution chart. 0 is a blank control, 1 is a corn sample with InDel1 fragment deletion, and 2 is a corn sample with InDel1 fragment insertion. DETAILED DESCRIPTION
[0029] The present application will be further described in detail below with reference to the specific embodiments. The examples provided below are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the present application.
[0030] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0031] In the quantitative test in the following examples, three repeated experiments were set, and the average value was taken, unless otherwise specified.
[0032] The maize haploid inducer line 2121-8 in the following examples is selected by China Agricultural University, and has an induction rate of 3%, with R1-njThe biological material can be obtained from the applicant, and is only used for repeating the experiments of the present application, and cannot be used for other purposes.
[0033] The maize haploid inducer CHOI4 in the following examples was bred by China Agricultural University, and its haploid induction rate was 15.8%, which had the characteristics of high haploid induction rate, high embryo coloration rate, and high embryo coloration rate. R1-nj The marker has been described in: Liu, C., Li, J., Chen, M., Li, W., Zhong, Y., Dong, X., Xu, X. et al . (2022) Development of high-oil maize haploid inducer with a novel phenotyping strategy. Crop J. 10, 524-531. The biological material can be obtained from the applicant, and is only used for repeating the experiments of the present application, and cannot be used for other purposes.
[0034] The Tris saturated phenol, chloroform, alcohol, and isopropanol in the following examples are products of Beijing Jipu Technology Co., Ltd.
[0035] The Mix and agarose in the following examples are products of Beijing Poly-Mer Biological Technology Co., Ltd.
[0036] The statistical software is used to process the data in the following examples, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, P<0.05 (*) indicates significant difference, P<0.01 (**) indicates extremely significant difference, and P<0.001 (*** ) indicates extremely significant difference.
[0037] Example 1, obtaining and application of molecular markers I. Discovery of QTL W1 enhancing embryo coloration trait F1 generation was obtained by crossing the inducer CHOI4 and 2121-8, and then selfing the F1 generation to form the F2 population. The F2 population was scanned for the whole genome by using the target sequencing genotyping technology (Genotyping by Target Sequencing, GBTS) of Shijiazhuang Boerdi Biological Technology Co., Ltd. for the trait of embryo coloration. A QTL site affecting embryo coloration was found on chromosome 7 of maize. The QTL site located on chromosome 7 was named QTLW1.
[0038] II. Obtaining of molecular markers By using 10x whole genome sequencing data of haploid inducer lines CHOI4 and 2121-8, the sequence of the QTLW1 locating interval was compared and analyzed.
[0039] After the indel (insertion / deletion) difference was found, the B73 reference sequence covering the region was downloaded. Then, the primers were designed by using the NCBI online tool, and after specific alignment and linkage group verification, a pair of molecular markers with obvious difference and clear band were finally determined, which were named QTLW1. The following polymorphic variations exist in the molecular marker QTLW1: SNP1, SNP2, SNP3, Indel 1, SNP4, and SNP5. The SNP1 site is located at the 45th position of SEQ ID No: 4, and the base type is A or G; the SNP2 site is located at the 51st position of SEQ ID No: 4, and the base type is C or A; the SNP3 site is located at the 68th position of SEQ ID No: 4, and the base type is T or C; the Indel 1 site is an insertion / deletion mutation at the 139th to 172nd position of SEQ ID No: 4, and the insertion sequence is 5'-TCCTAATTAGTTCCTAAAATATCAATAATGAGGC-3'; the SNP4 site is located at the 173rd position of SEQ ID No: 4, and the base type is C or T; and the SNP5 site is located at the 215th position of SEQ ID No: 4, and the base type is T or G.
[0040] The above closely linked allelic variation information forms two haplotypes Hap1 and Hap2. The genotype of Hap1 is AACCTTDDCCTT, that is, the base type of the SNP1 site is A, the base type of the SNP2 site is C, the base type of the SNP3 site is T, the Indel 1 site is a deletion type at the 139th to 172nd position of SEQ ID No: 4 (referred to as DD genotype), the base type of the SNP4 site is A, and the base type of the SNP5 site is C.
[0041] The genotype of Hap2 is GGAACCIITTGG, that is, the base type of the SNP1 site is G, the base type of the SNP2 site is A, the base type of the SNP3 site is C, the Indel 1 site is an insertion type at the 138th to 172nd position of SEQ ID No: 4 (referred to as II genotype), the base type of the SNP4 site is T, and the base type of the SNP5 site is G.
[0042] III. Design of specific primers for molecular marker QTLW1 The specific primer set F / R for molecular marker QTLW1 was designed, and the primer sequences are as follows: F: 5'-TCACCACAACACAGCGTACT-3' (SEQ ID No: 1); R: 5'-ATGGTTCCTTTAGTCGCTCTCC-3' (SEQ ID No: 2).
[0043] The genomic DNA of CHOl4 and 2121-8 was used as a template respectively, and the F / R primer pair was used for PCR amplification, and PCR amplification products with sizes of 217 bp and 251 bp were obtained.
[0044] The sequence of the amplified PCR product of CHOl4 is as follows: 5'-TCACCACAACACAGCGTACTGTTGCAGAGAGAAACATCACTGCCAACGAGCGCCTGTCAATGAGTGTTCACCAGGACGATGTCAAGGTCCTCTGTTTGCATTGCCCGTACATCTAGTTGGAGTGTTTGGTTCCTACTTCG ACTAAAATAAGTATTCCAAATAGGATTT CTAGGGACTACATTTTAGTCATGTTTAGGAGAGCGACTAAAGGAACCAT-3' (SEQ ID No: 3).
[0045] The sequence of the amplified PCR product of 2121-8 is as follows: 5'-TCACCACAACACAGCGTACTGTTGCAGAGAGAAACATCACTGCCGACGAGAGCCTGTCAATGAGTGTCCACCAGGACGATGTCAAGGTCCTCTGTTTGCATTGCCCGTACATCTAGTTGGAGTGTTTGGTTCCTACTTTCCTAATTAGTTCCTAAAATATCAATAATGAGGCTG ACTAAAATAAGTATTCCAAATAGGATTT CTAGGGACTACAGTTTAGTCATGTTTAGGAGAGCGACTAAAGGAACCAT-3' (SEQ ID No: 4).
[0046] The linkage group band type shows that the Indel 1 molecular marker is located in the positioning interval, and can be used for genotype detection of the molecular marker site. Compared with the haploid induction line CHOI4 genome (haplotype Hap1 type), the haploid induction line 2121-8 genome (haplotype Hap2 type) has a DNA fragment insertion of SEQ ID No: 4 from 139 to 172, and due to the existence of tightly linked allelic variation between the two haplotypes, the haplotype of the corn can be determined by identifying whether the Indel 1 site has the fragment, that is, the genotype or haplotype of the corn is identified by the linkage group band type (the length of the PCR product) through PCR detection of the corn sample to be tested.
[0047] The genotype of the PCR amplification product containing only the PCR product of CHOI4 (nucleotide sequence of SEQ ID No: 3) is defined as bb genotype; the genotype of the PCR amplification product containing only the PCR product of 2121-8 (nucleotide sequence of SEQ ID No: 4) is defined as BB genotype; and the genotype of the PCR amplification product containing both the PCR product band of CHOI4 and the PCR product band of 2121-8 is defined as Bb genotype.
[0048] Four, identification and verification of molecular marker qIN-2 in F2 population 1. DNA extraction of the plant to be tested The haploid induction line CHOI4 and the haploid induction line 2121-8 are crossed and then selfed to obtain an F2 progeny population, and a cross-over single plant is selected and selfed again. (Table 1 shows) The method provided by Murray and Thompson (1980) is used to extract the genomic DNA of the embryo of the single plant to be tested.
[0049] Table 1, genotype identification results and absorbance / weight phenotype of F2 generation population
[0050] 2. Genotype identification The genomic DNA of the single plant to be tested is used as a template, and the above primers F / R are used for PCR amplification of the genome of the corn to be tested to obtain a PCR amplification product.
[0051] The PCR amplification system is shown in Table 2: Table 2, PCR amplification system
[0052] PCR amplification procedure is shown in Table 3: Table 3, PCR amplification procedure
[0053] Prepare 3.0% agarose gel, then perform electrophoresis detection to verify the PCR amplification product, and use voltage 170V during electrophoresis, and the electrophoresis time is 20 minutes.
[0054] The electrophoresis results of single plants in F2 population are shown in Figure 1 Table 4 (1 lane is 2121-8, 2 lane is heterozygous band type, and 3 lane is CHOI4).
[0055] Based on the band type of electrophoresis results, the single plants in F2 population are divided into the following three genotypes: 1) If the PCR amplification product of the sample to be tested is consistent with the band type of haploid inducer line 2121-8, that is, the PCR amplification product only contains a fragment with a size of 250bp, then the genotype is BB genotype; 2) If the PCR amplification product of the sample to be tested is consistent with the band type of haploid inducer line CHOI4, that is, the PCR amplification product only contains a fragment with a size of 217bp, then the genotype is bb genotype; 3) If the PCR amplification product of the sample to be tested appears a heterozygous band type, that is, the PCR amplification product contains fragments with sizes of 250bp and 217bp, then the genotype is Bb genotype.
[0056] The genotype and phenotype identification results are shown in Table 1.
[0057] 3, Phenotype identification Self-cross the cross single plant with heterozygous genotype Bb to obtain self-crossing ear.
[0058] 1) Harvest and dry the ear, then separate the ear individually, soak for 60 minutes, peel the seed coat, take out the embryo one by one, and then put them into 2ml centrifuge tubes after uniform weighing.
[0059] 2) Cut a very small part of the embryo in a deep well tube for extracting DNA to identify the grain genotype 3) Quantitatively add 100 uL of 75% alcohol and a slightly large steel ball into the 2ml centrifuge tube, and grind the sample for 2 minutes by using a sample grinder to obtain homogenate.
[0060] 4) Quantitatively add 1.5mL of 75% alcohol and mix well, stand for 20 minutes, and shake 1-2 times during the period.
[0061] 5) Centrifuge at 12000rpm for 5 minutes.
[0062] 6) Take 1 mL supernatant in a cuvette.
[0063] 7) Measure the absorbance A at 530 nm with a spectrophotometer. The ratio of absorbance to embryo weight (absorbance / weight (AU / g)) is the final corrected phenotype data. The specific results are shown in Table 1, and the statistical results are shown in Table 4.
[0064] Table 4, genotype and absorbance / weight phenotype correlation analysis in CHOI4x2121-8 F2 population
[0065] As shown in Table 4, the average absorbance / weight of the test corn sample with BB genotype is significantly higher than that of the test corn sample with bb genotype. If the amplified band type is consistent with the haploid inducer line 2121-8 (i.e., BB genotype), the corresponding single plant is identified as a candidate haploid inducer line with enhanced embryo color development.
[0066] Example 2, identification and application of molecular markers in F 2:3 population 1, DNA extraction from test plants The F2 progeny population in Table 1 is selfed to obtain the F3 progeny population, and the specific information is shown in Table 5.
[0067] The method provided by Murray and Thompson (1980) is used to extract genomic DNA from the embryo of the test single plant.
[0068] Table 5, genotype type and absorbance / weight phenotype results in F 2:3 population
[0069] 2, genotype identification The genomic DNA of the test single plant is used as a template, and the above primer pair F / R is used for PCR amplification to obtain the PCR amplification product. The PCR amplification system and amplification program are the same as in Example 1. A 3.0% agarose gel is prepared and then subjected to electrophoresis detection to verify the PCR amplification product. During electrophoresis, a voltage of 170 V is used, and the electrophoresis time is 20 minutes.
[0070] F 2:3 population, and the electrophoresis results are shown in Figure 2The results are shown in Figure 2 (lane 2 is 2121-8, lane 1 is hybrid band, and lane 3 is CHOI4). Based on the banding pattern of electrophoresis results, F 2:3 The single strains in the population were divided into three genotypes, as shown in Table 5.
[0071] If the amplified banding pattern is consistent with the haploid inducer line 2121-8, the corresponding single strain is identified as a candidate embryo color-enhancing haploid inducer line.
[0072] III. Phenotype identification The hybrid genotype of the cross single strain was selfed to obtain selfed ear. The specific steps are the same as the phenotype identification in step three in Example 1, and the specific phenotype results are shown in Table 5.
[0073] The ratio of absorbance value to embryo weight was used as the final corrected phenotype data, and the statistical results are shown in Table 6.
[0074] Table 6, Genotype and absorbance / weight phenotype correlation analysis in CHOI4 x 2121-8 F3 population
[0075] The above describes the present application in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.
Claims
1. The application of InDel molecular labeling or detection of substances labeled with InDel molecular markers, characterized in that, The InDel molecular marker is a double-stranded DNA molecule whose nucleotide sequence is from position 139 to 172 of SEQ ID No:4; the application is any of the following: (1) Identification or auxiliary identification of maize embryo color enhancement haploid inducible lines; (2) Screening or breeding of embryo chromogenic haploid induction lines; (3) Maize breeding; (4) Prepare products for identification or auxiliary identification of maize embryo color enhancement haploid inducible lines; (5) Prepare screening or breeding of maize embryo color enhancement haploid inducible lines.
2. The application according to claim 1, characterized in that, The substance contains PCR primers for amplifying maize genomic DNA fragments including the InDel molecular marker.
3. The application according to claim 2, characterized in that, The PCR primers are primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds upstream of the InDel molecular marker in maize genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds downstream of the InDel molecular marker in maize genomic DNA.
4. The application according to claim 3, characterized in that, The forward primer sequence is SEQ ID No:1, and the reverse primer sequence is SEQ ID No:
2.
5. A method for breeding maize, characterized in that, The method involves selecting maize genomic DNA from which the amplification product obtained by amplification using the primer pair described in claim 3 or 4 has a nucleotide sequence of SEQ ID No:4 as a parent for breeding. The purpose of the breeding is to select maize varieties with enhanced embryo chromatographic haploid inducible lines.
6. A method for identifying or assisting in the identification of maize embryo color-enhancing haploid inducible lines, characterized in that, The genotype of molecular markers in the genome of the maize to be identified is detected, and the genotype is used to determine whether the maize to be tested is a maize embryo chromogenic enhanced haploid inducible line: The genotypes are bb, BB, and Bb. 1) If the PCR amplification product of the sample to be tested contains only the DNA fragment with the nucleotide sequence SEQ ID No:4, then the genotype is BB genotype; 2) If the PCR amplification product of the sample to be tested contains only the DNA fragment with the nucleotide sequence SEQ ID No:3, then the genotype is bb genotype; 3) If the PCR amplification product of the sample to be tested shows a heterozygous band, that is, the PCR amplification product contains both SEQ ID No:4 and SEQ ID No:3, then the genotype is Bb genotype; The BB genotype maize embryos showed stronger color development than the bb genotype maize.
7. The product, characterized in that: The product contains the substance for detecting the InDel molecular marker as described in claim 1, and the product is any one of the following: C1) Products that detect molecular marker polymorphisms or genotypes associated with maize embryo colorimetric enhancement haploid inducible lines; C2) Products for identification or auxiliary identification of corn embryo color enhancement haploid inducible lines; C3) Products used in maize breeding.
8. The product according to claim 7, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying maize genomic DNA fragments including the molecular marker; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
9. The product according to claim 7 or 8, characterized in that: The substance is a primer composition consisting of SEQ ID No:1 and SEQ ID No:
2.
10. The InDel molecular marker as described in claim 1.