Anti-CD27 and anti-PD-L1 antibodies and bispecific constructs

Abstract

The present invention provides novel anti-CD27 and anti-PD-L1 antibodies, and binding domains thereof, as well as bispecific constructs and anti-CD27 binding domains linked to anti-PD-L1 binding domains. The present invention also provides methods of stimulating T cell activity, methods of inducing or enhancing an immune response, and methods of treating a disease or condition (e.g., cancer) by administering to a patient in need thereof a bispecific construct, antibody, or antigen-binding fragment thereof described herein, or a composition described herein.

Description

[0001] Related Applications

[0002] This application claims the priority benefit of U.S. Provisional Application No. 62 / 658,899, filed Apr. 17, 2018, and U.S. Provisional Application No. 62 / 826,091, filed Mar. 29, 2019. The content of the foregoing applications is hereby incorporated by reference in its entirety.

[0003] I. BACKGROUND OF THE INVENTION

[0004] Interactions between T cells and antigen-presenting cells involve multiple accessory molecules that contribute to the generation of an immune response. One such molecule is CD27, which binds CD70 and belongs to the tumor necrosis factor receptor (TNF-R) superfamily (Ranheim, E.A. et al. (1995) Blood, 85(12):3556-65). CD27 normally exists as a glycosylated type I transmembrane protein, often in the form of a homodimer with a disulfide bond linking two monomers. The disulfide bond is in the extracellular domain near the membrane (Camerini et al. (1991) J. Immunol. 147:3165-69). CD27 can also be expressed in a soluble form (see, e.g., van Oers, M.H. et al. (1993) Blood 82(11):3430-6 and Loenen, W.A. et al. (1992) Eur. J. Immunol., 22:447). Crosslinking the CD27 antigen on T cells provides a co-stimulatory signal that, together with T cell receptor crosslinking, can induce T cell proliferation and cellular immune activation.

[0005] CD27 is expressed on mature thymocytes, most CD4+ and CD8+ peripheral blood T cells, natural killer cells, and B cells (Kobata, T. et al. (1995) Proc. Natl. Acad. Sci. USA, 92(24):11249-53). CD27 is also highly expressed on B cell non-Hodgkin's lymphomas and B cell chronic lymphocytic leukemia (Ranheim, E.A. et al. (1995) Blood, 85(12):3556-65). In addition, elevated levels of soluble CD27 protein have been identified in the serum or disease-active sites of parasitic infections, cytomegalovirus (CMV) infections, sarcoidosis, multiple sclerosis, and B cell chronic lymphocytic leukemia (Loenen, W.A. et al. (1992) Eur. J. Immunol, 22:447).

[0006] Programmed death ligand 1 (PD-L1) is a 40 kDa type I transmembrane protein that is hypothesized to play an important role in suppressing the immune system in specific events such as pregnancy, tissue allotransplantation, autoimmune diseases, and other disease states such as hepatitis. Generally, the immune system responds to foreign antigens associated with exogenous or endogenous danger signals, triggering the proliferation of antigen-specific CD8+ T cells and / or CD4+ helper cells. The binding of PD-L1 to PD-1 transmits an inhibitory signal that reduces the proliferation of these T cells and can also induce apoptosis, which is mediated by the downregulation of the gene Bcl-2. PD-L1 is abundant in a variety of human cancers (Dong et al. (2002) Nat. Med. 8:787-9). The interaction between PD-1 and PD-L1 results in a reduction in tumor-infiltrating lymphocytes, a reduction in T cell receptor-mediated proliferation, and immune escape of cancerous cells (Dong et al. (2003) J. Mol. Med. 81:281-7; Blank et al. (2005) Cancer Immunol. Immunother. 54:307-314; Konishi et al. (2004) Clin. Cancer Res. 10:5094-100). Immune suppression can be reversed by inhibiting the local interaction of PD-1 with PD-L1, and this effect is additive when the interaction of PD-1 with PD-L2 is also blocked (Iwai et al. (2002) Proc. Nat’l. Acad. Sci. USA 99:12293-7; Brown et al. (2003) J. Immunol. 170:1257-66).

[0007] Despite the progress of multimodal therapy, there is still a need in the art for new and improved therapeutic agents for treating conditions or diseases (e.g., where stimulation of an immune response is desired). Accordingly, one object of the present invention is to provide an improved method for treating a subject suffering from such a condition or disease (e.g., cancer).

[0008] II. SUMMARY OF THE INVENTION

[0009] The present disclosure provides novel anti-CD27 and anti-PD-L1 antibodies and their binding domains, as well as bispecific constructs and multispecific constructs comprising an anti-CD27 binding domain linked to an anti-PD-L1 binding domain. The present disclosure also provides methods for stimulating T cell activity, inducing or enhancing an immune response, and treating a disease or condition (e.g., cancer) by administering to a patient in need thereof a bispecific or multispecific construct, an antibody, or an antigen-binding fragment thereof, or a composition described herein.

[0010] An exemplary anti-CD27 antibody is antibody 3C2 as described herein. In one embodiment, the anti-CD27 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 3C2. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 3C2 having the sequence shown in SEQ ID NO: 17, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 3C2 having the sequence shown in SEQ ID NO: 18. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 17. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 18. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 17 and 18, respectively.

[0011] Another exemplary anti-CD27 antibody is antibody 2B3 described herein. In one embodiment, the anti-CD27 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 2B3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 2B3 having the sequence shown in SEQ ID NO: 19, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 2B3 having the sequence shown in SEQ ID NO: 20. In another embodiment, the antibody or its binding domain comprises heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 19. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 20. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 19 and SEQ ID NO: 20, respectively.

[0012] An exemplary anti-PD-L1 antibody is antibody 7H7 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 7H7. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 7H7 having the sequence shown in SEQ ID NO: 77, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 7H7 having the sequence shown in SEQ ID NO: 78. In another embodiment, the antibody or its binding domain comprises heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 29, 30, and 31, respectively, or conservative sequence modifications thereof, and light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 32, 33, and 34, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 77. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 77. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 77 and 78, respectively.

[0013] Another exemplary anti-PD-L1 antibody is antibody 1B3 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 1B3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 1B3 having the sequence shown in SEQ ID NO: 79, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 1B3 having the sequence shown in SEQ ID NO: 80. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 35, 36, and 37, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 38, 39, and 40, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 79. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 80. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 79 and SEQ ID NO: 80, respectively.

[0014] Another exemplary anti-PD-L1 antibody is antibody 3B6 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 3B6. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 3B6 having the sequence shown in SEQ ID NO: 81, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 3B6 having the sequence shown in SEQ ID NO: 82. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 41, 42, and 43, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 44, 45, and 46, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 81. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 82. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 81 and 82, respectively.

[0015] Another exemplary anti-PD-L1 antibody is antibody 8B1 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 8B1. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 8B1 having the sequence shown in SEQ ID NO: 83, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 8B1 having the sequence shown in SEQ ID NO: 84. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 47, 48, and 49, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 50, 51, and 52, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises the heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 83. In another embodiment, the antibody or its binding domain comprises the light chain variable region having the amino acid sequence shown in SEQ ID NO: 84. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively.

[0016] Another exemplary anti-PD-L1 antibody is antibody 4A3 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 4A3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 4A3 having the sequence shown in SEQ ID NO: 85, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 4A3 having the sequence shown in SEQ ID NO: 86. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 53, 54, and 55, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 56, 57, and 58, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 85. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 86. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 85 and 86, respectively.

[0017] Another exemplary anti-PD-L1 antibody is antibody 9H9 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 9H9. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 9H9 having the sequence shown in SEQ ID NO: 87, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 9H9 having the sequence shown in SEQ ID NO: 88. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 59, 60, and 61, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 62, 63, and 64, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 87. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 88. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 87 and 88, respectively.

[0018] In one embodiment, the CDR1, 2, and / or 3 regions of the anti-C27 or anti-PD-L1 binding domain described herein may comprise the exact amino acid sequences identical to those of antibodies 3C2, 2B3, 7H7, 1B3, 3B6, 8B1, 4A3, and 9H9 as disclosed herein. In another embodiment, the antibody comprises derivatives of the exact CDR sequences from 3C2, 2B3, 7H7, 1B3, 3B6, 8B1, 4A3, and 9H9, but still retains the ability to bind CD27 or PD-L1 effectively. Such sequence modifications may include one or more (e.g., 1, 2, 3, 4, 5, or 6) amino acid additions, deletions, or substitutions, e.g., conservative sequence modifications.

[0019] In another embodiment, the anti-C27 or anti-PD-L1 binding domain described herein may consist of one or more CDRs that are, for example, 90%, 95%, 98%, or 99.5% identical to one or more CDRs of antibodies 3C2, 2B3, 7H7, 1B3, 3B6, 8B1, 4A3, and 9H9. Ranges intermediate the above values, e.g., CDRs having 90-95%, 95-98%, or 98-100% identity characteristics to one or more of the foregoing sequences, are also intended to be encompassed by the present invention.

[0020] The antibody sequence can also be a consensus sequence of several antibodies. For example, in one embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR1 containing an amino acid sequence selected from the consensus sequence: (T, S)(S, Y, H)WMS (SEQ ID NO: 167). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR2 containing SEQ ID NO: 168. In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR3 containing SEQ ID NO: 169. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR1 containing SEQ ID NO: 170. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR2 containing SEQ ID NO: 171. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR3 containing SEQ ID NO: 172.

[0021] Sequences that are substantially identical to the anti-C27 and / or anti-PD-L1 binding domains described herein (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the foregoing sequences) are also encompassed by the present invention. In one embodiment, the anti-CD27 binding domain comprises a heavy chain variable region containing SEQ ID NO: 17, SEQ ID NO: 19, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a light chain variable region containing SEQ ID NO: 18, SEQ ID NO: 20, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18 or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20 or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the foregoing sequences).

[0022] In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising a sequence having SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region comprising a sequence having SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 77 and a light chain variable region comprising SEQ ID NO: 78, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 79 and a light chain variable region comprising SEQ ID NO: 80, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 81 and a light chain variable region comprising SEQ ID NO: 82, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences).In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).

[0023] Anti-CD27 and / or anti-PD-L1 antibodies or binding domains thereof that compete for binding with any antibody or binding domain thereof described herein or bind the same epitope as any antibody or binding domain thereof described herein are also suitable for use and are encompassed by the present invention. For example, in one embodiment, the anti-CD27 antibody or binding domain thereof competes for binding to CD27 with antibody 3C2 and / or antibody 2B3, as described herein. For example, as described in Example 28, an antibody of the present invention (e.g., antibody 2B3) binds to one or more residues within amino acids 80-95 of the ECD of human CD27 (SEQ ID NO: 183), e.g., one or more residues within amino acids 85-89, e.g., amino acids 85, 87, 88, and / or 89 of the ECD of human CD27 (SEQ ID NO: 183).

[0024] In another embodiment, the antibody binds to the wild-type ECD of human CD27 but does not bind to a mutant form of the ECD having an amino acid substitution at one or more positions within amino acid residues 85-89 of the ECD of human CD27 (SEQ ID NO: 183) (e.g., A85S, R87A, N88A, and / or G89A). For example, the anti-CD27 antibody or antigen-binding fragment thereof binds to the wild-type ECD of human CD27 (SEQ ID NO: 183) but does not bind to a mutant form of the wild-type ECD of human CD27 having the following amino acid substitutions: the mutant form with A85S, R87A, N88A, and G89A.

[0025] In another embodiment, the anti-CD27 antibody or binding domain binds to the same epitope on CD27 as antibody 3C2 and / or antibody 2B3 described herein. In another embodiment, the antibody or anti-PD-L1 binding domain competes with antibodies 7H7, 1B3, 3B6, 8B1, 4A3, and / or 9H9 for binding to PD-L1, as described herein. In another embodiment, the anti-PD-L1 antibody or binding domain binds to the same epitope on PD-L1 as antibodies 7H7, 1B3, 3B6, 8B1, 4A3, and / or 9H9, as described herein.

[0026] In one aspect, provided is a bispecific construct (or multispecific construct) comprising an anti-CD27 binding domain linked to an anti-PD-L1 binding domain, wherein:

[0027] (i) The anti-CD27 binding domain comprises:

[0028] a. Heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, or

[0029] b. Heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof; and

[0030] (ii) The anti-PD-L1 binding domain comprises:

[0031] a. Heavy chain variable region CDR1 containing an amino acid sequence selected from the consensus sequence: (T, S)(S, Y, H)WMS (SEQ ID NO: 167);

[0032] b. Heavy chain variable region CDR2 containing SEQ ID NO: 168;

[0033] c. Heavy chain variable region CDR3 containing SEQ ID NO: 169;

[0034] d. Light chain variable region CDR1 containing SEQ ID NO: 170;

[0035] e. Light chain variable region CDR2 containing SEQ ID NO: 171; and

[0036] f. Light chain variable region CDR3 containing SEQ ID NO: 172.

[0037] In another embodiment, the bispecific construct comprises an anti-CD27 binding domain linked to an anti-PD-L1 binding domain, wherein:

[0038] (i) The anti-CD27 binding domain comprises:

[0039] a. Heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, or

[0040] b. Heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof; and

[0041] (ii) The anti-PD-L1 binding domain comprises:

[0042] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78 or a sequence having at least 95% identity thereto;

[0043] b. A heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80 or a sequence having at least 95% identity thereto;

[0044] c. A heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82 or a sequence having at least 95% identity thereto;

[0045] d. A heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84 or a sequence having at least 95% identity thereto;

[0046] e. A heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86 or a sequence having at least 95% identity thereto; or

[0047] f. A heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88 or a sequence having at least 95% identity thereto.

[0048] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 32, 33, and 34, respectively.

[0049] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78.

[0050] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 of the heavy chain shown as SEQ ID NO: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR shown as SEQ ID NO: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 shown as SEQ ID NO: 38, 39, and 40, respectively.

[0051] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80.

[0052] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 44, 45, and 46, respectively.

[0053] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region having SEQ ID NO: 17 and a light chain variable region having SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region having SEQ ID NO: 81 and a light chain variable region having SEQ ID NO: 82.

[0054] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively, or conservative sequence modifications thereof.

[0055] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region having SEQ ID NO: 17 and a light chain variable region having SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region having SEQ ID NO: 83 and a light chain variable region having SEQ ID NO: 84.

[0056] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 53, 54, and 55, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 56, 57, and 58, respectively, or conservative sequence modifications thereof.

[0057] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86.

[0058] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof, and an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 59, 60, and 61, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 62, 63, and 64, respectively, or conservative sequence modifications thereof.

[0059] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88.

[0060] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 29, 30, and 31, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 32, 33, and 34, respectively, or conservative sequence modifications thereof.

[0061] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78.

[0062] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 35, 36, and 37, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 38, 39, and 40, respectively, or conservative sequence modifications thereof.

[0063] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80.

[0064] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 41, 42, and 43, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 44, 45, and 46, respectively, or conservative sequence modifications thereof.

[0065] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82.

[0066] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively, or conservative sequence modifications thereof.

[0067] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84.

[0068] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 53, 54, and 55, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 56, 57, and 58, respectively, or conservative sequence modifications thereof.

[0069] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86.

[0070] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 59, 60, and 61, respectively, or conservative sequence modifications thereof, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 62, 63, and 64, respectively, or conservative sequence modifications thereof.

[0071] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88.

[0072] In one embodiment, the anti-PD-L1 binding domain and the anti-CD27 binding domain are genetically fused. The bispecific construct can be, for example, a fusion protein, which can be prepared by genetic engineering using standard recombinant DNA techniques to operably link nucleic acids encoding the anti-CD27 and anti-PD-L1 binding domains. In another embodiment, the anti-PD-L1 binding domain and the anti-CD27 binding domain are chemically conjugated.

[0073] For example, the bispecific construct can be a chemical conjugate, which can be prepared by chemical conjugation of the anti-CD27 and anti-PD-L1 binding domains. In one embodiment, the anti-PD-L1 binding domain further comprises a human IgG1 constant domain. In another embodiment, the anti-CD27 binding domain is linked to the C-terminus of the heavy chain of the anti-PD-L1 binding domain. In another embodiment, the anti-CD27 binding domain is a scFv.

[0074] In another embodiment, the anti-CD27 binding domain further comprises a human IgG1 constant domain. In another embodiment, the anti-PD-L1 binding domain is linked to the C-terminus of the heavy chain of the anti-CD27 binding domain. In another embodiment, the anti-PD-L1 binding domain is a scFv.

[0075] In a specific embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0076] (i) the anti-CD27 scFv comprises:

[0077] a. CDR1, CDR2, and CDR3 of the heavy chain variable region as shown in SEQ ID NO: 1, 2, and 3, respectively, and CDR1, CDR2, and CDR3 of the light chain variable region as shown in SEQ ID NO: 4, 5, and 6, respectively, or

[0078] b. CDR1, CDR2, and CDR3 of the heavy chain variable region as shown in SEQ ID NO: 7, 8, and 9, respectively, and CDR1, CDR2, and CDR3 of the light chain variable region as shown in SEQ ID NO: 10, 11, and 12, respectively; and

[0079] (ii) the anti-PD-L1 antibody comprises:

[0080] a. CDR1, CDR2, and CDR3 of the heavy chain variable region as shown in SEQ ID NO: 29, 30, and 31, respectively, and CDR1, CDR2, and CDR3 of the light chain variable region as shown in SEQ ID NO: 32, 33, and 34, respectively;

[0081] b. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 35, 36, and 37 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 38, 39, and 40 respectively;

[0082] c. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 41, 42, and 43 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 44, 45, and 46 respectively;

[0083] d. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 47, 48, and 49 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 50, 51, and 52 respectively;

[0084] e. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 53, 54, and 55 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 56, 57, and 58 respectively; or

[0085] f. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 59, 60, and 61 respectively, and the light chain variable region CDR1, CDR2, and CDR as shown in SEQ ID NO: 62, 63, and 64 respectively; and

[0086] g. Human IgG1 constant domain.

[0087] In another specific embodiment, the bispecific construct comprises an anti - CD27 antibody linked to an anti - PD - L1 scFv, wherein:

[0088] (i) The anti - CD27 antibody comprises:

[0089] a. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 1, 2, and 3 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 4, 5, and 6 respectively

[0090] b. The heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 7, 8, and 9 respectively, and the light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 10, 11, and 12 respectively; and

[0091] c. Human IgG1 constant domain; and

[0092] (ii) The anti-PD-L1 scFv comprises:

[0093] a. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 29, 30 and 31 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 32, 33 and 34 respectively;

[0094] b. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 35, 36 and 37 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 38, 39 and 40 respectively;

[0095] c. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 41, 42 and 43 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 44, 45 and 46 respectively;

[0096] d. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 47, 48 and 49 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 50, 51 and 52 respectively;

[0097] e. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 53, 54 and 55 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 56, 57 and 58 respectively; or

[0098] f. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 59, 60 and 61 respectively, and light chain variable region CDR1, CDR2 and CDR as shown in SEQ ID NO: 62, 63 and 64 respectively.

[0099] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0100] (i) The anti-CD27 scFv comprises:

[0101] a. A heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18; or

[0102] b. A heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0103] (ii) The anti-PD-L1 antibody comprises:

[0104] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78;

[0105] b. A heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80;

[0106] c. A heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82;

[0107] d. A heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84;

[0108] e. A heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86; or

[0109] f. A heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88; and

[0110] g. A human IgG1 constant domain.

[0111] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0112] (i) The anti-CD27 antibody comprises:

[0113] a. A heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18; or

[0114] b. A heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0115] c. A human IgG1 constant domain; and

[0116] (ii) The anti-PD-L1 scFv comprises:

[0117] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78;

[0118] b. having a heavy chain variable region of SEQ ID NO: 79 and a light chain variable region of SEQ ID NO: 80;

[0119] c. having a heavy chain variable region of SEQ ID NO: 81 and a light chain variable region of SEQ ID NO: 82;

[0120] d. having a heavy chain variable region of SEQ ID NO: 83 and a light chain variable region of SEQ ID NO: 84;

[0121] e. having a heavy chain variable region of SEQ ID NO: 85 and a light chain variable region of SEQ ID NO: 86; or

[0122] f. having a heavy chain variable region of SEQ ID NO: 87 and a light chain variable region of SEQ ID NO: 88.

[0123] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0124] (i) the anti-CD27 scFv comprises heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 7, 8 and 9 respectively and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 10, 11 and 12 respectively; and

[0125] (ii) the anti-PD-L1 antibody comprises heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 47, 48 and 49 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 50, 51 and 52 respectively, and a human IgG1 constant domain.

[0126] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0127] (i) the anti-CD27 antibody comprises heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 7, 8 and 9 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 10, 11 and 12 respectively, and a human IgG1 constant domain; and

[0128] (ii) The anti-PD-L1 scFv comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 47, 48, and 49, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 50, 51, and 52, respectively.

[0129] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0130] (i) The anti-CD27 scFv comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0131] (ii) The anti-PD-L1 antibody comprises a heavy chain variable region containing SEQ ID NO: 83, a light chain variable region containing SEQ ID NO: 84, and a human IgG1 constant domain.

[0132] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0133] (i) The anti-CD27 antibody comprises a heavy chain variable region containing SEQ ID NO: 19, a light chain variable region containing SEQ ID NO: 20, and a human IgG1 constant domain; and

[0134] (ii) The anti-PD-L1 scFv comprises a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84.

[0135] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0136] (i) The anti-CD27 scFv comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 7, 8, and 9, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 10, 11, and 12, respectively; and

[0137] (ii) The anti-PD-L1 antibody comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 59, 60, and 61, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 62, 63, and 64, respectively, and a human IgG1 constant domain.

[0138] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0139] (i) the anti-CD27 antibody comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, and a human IgG1 constant domain; and

[0140] (ii) the anti-PD-L1 scFv comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 62, 63, and 64, respectively.

[0141] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0142] (i) the anti-CD27 scFv comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0143] (ii) the anti-PD-L1 antibody comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88, and a human IgG1 constant domain.

[0144] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0145] (i) the anti-CD27 antibody comprises a heavy chain variable region containing SEQ ID NO: 19, a light chain variable region containing SEQ ID NO: 20, and a human IgG1 constant domain; and

[0146] (ii) the anti-PD-L1 scFv comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88.

[0147] In another embodiment, the bispecific construct has one or more of the following functional characteristics: inducing NF-κB activation, increasing T cell proliferation, inducing a CD8 T cell response, and / or increasing IL-2 production. In another embodiment, the bispecific construct increases IL-2 production by at least about 1.5-fold (e.g., at least 2-fold, 2.5-fold, 3-fold, 3.5-fold, or 4-fold) compared to an anti-CD27 monoclonal antibody or antibody or an anti-PD-L1 monoclonal antibody alone. In another embodiment, the bispecific construct induces a CD8 T cell response that is at least about 2-fold higher (e.g., at least 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8.0-fold, 8.5-fold, or 9-fold) compared to an anti-CD27 monoclonal antibody alone. In another embodiment, the bispecific construct increases survival time by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, or 5-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone. In another embodiment, the bispecific construct reduces tumor weight by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, or 5-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone or in combination with them. In another embodiment, the bispecific construct antibody increases T cell production by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8.0-fold, 8.5-fold, or 9-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone or in combination with them.

[0148] In certain embodiments, the bispecific constructs described herein exhibit a synergistic effect (e.g., in enhancing the in vivo immune response) compared to the combined use of an anti-CD27 binding domain and an anti-PD-L1 binding domain (i.e., co-administration of non-linked antibodies).

[0149] In another aspect, provided are novel anti-CD27 antibodies or antigen-binding portions thereof that comprise any of the anti-CD27 binding domains described herein. In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence).

[0150] In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20 or a sequence having at least 95% identity thereto.

[0151] In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof has one or more of the following functional characteristics: inducing or enhancing a T cell-mediated immune response, blocking the binding of sCD70 to CD27 (e.g., partially or completely), inducing NF-κB activation, increasing T cell proliferation, binding to human CD27 with an equilibrium dissociation constant Kd of 10 -9 M or lower or an equilibrium association constant Ka of 10 +9 M -1 or higher, inducing specific complement-mediated cytotoxicity (CDC) of cells expressing CD27, inducing specific lysis of antibody-dependent cell-mediated cytotoxicity (ADCC) of cells expressing CD27, inducing or enhancing an antigen-specific immune response in vivo in combination with a vaccine or an endogenous antigen, inducing or enhancing an antigen-specific TH1 immune response in vivo in combination with a vaccine or an endogenous antigen, inducing or enhancing antigen-specific T cell proliferation or activation in vivo in combination with a vaccine or an endogenous antibody; and / or inducing or enhancing T cell activity when combined with TCR activation simultaneously, separately, or sequentially.

[0152] In another aspect, a bispecific construct is provided, wherein the bispecific construct comprises any of the anti-CD27 antibodies described herein linked to an anti-PD-L1 binding domain. In one embodiment, the anti-PD-L1 binding domain is selected from the group consisting of:

[0153] a. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 32, 33, and 34, respectively;

[0154] b. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 38, 39, and 40, respectively;

[0155] c. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 44, 45, and 46, respectively;

[0156] d. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively;

[0157] e. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 53, 54, and 55, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 56, 57, and 58, respectively; and

[0158] f. An anti-PD-L1 antibody or an antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 62, 63, and 64, respectively.

[0159] In another embodiment, the anti-PD-L1 binding domain is selected from the group consisting of: (a) a heavy chain variable region comprising SEQ ID NO: 77 and a light chain variable region comprising SEQ ID NO: 78; and (b) a heavy chain variable region comprising SEQ ID NO: 79 and a light chain variable region comprising SEQ ID NO: 80; (c) a heavy chain variable region comprising SEQ ID NO: 81 and a light chain variable region comprising SEQ ID NO: 82; (d) a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84; (e) a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86; (f) a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88. In a specific embodiment, the anti-PD-L1 binding domain is a scFv.

[0160] In certain embodiments, the bispecific constructs described herein exhibit a synergistic effect (e.g., in enhancing an in vivo immune response) compared to the combined use of an anti-CD27 binding domain and an anti-PD-L1 binding domain (i.e., co-administration of unlinked antibodies).

[0161] In another aspect, novel anti-PD-L1 antibodies or antigen-binding portions thereof are provided, which comprise any of the anti-PD-L1 binding domains described herein. In one embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 32, 33, and 34, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 38, 39, and 40, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 44, 45, and 46, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively.In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequence). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 53, 54 and 55, respectively, and light chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 56, 57 and 58, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequence). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 59, 60 and 61, respectively, and light chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 62, 63 and 64, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequence).

[0162] In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof has one or more of the following functional characteristics: (a) blocks the binding of PD1 to PD-L1 (e.g., partially or completely), (b) induces NFAT pathway activation, and / or (c) induces a mixed lymphocyte reaction.

[0163] In another aspect, a bispecific construct is provided, wherein the bispecific construct comprises any of the anti-PD-L1 antibodies or antigen-binding fragments thereof described herein linked to an anti-CD27 binding domain. In one embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively. In another embodiment, the anti-CD27 binding domain comprises an antibody comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence). In another embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively. In another embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence). In one embodiment, the anti-CD27 binding domain further comprises a human IgG1 constant domain.

[0164] In certain embodiments, the bispecific constructs described herein exhibit a synergistic effect (e.g., in enhancing an immune response in vivo) as compared to the combined use of an anti-CD27 binding domain and an anti-PD-L1 binding domain (i.e., co-administration of unlinked antibodies).

[0165] In another aspect, compositions are provided that comprise any of the bispecific constructs (multispecific constructs), antibodies, or antigen-binding fragments thereof described herein, and a pharmaceutically acceptable carrier. Kits are also provided that comprise any of the bispecific constructs (multispecific constructs), antibodies, or antigen-binding fragments thereof described herein and instructions for use.

[0166] In another aspect, isolated nucleic acid molecules encoding the binding domains, antibodies or antigen-binding portions thereof, and bispecific or multispecific constructs described herein are also provided, as well as expression vectors comprising such nucleic acids and host cells comprising such expression vectors. In another embodiment, nucleic acid molecules encoding any of the binding domains, antibodies or antigen-binding portions thereof, or bispecific constructs described herein are provided. In another embodiment, the nucleic acid molecule is in the form of an expression vector. In another embodiment, the nucleic acid molecule is in the form of an expression vector that expresses a binding domain, antibody or antigen-binding portion thereof, or bispecific construct when administered in vivo to a subject.

[0167] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence encoding an antibody variable region, wherein the antibody variable region comprises the amino acid sequence depicted in SEQ ID NO: 17, 18, 19, 20, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or an amino acid sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to one or more of the foregoing sequences). In another embodiment, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 25, 26, 27, 28, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112 or a nucleotide sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to one or more of the foregoing sequences).

[0168] In another embodiment, the nucleic acid molecule comprises a nucleotide sequence encoding the heavy and light chain variable regions of an antibody, wherein the heavy and light chain variable regions respectively comprise the amino acid sequences depicted in SEQ ID NO: 17 and 18, SEQ ID NO: 19 and 20, SEQ ID NO: 77 and 78, SEQ ID NO: 79 and 80, SEQ ID NO: 81 and 82, SEQ ID NO: 83 and 84, SEQ ID NO: 85 and 86 or SEQ ID NO: 87 and 88, or an amino acid sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).

[0169] In another aspect, a method of stimulating T cell activity is provided, which comprises contacting a T cell with any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein. Stimulating T cell activity can include, for example, stimulating IFN-γ production.

[0170] In yet another aspect, a method for inducing or enhancing an immune response (e.g., against an antigen) in a subject is provided, which comprises administering to the subject an amount of any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein effective to induce or enhance the immune response of the subject (e.g., against an antigen).

[0171] In another aspect, a method for treating a condition or disease in a subject is provided, the method comprising administering to the subject an amount of any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein effective to treat the condition or disease.

[0172] In another aspect, a method for treating a condition or disease in a subject is provided, wherein the method comprises administering in combination to the subject any one of the anti-CD27 antibodies or antigen-binding fragments thereof described herein and any one of the anti-PD-L1 antibodies or antigen-binding fragments thereof described herein. For example, in one embodiment:

[0173] (i) The anti-CD27 antibody or antigen-binding fragment thereof is selected from the group consisting of: (a) an anti-CD27 antibody or antigen-binding fragment thereof comprising a heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 1, 2 and 3, respectively, and a light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 4, 5 and 6, respectively, and (b) an anti-CD27 antibody or antigen-binding fragment thereof comprising a heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 7, 8 and 9, respectively, and a light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 10, 11 and 12, respectively; and

[0174] (ii) The anti-PD-L1 antibody or its antigen-binding fragment is selected from the group consisting of: (a) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 29, 30, and 31, respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 32, 33, and 34, respectively; (b) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 35, 36, and 37, respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 38, 39, and 40, respectively; (c) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 41, 42, and 43, respectively, and the CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 44, 45, and 46, respectively; (d) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 47, 48, and 49, respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 50, 51, and 52, respectively; (e) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 53, 54, and 55, respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 56, 57, and 58, respectively; (f) an anti-PD-L1 antibody or its antigen-binding fragment comprising the heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 59, 60, and 61, respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NOs: 62, 63, and 64, respectively.)

[0175] In another embodiment,

[0176] (i) The anti-CD27 antibody or its antigen-binding fragment is selected from the group consisting of: (a) an anti-CD27 antibody or its antigen-binding fragment comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-CD27 antibody or its antigen-binding fragment comprising SEQ ID NO: 19 and a light chain variable region or sequence containing SEQ ID NO: 20; and

[0177] (ii) The anti-PD-L1 antibody or antigen-binding fragment thereof is selected from the group consisting of: (a) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78; (b) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80; (c) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82; (d) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84; (e) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86; and (f) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88.

[0178] In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered separately. In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered sequentially. For example, the anti-CD27 antibody or antigen-binding fragment thereof can be administered first, followed by (e.g., immediately followed by) the anti-PD-L1 antibody or antigen-binding fragment thereof, and vice versa. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered together. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered simultaneously. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered simultaneously in a single formulation. Alternatively, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are formulated for separate administration and are administered simultaneously or sequentially. Such simultaneous or sequential administration preferably results in the co-presence of the two antibodies in the treated patient.

[0179] In certain embodiments, the administration of any anti-CD27 antibody or antigen-binding fragment thereof described herein in combination with any anti-PD-L1 antibody or antigen-binding fragment thereof described herein results in a synergistic effect (e.g., in enhancing the in vivo immune response) as compared to the use of either antibody alone.

[0180] The subject can be, for example, a subject suffering from a condition or disease for which stimulation of an immune response is desired. In one embodiment, the condition or disease for which stimulation of an immune response is desired is cancer. A method of inducing or enhancing an immune response (e.g., against an antigen) in a subject can further comprise administering an antigen to the subject. Preferred antigens to be co-administered with the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein are tumor antigens. BRIEF DESCRIPTION OF THE DRAWINGS

[0181] Figure 1 A graph showing the binding of CD27 antibodies 2B3 and 3C2 to recombinant human CD27 as a function of antibody concentration.

[0182] Figure 2 A graph showing the binding of CD27 antibodies 2B3 and 3C2 to recombinant cynomolgus CD27.

[0183] Figure 3 A graph showing the high-level binding of CD27 antibodies 2B3 and 3C2 to Ramos cells expressing CD27 on their surface.

[0184] Figure 4 A graph showing the high-level binding of CD27 antibodies 2B3 and 3C2 to T cells.

[0185] Figure 5 A graph showing that antibodies 2B3 and 3C2 significantly block the binding of CD70 to CD27.

[0186] Figure 6 A graph showing significant NF-κB activation induced by antibodies 2B3 and 3C2 as a function of antibody concentration.

[0187] Figure 7 A graph showing that antibodies 2B3 and 3C2 increase T cell proliferation.

[0188] Figure 8 A graph showing the binding of an anti-PD-L1 antibody to human PD-L1 as a function of antibody concentration.

[0189] Figure 9 A graph showing the binding of an anti-PD-L1 antibody to recombinant cynomolgus PD-L1.

[0190] Figure 10 A graph showing that an anti-PD-L1 antibody significantly blocks the binding of PD-L1 to PD-1 as a function of antibody concentration.

[0191] Figure 11 A graph showing the high-level binding of an anti-PD-L1 antibody to cells expressing human PD-L1 as a function of antibody concentration.

[0192] Figure 12A graph showing high-level binding of an anti-PD-L1 antibody to human dendritic cells in the form of a function of antibody concentration.

[0193] Figure 13 A graph showing that blocking of the PD1 / PD-L1 interaction between cells by an anti-PD-L1 antibody results in activation of the NFAT pathway.

[0194] Figure 14 A graph showing that an anti-PD-L1 antibody induces a mixed lymphocyte reaction as a function of antibody concentration.

[0195] Figure 15A A representative DNA expression vector containing an anti-CD27 light chain, an anti-CD27 heavy chain, and a C-terminal anti-PD-L1 single-chain (VL+VH) peptide.

[0196] Figure 15B A graph of a CD27 / PD-L1 bispecific antibody protein in which the anti-PD-L1 antibody is linked to an anti-CD27 scFv.

[0197] Figure 15C A graph of a CD27 / PD-L1 bispecific antibody protein in which the anti-CD27 antibody is linked to an anti-PD-L1 scFv.

[0198] Figure 15D A table of representative anti-CD27 / anti-PD-L1 bispecific constructs.

[0199] Figure 15E Shows the characterization of the bispecific antibody CDX-527 by HPLC and gel electrophoresis.

[0200] Figure 16 A graph showing the binding of an anti-CD27 / anti-PD-L1 bispecific construct (BsAb) to CD27 and PD-L1 using a bifunctional ELISA.

[0201] Figure 17 A graph showing increased NFκB activation induced by an anti-CD27 / anti-PD-L1 bispecific construct compared to antibody 1F5 or 2B3 alone.

[0202] Figure 18 A graph showing that an anti-CD27 / anti-PD-L1 bispecific construct blocks the PD1 / PD-L1 interaction and induces NFAT pathway activation as a function of antibody concentration.

[0203] Figure 19 A graph showing increased IL-2 production / secretion by an anti-CD27 / anti-PD-L1 bispecific construct in a mixed lymphocyte reaction compared to antibody AbX (a known anti-PD-L1 monoclonal antibody), 8B1, or 9H9 alone.

[0204] Figure 20A and 20B is a graph showing that the anti-CD27 / anti-PD-L1 bispecific construct (e.g., CD27xAbX) induces a higher CD8 T cell response compared to the CD27 monoclonal antibody alone.

[0205] Figure 21 is a Kaplan-Meier curve showing the improved survival rate of mice treated with the bispecific construct (e.g., CD27xAbX) in a murine tumor model compared to the CD27 and PD-L1 antibodies alone or in combination.

[0206] Figure 22A is a graph showing the reduced tumor weight of mice treated with the bispecific construct (e.g., CD27xAbX) compared to the CD27 and PD-L1 antibodies alone or in combination. Figure 22B is a graph showing the increased percentage of CD8 T cells in mice treated with the bispecific construct (e.g., CD27xAbX) compared to the CD27 and PD-L1 antibodies alone or in combination. Figure 22C is a graph showing the increased percentage of CD4 T cells in mice treated with the bispecific construct (e.g., CD27xAbX) compared to the CD27 and PD-L1 antibodies alone or in combination. Figure 22D is a graph showing the increased activated CD8 T cells in mice treated with the bispecific construct (e.g., CD27xAbX) compared to the CD27 and PD-L1 antibodies alone or in combination.

[0207] Figure 23A and 23B is a graph showing that the anti-CD27 Ab (e.g., CDX-1127) upregulates the PD-L1 expression in tumor cells and tumor infiltrating cells.

[0208] Figure 24 is a graph showing the binding of the anti-CD27 / anti-PD-L1 bispecific construct CDX-527 to CD27 and PD-L1 using a bifunctional ELISA.

[0209] Figure 25 is a graph showing the increased NFκB activation induced by the anti-CD27 / anti-PD-L1 bispecific construct CDX-527 compared to antibody 1F5 or 2B3 alone (left panel) and in the presence of soluble FcγR1 (right panel).

[0210] Figure 26It is a graph showing increased IL-2 production / secretion of the anti-CD27 / anti-PD-L1 bispecific construct CDX-527 in a mixed lymphocyte reaction compared to antibody 2B3 or 9H9 alone or in combination with them.

[0211] Figure 27 It is a graph showing increased IL-2 production / secretion of the anti-CD27 / anti-PD-L1 bispecific construct CDX-527 in T cells compared to the combination of antibodies 2B3 and 9H9.

[0212] Figure 28 It is a graph showing the serum levels of CDX-527 in an NHP pharmacokinetic study.

[0213] Figure 29 It is a graph showing increased PD-1 signaling of the 9H9x2B3 configuration compared to the 2B3x9H9 configuration.

[0214] Figure 30 It is a graph showing increased T cell activation of the 9H9x2B3 configuration compared to the 2B3x9H9 configuration.

[0215] Figure 31 It is a graph showing increased stimulation of vaccine-induced CD8+ T cell responses by AbXx2B3 compared to 2B3xAbX.

[0216] Figure 32 It is a graph showing increased anti-tumor activity of AbXx2B3 compared to 2B3xAbX.

[0217] Figure 33 It is a graph showing blockade of the binding of PD-L1 to CD80 by the anti-PD-L1 antibody AbX and 9H9.

[0218] Figure 34 Shows the sequence of the extracellular domain (ECD) of wild-type huCD27 and a mutant form with substitutions at positions 85, 87, 88, and 89.

[0219] Figure 35 It is a graph showing the binding of the anti-CD27 antibody 2B3 to wild-type huCD27 and mutant huCD27, the sequences of which are as Figure 34 shown.

[0220] Figure 36 It is a graph showing improved production (expression) of the modified 9H9x2B3 (DD) construct compared to the original (unmodified) 9H9x2B3 construct. DETAILED DESCRIPTION OF THE INVENTION

[0222] CD27 is an important co-stimulatory receptor and, using agonist molecules, it can be used for immunotherapy. CD27 plays a key role in a variety of immunological processes, including T cell survival, activation, and effector functions, as well as natural killer (NK) cell proliferation and cytotoxic activity. These events occur in response to the proper interaction of the ligand (CD70) with CD27, leading to intracellular signaling events that cause NF-kB activation and related gene expression. As with most co-stimulatory molecules, effective stimulation of T cells with a ligand or agonist antibody also requires simultaneous stimulation through the T cell receptor (TCR).

[0223] Most CD27 agonist molecules require multimerization or cross-linking to exert their activity. For example, anti-CD27 antibodies that act as agonists are cross-linked through their interaction with Fc receptors via cis or trans interactions through their Fc domains. In vitro, this can also be done artificially using a second anti-Ig antibody or by adsorbing the antibody to a solid-phase matrix. The requirement for FcR interaction by anti-CD27 agonist antibodies implies that the stimulatory activity of T cells depends at least in part on the number of cells expressing FcR.

[0224] To eliminate the requirement for FcR interaction, CD27 agonists have been developed that: 1) eliminate the need for interaction with receptors other than CD27 (referred to herein as CD27 super-crosslinkers), or 2) can provide cross-linking through the interaction of alternative receptors, which can be located on different cell types of different specificities that do not express FcR, and the alternative receptors can also provide additional functions (referred to herein as CD27 multispecific reagents).

[0225] In one aspect, the present invention provides bispecific constructs (or multispecific constructs) that comprise an anti-CD27 antibody or an antigen-binding fragment thereof linked to an anti-PD-L1 antibody or an antigen-binding fragment thereof. Such anti-CD27x anti-PD-L1 bispecific agents of the present invention have now been shown to exhibit a synergistic effect in vivo, such as in enhancing immune parameters and inhibiting tumor growth, as compared to the co-administration of an anti-CD27 antibody and an anti-PD-L1 antibody (see Examples 9 and 10).

[0226] To more readily understand the present invention, certain terms are first defined. Additional definitions are listed throughout the detailed description.

[0227] A. Definitions

[0228] As used herein, the term "subject" includes any human or non-human animal. For example, the methods and compositions of the present invention can be used to treat a subject suffering from an immune disorder. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0229] As used herein, the term "binding domain" refers to the portion of a protein or antibody that contains the amino acid residues that interact with an antigen. Binding domains include, but are not limited to, antibodies (e.g., full-length antibodies) and antigen-binding portions thereof. The binding domain confers upon the binder its specificity and affinity for the antigen. The term also encompasses any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin binding domain. Such proteins can be derived from natural sources or produced partially or wholly synthetically.

[0230] The term "antibody" as used herein includes intact antibodies and any antigen-binding fragment (i.e., "antigen-binding portion") thereof or single-chain forms thereof. In a preferred embodiment, an "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding portion thereof. Each heavy chain is composed of a heavy-chain variable region (abbreviated herein as V H ) and a heavy-chain constant region. The heavy-chain constant region is composed of three domains CH1, CH2, and CH3. Each light chain is composed of a light-chain variable region (abbreviated herein as V L ) and a light-chain constant region. The light-chain constant region is composed of one domain CL. V H and VL regions can be further subdivided into regions of high variability, called complementarity-determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). Unless otherwise specified, the CDRs identified herein are according to the Kabat system. Each V H and V L is composed of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with an antigen. The constant region of an antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1q).

[0231] As used herein, the term "antigen-binding fragment" of an antibody (or simply "antibody fragment") refers to one or more fragments or portions of an antibody that retain the ability to specifically bind an antigen (e.g., human CD27). Such "fragments" are, for example, from about 8 to about 1500 amino acids in length, suitably from about 8 to about 745 amino acids in length, suitably from about 8 to about 300, e.g., from about 8 to about 200 amino acids, or from about 10 to about 50 or 100 amino acids in length. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include: (i) Fab fragments, consisting of V L , VH , a monovalent fragment consisting of the CL and CH1 domains; (ii) an F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bond in the hinge region; (iii) an Fd fragment consisting of the V H and CH1 domains; (iv) an Fv fragment consisting of the V L and V H domains of a single arm of the antibody, (v) a dAb fragment consisting of the V H domain (Ward et al., (1989) Nature 341: 544-546); (vi) an isolated complementarity-determining region (CDR) or (vii) a combination of two or more isolated CDRs, which may optionally be linked by a synthetic linker. In addition, although the two domains of the Fv fragment, V L and V H , are encoded by separate genes, they can be joined together by a synthetic linker using recombinant methods, enabling them to be made into a single protein chain, in which the V L and V H regions pair to form a monovalent molecule (referred to as single-chain Fv (sFv); see, for example, Bird et al. (1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the utility of the fragments is screened in the same manner as for intact antibodies. The antigen-binding portion can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact immunoglobulins.

[0232] As used herein, the term "monoclonal antibody" refers to an antibody that exhibits a single binding specificity and affinity for a particular epitope. Thus, the term "human monoclonal antibody" refers to an antibody that exhibits a single binding specificity and has variable regions and optionally constant regions derived from human germline immunoglobulin sequences. In one embodiment, a human monoclonal antibody is produced by a hybridoma that includes B cells obtained from a transgenic non-human animal (e.g., a transgenic mouse) that has a genome containing a human heavy chain transgenic and a light chain transgenic, which are fused with an immortalized cell.

[0233] As used herein, the term "recombinant human antibody" includes all human antibodies prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from transgenic or transchromosomic animals (e.g., mice) carrying human immunoglobulin genes or from hybridomas made therefrom, (b) antibodies isolated from host cells transformed to express the antibody (e.g., from transfected myelomas), (c) antibodies isolated from recombinant combinatorial human antibody libraries, and (d) antibodies prepared, expressed, created or isolated by any other means involving splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies contain variable and constant regions that utilize specific human germline immunoglobulin sequences, encoded by germline genes, but including subsequent rearrangements and mutations that occur, for example, during antibody maturation. As is known in the art (see, e.g., Lonberg (2005) Nature Biotech. 23(9):1117-1125), the variable region contains the antigen-binding domain, which is encoded by multiple genes that rearrange to form an antibody specific for a foreign antigen. In addition to rearrangement, the variable region can be further modified by multiple single amino acid changes (termed somatic or hypermutation) to increase the affinity of the antibody for the foreign antigen. The constant region is altered (i.e., isotype switched) in further response to the antigen. Thus, in response to an antigen, the nucleic acid molecules encoding the rearranged and somatically mutated immunoglobulin polypeptides of the light and heavy chains may not have sequence identity with the original nucleic acid molecules, but will be substantially the same or similar (i.e., have at least 80% identity).

[0234] The term "human antibody" includes antibodies having variable and constant regions (if any) of human germline immunoglobulin sequences. The human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-directed mutagenesis in vitro or by somatic mutation in vivo) (see, Lonberg, N. et al. (1994) Nature 368(6474):856-859; Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13:65-93, and Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536-546). However, the term "human antibody" does not include antibodies in which CDR sequences from the germline of another mammalian species (e.g., mouse) are grafted onto human framework sequences (i.e., chimeric humanized antibodies).

[0235] As used herein, "isolated antibody" means an antibody that is substantially free of other antibodies having different antigen specificities (e.g., an isolated antibody that specifically binds human CD27 is substantially free of antibodies that specifically bind an antigen other than human CD27; an isolated antibody that specifically binds human PD-L1 is substantially free of antibodies that specifically bind an antigen other than human PD-L1). However, an isolated antibody that specifically binds an epitope may have cross-reactivity to the same antigen from different species. Additionally, an isolated antibody is generally substantially free of other cellular materials and / or chemicals.

[0236] The term "epitope" or "antigenic determinant" refers to the site on an antigen to which an immunoglobulin or antibody specifically binds. Epitopes can be formed by contiguous amino acids and by non-contiguous amino acids juxtaposed by protein tertiary folding. When exposed to a denaturing solvent, epitopes formed by contiguous amino acids generally remain, while epitopes formed by tertiary folding generally are lost upon treatment with a denaturing solvent. Epitopes generally comprise at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids that form a unique spatial conformation. Methods for determining which epitopes a given antibody binds (i.e., epitope mapping) are well known in the art and include, for example, immunoblotting and immunoprecipitation assays in which overlapping or contiguous peptides from an antigen (e.g., CD27 or PD-L1) are tested with a given antibody (e.g., an anti-CD27 or anti-PD-L1 antibody). Methods for determining the spatial conformation of an epitope include techniques known in the art and described herein, such as X-ray crystallography and two-dimensional nuclear magnetic resonance (see, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, volume 66, edited by G.E. Morris (1996)).

[0237] The term "antibody that binds the same epitope" as another antibody is intended to encompass an antibody that interacts (i.e., binds) with the same structural region on human CD27 as a reference anti-CD27 antibody. The "same epitope" to which an antibody binds can be a linear epitope or a conformational epitope formed by antigen tertiary folding.

[0238] The term "competitive antibody" refers to an antibody that competes with a reference anti-CD27 antibody for binding to human CD27, i.e., competitively inhibits the binding of the reference anti-CD27 antibody to CD27. A "competitive antibody" can bind to the same epitope on CD27 as the reference anti-CD27 antibody, can bind to an overlapping epitope, or can sterically hinder the binding of the reference anti-CD27 antibody to CD27.

[0239] Conventional techniques can be used to identify antibodies that recognize the same epitope or compete for binding. Such techniques include, for example, immunoassays that show the ability of one antibody to block the binding of another antibody to a target antigen, i.e., competitive binding assays. Competitive binding is determined in an assay where the immunoglobulin under test inhibits the specific binding of a reference antibody to a common antigen (e.g., CD27). Multiple types of competitive binding assays are known, such as: solid-phase direct or indirect radioimmunoassay (RIA), solid-phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay (see Stahli et al., Methods in Enzymology 9:242 (1983)); solid-phase direct biotin-avidin EIA (see Kirkland et al., J. Immunol. 137:3614 (1986)); solid-phase direct labeled assay, solid-phase direct labeled sandwich assay (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1988)); solid-phase direct labeled RIA using I-125 (see Morel et al., Mol. Immunol. 25(1):7 (1988)); solid-phase direct biotin-avidin EIA (Cheung et al., Virology 176:546 (1990)); and direct labeled RIA. (Moldenhauer et al., Scand. J. Immunol. 32:77 (1990)). Generally, such assays involve the use of a purified antigen that is bound to a solid surface or to a cell bearing either the unlabeled test immunoglobulin or the labeled reference immunoglobulin. In the presence of the test immunoglobulin, competitive inhibition is measured by determining the amount of label bound to the solid surface or cell. Generally, the test immunoglobulin is present in excess. Generally, when the competing antibody is present in excess, it inhibits the specific binding of the reference antibody to the common antigen by at least 50-55%, 55-60%, 60-65%, 65-70%, 70-75% or more.

[0240] Other techniques include, for example, epitope mapping methods such as X-ray analysis of crystals of antigen:antibody complexes, which provides atomic-level resolution of the epitope. Other methods monitor the binding of an antibody to antigen fragments or mutant variants of the antigen, where loss of binding due to modification of amino acid residues within the antigen sequence is generally considered an indication of epitope components. Additionally, computational combinatorial methods for epitope mapping can also be used. These methods rely on the ability of the antibody of interest to affinity isolate specific short peptides from a combinatorial phage display peptide library. This peptide is then considered a lead defining the epitope that corresponds to the antibody used for screening the peptide library. Computational algorithms have also been developed for epitope mapping and have been shown to map conformationally discontinuous epitopes.

[0241] As used herein, the terms "specifically bind", "selectively bind", "selectively binds" and "specifically binds" refer to an antibody that binds to an epitope on a predetermined antigen. Generally, when determined by surface plasmon resonance (SPR) in a BIACORE 2000 instrument (e.g., using recombinant human CD27 as the analyte and the antibody as the ligand), the antibody binds with an equilibrium dissociation constant (KD) of about less than 10 -7 M, e.g., about less than 10 -8 M, 10 -9 M or 10 -10 M or even lower, and binds to the predetermined antigen with an affinity that is at least two-fold greater than its binding to a non-specific antigen (e.g., BSA, casein) (other than the predetermined antigen or a closely related antigen). The phrases "antibody that recognizes an antigen" and "antibody specific for an antigen" are used interchangeably herein with the term "antibody that specifically binds an antigen".

[0242] As used herein, the term "this D " is intended to refer to the dissociation equilibrium constant of a particular antibody-antigen interaction. Generally, when determined by surface plasmon resonance (SPR) technology in a BIACORE 2000 instrument (e.g., using recombinant human CD27 as the analyte and the antibody as the ligand), the human antibodies of the present invention bind to CD27 with a dissociation equilibrium constant (K -8 M or less, e.g., less than 10 -9 M or 10 -10 M or even less D ).

[0243] As used herein, the term "this

[0244] " is intended to refer to the dissociation rate constant at which an antibody dissociates from an antibody / antigen complex.

[0245] As used herein, the term "this

[0246] " is intended to refer to the association rate constant at which an antibody associates with an antigen.

[0247] As used herein, the terms "inhibit" or "block" (e.g., referring to inhibiting / blocking the binding of CD70 to CD27 and / or the binding of PD1 to PD-L1) are used interchangeably and encompass both partial and complete inhibition / blockade. Inhibition / blockade preferably reduces or alters the normal activity level or type that occurs when the binding takes place without inhibition or blockade. Inhibition and blockade also are intended to include any measurable decrease in the binding affinity of CD70 when contacted with an anti-CD27 antibody as compared to CD70 not contacted with the anti-CD27 antibody, e.g., inhibiting the binding of CD70 by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. In one embodiment, the anti-CD27 antibody inhibits the binding of CD70 by at least about 70%. In another embodiment, the anti-CD27 antibody inhibits the binding of CD70 by at least 80%. Inhibition and blockade also are intended to include any measurable decrease in the binding affinity of PD1 when contacted with an anti-PD-L1 antibody as compared to PD1 not contacted with the anti-PD-L1 antibody, e.g., inhibiting the binding of PD1 by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. In one embodiment, the anti-PD-L1 antibody inhibits the binding of PD1 by at least about 70%. In another embodiment, the anti-PD-L1 antibody inhibits the binding of PD1 by at least 80%.

[0248] As used herein, the term "cross-react" refers to the ability of the anti-CD27 binding domain or anti-PD-L1 binding domain of the invention to bind CD27 or PD-L1, respectively, from different species. For example, the CD27 binding domain of the invention that binds human CD27 also may bind CD27 of another species. Similarly, the anti-PD-L1 binding domain of the invention that binds human PD-L1 also may bind PD-L1 of another species. As used herein, cross-reactivity is measured by detecting specific reactivity with a purified antigen or binding to cells physiologically expressing CD27 or functional interaction in a binding assay (e.g., SPR, ELISA). Methods for determining cross-reactivity include the standard binding assays described herein, e.g., using a Biacore TM 2000 SPR instrument (Biacore AB, Uppsala, Sweden) by Biacore TM surface plasmon resonance (SPR) analysis or flow cytometry techniques.

[0249] As used herein, the term "naturally occurring" when used in reference to an entity means the fact that the entity can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in a living organism (including a virus), can be isolated from a natural source, and has not been deliberately modified by a human in the laboratory is naturally occurring.

[0250] The invention also encompasses "conservative sequence modifications" of any of the sequences shown in SEQ ID NOs: 1-160, i.e., nucleotide and amino acid sequence modifications that do not eliminate the binding of the VH and VL sequences encoded by the nucleotide sequence or comprising the amino acid sequence to an antigen. Such conservative sequence modifications include conservative nucleotide and amino acid substitutions, as well as nucleotide and amino acid additions and deletions. For example, modifications can be introduced into SEQ ID NOs: 1-160 by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include amino acid substitutions in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are well defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids having nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids having β-branched side chains (e.g., threonine, valine, isoleucine) and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted non-essential amino acid residue in an anti-CD27 antibody is preferably replaced with another amino acid residue from the same side chain family. Methods for identifying conservative substitutions of nucleotides and amino acids that do not eliminate antigen binding are well known in the art (see, e.g., Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al., Protein Eng. 12(10):879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. USA 94:412-417 (1997)).

[0251] In certain embodiments, conservative amino acid sequence modifications refer to up to 1, 2, 3, 4, or 5 conservative amino acid substitutions in the CDR sequences described herein. For example, each such CDR can contain up to 5 conservative amino acid substitutions, e.g., up to (i.e., not exceeding) 4 conservative amino acid substitutions, e.g., up to (i.e., not exceeding) 3 conservative amino acid substitutions, e.g., up to (i.e., not exceeding) 2 conservative amino acid substitutions, or not exceeding 1 conservative amino acid substitution.

[0252] Alternatively, in another embodiment, mutations can be randomly introduced, such as by saturation mutagenesis, along all or part of the anti-CD27 or anti-PD-L1 binding domain coding sequence, and the resulting modified anti-CD27 or anti-PD-L1 antibody can be screened for binding activity.

[0253] For nucleic acids, the term "substantially homologous" means that when optimally aligned and compared, two nucleic acids or their designated sequences are identical for at least about 80% of the nucleotides, usually at least about 90% to 95%, more preferably at least about 98% to 99.5% of the nucleotides, with appropriate nucleotide insertions or deletions. Alternatively, substantial homology exists when the fragment will hybridize to a complementary strand under selective hybridization conditions.

[0254] For amino acids, the term "substantially homologous" means that when optimally aligned and compared, two amino acid sequences or their designated sequences are identical for at least about 80% of the amino acids, usually at least about 90% to 95%, more preferably at least about 98% to 99% or 99.5% of the amino acids, with appropriate amino acid insertions or deletions.

[0255] Taking into account the number of gaps and the length of each gap, the percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions x 100), which is introduced to achieve the optimal alignment of the two sequences. The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using mathematical algorithms, as described in the following non-limiting examples.

[0256] The percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http: / / www.gcg.com), using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4: 11-17 (1989)) incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0257] The nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to search against public databases to, for example, identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215: 403-10. The BLAST nucleotide search can be performed using the NBLAST program (score = 100, wordlength = 12) to obtain nucleotide sequences identical to the nucleic acid molecules of the present invention. The BLAST protein search can be performed using the XBLAST program (score = 50, wordlength = 3) to obtain amino acid sequences identical to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402 can be used. When using the BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov.

[0258] B. Anti-CD27 Antibodies and Their Binding Domains

[0259] The present invention provides novel anti-CD27 antibodies and their binding domains. The term "novel domain" (also referred to as "domain molecule", "domain receptor", "novel receptor", "somatic cell activation antigen CD27", "CD27 antigen novel antibody", "CD27 antigen novel antibody i", "tumor necrosis factor receptor superfamily, member 7", "tumor necrosis cell activation antigen S152 antibody", "S152 antigen", "tumor necrosis factor receptor superfamily member 7", "tumor necrosis factor antigen", and "somatic cell activation antigen CD27") refers to a receptor that is a member of the TNF receptor superfamily and binds to the ligand CD70. CD27 is essential for the generation and long-term maintenance of T cell immunity and plays a key role in regulating B cell activation and immunoglobulin synthesis. The term "CD27" includes any variant or isotype of CD27 that is naturally expressed by cells (e.g., human CD27 deposited in with accession number AAH12160.1, as shown in SEQ ID NO: 173). Thus, the CD27 binding domains of the present invention can cross-react with CD27 from species other than human. Alternatively, the CD27 binding domain can be specific for human CD27 and may not exhibit any cross-reactivity with other species. CD27 or any of its variants and isotypes can be isolated from cells or tissues that naturally express CD27 or can be recombinantly produced using techniques well known in the art and / or techniques described herein. Preferably, the CD27 binding domain targets human CD27 with a normal glycosylation pattern.

[0260] The term "CD70" (also referred to as "normal domain", "normal molecule", "normal glycosylation", "normal glycosyl", "tumor necrosis factor (ligand) superfamily member 7", "family member ligand", "member antigen", "surface antigen CD70", "tumor necrosis factor ligand superfamily, member 7", "member necrosis factor antigen") refers to the ligand of CD27 (see, e.g., Bowman MR et al., J. Immunol. 1994 Feb 15; 152(4): 1756-61). CD70 is a type II transmembrane protein belonging to the tumor necrosis factor (TNF) ligand family. It is a surface antigen on activated T and B lymphocytes that can induce the proliferation of co-stimulatory T cells, enhance the generation of cytolytic T cells, and contribute to T cell activation. It has also been shown that CD70 plays a role in regulating B cell activation, the cytotoxic function of natural killer cells, and immunoglobulin synthesis (Hintzen RQ et al., Immunol. 1994 Feb 15; 152(4): 1762-73). The amino acid sequence of human CD70 (SEQ ID NO: 174) is reported under accession number NP_001243.

[0261] An exemplary anti-CD27 antibody is antibody 3C2 described herein. In one embodiment, the anti-CD27 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 3C2. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 3C2 having the sequences shown in SEQ ID NO: 17, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 3C2 having the sequences shown in SEQ ID NO: 18. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 1, 2, and 3, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 4, 5, and 6, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 17. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 18. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 17 and 18, respectively.

[0262] Another exemplary anti-CD27 antibody is antibody 2B3 described herein. In one embodiment, the anti-CD27 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 2B3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 2B3 having the sequence shown in SEQ ID NO: 19, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 3C2 having the sequence shown in SEQ ID NO: 20. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 7, 8, and 9, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 10, 11, and 12, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 19. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 20. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 19 and 20, respectively.

[0263] Provided are sequences that are substantially the same as the anti-CD27 binding domains described herein (e.g., sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical (the same) to the foregoing sequences). In one embodiment, the anti-CD27 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 17, SEQ ID NO: 19, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a light chain variable region comprising SEQ ID NO: 18, SEQ ID NO: 20, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, or a sequence that is at least 90% identical thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the foregoing sequences).

[0264] Anti-CD27 antibodies and binding domains thereof that compete with any of the anti-CD27 antibodies or binding domains described herein for binding or bind to the same epitope as any of the anti-CD27 antibodies or binding domains described herein are also applicable and are provided herein. For example, in one embodiment, the anti-CD27 antibody or binding domain thereof competes with antibody 3C2 (or an antibody having the heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to antibody 3C2) for binding to CD27. In another embodiment, the anti-CD27 antibody or binding domain thereof competes with antibody 2B3 (or an antibody having the heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to antibody 2B3) for binding to CD27. In another embodiment, the antibody or anti-CD27 binding domain thereof binds to the same epitope on CD27 as antibody 3C2 (or an antibody having the heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to antibody 3C2). In another embodiment, the anti-CD27 antibody or binding domain thereof binds to the same epitope on CD27 as antibody 2B3 (or an antibody having the heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to antibody 2B3).

[0265] In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises CDR1, CDR2, and CDR3 of the heavy chain variable region as shown in SEQ ID NOs: 1, 2, and 3, respectively, and CDR1, CDR2, and CDR3 of the light chain variable region as shown in SEQ ID NOs: 4, 5, and 6, respectively. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequence).

[0266] In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises CDR1, CDR2, and CDR3 of the heavy chain variable region as shown in SEQ ID NOs: 7, 8, and 9, respectively, and CDR1, CDR2, and CDR3 of the light chain variable region as shown in SEQ ID NOs: 10, 11, and 12, respectively. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20 or a sequence having at least 95% identity thereto.

[0267] In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof has one or more of the following functional characteristics: inducing or enhancing a T cell-mediated immune response, blocking the binding of sCD70 to CD27 (e.g., partially or completely), inducing NF-κB activation, increasing T cell proliferation, with a dissociation equilibrium constant Kd of 10 -9 M or lower or an association equilibrium constant Ka of 10 +9 M -1 or higher binding to human CD27, inducing specific complement-mediated cytotoxicity (CDC) of cells expressing CD27, inducing specific lysis of antibody-dependent cell-mediated cytotoxicity (ADCC) of cells expressing CD27, inducing or enhancing an antigen-specific immune response in vivo in combination with a vaccine or an endogenous antigen, inducing or enhancing an antigen-specific TH1 immune response in vivo in combination with a vaccine or an endogenous antigen, inducing or enhancing antigen-specific T cell proliferation or activation in vivo in combination with a vaccine or an endogenous antibody; and / or inducing or enhancing T cell activity when in a simultaneous, separate or sequential TCR activation combination.

[0268] C. Anti-PD-L1 antibodies and binding domains

[0269] Provided herein are novel anti-PD-L1 antibodies and their binding domains. As used herein, the terms “programmed cell death 1 ligand 1”, “programmed cell death ligand 1”, “PD-L1 homolog 1”, “PD-L1 homolog”, “PD-L1”, “homolog of programmed death ligand” and “homolog of death ligand” are used interchangeably and include variants, isotypes, species homologs of human PD-L1, and analogs having at least one epitope in common with PD-L1. The complete PD-L1 sequence can be found under GenBank accession number NP_001254635, as shown in SEQ ID NO: 176.

[0270] Programmed death ligand 1 (PD-L1) is a 40 kDa type I transmembrane protein that is hypothesized to play an important role in the suppression of the immune system in specific events such as pregnancy, tissue allograft, autoimmune diseases, and other diseases such as hepatitis. Generally, the immune system responds to foreign antigens associated with exogenous or endogenous danger signals, which triggers the proliferation of antigen-specific CD8+ T cells and / or CD4+ helper cells. The binding of PD-L1 to PD-1 transmits an inhibitory signal that reduces the proliferation of these T cells and can also induce apoptosis, which is mediated by the downregulation of the gene Bcl-2. As used herein, the terms “programmed death 1”, “programmed cell death 1”, “protein PD-1”, “PD-1 cell death”, “PD1”, “PD1 cell death”, “PD11 cell death”, and “11 cell death” are used interchangeably and include variants, isotypes, species homologs of human PD-1, and analogs having at least one common epitope with PD-1. The complete PD-1 sequence can be found under GenBank accession number NP_005009, as shown in SEQ ID NO: 175.

[0271] PD-L1 is abundant in a variety of human cancers (Dong et al. (2002) Nat. Med. 8 : 787-9). The interaction between PD-1 and PD-L1 results in a decrease in tumor-infiltrating lymphocytes, a decrease in T cell receptor-mediated proliferation, and immune evasion of cancerous cells (Dong et al. (2003) (2003) J. Mol. Med. 81 : 281-7; Blank et al. (2005) Cancer Immunol. Immunother. 54 : 307-314; Konishi et al. (2004) Clin. Cancer Res. 10 : 5094-100). Immune suppression can be reversed by inhibiting the local interaction between PD-1 and PD-L1, and this effect is additive when the interaction between PD-1 and PD-L2 is also blocked (Iwai et al. (2002) Proc. Nat’l. Acad. Sci. USA 99 : 12293-7; Brown et al. (2003) J. Immunol. 170 : 1257-66).

[0272] An exemplary anti-PD-L1 antibody is antibody 7H7 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 7H7. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 7H7 having the sequence shown in SEQ ID NO: 77, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 7H7 having the sequence shown in SEQ ID NO: 78. In another embodiment, the antibody or its binding domain comprises heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 29, 30, and 31, respectively, or conservative sequence modifications thereof, and light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 32, 33, and 34, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 77. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 77. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 77 and SEQ ID NO: 78, respectively.

[0273] Another exemplary anti-PD-L1 antibody is antibody 1B3 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 1B3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 1B3 having the sequence shown in SEQ ID NO: 79, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 1B3 having the sequence shown in SEQ ID NO: 80. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 35, 36, and 37, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 38, 39, and 40, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 79. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 80. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 79 and SEQ ID NO: 80, respectively.

[0274] Another exemplary anti-PD-L1 antibody is antibody 3B6 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 3B6. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 3B6 having the sequence shown in SEQ ID NO: 81, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 3B6 having the sequence shown in SEQ ID NO: 82. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 41, 42, and 43, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 44, 45, and 46, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 81. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 82. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 81 and SEQ ID NO: 82, respectively.

[0275] Another exemplary anti-PD-L1 antibody is antibody 8B1 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 8B1. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 8B1 having the sequence shown in SEQ ID NO: 83, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 8B1 having the sequence shown in SEQ ID NO: 84. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 47, 48, and 49, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 50, 51, and 52, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 83. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 84. In another embodiment, the antibody or its binding domain comprises heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively.

[0276] Another exemplary anti-PD-L1 antibody is antibody 4A3 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 4A3. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 4A3 having the sequence shown in SEQ ID NO: 85, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 4A3 having the sequence shown in SEQ ID NO: 86. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 53, 54, and 55, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 56, 57, and 58, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 85. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 86. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively.

[0277] Another exemplary anti-PD-L1 antibody is antibody 9H9 described herein. In one embodiment, the anti-PD-L1 antibody or its binding domain comprises the heavy and light chain CDRs or variable regions of antibody 9H9. In another embodiment, the antibody or its binding domain comprises the CDR1, CDR2, and CDR3 domains of the heavy chain variable region of antibody 9H9 having the sequence shown in SEQ ID NO: 87, and the CDR1, CDR2, and CDR3 domains of the light chain variable region of antibody 9H9 having the sequence shown in SEQ ID NO: 88. In another embodiment, the antibody or its binding domain comprises the heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 59, 60, and 61, respectively, or conservative sequence modifications thereof, and the light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NOs: 62, 63, and 64, respectively, or conservative sequence modifications thereof. In another embodiment, the antibody or its binding domain comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 87. In another embodiment, the antibody or its binding domain comprises a light chain variable region having the amino acid sequence shown in SEQ ID NO: 88. In another embodiment, the antibody or its binding domain comprises the heavy and light chain variable regions having the amino acid sequences shown in SEQ ID NOs: 87 and 88, respectively.

[0278] The antibody sequence can also be a consensus sequence of several antibodies. For example, in one embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR1 containing an amino acid sequence selected from the consensus sequence: (T, S)(S, Y, H)WMS (SEQ ID NO: 167). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR2 containing SEQ ID NO: 168. In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region CDR3 containing SEQ ID NO: 169. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR1 containing SEQ ID NO: 170. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR2 containing SEQ ID NO: 171. In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region CDR3 containing SEQ ID NO: 172.

[0279] The present invention also encompasses sequences that are substantially identical to the anti-PD-L1 antibodies and their binding domains described herein (e.g., having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In one embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a light chain variable region containing SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84 or a sequence having at least 90% identity thereto (e.g., having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).

[0280] Anti-PD-L1 antibodies and their binding domains that compete with any anti-PD-L1 antibody or its binding domain described herein for binding, or anti-PD-L1 antibodies and their binding domains that bind to the same epitope as any anti-PD-L1 antibody or its binding domain described herein are also applicable and provided herein. For example, in one embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 7H7 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 7H7) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 7H7 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 7H7).

[0281] In another embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 1B3 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 1B3) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 1B3 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 1B3).

[0282] In another embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 3B6 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 3B6) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 3B6 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 3B6).

[0283] In another embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 8B1 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 8B1) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 8B1 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 8B1).

[0284] In another embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 4A3 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 4A3) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 4A3 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 4A3).

[0285] In another embodiment, the anti-PD-L1 antibody or its binding domain competes with antibody 9H9 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 9H9) for binding to PD-L1. In another embodiment, the anti-PD-L1 antibody or its binding domain binds to the same epitope on PD-L1 as antibody 9H9 (or an antibody having heavy and light chain CDRs and / or heavy and light chain variable region sequences corresponding to those of antibody 9H9).

[0286] In another embodiment, the anti-PD-L1 binding domain is an anti-PD-L1 antibody or an antigen-binding portion thereof. In one embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 32, 33, and 34, respectively. In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 38, 39, and 40, respectively. In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 44, 45, and 46, respectively. In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 antibody or an antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 50, 51, and 52, respectively.In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 53, 54 and 55, respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 56, 57 and 58, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences). In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 59, 60 and 61, respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NOs: 62, 63 and 64, respectively. In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88 or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).

[0287] In another embodiment, the anti-PD-L1 antibody or antigen-binding fragment thereof has one or more of the following functional characteristics: (a) blocks the binding of PD1 to PD-L1 (e.g., partially or completely), (b) induces NFAT pathway activation, and / or (c) induces a mixed lymphocyte reaction.

[0288] D. Bispecific constructs

[0289] Provided herein are bispecific constructs that comprise an anti-CD27 binding domain linked to an anti-PD-L1 binding domain. Also provided are such bispecific constructs linked to one or more other binding agents to form a multispecific construct.

[0290] A "bispecific" or "bifunctional" construct is an artificial hybrid having two different binding domain (e.g., heavy chain / light chain) pairs and two different binding sites. Bispecific constructs can be generated by a variety of methods, including fusion of hybridomas or ligation of Fab' fragments. See, e.g., Songsivilai & Lachmann, Clin. Exp. Immunol. 79:315-321 (1990); Kostelny et al., J. Immunol. 148, 1547-1553 (1992).

[0291] As used herein, the term "linked" refers to the association of two or more molecules. The linkage can be covalent or non-covalent. The linkage can also be genetic (i.e., recombinant fusion). A variety of techniques well known in the art, such as chemical conjugation and recombinant protein production, can be used to achieve such linkages.

[0292] For chemical conjugation, suitable reagents and methods are known in the art for conjugating two or more moieties, particularly two or more antibodies or fragments thereof, together. A variety of conjugating agents or cross-linking agents are commercially available and can be used to conjugate the anti-CD27 binding domain and the anti-PD-L1 binding domain. Non-limiting examples include sulfo-SMCC, protein A, carbodiimide, dimaleimide, dithio-bis-nitrobenzoic acid (DTNB), and N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP). Sulfo-SMCC, SPDP, and DTNB are preferred reagents, with sulfo-SMCC being particularly preferred. Other suitable methods for cross-linking components (e.g., binding domains) with a cross-linking agent are known in the art. See, e.g., Karpovsky, B. et al., (1984) J. Exp. Med. 160:1686; Liu, M.A. et al., (1985) Proc. Natl. Acad. Sci USA 82:8648; Segal, D.M. and Perez, P., U.S. Patent No. 4,676,980; and Brennan, M. (1986) Biotechniques 4:424.

[0293] For genetic engineering, nucleic acid molecules encoding anti-CD27 binding domains can be inserted into a suitable expression vector using standard recombinant DNA techniques. Nucleic acid molecules encoding anti-PD-L1 binding domains can also be inserted into the same expression vector such that they are operably linked to the CD27 binding domain (e.g., in-frame cloning), and the resulting expression vector thus gives rise to an expression vector that encodes a fusion protein that is a bispecific construct. Preferably, the anti-PD-L1 binding domain is operably linked to the C-terminal region of the heavy chain of the anti-CD27 binding domain. Other suitable expression vectors and cloning strategies for preparing the bispecific constructs described herein are known in the art.

[0294] To express the bispecific construct in a host cell, the coding regions of the binding domains are combined with a cloned promoter, leader sequence, translation initiation, leader sequence, constant region, 3' untranslated, polyadenylation, and transcriptional termination sequences to form an expression vector construct. These constructs can be used to express, for example, full-length human IgG1κ or IgG4κ antibodies. The fully human antibodies, humanized antibodies, and chimeric antibodies used in the bispecific constructs described herein also include IgG2, IgG3, IgE, IgA, IgM, and IgD antibodies. Similar plasmids can be constructed for expressing other heavy chain isotypes, or for expressing antibodies containing λ light chains.

[0295] After preparing the expression vector encoding the bispecific construct, the bispecific construct can be recombinantly expressed in a host cell using standard transfection methods. For example, in one embodiment, the nucleic acid encoding the bispecific construct can be ligated to an expression vector, such as a eukaryotic expression plasmid, such as those used in the GS gene expression system disclosed in WO 87 / 04462, WO 89 / 01036, and EP 338841 or other expression systems known in the art. The purified plasmid having the cloned bispecific construct gene can be introduced into a eukaryotic host cell, such as a CHO cell or an NSO cell, or into other eukaryotic cells, such as cells of plant origin, fungi, or yeast cells. The methods for introducing these genes can be the methods described in the art, such as electroporation, lipofectin, lipofectamine, or other methods. After introducing the expression vector into the host cell, cells expressing the bispecific construct can be identified and selected. These cells represent transfectomas, which can then be amplified to increase their expression levels and scaled up to produce the bispecific construct. Alternatively, these cloned bispecific constructs can be expressed in other expression systems, such as in Escherichia coli or in a whole organism, or can be synthesized and expressed. The recombinant bispecific construct can be isolated and purified from these culture supernatants and / or cells.

[0296] The bispecific constructs of the present invention, whether prepared by chemical conjugation or by genetic engineering, can be isolated and purified using one or more well-established methodologies for protein purification in the art. Preferred methods of separation and purification include, but are not limited to, gel filtration chromatography, affinity chromatography, anion exchange chromatography, etc. A particularly preferred method is gel filtration chromatography, for example using a Superdex 200 column. The isolated and purified bispecific constructs can be evaluated using standard methods such as SDS-PAGE analysis.

[0297] Thus, in one embodiment, the anti-PD-L1 binding domain and the anti-CD27 binding domain are Gene fused. In another embodiment, the anti-PD-L1 binding domain and the anti-CD27 binding domain are chemically conjugated. In one embodiment, the anti-PD-L1 binding domain further comprises a human IgG1 constant domain. In another embodiment, the anti-CD27 binding domain is linked to the C-terminus of the heavy chain of the anti-PD-L1 binding domain. In another embodiment, the anti-CD27 binding domain is a scFv. In another embodiment, the anti-CD27 binding domain further comprises a human IgG1 constant domain. In another embodiment, the anti-PD-L1 binding domain is linked to the C-terminus of the heavy chain of the anti-CD27 binding domain. In another embodiment, the anti-PD-L1 binding domain is a scFv.

[0298] Exemplary bispecific constructs are shown in Table 1-2 below, where the binding domains are defined by the CDR sequences (Table 1) or the variable region sequences (Table 2).

[0299] Table 1: Exemplary bispecific constructs (CDR)

[0300]

[0301]

[0302] Table 2: Exemplary bispecific constructs (VR)

[0303]

[0304] In one embodiment, a bispecific construct is provided that comprises an anti-CD27 binding domain linked to an anti-PD-L1 binding domain, wherein:

[0305] (i) the anti-CD27 binding domain comprises:

[0306] a. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 1, 2, and 3 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 4, 5, and 6 respectively

[0307] b. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 7, 8, and 9 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 10, 11, and 12 respectively; and

[0308] (ii) The anti-PD-L1 binding domain comprises:

[0309] a. A heavy chain variable region CDR1 containing an amino acid sequence selected from the consensus sequence: (T, S)(S, Y, H)WMS (SEQ ID NO: 167);

[0310] b. A heavy chain variable region CDR2 containing SEQ ID NO: 168;

[0311] c. A heavy chain variable region CDR3 containing SEQ ID NO: 169;

[0312] d. A light chain variable region CDR1 containing SEQ ID NO: 170;

[0313] e. A light chain variable region CDR2 containing SEQ ID NO: 171; and

[0314] f. A light chain variable region CDR3 containing SEQ ID NO: 172.

[0315] In another embodiment, a bispecific construct comprising an anti-CD27 binding domain linked to an anti-PD-L1 binding domain is provided, wherein:

[0316] (i) The anti-CD27 binding domain comprises:

[0317] a. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 1, 2, and 3 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 4, 5, and 6 respectively

[0318] b. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 7, 8, and 9 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 10, 11, and 12 respectively; and

[0319] (ii) The anti-PD-L1 binding domain comprises:

[0320] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences);

[0321] b. A heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences);

[0322] c. A heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences);

[0323] d. A heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences);

[0324] e. A heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences);

[0325] f. A heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88 or a sequence having at least 95% identity thereto (e.g., at least 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences).

[0326] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 32, 33, and 34, respectively.

[0327] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78.

[0328] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 4, 5, and 6, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 38, 39, and 40, respectively.

[0329] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80.

[0330] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 4, 5, and 6, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 44, 45, and 46, respectively.

[0331] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82.

[0332] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively.

[0333] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84.

[0334] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively; and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 53, 54, and 55, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 56, 57, and 58, respectively.

[0335] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86.

[0336] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, and an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 62, 63, and 64, respectively.

[0337] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 17 and a light chain variable region comprising SEQ ID NO: 18, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88.

[0338] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 32, 33, and 34, respectively.

[0339] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 77 and a light chain variable region comprising SEQ ID NO: 78.

[0340] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 38, 39, and 40, respectively.

[0341] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80.

[0342] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 44, 45, and 46, respectively.

[0343] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, and an anti-PD-L1 binding domain comprising a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82.

[0344] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and (b) a PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 50, 51, and 52, respectively.

[0345] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84.

[0346] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 53, 54, and 55, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 56, 57, and 58, respectively.

[0347] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86.

[0348] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a domain having heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively, and (b) an anti-PD-L1 binding domain comprising heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 62, 63, and 64, respectively.

[0349] In another embodiment, the bispecific construct comprises (a) an anti-CD27 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 19 and a light chain variable region comprising SEQ ID NO: 20, and (b) an anti-PD-L1 binding domain comprising a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88.

[0350] In a specific embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0351] (i) the anti-CD27 scFv comprises:

[0352] a. heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 4, 5, and 6, respectively, or

[0353] b. heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 10, 11, and 12, respectively; and

[0354] (ii) the anti-PD-L1 antibody comprises:

[0355] a. heavy chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as set forth in SEQ ID NOs: 32, 33, and 34, respectively;

[0356] b. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 35, 36, and 37 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 38, 39, and 40 respectively;

[0357] c. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 41, 42, and 43 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 44, 45, and 46 respectively;

[0358] d. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 47, 48, and 49 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 50, 51, and 52 respectively;

[0359] e. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 53, 54, and 55 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 56, 57, and 58 respectively; or

[0360] f. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 59, 60, and 61 respectively, and the light chain variable region CDR1, CDR2, and CDR shown in SEQ ID NO: 62, 63, and 64 respectively; and

[0361] g. The human IgG1 constant domain.

[0362] In another specific embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0363] [[ID=**21**]](i) The anti-CD27 antibody comprises:

[0364] a. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 1, 2, and 3 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 4, 5, and 6 respectively, or

[0365] b. The heavy chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 7, 8, and 9 respectively, and the light chain variable region CDR1, CDR2, and CDR3 shown in SEQ ID NO: 10, 11, and 12 respectively; and

[0366] c. The human IgG1 constant domain; and

[0367] (ii) The anti-PD-L1 scFv comprises:

[0368] a. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 29, 30 and 31 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 32, 33 and 34 respectively;

[0369] b. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 35, 36 and 37 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 38, 39 and 40 respectively;

[0370] c. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 41, 42 and 43 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 44, 45 and 46 respectively;

[0371] d. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 47, 48 and 49 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 50, 51 and 52 respectively;

[0372] e. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 53, 54 and 55 respectively, and light chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 56, 57 and 58 respectively; or

[0373] f. Heavy chain variable region CDR1, CDR2 and CDR3 as shown in SEQ ID NO: 59, 60 and 61 respectively, and light chain variable region CDR1, CDR2 and CDR as shown in SEQ ID NO: 62, 63 and 64 respectively.

[0374] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0375] (i) The anti-CD27 scFv comprises:

[0376] a. A heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18; or

[0377] b. A heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0378] (ii) The anti-PD-L1 antibody comprises:

[0379] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78;

[0380] b. A heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80;

[0381] c. A heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82;

[0382] d. A heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84;

[0383] e. A heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86; or

[0384] f. A heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88; and

[0385] g. A human IgG1 constant domain.

[0386] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0387] (i) The anti-CD27 antibody comprises:

[0388] a. A heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18; or

[0389] b. A heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0390] c. A human IgG1 constant domain; and

[0391] (ii) The anti-PD-L1 scFv comprises:

[0392] a. A heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78;

[0393] b. having a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80;

[0394] c. having a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82;

[0395] d. having a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84;

[0396] e. having a heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86; or

[0397] f. having a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88.

[0398] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0399] (i) the anti-CD27 scFv comprises heavy chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 7, 8 and 9 respectively and light chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 10, 11 and 12 respectively; and

[0400] (ii) the anti-PD-L1 antibody comprises heavy chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 47, 48 and 49 respectively, and light chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 50, 51 and 52 respectively, and a human IgG1 constant domain.

[0401] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0402] (i) the anti-CD27 antibody comprises heavy chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 7, 8 and 9 respectively, and light chain variable region CDR1, CDR2 and CDR3 shown as SEQ ID NOs: 10, 11 and 12 respectively, and a human IgG1 constant domain; and

[0403] (ii) The anti-PD-L1 scFv comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 47, 48, and 49, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 50, 51, and 52, respectively.

[0404] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0405] (i) The anti-CD27 scFv comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0406] (ii) The anti-PD-L1 antibody comprises a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84, and a human IgG1 constant domain.

[0407] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0408] (i) The anti-CD27 antibody comprises a heavy chain variable region containing SEQ ID NO: 19, a light chain variable region containing SEQ ID NO: 20, and a human IgG1 constant domain; and

[0409] (ii) The anti-PD-L1 scFv comprises a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84.

[0410] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0411] (i) The anti-CD27 scFv comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 7, 8, and 9, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 10, 11, and 12, respectively; and

[0412] (ii) The anti-PD-L1 antibody comprises a heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 59, 60, and 61, respectively, and a light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 62, 63, and 64, respectively, and a human IgG1 constant domain.

[0413] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0414] (i) the anti-CD27 antibody comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively, and a human IgG1 constant domain; and

[0415] (ii) the anti-PD-L1 scFv comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 62, 63, and 64, respectively.

[0416] In another embodiment, the bispecific construct comprises an anti-PD-L1 antibody linked to an anti-CD27 scFv, wherein:

[0417] (i) the anti-CD27 scFv comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and

[0418] (ii) the anti-PD-L1 antibody comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88, and a human IgG1 constant domain.

[0419] In another embodiment, the bispecific construct comprises an anti-CD27 antibody linked to an anti-PD-L1 scFv, wherein:

[0420] (i) the anti-CD27 antibody comprises a heavy chain variable region containing SEQ ID NO: 19, a light chain variable region containing SEQ ID NO: 20, and a human IgG1 constant region; and

[0421] (ii) the anti-PD-L1 scFv comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88.

[0422] In another aspect, there is provided a bispecific construct, wherein the bispecific construct comprises any of the anti-CD27 antibodies or antigen-binding fragments thereof described herein linked to an anti-PD-L1 binding domain. In one embodiment, the anti-PD-L1 binding domain is selected from the group consisting of:

[0423] a. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 32, 33, and 34, respectively;

[0424] b. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 38, 39, and 40, respectively;

[0425] c. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 44, 45, and 46, respectively;

[0426] d. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 50, 51, and 52, respectively;

[0427] e. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 53, 54, and 55, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 56, 57, and 58, respectively; and

[0428] f. An anti-PD-L1 antibody or an antigen-binding fragment thereof, comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NO: 62, 63, and 64, respectively.

[0429] In another embodiment, the anti-PD-L1 binding domain is selected from the group consisting of: (a) a heavy chain variable region comprising SEQ ID NO: 77 and a light chain variable region comprising SEQ ID NO: 78; and (b) a heavy chain variable region comprising SEQ ID NO: 79 and a light chain variable region comprising SEQ ID NO: 80; (c) a heavy chain variable region comprising SEQ ID NO: 81 and a light chain variable region comprising SEQ ID NO: 82; (d) a heavy chain variable region comprising SEQ ID NO: 83 and a light chain variable region comprising SEQ ID NO: 84; (e) a heavy chain variable region comprising SEQ ID NO: 85 and a light chain variable region comprising SEQ ID NO: 86; and (f) a heavy chain variable region comprising SEQ ID NO: 87 and a light chain variable region comprising SEQ ID NO: 88. In a specific embodiment, the anti-PD-L1 binding domain further comprises a human IgG1 constant domain. In another embodiment, the anti-PD-L1 binding domain is a scFv.

[0430] In another aspect, a bispecific construct is provided, wherein the bispecific construct comprises any of the anti-PD-L1 antibodies or antigen-binding fragments thereof described herein linked to an anti-CD27 binding domain. In one embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody, and the CD27 antibody comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 4, 5, and 6, respectively. In another embodiment, the anti-CD27 binding domain comprises an antibody that comprises a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18, or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences). In another embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody that comprises heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 7, 8, and 9, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 10, 11, and 12, respectively. In another embodiment, the anti-CD27 binding domain comprises an anti-CD27 antibody that comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20, or a sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the foregoing sequences). In one embodiment, the anti-CD27 binding domain is a scFv. In another embodiment, the anti-CD27 binding domain further comprises a human IgG1 constant domain.

[0431] In another embodiment, the bispecific construct has one or more of the following functional characteristics: inducing NF B activation, increasing T cell proliferation, inducing a CD8 T cell response, and / or increasing IL-2 production. In another embodiment, the bispecific construct increases IL-2 production by at least about 1.5-fold (e.g., at least 2-fold, 2.5-fold, 3-fold, 3.5-fold, or 4-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone. In another embodiment, the bispecific construct induces a CD8 T cell response that is at least about 2-fold higher (e.g., at least 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8.0-fold, 8.5-fold, or 9-fold) than an anti-CD27 monoclonal antibody alone. In another embodiment, the bispecific construct increases survival rate by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, or 5-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone. In another embodiment, the bispecific construct reduces tumor weight by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, or 5-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone or in combination with them. In another embodiment, the bispecific construct increases T cell production by at least about 1.5-fold (e.g., at least 1.5-fold, 2.0-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8.0-fold, 8.5-fold, or 9-fold) compared to an anti-CD27 monoclonal antibody or an anti-PD-L1 monoclonal antibody alone or in combination with them.

[0432] In certain embodiments, the bispecific constructs described herein exhibit a synergistic effect (e.g., in enhancing an immune response in vivo) compared to the combined use of an anti-CD27 binding domain and an anti-PD-L1 binding domain (i.e., co-administration of non-linked antibodies).

[0433] E. Compositions

[0434] The present invention also provides compositions, such as compositions comprising one or any combination of the following: a binding domain, an antibody or an antigen-binding fragment thereof, a bispecific construct, or a multispecific construct as described herein, which are formulated with a delivery vehicle (e.g., a pharmaceutically acceptable delivery vehicle).

[0435] As used herein, the terms "delivery vehicle" and "pharmaceutically acceptable delivery vehicle" include any and all physiologically compatible solvents, salts, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Preferably, the delivery vehicle is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active compound (i.e., any binding domain, antibody or antigen-binding fragment thereof, bispecific construct or multispecific construct described herein) can be coated in a material to protect the compound from acids and other natural conditions that can inactivate the compound.

[0436] Examples of adjuvants that can be used with the binding domains, antibodies or antigen-binding fragments thereof, bispecific constructs or multispecific constructs described herein include, but are not limited to: Freund's incomplete and complete adjuvants (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; insoluble suspensions of acylated tyrosine; acylated sugars; cationic or anionic derived polysaccharides; polyphosphazenes; biodegradable microspheres; cytokines such as GM-CSF, interleukin-2, interleukin-7, interleukin-12, and other similar factors; 3D-MPL; CpG oligonucleotides; and monophosphoryl lipid A, such as 3-de-O-acylated monophosphoryl lipid A.

[0437] MPL adjuvant is available from Corixa Corporation (Seattle, Wash; see, e.g., U.S. Patent Nos. 4,436,727; 4,877,611; 4,866,034 and 4,912,094). CpG-containing oligonucleotides in which the CpG dinucleotide is unmethylated are well known and are described, for example, in WO 96 / 02555, WO 99 / 33488 and U.S. Patent Nos. 6,008,200 and 5,856,462. Immunostimulatory DNA sequences are also described, for example, in Sato et al., Science 273:352, 1996.

[0438] Other alternative adjuvants include, for example, saponins (such as Quil A) or their derivatives, including QS21 and QS7 (Aquila Biopharmaceuticals Inc., Framingham, MA); Escin; digitonin; or gypsophila or quinoa saponins; Montanide ISA 720 (Seppic, France); SAF (Chiron, California, USA); ISCOMS (CSL), MF-59 (Chiron); SBAS series adjuvants (such as SBAS-2 or SBAS-4, available from SmithKlineBeecham, Rixensart, Belgium); Detox (Enhanzyn TM)(Corixa, Hamilton, Mont.); RC-529 (Corixa, Hamilton, Mont.) and other aminoalkyl glucosaminide 4-phosphates (AGPs); polyoxyethylene ether adjuvants such as those described in WO99 / 52549A1; synthetic imidazoquinolines such as imiquimod [S-26308, R-837] (Harrison et al., Vaccine 19:1820-1826, 2001); and resiquimod [S-28463, R-848] (Vasilakos et al., Cellular immunology 204:64-74, 2000); Schiff bases of carbonyls and amines constitutively expressed on antigen-presenting cells and T cell surfaces such as tucaresol (Rhodes, J. et al., Nature 377:71-75, 1995); cytokines, chemokines and costimulatory molecules as proteins or peptides, including pro-inflammatory cytokines (such as interferon, GM-CSF, IL-1α, IL-1β, TGF-α and TGF-S), Th1 inducers (such as interferon γ, IL-2, IL-12, IL-15, IL-18 and IL-21), Th2 inducers (such as IL-4, IL-5, IL-6, IL-10 and IL-13) and other chemokines and costimulatory genes (such as MCP-1, MIP-1α, MIP-1β, RANTES, TCA-3, CD80, CD86 and CD40L); immunostimulants of targeted ligands (such as CTLA-4 and L-selectin), apoptosis-stimulating proteins and polypeptides (such as Fas); synthetic lipid-based adjuvants (such as vaxfectin (Reyes et al., Vaccine 19:3778-3786, 2001), squalene, α-tocopherol, polysorbate 80, DOPC and cholesterol); endotoxin, [LPS], (Beutler, B., Current Opinion in Microbiology 3:23-30, 2000); ligands that trigger Toll receptors to produce Th1-inducing cytokines (such as synthetic mycobacterial lipoproteins, mycobacterial protein p19, peptidoglycan, teichoic acid and lipid A); and CT (cholera toxin, subunits A and B) and LT (heat-labile enterotoxin from Escherichia coli, subunits A and B), heat shock protein family (HSP) and LLO (Listeria monocytogenes hemolysin O; WO01 / 72329). These and a variety of other Toll-like receptor (TLR) agonists are described, for example, in Kanzler et al., Nature Medicine, May 2007, Vol. 13, No. 5.

[0439] "Pharmaceutically acceptable salts" refer to salts that retain the desired biological activity of the parent compound and do not impart any undesired toxicological effects (see, e.g., Berge, S.M. et al. (1977) J. Pharm. Sci. 66:1-19). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, phosphorous acid, etc., and those derived from non-toxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, etc. Base addition salts include salts derived from alkaline earth metals (such as sodium, potassium, magnesium, calcium, etc.), and salts of non-toxic organic amines (such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine, etc.).

[0440] The compositions of the present invention can be administered by a variety of methods known in the art. Those skilled in the art will understand that the route and / or mode of administration will vary depending on the desired result. The active compounds can be formulated with delivery carriers that will protect the compound from rapid release, e.g., controlled release formulations including implants, transdermal patches, and microencapsulation delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Many methods for preparing such formulations are patented or are generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, edited by J.R. Robinson, Marcel Dekker, Inc., New York, 1978.

[0441] In order to administer the compounds of the present invention by certain routes of administration, it is necessary to coat the compound with a material that prevents its inactivation or co-administer the compound with such a material. For example, the compound can be administered to a subject in a suitable delivery carrier such as a liposome or a diluent. Acceptable diluents include saline solutions and buffered aqueous solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).

[0442] Delivery carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for active pharmaceutical substances is known in the art. Unless any conventional media or agent is incompatible with the active compound, it can be considered for use in the pharmaceutical compositions of the present invention. Supplementary active compounds can also be incorporated into the compositions.

[0443] Therapeutic compositions generally must be sterile and stable under the conditions of manufacture and storage. The compositions can be formulated as solutions, microemulsions, liposomes or other ordered structures suitable for high drug concentrations. The delivery vehicle can be a solvent or a dispersion medium, which includes, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.) and suitable mixtures thereof. It can be, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions and by using surfactants to maintain appropriate fluidity. In many cases, it is preferred to include in the composition isotonic agents, such as sugars, polyols (such as mannitol, sorbitol) or sodium chloride. By including in the composition agents that delay absorption, such as monostearates and gelatin, extended absorption of injectable compositions can be achieved.

[0444] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent (as required) with one or a combination of the above ingredients, followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization), which yield a powder of the active ingredient and any other desired ingredients from its previously sterile-filtered solution.

[0445] The dosage regimen is adjusted to provide the optimal desired response (e.g., therapeutic response). For example, a single bolus can be administered, several divided doses can be administered over time, or the dose can be proportionally decreased or increased as indicated by exigencies of the therapeutic situation. For example, the antibodies of the present invention can be administered once or twice a week by subcutaneous or intramuscular injection, or once or twice a month by subcutaneous or intramuscular injection.

[0446] It is particularly advantageous to formulate parenteral compositions in unit dosage form for ease of administration and uniformity of dosage. As used herein, unit dosage form refers to physically discrete units suitable as unit doses for the subject to be treated; each unit contains a predetermined quantity of the active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical delivery vehicle. The specification of the unit dosage forms of the present invention is determined by and directly depends on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such compounds for the treatment of individual sensitivity.

[0447] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, etc.; (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.

[0448] For therapeutic compositions, the formulations of the present invention include formulations suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and / or parenteral administration. The formulations may conveniently be in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of the active ingredient that may be combined with the delivery carrier materials to produce a single dosage form will vary depending on the subject being treated and the particular mode of administration. The amount of the active ingredient that may be combined with the delivery carrier materials to produce a single dosage form will generally be the amount of the active ingredient in the composition that produces a therapeutic effect. Generally, on a percentage basis, the amount of the active ingredient will be from about 0.001% to about ninety percent, preferably from about 0.005% to about seventy percent, and most preferably from about 0.01% to about thirty percent.

[0449] The formulations of the present invention suitable for vaginal administration also include pessaries, plugs, creams, gels, pastes, foams or spray formulations, which contain suitable delivery carriers known in the art. Dosage forms for topical or transdermal administration of the compositions of the present invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound can be mixed with pharmaceutically acceptable delivery carriers and any preservatives, buffers or propellants that may be required under sterile conditions.

[0450] As used herein, the phrases "parenteral administration" and "administered parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.

[0451] Examples of suitable aqueous and non-aqueous delivery carriers that may be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil and injectable organic esters such as ethyl oleate. For example, by using coating materials such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants, appropriate fluidity can be maintained.

[0452] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the presence of microorganisms can be ensured by sterilization procedures (refer to the foregoing) as well as by including various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, etc. It may also be necessary to include in the composition isotonic agents such as sugars, sodium chloride, etc. In addition, prolonged absorption of injectable drug forms can be brought about by including agents that delay absorption such as aluminum monostearate and gelatin.

[0453] When the compounds of the present invention are administered as drugs to humans and animals, they can be given alone or as a pharmaceutical composition comprising, for example, 0.001 to 90% (more preferably 0.005 to 70%, such as 0.01 to 30%) of the active ingredient, in combination with a pharmaceutically acceptable delivery carrier.

[0454] Regardless of the chosen route of administration, the compounds of the present invention and / or the pharmaceutical compositions of the present invention, which can be used in a suitable hydrated form, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art.

[0455] The actual dosage level of the active ingredient in the pharmaceutical compositions of the present invention can vary so as to obtain an amount of the active ingredient effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend on a variety of pharmacokinetic factors including the activity of the particular composition or its ester, salt or amide used in the present invention, the route of administration, the time of administration, the excretion rate of the particular compound used, the duration of treatment, other drugs, compounds and / or materials used in combination with the particular composition employed, age, sex, weight, medical condition, general health, and prior medical history of the patient being treated, and other factors well known in the medical arts. A physician or veterinarian having ordinary skill in the art can readily determine the effective amount of the pharmaceutical composition required and prescribe the same. For example, the physician or veterinarian can start administration of the compounds of the present invention at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is obtained. Generally, the appropriate daily dosage of the compositions of the present invention will be the amount of the compound that is the lowest dosage effective to produce a therapeutic effect. Such effective dosage will generally depend on the above factors. Administration is preferably intravenous, intramuscular, intraperitoneal or subcutaneous, preferably near the target site. As desired, the effective daily dosage of the therapeutic composition can be administered in divided sub-doses, optionally in unit dosage forms, at appropriate intervals throughout the day in two, three, four, five, six or more sub-doses. Although the compounds of the present invention can be administered alone, it is preferred to administer the compounds in the form of a pharmaceutical formulation (composition).

[0456] The therapeutic compositions can be administered using medical devices known in the art. For example, in a preferred embodiment, the therapeutic compositions of the present invention can be administered using a needleless subcutaneous injection device, such as the devices disclosed in U.S. Patent Nos. 5,399,163, 5,383,851, 5,312,335, 5,064,413, 4,941,880, 4,790,824, or 4,596,556. Examples of known implants and modules that can be used in the present invention include: U.S. Patent No. 4,487,603, which discloses an implantable microinfusion pump for dispensing drugs at a controlled rate; U.S. Patent No. 4,486,194, which discloses a therapeutic device for administering drugs through the skin; U.S. Patent No. 4,447,233, which discloses a drug infusion pump for delivering drugs at a precise infusion rate. U.S. Patent No. 4,447,224, which discloses a flow-variable implantable infusion instrument for continuous drug delivery. U.S. Patent No. 4,439,196, which discloses an osmotic drug delivery system having multiple chambers. U.S. Patent No. 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.

[0457] In certain embodiments, the antibodies of the invention can be formulated to ensure proper distribution in vivo. For example, the blood-brain barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the therapeutic compounds of the invention cross the BBB (as desired), they can be formulated, for example, as liposomes. Methods for making liposomes are described, for example, in U.S. Pat. Nos. 4,522,811; 5,374,548; and 5,399,331. The liposomes can include one or more moieties that are selectively transported into specific cells or organs, thereby enhancing targeted drug delivery (see, e.g., Ranade (1989) J. Clin. Pharmacol. 29:685). Exemplary targeting moieties include folic acid or biotin (see, e.g., U.S. Pat. No. 5,416,016 to Low et al.); mannoside (Umezawa et al., (1988) Biochem. Biophys. Res. Commun. 153:1038); antibodies (P.G. Bloeman et al. (1995) FEBS Lett. 357:140; M. Owais et al. Antimicrob. Agents Chemother. 39:180); surfactant protein A receptor (Briscoe et al., (1995) Am. J. Physiol. 1233:134), different species of which can include the formulations of the invention, as well as components of the molecules of the invention; p120 (Schreier et al. J. Biol. Chem. 269:9090); see also K. Keinanen; M.L. Laukkanen (1994) FEBS Lett. 346:123; J.J. Killion; I.J. Fidler (1994) Immunomethods 4:273. In one embodiment of the invention, the therapeutic compounds of the invention are formulated as liposomes. In a more preferred embodiment, the liposomes include a targeting moiety. In the most preferred embodiment, the therapeutic compound in the liposomes is delivered by bolus injection to a site proximal to the tumor or infection. The composition must have a certain degree of fluidity to make it easy to inject. It must be stable under the conditions of manufacture and storage and must prevent contamination by microorganisms such as bacteria and fungi.

[0458] The ability of a compound to inhibit cancer can be evaluated in an animal model system that predicts efficacy in human tumors. Alternatively, this property of a compound can be evaluated by examining the ability of the compound to inhibit, which in vitro assays of inhibition are known to those of skill in the art. A therapeutically effective amount of a therapeutic compound can reduce the size of a tumor, or otherwise improve the symptoms of a subject. A person of ordinary skill in the art will be able to determine these amounts based on factors such as the size of the subject, the severity of the subject's symptoms, and the particular composition or route of administration selected.

[0459] The composition must be sterile and have a degree of fluidity such that the composition can be delivered by syringe. In addition to water, the delivery vehicle can be an isotonic buffered salt solution, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, in the case of dispersions by maintaining the desired particle size, and by using surfactants. In many cases, it is preferred to include an isotonic agent in the composition, such as sugars, polyols (such as mannitol or sorbitol) and sodium chloride. Prolonged absorption of the injectable composition can be achieved by including an agent that delays absorption, such as aluminum monostearate or gelatin.

[0460] As described above, when a suitable protective compound is present, the compound can be administered orally, for example, together with an inert diluent or an assimilable edible delivery vehicle.

[0461] F. Nucleic Acids

[0462] As used herein, the term "nucleic acid molecule" is intended to include DNA molecules and RNA molecules. The nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA.

[0463] As used herein, the term "isolated nucleic acid molecule" refers to a nucleic acid that encodes a binding domain, antibody, or antibody portion (e.g., V H , V L , CDR3) that binds to CD27 and / or PD-L1, and is intended to refer to a nucleic acid molecule in which the nucleotide sequence encoding the binding domain, antibody, or antibody portion does not have other nucleotide sequences encoding binding domains, antibodies, or antibody portions that bind antigens other than CD27 and / or PD-L1, where the other sequences may be naturally flanking the nucleic acid in the human genomic DNA.

[0464] The nucleic acid can be present in intact cells, cell lysates, or in a partially purified or substantially pure form. By standard techniques well known in the art, which include alkaline / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, etc., the nucleic acid is "isolated" or "substantially purified" when purified from other cellular components or other contaminants (e.g., other cellular nucleic acids or proteins). See F. Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York (1987)).

[0465] The nucleic acid molecules of the invention from cDNA, genomic, or mixtures thereof, while usually in the native sequence (except for modified restriction sites, etc.), can be mutated according to standard techniques for providing gene sequences. For coding sequences, these mutations can affect the desired amino acid sequence. Specifically, DNA sequences that are substantially identical to the native V, D, J, constant, switch, and other such sequences as described herein, or DNA sequences derived therefrom (where "derived from" means that one sequence is identical to or modified from another sequence), are contemplated.

[0466] A nucleic acid is "operably linked" or "operatively linked" when it is in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. With respect to transcriptional regulatory sequences, operably linked means that the DNA sequences being linked are contiguous, and in the case of two protein-coding regions, they must be contiguous and in-frame. For switch sequences, operably linked means that the sequence is capable of affecting switch recombination.

[0467] Also provided are isolated nucleic acid molecules encoding the binding domains, antibodies or antigen-binding portions thereof, bispecific constructs, and multispecific constructs described herein, as well as expression vectors containing such nucleic acids and host cells containing such expression vectors. In another embodiment, provided are nucleic acid molecules encoding any of the binding domains, antibodies or antigen-binding portions thereof, bispecific constructs, or multispecific constructs described herein. In another embodiment, the nucleic acid molecule is in the form of an expression vector. In another embodiment, the nucleic acid molecule is in the form of an expression vector that, when administered in vivo to a subject, expresses a binding domain, antibody or antigen-binding portion thereof, bispecific construct, or multispecific construct.

[0468] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence encoding an antibody variable region, wherein the antibody variable region comprises the amino acid sequence depicted in SEQ ID NOs: 17, 18, 19, 20, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or an amino acid sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to one or more of the foregoing sequences). In another embodiment, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NOs: 25, 26, 27, 28, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112 or a nucleotide sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to one or more of the foregoing sequences).

[0469] In another embodiment, the nucleic acid molecule comprises a nucleotide sequence encoding the heavy and light chain variable regions of an antibody, wherein the heavy and light chain variable regions respectively comprise the amino acid sequence depicted in SEQ ID NOs: 17 and 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 77 and 78, SEQ ID NOs: 79 and 80, SEQ ID NOs: 81 and 82, SEQ ID NOs: 83 and 84, SEQ ID NOs: 85 and 86 or SEQ ID NOs: 87 and 88, or an amino acid sequence having at least 90% identity thereto (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the foregoing sequences).

[0470] As used herein, the term "vector" is intended to mean a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, into which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of the host cell upon introduction into the host cell and, thereby, replicated along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably because plasmids are the most commonly used form of vector. However, the present invention is intended to include other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), which are useful for equivalent functions.

[0471] As used herein, the term "recombinant host cell" (or simply "host cell") is intended to mean a cell into which a recombinant expression vector has been introduced. It should be understood that these terms are intended to refer not only to the particular subject cell but also to the progeny of such a cell. Because certain modifications may occur in progeny due to mutation or environmental influences, such progeny may in fact be different from the parent cell, but are still included within the scope of the term "host cell" as used herein.

[0472] G. Combination Therapy

[0473] Any binding domain, antibody, antigen-binding fragment thereof, bispecific construct, and / or multispecific construct described herein can be administered in combination with another therapy, i.e., in combination with other agents. The term "co-administered" as used herein includes any or all of simultaneous, separate, or sequential administration of the binding domain, antibody, antigen-binding fragment thereof, bispecific construct, or multispecific construct described herein with adjuvants and other agents, including administration as part of a dosing regimen. For example, the combination therapy can include co-administering any binding domain, antibody, antigen-binding fragment thereof, bispecific construct, and / or multispecific construct described herein with at least one or more other therapeutic agents, such as anti-inflammatory agents, DMARDs (disease-modifying anti-rheumatic drugs), immunosuppressants, chemotherapy, radiotherapy, other antibodies, cytotoxins, and / or drugs, as well as adjuvants, immunostimulants, and / or immunosuppressants.

[0474] In the treatment of tumors, chemotherapeutic agents suitable for co - administration with the binding domains, antibodies, antigen - binding fragments thereof, bispecific constructs, and / or multispecific constructs described herein include, for example: taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 - dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, and their analogs or homologs. Other agents also include, for example, antimetabolites (such as methotrexate, 6 - mercaptopurine, 6 - thioguanine, cytarabine, 5 - fluorouracil dacarbazine), alkylating agents (such as nitrogen mustard, thiotepa, chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozocin, mitomycin C and cis - dichlorodiamine platinum(II) (DDP) cisplatin), anthracyclines (such as daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (such as dactinomycin (formerly actinomycin), bleomycin, mithramycin and anthramycin (AMC)), antimitotic agents (such as vincristine and vinblastine) and temozolomide.

[0475] For example, agents that eliminate or inhibit immunosuppressive activity through immunosuppressive factors (such as TGF - β, indoleamine 2,3 - dioxygenase - IDO) produced in the tumor local microenvironment by immune cells (such as regulatory T cells, NKT cells, macrophages, myeloid - derived suppressor cells, immature or inhibitory dendritic cells) or tumor or host cells can also be co - administered with the binding domains, antibodies, antigen - binding fragments thereof, bispecific constructs, and / or multispecific constructs described herein. Such reagents include antibodies and small - molecule drugs, such as IDO inhibitors (such as 1 - methyltryptophan or derivatives).

[0476] Suitable agents for co - administration with the binding domains, antibodies, antigen - binding fragments thereof, bispecific constructs, and / or multispecific constructs described herein for treating such immune disorders include, for example, immunosuppressive agents (such as rapamycin, cyclosporine, and FK506); anti - TNF agents (such as etanercept, adalimumab, and infliximab); and steroids. Examples of specific natural and synthetic steroids include, for example: aldosterone, beclomethasone, betamethasone, budesonide, cloprednol, cortisone, corticosterone, desonide, desoximetasone, dexamethasone, difluorocortolone, fluclorolone, flumethasone, flunisolide, fluocinolone, fluocinonide, flucortin butyl, fludrocortisone, fluorocortolone, fluorometholone, fluocinolone acetonide, fluticasone, halcinonide, hydrocortisone, icomethasone, methylprednisolone, methylprednisolone, paramethasone, prednisolone, prednisone, tixocortol, and triamcinolone.

[0477] Suitable agents for co - administration with the binding domains, antibodies, antigen - binding fragments thereof, bispecific constructs, and / or multispecific constructs described herein for inducing or enhancing an immune response include, for example, adjuvants and / or immunostimulants, non - limiting examples of which have been disclosed above. In one embodiment, the immunostimulant is a TLR3 agonist, such as Poly IC.

[0478] As used herein, the term "immunostimulant" includes, but is not limited to, compounds capable of stimulating antigen-presenting cells (APCs), such as dendritic cells (DCs) and macrophages. For example, suitable immunostimulants for use in the present invention are capable of stimulating APCs, thereby accelerating the maturation process of APCs, increasing the proliferation of APCs, and / or recruiting or releasing costimulatory molecules (such as CD80, CD86, ICAM-1, MHC molecules, and CCR7) and upregulating pro-inflammatory cytokines (such as IL-1β, IL-6, IL-12, IL-15, and IFN-γ). Suitable immunostimulants are also capable of increasing T cell proliferation. Such immunostimulants include, but are not limited to, CD40 ligand, FLT3 ligand; cytokines (such as IFN-α, IFN-β, IFN-γ, and IL-2); colony-stimulating factors (such as G-CSF (granulocyte colony-stimulating factor) and GM-CSF (granulocyte-macrophage colony-stimulating factor)); anti-CTLA-4 antibody, anti-PD1 antibody, anti-41BB antibody, or anti-OX-40 antibody; LPS (endotoxin); ssRNA; dsRNA; Bacille Calmette-Guerin (BCG); levamisole hydrochloride; and intravenous immunoglobulin. In one embodiment, the immunostimulant can be a Toll-like receptor (TLR) agonist. For example, the immunostimulant can be a TLR3 agonist (such as double-stranded inosine:cytosine polynucleotide (Poly I:C, e.g., as Ampligen TM obtained from Hemispherx Bipharma, PA, US, or as Poly IC:LC obtained from Oncovir) or Poly A:U; a TLR4 agonist (such as monophosphoryl lipid A (MPL) or RC-529 (e.g., available from GSK, UK)); a TLR5 agonist (such as flagellin); a TLR7 or TLR8 agonist (such as imidazoquinoline); a TLR7 or TLR8 agonist (e.g., imiquimod (e.g., Aldara TM ) or resiquimod) and related imidazoquinoline agents (e.g., obtained from 3M); or a TLR9 agonist (such as deoxynucleotides having an unmethylated CpG motif (so-called "CpG-ODN", e.g., available from Coley Pharmaceutical)). These immunostimulants can be administered simultaneously, separately, or sequentially with the binding domains, antibodies, antigen-binding fragments thereof, bispecific constructs, and / or multispecific constructs described herein.

[0479] H. Uses and Methods of the Invention

[0480] The present invention provides methods for stimulating T cell activity, inducing or enhancing an immune response, and treating a disease or condition (such as cancer) by administering to a patient in need thereof a bispecific construct, multispecific construct, antibody or antigen-binding fragment thereof, or composition described herein.

[0481] As used herein, the term “cell-mediated response” or “cell activity” refers to any response mediated by T cells, including effector T cells (e.g., CD8 + cells) and helper T cells (e.g., CD4 + cells). T cell-mediated responses include, for example, T cell cytotoxicity and proliferation. Stimulation of T cell activity can be evaluated using any of a number of indicators of T cell activity known in the art. For example, enhancement of interferon-γ production by OKT3-stimulated T cells can be used as a measure of T cell activation. Stimulation of T cell activity can also be evaluated using an NF-κB-driven reporter gene system in cells expressing CD27. Other suitable assays for T cell activation are well established in the art.

[0482] The terms “inducing an immune response” and “enhancing an immune response” are used interchangeably and refer to the stimulation of an immune response (i.e., passive or adaptive) to a specific antigen.

[0483] As used herein, the terms “treat,” “treating,” and “treatment” refer to the therapeutic or prophylactic measures described herein. The “treatment” methods comprise administering to a subject in need of such treatment, e.g., a subject in need of enhanced immune response against a specific antigen, or a subject ultimately susceptible to such a disorder, a bispecific construct, multispecific construct, antibody, antigen-binding fragment thereof, or composition described herein, thereby preventing, curing, delaying, alleviating the severity of, or eliminating the disorder or one or more symptoms of a recurrent disorder, or thereby prolonging the survival of the subject beyond that expected in the absence of such treatment.

[0484] The term “effective dose” or “effective dosage” is defined as an amount sufficient to achieve or at least partially achieve the desired effect. The term “therapeutically effective dose” is defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. The effective amount for such use will depend on the severity of the disorder being treated and the general state of the patient's own immune system.

[0485] The term “patient” includes human and other mammalian subjects to which prophylaxis or treatment is administered.

[0486] As used herein, the term "growth inhibition" (e.g., in reference to a cell) is intended to include any measurable decrease in the growth of a cell, e.g., inhibition of cell growth by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% or 100%.

[0487] In one aspect, provided are methods of stimulating T cell activity, the methods comprising contacting a T cell with any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein. Stimulating T cell activity can include, for example, stimulating the production of IFN-.

[0488] In another aspect, methods for inducing or enhancing an immune response (e.g., an immune response against an antigen) in a subject, comprising administering to the subject an amount of any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein effective to induce or enhance an immune response (e.g., against an antigen) in the subject.

[0489] In another aspect, provided are methods for treating a condition or disease in a subject, the methods comprising administering to the subject an amount of any one of the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs or compositions described herein effective to treat the condition or disease.

[0490] In another aspect, provided are methods for treating a condition or disease in a subject, wherein the methods comprise administering to the subject a combination of any one of the anti-CD27 antibodies or antigen-binding fragments thereof described herein and any one of the anti-PD-L1 antibodies or antigen-binding fragments thereof described herein. For example, in one embodiment:

[0491] (i) The anti-CD27 antibody or antigen-binding fragment thereof is selected from the group consisting of: (a) an anti-CD27 antibody or antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 1, 2 and 3, respectively, and light chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 4, 5 and 6, respectively, and (b) an anti-CD27 antibody or antigen-binding fragment thereof comprising heavy chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 7, 8 and 9, respectively, and light chain variable region CDR1, CDR2 and CDR3 as set forth in SEQ ID NOs: 10, 11 and 12, respectively; and

[0492] (ii) The anti-PD-L1 antibody or its antigen-binding fragment is selected from the group consisting of: (a) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 29, 30, and 31, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 32, 33, and 34, respectively; (b) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 35, 36, and 37, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 38, 39, and 40, respectively; (c) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 41, 42, and 43, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 44, 45, and 46, respectively; (d) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 47, 48, and 49, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 50, 51, and 52, respectively; (e) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 53, 54, and 55, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 56, 57, and 58, respectively; (f) an anti-PD-L1 antibody or its antigen-binding fragment comprising heavy chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 59, 60, and 61, respectively, and light chain variable region CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 62, 63, and 64, respectively.

[0493] In another embodiment,

[0494] (i) The anti-CD27 antibody or its antigen-binding fragment is selected from the group consisting of: (a) an anti-CD27 antibody or its antigen-binding fragment comprising a heavy chain variable region containing SEQ ID NO: 17 and a light chain variable region containing SEQ ID NO: 18; and (b) an anti-CD27 antibody or its antigen-binding fragment comprising a heavy chain variable region of SEQ ID NO: 19 and a light chain variable region or sequence of SEQ ID NO: 20; and

[0495] (ii) The anti-PD-L1 antibody or antigen-binding fragment thereof is selected from the group consisting of: (a) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 77 and a light chain variable region containing SEQ ID NO: 78; (b) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 79 and a light chain variable region containing SEQ ID NO: 80; (c) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 81 and a light chain variable region containing SEQ ID NO: 82; (d) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84; (e) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 85 and a light chain variable region containing SEQ ID NO: 86; and (f) an anti-PD-L1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO: 88.

[0496] In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered separately. In one embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered sequentially. For example, the anti-CD27 antibody or antigen-binding fragment thereof can be administered first, followed by (e.g., immediately followed by) the anti-PD-L1 antibody or antigen-binding fragment thereof, and vice versa. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered together. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered simultaneously. In another embodiment, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are administered simultaneously in a single formulation. Alternatively, the anti-CD27 antibody or antigen-binding fragment thereof and the anti-PD-L1 antibody or antigen-binding fragment thereof are formulated for separate administration and administered simultaneously or sequentially. Such simultaneous or sequential administration preferably results in the presence of both antibodies in the treated patient.

[0497] In certain embodiments, the administration of any anti-CD27 antibody or antigen-binding fragment thereof described herein in combination with any anti-PD-L1 antibody or antigen-binding fragment thereof described herein results in a synergistic effect (e.g., enhanced immune response in vivo) compared to the use of either antibody alone.

[0498] The subject can be, for example, a subject suffering from a condition or disease for which stimulation of an immune response is desired. In one embodiment, the condition or disease is cancer.Cancer types include, but are not limited to, leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, myeloblast promyelocyte myelomonocyte monocyte erythroleukemia, chronic leukemia, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, mantle cell lymphoma, primary central nervous system lymphoma, Burkitt’s lymphoma, and marginal zone B-cell lymphoma, polycythemia vera lymphoma, Hodgkin's disease, non-Hodgkin's disease, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, solid tumors, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon sarcoma, colorectal carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular tumor, lung carcinoma, small cell lung cancer, non-small cell lung cancer, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, nasopharyngeal carcinoma, esophageal carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, cervical cancer, choriocarcinoma, colorectal cancers, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer, intraepithelial neoplasia, kidney cancer, laryngeal cancer, liver cancer, lung cancer (small cell, large cell), melanoma, neuroblastoma; oral cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer; respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, and urinary system cancer.Particular cancers include tumors that express CD27 and are selected from the group consisting of chronic lymphocytic leukemia, mantle cell lymphoma, primary central nervous system lymphoma, Burkitt's lymphoma, and marginal zone B-cell lymphoma.

[0499] Other disease indications include bacterial, fungal, viral, and parasitic infectious diseases.

[0500] Methods of inducing or enhancing an immune response (e.g., against an antigen) in a subject as described herein can further comprise administering an antigen to the subject. As used herein, the term "antigen" refers to any natural or synthetic immunogenic substance, such as a protein, peptide, hapten, polysaccharide, and / or lipid. The bispecific constructs, multispecific constructs, antibodies, antigen-binding fragments thereof, or compositions described herein and the antigen can be administered simultaneously, or the bispecific constructs, multispecific constructs, antibodies, antigen-binding fragments thereof, or compositions can be administered before or after the antigen.

[0501] In one embodiment, the bispecific constructs, multispecific constructs, antibodies, antigen-binding fragments thereof, or compositions described herein are administered in combination with a vaccine to enhance the immune response against the vaccine antigen, such as a tumor antigen (thereby enhancing the immune response against the tumor) or an antigen from an infectious disease pathogen (thereby enhancing the immune response against the infectious disease pathogen). Thus, in one embodiment, the vaccine antigen can comprise, for example, an antigen or antigen composition capable of eliciting an immune response against a tumor or against an infectious disease pathogen, such as a virus, bacterium, parasite, or fungus. One or more antigens are derived from a tumor, such as the various tumor antigens previously disclosed herein. Alternatively, the one or more antigens can be derived from a pathogen, such as a virus, bacterium, parasite, and / or fungus.

[0502] Preferred antigens to be co-administered with the antibodies or antigen-binding fragments thereof, bispecific constructs, multispecific constructs, or compositions described herein include tumor antigens and vaccine antigens (e.g., bacterial, viral, or other pathogen antigens for which it is desirable to generate a protective immunity in a subject for vaccination purposes). Examples of other suitable pathogen antigens include tumor-associated antigens (TAAs), which include, but are not limited to, sequences that comprise all or part of the sequences of EGFR, EGFRvIII, gp100 or Pmel17, HER2 / neu, mesothelin, CEA, MART1, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MUC-1, GPNMB, HMW-MAA, TIM1, ROR1, CD19, and germ cell-derived tumor antigens.

[0503] Other suitable antigens include viral antigens for the prevention or treatment of viral diseases. Examples of viral antigens include, but are not limited to, HIV-1 env, HBsAg, HPV, FAS, HSV-1, HSV-2, p17, ORF2 and ORF3 antigens. Additionally, viral antigens or antigenic determinants can be derived from, for example: cytomegalovirus (especially human, such as gB or its derivatives); Epstein-Barr virus (such as gp350); flaviviruses (e.g., yellow fever virus, dengue virus, tick-borne encephalitis virus, Japanese encephalitis virus); hepatitis viruses such as hepatitis B virus (e.g., hepatitis B surface antigen, such as the PreS1, PreS2 and S antigens described in EP-A-414 374, EP-A-0304 578 and EP-A-198474), hepatitis A virus, hepatitis C virus and hepatitis E virus; HIV-1, (such as tat, nef, gp120 or gp160); human herpesviruses, such as gD or its derivatives, or immediate early protein, such as ICP27 from HSV1 or HSV2; human papillomavirus (e.g., HPV6, 11, 16, 18); influenza virus (whole live or inactivated virus, split influenza virus, which is grown in eggs or MDCK cells, or Vero cells or whole influenza virions (as described in Gluck, Vaccine, 1992, 10, 915-920), or its purified or recombinant proteins, such as NP, NA, HA or M proteins); measles virus; mumps virus; parainfluenza virus; rabies virus; respiratory syncytial virus (such as F and G proteins); rotavirus (including live attenuated virus); smallpox virus; varicella-zoster virus (such as gpI, II and IE63); and HPV virus responsible for cervical cancer (e.g., early protein E6 or E7, or a combination thereof, which is fused with a protein D delivery vector to form a protein D-E6 or E7 fusion from HPV 16; or a combination of E6 or E7 with L2 (see, for example, WO96 / 26277).

[0504] Examples of bacterial antigens include, but are not limited to, Toxoplasma gondii or Treponema pallidum. Bacterial antigens can be used to treat or prevent a variety of bacterial diseases, such as anthrax, botulism, tetanus, chlamydia, cholera, diphtheria, Lyme disease, syphilis, and tuberculosis. Bacterial antigens or epitopes can be derived from, for example: Bacillus spp., including Bacillus anthracis (e.g., botulinum toxin); Bordetella spp., including Bordetella pertussis (e.g., pertussis adhesin, pertussis toxin, filamentous hemagglutinin, adenylate cyclase, fimbriae); Borrelia spp., including Borrelia burgdorferi (e.g., OspA, OspC, DbpA, DbpB), Borrelia garinii (e.g., OspA, OspC, DbpA, DbpB), Borrelia afzelii (e.g., OspA, OspC, DbpA, DbpB), Borrelia andersonii (e.g., OspA, OspC, DbpA, DbpB), Borrelia hermsii; Campylobacter spp, including Campylobacter jejuni (e.g., toxin, adhesin, and invasins) and Campylobacter coli; Chlamydia spp, including Chlamydia trachomatis (e.g., MOMP, heparin-binding protein), Chlamydia pneumoniae (e.g., MOMP, heparin-binding protein), Chlamydia psittaci; Clostridium spp, including Clostridium tetani (e.g., tetanus toxin), Clostridium botulinum (e.g., botulinum toxin), Clostridium difficile (e.g., Clostridium toxin A or B); Corynebacterium spp, including Corynebacterium diphtheriae (e.g., diphtheria toxin); Ehrlichia spp, including Ehrlichia equi and agents for human granulocytic ehrlichiosis; Rickettsia spp, including Rickettsia rickettsii; Enterococcus spp, including Enterococcus faecalis, Enterococcus faecium; Escherichia spp, including enterotoxic Escherichia coli (e.g., colonization factor, heat-labile toxin or its derivatives, or heat-stable toxin), enterohemorrhagic Escherichiacoli), enteropathogenic Escherichia coli (e.g., Shiga-like toxins); Haemophilus spp., including Haemophilus influenzae type B (e.g., PRP), nontypeable Haemophilus influenzae, e.g., OMP26, high molecular weight adhesin, P5, P6, Protein D, and lipoproteins D, as well as fimbrin and fimbrin-derived peptides (see, e.g., US5,843,464); Helicobacter spp., including Helicobacter pylori (e.g., urease, catalase, vacuolating toxin); Pseudomonas spp., including Pseudomonas aeruginosa; Legionella spp., including Legionella pneumophila; Leptospira spp., including Leptospira interrogans (L. interrogans); Listeria spp., including Listeria monocytogenes; Moraxella spp., including Moraxella catarrhalis (M. catarrhalis), also known as Branhamella catarrhalis (e.g., high and low molecular weight adhesins and invasins); Moraxella catarrhalis (including its outer membrane vesicles and OMP106 (see, e.g., WO97 / 41731)); Mycobacterium spp., including Mycobacterium tuberculosis (e.g., ESAT6, antigen 85A, -B or -C), Mycobacterium bovis, Mycobacterium leprae, Mycobacterium avium, Mycobacterium paratuberculosis, Mycobacterium smegmatis; Neisseria spp., including Neisseria gonorrhoeae and Neisseria meningitidis (e.g., capsular polysaccharides and their conjugates, transferrin-binding proteins, lactoferrin-binding proteins, PilC, adhesins); Neisseria meningitidis serogroup B (including its outer membrane vesicles and NspA (e.g., see WO 96 / 29412)); Salmonella spp., including Salmonella typhi, Salmonella paratyphi, Salmonella choleraesuis, Salmonella enteritidis; Shigella spp., Shigella sonnei (S. sonnei), Shigella dysenteriae, Shigella flexnerii (S. flexnerii); Staphylococcus spp., including Staphylococcus aureus, Staphylococcus epidermidis; Streptococcus spp., including Streptococcus pneumoniae (e.g., capsular polysaccharides and their conjugates, PsaA, PspA, streptolysin, choline-binding proteins) and the protein antigen pneumolysin (Biochem Biophys Acta, 1989, 67, 1007; Rubins et al., Microbial Pathogenesis, 25, 337-342) and its mutant detoxified derivatives (see, e.g., WO90 / 06951; WO99 / 03884); Treponema spp., including Treponema pallidum (e.g., outer membrane proteins), Treponema denticola (T. denticola), Treponema hyodysenteriae; Vibrio spp., including Vibrio cholerae (e.g., cholera toxin); and Yersinia spp., including Yersinia enterocolitica (e.g., Yop proteins), Yersinia pestis, Yersinia pseudotuberculosis..

[0505] Parasitic / fungal antigens or antigenic determinants can be derived from, for example: Babesia spp., including Babesia microti; Candida spp., including Candida albicans; Cryptococcus spp., including Cryptococcus neoformans; Entamoeba spp., including Entamoeba histolytica; Giardia spp., including Giardia lamblia; Leishmania spp., including Leishmania major; Plasmodium falciparum (MSP1, AMA1, MSP3, EBA, GLURP, RAP1, RAP2, Sequestrin, PfEMP1, Pf332, LSA1, LSA3, STARP, SALSA, PfEXP1, Pfs25, Pfs28, PFS27 / 25, Pfs16, Pfs48 / 45, Pfs230 and analogues thereof in the genus Plasmodium); Pneumocystis spp., including Pneumocystis carinii; Schistosoma spp., including Schistosoma mansoni; Trichomonas spp., including Trichomonas vaginalis; Toxoplasma spp., including Toxoplasma gondii (e.g. TAG2, SAG3, Tg34); Trypanosoma spp., including Trypanosoma cruzi).

[0506] It should be understood that according to this aspect of the invention, the antigens and antigenic determinants can be used in many different forms. For example, the antigen or antigenic determinant can exist as an isolated protein or peptide (e.g. in a so-called "subunit vaccine"), or for example as a cell-associated or virus-associated antigen or antigenic determinant (e.g. in a live or dead pathogen strain). The live pathogen will preferably be attenuated in a known manner. Alternatively, the antigen or antigenic determinant can be generated in situ in a subject by using a polynucleotide encoding the antigen or antigenic determinant (as in a so-called "nucleic acid vaccination"), although it should be understood that the polynucleotides that can be used for such methods are not limited to DNA and can also include RNA and modified polynucleotides as discussed above.

[0507] In one embodiment, the vaccine antigen can also be targeted to, for example, a specific cell type or a specific tissue. For example, the vaccine antigen can be targeted to antigen-presenting cells (APCs), for example by using agents such as antibodies that target APC surface receptors (such as DEC-205), as discussed in, for example, WO2009 / 061996 (Celldex Therapeutics), or the mannose receptor (CD206), as discussed in WO 03040169 (Medarex, Inc.).

[0508] I. Kits

[0509] Also provided are kits (e.g., diagnostic kits) that contain one or more of the anti-CD27 binding domains, anti-PD-L1 binding domains, bispecific constructs, multispecific constructs, or compositions described herein, optionally including instructions for use. The kits may also include an information booklet, e.g., a booklet that informs how to use the reagents to practice the methods disclosed herein. The term "booklet" includes any written, marketing material, or recorded material provided on or with the kit, or otherwise accompanying the kit.

[0510] The invention is further illustrated by the following examples, which should not be construed as further limiting. The content of the drawings cited throughout this application, as well as all references, patents, and published patent applications, are hereby expressly incorporated by reference.

[0511] V. EXAMPLES

[0512] Example 1: Generation of CD27-Specific Human Monoclonal Antibodies

[0513] Immunize transgenic mice of the H2L2 strain with soluble human CD27 antigen to generate human anti-CD27 monoclonal antibodies. The transgenic mice already have knockout endogenous murine heavy chain (HC) and κ light chain (κ-chain) DNA sequences, and sequences of human variable regions (V) and rat constant regions (C) stably incorporated into the murine genome.

[0514] Antigen and Immunization: The antigen is a soluble fusion protein that contains the extracellular domain of CD27 with an Fc tag (R&D Systems). The antigen is mixed with the MPL plus TDM adjuvant system (Sigma) for immunization. PBS containing 5 - 25 micrograms of soluble recombinant CD27 antigen is mixed 1:1 with the adjuvant. 200 microliters of the prepared antigen is injected intraperitoneally into the mice every 14 days. Animals that develop anti-CD27 titers are given an intravenous injection of 5 - 10 micrograms of soluble recombinant CD27 antigen three to four days prior to fusion. The spleens of the mice are harvested, and the isolated splenocytes are used for hybridoma preparation.

[0515] Preparation of Hybridomas: The P3x63Ag8.653 murine myeloma cell line (ATCC CRL 1580) is used for fusion. RPMI 1640 (Invitrogen) containing 10% FBS is used to culture the myeloma cells. Other media supplements are added to the hybridoma growth medium, which include: up to 10% of the hybridoma enhancement supplement (Sigma), 10% FBS (Sigma), L-glutamine (Gibco), 0.1% gentamicin (Gibco), 2-mercaptoethanol (Gibco), and HAT (Sigma; 1.0x 10 4M Hypoxanthine, 4.0x 10 -7 M Aminopterin, 1.6x 10 -5 M Thymidine Medium).

[0516] Spleen cells were mixed with P3x63Ag8.653 myeloma cells at a ratio of 6:1 and pelleted by centrifugation. Polyethylene glycol was added dropwise and carefully mixed to promote fusion. Hybridomas were allowed to grow for one to two weeks until visible colonies were established. The supernatant was harvested and used for the preliminary screening of rat IgG via ELISA using a specific detection of human soluble CD27 fusion protein and rat Fc. Then, the CD27 specificity of IgG-positive supernatants was determined via flow cytometry. The cross-reactivity of hybridomas with cynomolgus monkey CD27 was also screened, and all bindings were positive.

[0517] Hybridoma cells were amplified and the cell pellet was frozen for RNA isolation and sequencing. The V H and V L coding regions of human monoclonal antibodies were identified using RNA from the corresponding hybridomas. RNA was reverse transcribed to cDNA, the V coding regions were amplified by PCR and the PCR products were sequenced, inserted into a human IgG1 single vector, transiently expressed and purified by protein A column chromatography, which led to the isolation of antibodies of particular interest, designated 2B3 and 3C2.

[0518] Example 2: Assay for Determining the Binding Characteristics of Human Monoclonal Antibodies to CD27

[0519] Microtiter plates were coated with PBS containing recombinant human CD27-FLAG-HIS and then blocked with PBS containing 5% bovine serum albumin. Purified human monoclonal antibodies were added at various concentrations and incubated at 37°C. The plates were washed with PBS / Tween and then incubated at 37°C with a goat anti-human IgG Fc-specific polyclonal reagent conjugated to horseradish peroxidase. After washing, the plates were developed with HRP substrate and analyzed using a microtiter plate reader at OD 450 - 650 nm. Figure 1 The anti-CD27 antibodies 2B3 and 3C2 were shown to bind human CD27.

[0520] To establish cynomolgus monkeys as a relevant model for testing anti-CD27 monoclonal antibodies, microtiter plates were coated with PBS containing recombinant cynomolgus monkey CD27-FLAG-HIS and then blocked with PBS containing 5% bovine serum albumin. Hybridoma supernatant or rat IgG control was added and incubated at 37°C. The plates were washed with PBS / Tween and then incubated at 37°C with a mouse anti-rat IgG Fc-specific polyclonal reagent conjugated to horseradish peroxidase. After washing, the plates were developed with HRP substrate and analyzed using a microtiter plate reader at OD 450 - 650 nm.Figure 2 It is shown that the anti-CD27 antibodies 2B3 and 3C2 bind to cynomolgus monkey CD27.

[0521] Example 3: Binding to CD27 cells

[0522] The ability of anti-CD27 human monoclonal antibodies to bind to CD27 on cells expressing human CD27 on their surface was studied by flow cytometry as follows:

[0523] The binding of the antibodies to human cell lines expressing human CD27 on their surface was tested. Protein A-purified human monoclonal antibodies (3 μg / ml) were incubated with Ramos cells expressing human CD27 at room temperature on a plate shaker. After 20 minutes, the cells were washed with PBS (PBA) containing 0.1% BSA and 0.05% NaN3, and the bound antibodies were detected by incubating the cells with a PE-labeled goat anti-human IgG Fc-specific probe. Excess probe was washed out of the cells with PBA, and the FACSCanto II TM instrument (BD Biosciences, NJ, USA) was used to determine the fluorescence associated with the cells by analysis.

[0524] As Figure 3 shown, the anti-CD27 human monoclonal antibodies exhibited a high level of binding to cells expressing human CD27.

[0525] Example 4: Binding to human T cells

[0526] The ability of anti-CD27 human monoclonal antibodies to bind to CD27 on human T cells was studied by flow cytometry as follows:

[0527] The binding of the antibodies to human CD3 + T cells expressing human CD27 on their surface was tested. Human peripheral blood mononuclear cells were isolated from the buffy coat using Ficoll separation, and CD3 + cells were isolated from PBMCs using magnetic bead separation technology from Miltenyi Biotec. Protein A-purified human monoclonal antibodies (3 μg / ml) were incubated with the T cells at room temperature on a plate shaker. After 20 minutes, the cells were washed with PBS (PBA) containing 0.1% BSA and 0.05% NaN3, and the bound antibodies were detected by incubating the cells with a PE-labeled goat anti-human IgG Fc-specific probe. Excess probe was washed out of the cells with PBA, and the FACSCanto II TM instrument (BD Biosciences, NJ, USA) was used to determine the fluorescence associated with the cells by analysis.

[0528] As Figure 4 shown, the anti-CD27 human monoclonal antibody exhibits a high level of binding to human T cells.

[0529] Example 5: Blocking CD70 binding

[0530] The effect of human monoclonal antibodies on the binding of cell surface soluble CD70 to CD27 was measured by flow cytometry. Ramos cells expressing CD27 were incubated with the antibody (50 μg / ml) for 5 minutes at room temperature, followed by addition of human CD70 biotin ([final] = 0.5 μg / mL) for 20 minutes at room temperature on a plate shaker. CD70 captured by CD27 was detected with streptavidin PE and analyzed on a FACSCanto II M instrument (BD Biosciences, NJ, USA). Figure 5 It was shown that the anti-CD27 antibodies 2B3 and 3C2 blocked the binding of CD70 to CD27 on the cells.

[0531] Example 6: NFκB activation

[0532] The luciferase reporter cell line expressing CD27 was incubated with various concentrations of human anti-CD27 antibody at 37 °C, 6% CO2 for 6 hours. Luciferase is expressed upon activation and detected using Promega's luciferase assay system according to the manufacturer's guidelines. Figure 6 It was shown that the 2B3 and 3C2 antibodies induced a high level of NFκB activation as a function of antibody concentration.

[0533] Example 7: T cell proliferation

[0534] Human peripheral blood mononuclear cells (PBMCs) and CD3 + cells isolated from buffy coat preparations were further isolated from PBMCs using magnetic bead separation technology from Miltenyi Biotec. T cells were labeled with 1 mM carboxyfluorescein succinimidyl ester (CFSE) at room temperature while rotating for 5 minutes. The CFSE-labeled PBMCs (1 x 10 6 cells) were dispensed into wells dry-coated with 1 μg / mL of anti-CD3 antibody (OKT3, eBioscience) and 10 μg / mL of anti-CD27 antibody or human IgG1 control. The plates were incubated at 37 °C, 5% CO2 for 72 hours. The cells were collected and analyzed by flow cytometry on a FACSCanto II TM instrument (BD Biosciences, NJ, USA) according to the manufacturer's instructions. Figure 7 It was shown that the antibodies 2B3 and 3C2 significantly increased T cell proliferation.

[0535] Example 8: Generation of a PD-L1 Specific Human Monoclonal Antibody

[0536] Human anti-PD-L1 monoclonal antibodies were generated by immunizing the transgenic mouse H2L2 strain with soluble human PD-L1 antigen. The transgenic mice have endogenous murine heavy chain (HC) and κ light chain (κ-chain) DNA sequences knocked out and sequences of human variable regions (V) and rat constant regions (C) stably incorporated into the murine genome.

[0537] Antigen and Immunization: The antigen is a soluble fusion protein comprising the extracellular domain of PD-L1 with a HIS tag (R&D Systems) or a recombinant human PD-L1-msG2a chimeric protein (self-made). The antigen was mixed with the MPL plus TDM adjuvant system (Sigma) for immunization. PBS containing 5 - 25 μg of soluble recombinant PD-L1 antigen was mixed with the adjuvant at a 1:1 ratio. 200 μL of the prepared antigen was injected into the peritoneal cavity of the mice every 14 days. Animals that developed anti-PD-L1 titers were given an intravenous injection of 5 - 10 μg of soluble recombinant PD-L1 antigen three to four days prior to fusion. Mouse spleens were harvested and the isolated splenocytes were used for hybridoma preparation.

[0538] Preparation of Hybridomas: The P3x63Ag8.653 murine myeloma cell line (ATCC CRL 1580) was used for fusion. RPMI 1640 (Invitrogen) containing 10% FBS was used for culturing the myeloma cells. Other medium supplements were added to the hybridoma growth medium, including: up to 10% of the hybridoma enhancement supplement (Sigma), 10% FBS (Sigma), L-glutamine (Gibco), 0.1% gentamicin (Gibco), 2-mercaptoethanol (Gibco), and HAT (Sigma; 1.0x 10 4 M hypoxanthine, 4.0x 10 -7 M aminopterin, 1.6x 10 -5 M thymidine medium).

[0539] The splenocytes were mixed with P3x63Ag8.653 myeloma cells at a ratio of 6:1 and pelleted by centrifugation. Polyethylene glycol was added dropwise and carefully mixed to promote fusion. The hybridomas were allowed to grow for one to two weeks until visible colonies were established. The supernatant was harvested and used for preliminary screening of rat IgG via ELISA using a specific detection of human soluble PD-L1 fusion protein and rat Fc. The PD-L1 specificity of the IgG-positive supernatant was then determined via flow cytometry. The cross-reactivity of the hybridomas with cynomolgus monkey PD-L1 was also screened and all bindings were positive.

[0540] Hybridoma cells were amplified and the cell pellet was frozen for RNA isolation and sequencing. The V of human monoclonal antibodies was identified using RNA from the corresponding hybridoma H and V L coding regions. The RNA was reverse transcribed to cDNA, the V coding regions were amplified by PCR and the PCR products were sequenced, inserted into a human IgG1 vector, transiently expressed and purified by protein A column chromatography, which resulted in the isolation of multiple antibodies of particular interest, designated 1B3, 3B6, 4A3, 7H7, 8B1 and 9H9.

[0541] Example 9: Assay for determining the binding characteristics of human monoclonal antibodies to PD-L1

[0542] Microtiter plates were coated with PBS containing recombinant human PD-L1-msFc and then blocked with PBS containing 5% bovine serum albumin. Human monoclonal antibodies purified with Protein A were added at various concentrations and incubated at 37 °C. The plates were washed with PBS / Tween and then incubated at 37 °C with a goat anti-human IgG Fc-specific polyclonal reagent conjugated to horseradish peroxidase. After washing, the plates were developed with HRP substrate and analyzed using a microtiter plate reader at OD 450 - 650 nm. Figure 8 It was shown that the anti-PD-L1 antibodies bind firmly to human PD-L1 as a function of antibody concentration.

[0543] To establish cynomolgus monkeys as a relevant model for testing anti-PD-L1 monoclonal antibodies, microtiter plates were coated with PBS containing recombinant cynomolgus monkey PD-L1-FLAG-HIS and then blocked with PBS containing 5% bovine serum albumin. Hybridoma supernatants or rat IgG controls were added and incubated at 37 °C. The plates were washed with PBS / Tween and then incubated at 37 °C with a mouse anti-rat IgG Fc-specific polyclonal reagent conjugated to horseradish peroxidase. After washing, the plates were developed with HRP substrate and analyzed using a microtiter plate reader at OD 450 - 650 nm. Figure 9 It was shown that the anti-PD-L1 antibodies bind to cynomolgus monkey PD-L1.

[0544] Example 10: Blocking PD1 binding

[0545] The effect of human monoclonal antibodies on the binding of soluble PD1 to PD-L1 on the cell surface was measured by flow cytometry. 293 cells expressing PD-L1 were incubated with the antibody at room temperature for 5 minutes, followed by the addition of human PD1-biotin ([final] = 0.5 mg / mL). PD1 captured by PD-L1 was detected with streptavidin PE and analyzed on a FACSCanto II TM instrument (BD Biosciences, NJ, USA).Figure 10 The display shows the blockade of the binding of anti-PD-L1 antibody to PD-L1 as a function of antibody concentration.

[0546] Example 11: Binding to PD-L1 cells

[0547] The ability of an anti-PD-L1 human monoclonal antibody to bind to PD-L1 on human cells expressing human PD-L1 on their surface was studied by flow cytometry as follows:

[0548] The binding of the antibody to a human cell line expressing human PD-L1 on its surface was tested. The protein A-purified human monoclonal antibody was incubated with 293 cells expressing human PD-L1 at room temperature on a plate shaker. After 20 minutes, the cells were washed with PBS (PBA) containing 0.1% BSA and 0.05% NaN3, and the bound antibody was detected by incubating the cells with a PE-labeled goat anti-human IgG Fc-specific probe. The excess probe was washed from the cells with PBA, and the fluorescence associated with the cells was determined by analysis using a FACSCanto II TM instrument (BD Biosciences, NJ, USA).

[0549] As Figure 11 shown, the anti-PD-L1 human monoclonal antibody exhibited a high level of binding to cells expressing human PD-L1 as a function of antibody concentration.

[0550] Example 12: Binding to human dendritic cells

[0551] The ability of an anti-PD-L1 human monoclonal antibody to bind to PD-L1 on human dendritic cells was studied by flow cytometry as follows:

[0552] The binding of the antibody to human dendritic cells expressing human PD-L1 on their surface was tested. Dendritic cells were generated as follows: PBMCs were added to a T175 cm 2In a flask, monocytes were allowed to adhere for approximately 2 hours at 37 °C and 6% CO2. Non-adherent cells were removed, and the monocytes were cultured for 7 days in RPMI containing 10% FBS, 10 ng / mL IL-4 (R&D Systems), and 100 ng / mL GM-CSF (R&D Systems). Non-adherent cells were harvested and confirmed to be dendritic cells by the expression of CD11c (not shown). Protein A-purified human monoclonal antibodies were incubated with dendritic cells on a plate shaker at room temperature. After 20 minutes, the cells were washed with PBS (PBA) containing 0.1% BSA and 0.05% NaN3, and bound antibodies were detected by incubating the cells with a PE-labeled goat anti-human IgG Fc-specific probe. Excess probe was washed from the cells with PBA, and fluorescence associated with the cells was determined by analysis using a FACSCanto II TM instrument (BD Biosciences, NJ, USA).

[0553] As Figure 12 shown, the anti-PD-L1 human monoclonal antibody exhibited a high level of binding to human dendritic cells as a function of antibody concentration.

[0554] Example 13: T cell PD1 / PD-L1 blockade bioassay

[0555] The effect of PD-L1 antibodies on the blockade of PD1 / PD-L1 interaction was determined using a PD1 / PD-L1 Blockade Assay from Promega. In the presence of antibody, two engineered cell lines, PD1 effector cells and PD-L1 aAPC / CHO-K1 cells, were co-cultured for 6 hours. Blockade of the PD1 / PD-L1 interaction results in TCR activation and induction of luminescence via the NFAT pathway. Luminescence was detected by the addition of Bio-Glo reagent and quantified on a Perkin Elmer Victor X luminometer. As Figure 13 shown, anti-PD-L1 antibodies effectively blocked the PD1 / PD-L1 interaction between cells to activate the NFAT pathway.

[0556] Example 14: Mixed lymphocyte reaction

[0557] Human peripheral blood monocytes were isolated from buffy coats using Ficoll separation, and CD4 + cells were isolated from PBMCs using magnetic bead separation technology from Miltenyi Biotec. Allogeneic dendritic cells were generated as follows: PMBCs were added to T175 cm 2In a flask, monocytes were allowed to adhere for approximately 2 hours at 37°C and 6% CO2. Non-adherent cells were removed, and monocytes were cultured in RPMI containing 10% FBS, 10 ng / mL IL-4 (R&D Systems), and 100 ng / mL GM-CSF (R&D Systems) for 7 days. Non-adherent cells were harvested and confirmed to be dendritic cells by the expression of CD11c (not shown). CD4 + cells and DCs were co-incubated at a ratio of 10:1 in the presence of antibody diluent for 3 days. Supernatants were harvested and analyzed for IL-2 production by ELISA (R&D Systems). As Figure 14 shown, anti-PD-L1 antibody was able to induce a significant mixed lymphocyte reaction.

[0558] Example 15: Development and functional testing of bispecific constructs

[0559] A tetravalent bispecific construct was developed using a fully human IgG1 backbone for the anti-PD-L1 monoclonal antibody and an scFv of a CD27 monoclonal antibody genetically linked to the C-terminus of the heavy chain. Additional bispecific constructs were also developed using a fully human IgG1 backbone for the CD27 monoclonal antibody and an scFv of the PD-L1 monoclonal antibody. Figure 15A A representative vector containing the CD27 light chain, CD27 heavy chain, and a C-terminal PD-L1 single-chain Fv (VL+VH) polypeptide is shown. Figure 15B and 15C are two alternative descriptions of the CD27 / PD-L1 bispecific format. Figure 15B The CD27 / PD-L1 bispecific antibody protein is shown, where the anti-PD-L1 antibody is linked to the anti-CD27 scFv (referred to herein as ", herein referred to as "vv, otherwise AbXx2B3 when the anti-PD-L1 antibody is 9H9 and the anti-CD27 scFv is derived from 2B3), and Figure 15C shows the CD27 / PD-L1 bispecific antibody protein where the anti-CD27 antibody is linked to the anti-PD-L1 scFv. Figure 15D is a table of the representative anti-CD27 / anti-PD-L1 bispecific constructs generated.

[0560] The full 9H9x2B3 (CDX-527) heavy chain sequence is as follows (where the IgG1 constant region sequence is shown in bold):

[0561]

[0562] The 9H9x2B3 (CDX-527) light chain sequence is as follows (constant region sequence shown in bold):

[0563]

[0564] Example 16: Assays for Determining the Binding Characteristics and Functional Activity of Bispecific Monoclonal Antibodies

[0565] The binding of the bispecific constructs to CD27 and PD-L1 was evaluated using a bifunctional ELISA. Antibody AbX is a known anti-PD-L1 monoclonal antibody. Briefly, microtiter plates were coated with human CD27-FLAG-HIS. Dilutions of the bispecific constructs were allowed to bind before the addition of human PD-L1-msFc, which was detected with an HRP-labeled goat anti-mouse IgG (Fc-specific) antibody. Representative binding curves for three bispecific constructs (CD27xAbX, CD27x8B1, and CD27x9H9) are shown as Figure 16 follows. All three antibodies showed significant binding to both CD27 and PD-L1.

[0566] Activation of the CD27 pathway was evaluated by measuring NFκB activation. Briefly, CD27 was transfected into an NFκB-luciferase reporter cell line (Signosis). Cells were incubated with each bispecific construct or antibody (1F5xAbX, 2B3x8B1, 2B3x9H9, 1F5, 2B3, or huIgG1) for 6 hours, and then luciferase expression was detected using the Brite-Glo TM system (Promega). Note: The reporter cell line is positive for human PD-L1. Figure 17 The level of NFκB activation induced by the antibodies is shown as a function of concentration. Additionally, the bispecific constructs 1F5xAbX, 2B3x8B1, and 2B3x9H9 showed significantly higher NFκB activation than 1F5 or 2B3 alone.

[0567] PD-1 signaling blockade was evaluated by measuring the activation of the NFAT pathway. Briefly, PD-1 effector cells and PD-L1 aAPC cells were co-cultured in the presence of dilutions of each bispecific construct or control antibody (CD27xAbX, CD27x8B1, CD27x9H9, or huIgG1). Activation of the NFAT pathway blocked via PD-L1 / PD-1 was detected by the addition of the Bio-GloTM reagent. (A kit commercially available from Promega). As Figure 18 shown, the bispecific constructs induced strong NFAT pathway activation as a function of antibody concentration.

[0568] IL-2 production / secretion was also measured in a mixed lymphocyte reaction. Briefly, CD4 cells were incubated for 3 days in the presence of allogeneic dendritic cells and a dilution of each bispecific construct or antibody (CD27xAbX, CD27x8B1, CD27x9H9, huIgG1, AbX, 8B1, or 9H9). Supernatants were harvested and IL-2 levels were assessed by ELISA (R&D Systems). Representative IL-2 concentration curves are shown in Figure 2. Figure 19 The bispecific constructs CD27xAbX, CD27x8B1, and CD27x9H9 showed significantly higher IL-2 production / secretion than AbX (a known anti-PD-L1 monoclonal antibody), 8B1, or 9H9 alone (e.g., approximately 2x higher IL-2 production).

[0569] Example 17: Assays to determine in vivo activity of CD27 / PD-L1 bispecific constructs

[0570] As indicated on the x-axis of each graph, HuCD27-Tg mice were injected with 0.1 mg of a bispecific CD27xAbX construct (BsAb) or a CD27 monospecific antibody (mAb) and 5 mg of ovalbumin on day 0. On day 7, splenocytes were harvested and the intracellular cytokines IFNγ and IL2 and the lytic enzyme granzyme B (GrB) were analyzed by flow cytometry in the presence and absence of SIINFEKL peptide in vitro. The percentages of SIINFEKL-specific IFN-γ and IL2+ in CD8 T cells are shown ( Figure 20A ), GrB in CD8 T cells without SIINFEKL stimulation + Percentage ( Figure 20B ), indicating that the CD27xAbX bispecific construct induced a significant CD8 T cell response (e.g., about 2.5x to about 8x higher response) compared to the CD27 monoclonal antibody alone.

[0571] Tumor growth, survival, and number of tumor infiltrates were also measured in mice treated with BsAb or mAbs. HuCD27-Tg mice were treated with BCL1 cells (5×10 6 On day 5, the antibody or bispecific construct was injected intraperitoneally (0.2 mg). The mice were divided into two groups. One group was used to measure survival (n=8). Figure 21Shows the percentage survival over time of mice treated with any of CD27 monoclonal antibody, PD-L1 monoclonal antibody, CD27 + PD-L1 monoclonal antibody combination, or CD27xAbX BsAb. Mice treated with CD27 + PD-L1 antibody survived significantly longer than mice treated with CD27 monoclonal antibody, PD-L1 monoclonal antibody, or Hu IgG1 alone (e.g., 1.5 to 2 times longer). In addition, mice treated with CD27xAbXBsAb survived significantly longer than mice treated with any of the other tested antibodies alone or in combination. In fact, 70% to 80% of the mice treated with CD27xAbX BsAb were still alive 80 days after tumor inoculation, while all the mice in the other groups had died. After 180 days of follow-up, three surviving mice were re-challenged with the same number of BCL1 cells, and they were protected from re-challenge.

[0572] A second group of mice was used to measure tumor weight and T cell levels on day 11. Figure 22A - 22D Tumor weight, percentage CD8 T cells, percentage CD4 T cells, and IFNγ and GrB double-positive CD8 T cells are shown, respectively. Similar to the survival data, CD27xAbX BsAb significantly reduced tumor weight (e.g., 1.5x to 3x reduction) and significantly increased T cell numbers and activity (e.g., 1.5x to 4x increase) compared to any of the other tested antibodies alone or in combination. Figure 23A and 23B Shows the upregulation of PD-L1 expression levels on the surface of BCL1 lymphoma cells ( Figure 23A ) and tumor microenvironment infiltrating cells ( Figure 23B ) after treatment with CD27 mAb (CDX-1127), providing a rationale for the combination of anti-CD27 and anti-PD-L1 or BsAb.

[0573] Example 18: Bifunctional ELISA

[0574] Characterization and binding of the bispecific construct CDX-527 (prepared as in Example 15) were analyzed. Figure 15E Characterization of the bispecific antibody CDX-527 by HPLC and gel electrophoresis (reducing conditions) is shown. As generally described in Example 16, binding to both CD27 and PD-L1 was determined using a bifunctional ELISA. The results are shown in Figure 24 from which it can be seen that CDX-527 shows significant binding to CD27 and PD-L1.

[0575] Example 19: Activation of NFkB by the bispecific construct CDX-527

[0576] To determine the activation of NF-κB by the bispecific construct CDX-527 (prepared as in Example 15) as generally described in Example 16, except that SteadyGlo from Promega TM reagent was used instead of BriteGlo TM .

[0577] The results are shown in Figure 25 which shows a higher level of activation of CDX-527 compared to the monospecific anti-CD27 antibodies 1F5 and 2B3 alone. Activation was also measured in the presence of soluble FcγR1, as shown in the figure, which further increased NF-κB activation.

[0578] Example 20: Mixed lymphocyte reaction

[0579] The ability of the bispecific construct CDX-527 (prepared as in Example 15) to induce a mixed lymphocyte reaction was determined by the method generally described in Example 14 and tested for IL-2.

[0580] The results are shown in Figure 26 from which it can be seen that CDX-527 was able to induce a significant mixed lymphocyte reaction, which was also significantly higher than the mixed lymphocyte reaction of the monospecific antibodies 2B3 and 9H9 when used alone or in combination.

[0581] Example 21: T cell activation

[0582] Human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coat preparations and CD3+ cells were further isolated from PBMCs using magnetic bead separation technology from Miltenyi Biotec. CD3+ cells (1 x 10 5 cells) were aliquoted into wells coated with anti-CD3 antibody (OKT3, eBioscience) and soluble human PD-L1. The antibodies 2B3 and 9H9 or CDX-527 (prepared as in Example 15) were added to the cells at concentrations from 0.1 nM to 10 nM. The plates were incubated at 37 °C, 5% CO2 for 72 hours, at which time the level of IL-2 in the supernatant was measured.

[0583] The results are shown in Figure 27 from which it can be seen that CDX-527 significantly activated T cells and activated T cells to a significantly greater extent than the combination of the monospecific antibodies 2B3 and 9H9.

[0584] Example 22: Pharmacokinetics

[0585] The pharmacokinetics of CDX-527 were studied in non-human primates (NHPs) at a dose level of 7.0 mg / kg and a volume of intravenous injection of 3.0 ml / kg. No significant changes in any clinical parameters were observed during the 21-day study. The serum levels of CDX-527 were determined by ELISA.

[0586] The results showed in Figure 28 . Pharmacokinetic analysis resulted in a T1 / 2 of approximately 110 hours.

[0587] Example 23: Cell-based PD1 / PDL1 blockade assay

[0588] As generally described in Example 13, in a cell-based PD1 / PDL1 blockade assay, the bispecific antibodies 9H9x2B3 and the opposite configuration 2B3x9H9 were compared.

[0589] The results showed in Figure 29 , from which it can be seen that the 9H9x2B3 configuration is more effective in blocking PD-1 signaling than the 2B3x9H9 configuration.

[0590] Example 24: Mixed lymphocyte reaction

[0591] As generally described in Example 14, in a mixed lymphocyte reaction, the bispecific antibodies 9H9x2B3 and the opposite configuration 2B3x9H9 were compared.

[0592] The results showed in Figure 30 , from which it can be seen that the 9H9x2B3 configuration is more effective in activating T cells than the 2B3x9H9 configuration.

[0593] Example 25: Vaccine-induced CD8 T cell response

[0594] As generally described in Example 17, in a vaccine model of T cell response, the bispecific antibodies AbXx2B3 and the opposite configuration 2B3xAbX were compared.

[0595] The results showed in Figure 31 , from which it can be seen that AbXx2B3 is more effective than 2B3xAbX in stimulating vaccine-induced CD8+ T cell responses.

[0596] Example 26: BCL1 tumor model

[0597] As generally described in Example 17, in a BCL1 tumor model, the bispecific antibodies AbXx2B3 and the opposite configuration 2B3xAbX were compared.

[0598] The results showed in Figure 32Among them, it can be seen that AbXx2B3 has greater anti-tumor activity than 2B3xAbX.

[0599] Example 27: Blocking of the binding of PD-L1 to CD80

[0600] Microtiter plates were coated with recombinant human CD80 and then blocked. Biotinylated huPD-L1 was pre-incubated with 50 ug / mL of huIgG1 control or anti-PD-L1 antibodies (AbX or 9H9) at room temperature for 1 hour and then added to the plates. Streptavidin-HRP was used to detect the binding of PD-L1 to CD80.

[0601] The results are shown in Figure 33 Among them, it can be seen that the anti-PD-L1 antibody completely blocked the binding of PD-L1 to CD80.

[0602] Example 28: Binding of 2B3 to huCD27

[0603] Human CD27 or the full-length wild-type extracellular domain (ECD) of human CD27 with mutations at amino acids 85, 87, 88, and 89 (A85S, R87A, N88A, and G89A; see Figure 34 ) were coated on plates and then blocked. Supernatants from transiently transfected cells expressing mAb 2B3 were added, and binding was detected with HRP-conjugated goat anti-human IgG Fc polyclonal antibody.

[0604] The results are shown in Figure 35 Among them, it can be seen that the anti-CD27 antibody 2B3 does not bind to the mutant CD27 ECD. Therefore, this indicates that the antibody 2B3 binds to an epitope on human CD27 that involves or includes one or more residues within amino acids 85 - 89, for example, one or more residues within amino acids 80 - 95 of the extracellular domain (ECD) of human CD27 (SEQ ID NO: 183), for example, amino acids 85, 87, 88, and / or 89 of the ECD of human CD27 (SEQ ID NO: 183).

[0605] Example 29: Increasing 9H9x2B3 expression by protein engineering: 9H9 - 2B3(DD)

[0606] To increase the expression of the bispecific product, the rare valine (V) residue at H72 in the 2B3 heavy chain FR3 and the rare asparagine (N) residue at L82 in the 2B3 light chain FR3 were each changed to an aspartic acid (D) residue (i.e., V72D and N82D, respectively).

[0607] The modified 2B3 heavy chain sequence is as follows (CDRs underlined, modified residues in FR3 underlined twice):

[0608]

[0609] The modified 2B3 light chain sequences are as follows (CDRs are underlined and modified residues in FR3 are double-underlined):

[0610]

[0611] These sequences (named 2B3(DD)) are used in the scFv form, which is genetically linked to the C-terminus of the 9H9 heavy chain. The resulting 9H9x2B3(DD) bispecific antibody is named 9H9x2B3(DD).

[0612] The full 9H9x2B3(DD) heavy chain sequence is as follows (where the IgG1 constant "framework" sequence is shown in bold):

[0613]

[0614]

[0615] The 9H9x2B3(DD) heavy chain sequence is as follows (constant regions are shown in bold):

[0616]

[0617] The DNA sequence of the 9H9x2B3(DD) variable domain sequence is as follows:

[0618] GAAGTGCAACTGGTGGAGTCGGGTGGTGGACTCGTGCAGCCCGGCGGATCCCTGAGACTCTCTTGTGCCGCATCGGGCGGCATTATTAGCACTTACTGGATGTCATGGGTCAGACAGGCACCGGGAAAGGGCTTGGAATGGGTGGCGAATATCAAGCAGGATGGATCCGAGAAGTACTACGTGGACTCCGTGAAGGGCAGATTCACCATTTCCCGGGACAACGCCAAGAACTCGCTCTATCTGCAAATGAACTCGTTGCGGGTGGAAGATACTGCCATGTACTACTGCGCCCGGGACCGGCCTGTGGCCGGGGCGTCGGCCCTCTGGGGCCAGGGCACTCTGGTCACCGTGTCCTCT(SEQ ID NO: 185)

[0619] The DNA sequence of the 9H9x2B3(DD) scFv domain is as follows (the connector and linker sequences are shown in bold):

[0620]

[0621] The DNA sequence of the 9H9x2B3(DD) light chain variable sequence is as follows:

[0622] GATATCCAGATGACCCAGAGCCCGTCCACCCTTTCCGCGAGCGTCGGCGACAGAGTGACCATTACTTGTCGGGCCTCGCAAAGCATCTCCGGCTGGCTGGCTTGGTACCAGCAAAAGCCTGGAAAGGCCCCTAAGCTGCTGATCTACAAGGCCTCATCCCTGGAGTCCGGAGTGCCTTCACGCTTTTCGGGGAGCGGATCGGGGACTGAGTTCACCCTCACCATTTCCTCCCTGCAACCCGACGATTTCGCGACATACTACTGCCAGCAGTACTACGGTTCCTCGCGCACGTTCGGACAGGGCACTAACGTCGAGATCAAG(SEQ ID NO: 187)

[0623] From Figure 36 It can be seen that transient transfection shows improved production (expression) of the 9H9-2B3(DD) modified construct compared to the original (unmodified) 9H9-2B3 construct.

[0624] Summary of the Sequence Listing

[0625]

[0626]

[0627]

[0628]

[0629]

[0630]

[0631]

[0632]

[0633]

[0634]

[0635]

[0636]

[0637]

[0638]

[0639]

[0640]

[0641]

[0642] Equivalent solutions

[0643] Through only routine experimentation, one of ordinary skill in the art would recognize or be able to ascertain many equivalent solutions to the specific embodiments of the invention described herein. The following claims are intended to cover these equivalent solutions. Sequence Listing <110> Celes Medical Corporation <120> Anti-CD27 and Anti-PD-L1 Antibodies and Bispecific Constructs <130> PD01166A <140> PCT / US2019 / 027897 <141> 2019-04-17 <150> US 62 / 658,899 <151> 2018-04-17 <150> US 62 / 826,091 <151> 2019-03-29 <160> 187 <170> PatentIn version 3.5 <210> 1 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VH CDR1 <400> 1 Gly Tyr Tyr Trp Ser 1 5 <210> 2 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3C2 VH CDR2 <400> 2 Tyr Asn Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser 1 5 10 15 <210> 3 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3C2 VH CDR3 <400> 3 Tyr Pro Leu Ile Arg Gly Ala Phe Asp Tyr 1 5 10 <210> 4 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3C2 VL CDR1 <400> 4 Arg Ser Ser Gln Asn Leu Leu His Thr Asn Gly Tyr Asn Tyr Leu Asp 1 5 10 15 <210> 5 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3C2 VL CDR2 <400> 5 Leu Gly Ser Asn Arg Ala Ser 1 5 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VL CDR3 <400> 6 Met Gln Ala Leu Gln Thr Pro Leu Thr 1 5 <210> 7 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VH CDR1 <400> 7 Gly Tyr Tyr Ile His 1 5 <210> 8 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VH CDR2 <400> 8 Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Ser Ala Gln Lys Phe Gln 1 5 10 15 Asp <210> 9 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VH CDR3 <400> 9 Asp Arg Leu Val Leu Pro Trp Phe Gly Glu Ile Phe Pro Asp Ala Phe 1 5 10 15 Asp Ile <210> 10 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL CDR1 <400> 10 Arg Ala Ser Gln Ser Ile Arg Ser Asn Leu Ala 1 5 10 <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL CDR2 <400> 11 Gly Ala Ser Thr Arg Ala Thr 1 5 <210> 12 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL CDR3 <400> 12 Gln Gln Tyr Asn Asn Trp Pro Leu Thr 1 5 <210> 13 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VH with Signal Sequence <400> 13 Met Lys His Leu Trp Phe Cys Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Gln Ala Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Thr Gly Ser Ile 35 40 45 Ser Gly Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Tyr Asn Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Val Thr Ile Ser Ile Asp Thr Ser Lys Asn Gln 85 90 95 Phe Ser Leu Lys Leu Asn Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Arg Tyr Pro Leu Ile Arg Gly Ala Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 14 <211> 132 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VL with Signal Sequence <400> 14 Met Arg Leu Pro Ala Gln Leu Leu Gly Leu Leu Met Leu Trp Val Ser 1 5 10 15 Gly Ser Ser Gly Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro 20 25 30 Val Thr Pro Gly Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn 35 40 45 Leu Leu His Thr Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys 50 55 60 Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala 65 70 75 80 Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr 100 105 110 Cys Met Gln Ala Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys 115 120 125 Val Glu Ile Lys 130 <210> 15 <211> 146 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VH with Signal Sequence <400> 15 Met Asp Trp Thr Trp Arg Ile Leu Phe Leu Val Ala Ala Ala Thr Gly 1 5 10 15 Ala His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Gly Tyr Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 50 55 60 Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Ser Ala 65 70 75 80 Gln Lys Phe Gln Asp Arg Val Thr Ile Thr Arg Val Thr Ser Ile Asn 85 90 95 Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val 100 105 110 Tyr Phe Cys Ala Arg Asp Arg Leu Val Leu Pro Trp Phe Gly Glu Ile 115 120 125 Phe Pro Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val 130 135 140 Ser Ser 145 <210> 16 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL with signal sequence <400> 16 Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Ser Thr Gly Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser 20 25 30 Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser 35 40 45 Ile Arg Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 50 55 60 Arg Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Ser Glu Asn Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn 100 105 110 Asn Trp Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 115 120 125 <210> 17 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VH without signal sequence <400> 17 Gln Ala Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Thr Gly Ser Ile Ser Gly Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Asn Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg Val Thr Ile Ser Ile Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80 Lys Leu Asn Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Arg Tyr Pro Leu Ile Arg Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 18 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 3C2 VL without signal sequence <400> 18 Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15 Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Leu Leu His Thr 20 25 30 Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95 Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 110 <210> 19 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VH without signal sequence <400> 19 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr 20 25 30 Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Ser Ala Gln Lys Phe 50 55 60 Gln Asp Arg Val Thr Ile Thr Arg Val Thr Ser Ile Asn Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Arg Asp Arg Leu Val Leu Pro Trp Phe Gly Glu Ile Phe Pro Asp 100 105 110 Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 20 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL without signal sequence <400> 20 Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Arg Ser Asn 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser 65 70 75 80 Glu Asn Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 21 <211> 411 <212> DNA <213> Artificial Sequence <220> <223> Synthetic: 3C2 VH DNA sequence with signal sequence <400> 21 atgaaacatc tgtggttctg ccttctcctg gtggcagctc ccagatgggt cctgtcccag 60 gcgcagctgc aggagtcggg cccaggactg gtgaagcctt cggagaccct gtccctcacc 120 tgcactgtct ctactggctc catcagtggt tactactgga gctggatccg gcagccccca 180 gggaagggac tggagtggat tgggtataat tattacagtg ggagcaccaa ctacaacccc 240 tccctcaaga gtcgagtcac catatcaata gacacgtcca agaaccagtt ctccctgaag 300 ctgaattctg tgaccgctgc ggacacggcc gtatattact gtgcgagata tcctctgatt 360 cggggagctt ttgactactg gggccaggga accctggtca ccgtctcctc a 411 <210> 22 <211> 396 <212> DNA <213> Artificial sequence <220> <223> Synthetic: 3C2 VL DNA sequence with signal sequence <400> 22 atgaggctcc ctgctcagct cctggggctg ctaatgctct gggtctctgg atccagtggg 60 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 120 atctcctgta ggtctagtca gaacctcctg catactaatg gctacaacta tttggattgg 180 tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc taatcgggcc 240 tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cagattttac actgaaaatc 300 agcagagtgg aggctgagga tgttggggtt tattactgca tgcaagctct acaaactccg 360 ctcactttcg gcggagggac caaggtggag atcaaa 396 <210> 23 <211> 438 <212> DNA <213> Artificial sequence <220> <223> Synthetic: 2B3 VH DNA sequence with signal sequence <400> 23 atggactgga cctggaggat cctcttcttg gtggcagcag ccacaggagc ccactcccag 60 gtgcagctgg tgcagtctgg ggctgaggtg aagaagcctg gggcctcagt gaaggtctcc 120 tgcaaggctt ctggatacac cttcaccggc tactatatac actgggtgcg acaggcccct 180 ggacaagggc ttgagtggat gggatggatc aaccctaaca gtggtggcac aaactctgca 240 cagaagtttc aggacagggt caccatcacc agggtcacgt ccatcaacac agcctacatg 300 gagctgagca gactgagatc tgacgacacg gccgtgtatt tctgtgcgag agatcggctc 360 gtattaccat ggttcgggga aatattccca gatgcttttg atatctgggg ccaagggaca 420 ttggtcaccg tctcttca 438 <210> 24 <211> 381 <212> DNA <213> Artificial sequence <220> <223> Synthetic: 2B3 VL DNA sequence with signal sequence <400> 24 atggaagccc cagcgcagct tctcttcctc ctgctactct ggctcccaga ttccactgga 60 gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 120 ctctcctgca gggccagtca gagtattagg agcaacttag cctggtatca gcagaaacct 180 ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc 240 aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 300 gaaaattttg cagtttatta ctgtcagcag tataataact ggcctctcac tttcggcgga 360 gggaccaagg tggagatcaa a 381 <210> 25 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> Synthetic: 3C2 VH DNA sequence without signal sequence <400> 25 caggcgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60 acctgcactg tctctactgg ctccatcagt ggttactact ggagctggat ccggcagccc 120 ccagggaagg gactggagtg gattgggtat aattattaca gtgggagcac caactacaac 180 ccctccctca agagtcgagt caccatatca atagacacgt ccaagaacca gttctccctg 240 aagctgaatt ctgtgaccgc tgcggacacg gccgtatatt actgtgcgag atatcctctg 300 attcggggag cttttgacta ctggggccag ggaaccctgg tcaccgtctc ctca 354 <210> 26 <211> 336 <212> DNA <213> Artificial sequence <220> <223> Synthetic: 3C2 VL DNA sequence without signal sequence <400> 26 gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgta ggtctagtca gaacctcctg catactaatg gctacaacta tttggattgg 120 tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc taatcgggcc 180 tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cagattttac actgaaaatc 240 agcagagtgg aggctgagga tgttggggtt tattactgca tgcaagctct acaaactccg 300 ctcactttcg gcggagggac caaggtggag atcaaa 336 <210> 27 <211> 381 <212> DNA <213> Artificial sequence <220> <223> Synthetic: 2B3 VH DNA sequence without signal sequence <400> 27 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctggata caccttcacc ggctactata tacactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcaacccta acagtggtgg cacaaactct 180 gcacagaagt ttcaggacag ggtcaccatc accagggtca cgtccatcaa cacagcctac 240 atggagctga gcagactgag atctgacgac acggccgtgt atttctgtgc gagagatcgg 300 ctcgtattac catggttcgg ggaaatattc ccagatgctt ttgatatctg gggccaaggg 360 acattggtca ccgtctcttc a 381 <210> 28 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Synthetic: 2B3 VL DNA sequence without signal sequence <400> 28 gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtattagg agcaacttag cctggtatca gcagaaacct 120 ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc 180 aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 240 gaaaattttg cagtttatta ctgtcagcag tataataact ggcctctcac tttcggcgga 300 gggaccaagg tggagatcaa a 321 <210> 29 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VH CDR1 <400> 29 Thr Ser Trp Met Ser 1 5 <210> 30 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VH CDR2 <400> 30 Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val Lys 1 5 10 15 Gly <210> 31 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VH CDR3 <400> 31 Asp Arg Pro Val Ala Gly Ala Ser Ala Leu 1 5 10 <210> 32 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VL CDR1 <400> 32 Arg Ala Ser Gln Ser Ile Ser Gly Trp Leu Ala 1 5 10 <210> 33 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VL CDR2 <400> 33 Lys Ala Ser Ser Leu Glu Ser 1 5 <210> 34 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 7H7 VL CDR3 <400> 34 Gln Gln Tyr Tyr Gly Ser Ser Arg Thr 1 5 <210> 35 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 1B3 VH CDR1 <400> 35 Thr Ser Trp Met Ser 1 5 <210> 36 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Synthetic: 1B3 VH CDR2 <400> 36 Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val Lys 1 5 10 15 Gly <210> 37 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 1B3 VH CDR3 <400> 37 Asp Arg Pro Val Ala Gly Ala Ser Ala Leu 1 5 10 <210> 38 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 1B3 VL CDR1 <400> 38 Arg Ala Ser Gln Ser Ile Ser Gly Trp Leu Ala 1 5 10 <210> 39 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 1B3 VL CDR2 <400> 39 Lys Ala Ser Ser Leu Glu Ser 1 5 <210> 40 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 1B3 VL CDR3 <400> 40 Gln Gln Tyr Tyr Gly Ser Ser Arg Thr 1 5 <210> 41 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3B6 VH CDR1 <400> 41 Thr Tyr Trp Met Ser 1 5 <210> 42 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3B6 VH CDR2 <400> 42 Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val Lys 1 5 10 15 Gly <210> 43 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3B6 VH CDR3 <400> 43 Asp Arg Pro Val Ala Gly Ala Ser Ala Leu 1 5 10 <210> 44 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3B6 VL CDR1 <400> 44 Arg Ala Ser Gln Ser Ile Ser Gly Trp Leu Ala 1 5 10 <210> 45 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Synthetic: 3B6 VL CDR2 <400> 45 Lys Ala Ser Ser Leu Glu Ser 1 5 <210> 46 <211> 9 <212> PRT <213> Artif...

Claims

1. A bispecific construct comprising an anti-CD27 binding domain linked to an anti-PD-L1 binding domain, wherein: (i) the anti-CD27 binding domain comprises: heavy chain variable region CDR1, CDR2 and CDR3 domains consisting of SEQ ID NO: 7, 8 and 9 respectively, and light chain variable region CDR1, CDR2 and CDR3 domains consisting of SEQ ID NO: 10, 11 and 12 respectively; and (ii) the anti-PD-L1 binding domain comprises: (a) heavy chain variable region CDR1, CDR2 and CDR3 consisting of SEQ ID NO: 47, 48 and 49 respectively, and light chain variable region CDR1, CDR2 and CDR3 shown by SEQ ID NO: 50, 51 and 52 respectively, or (b) heavy chain variable region CDR1, CDR2 and CDR3 consisting of SEQ ID NO: 59, 60 and 61 respectively, and light chain variable region CDR1, CDR2 and CDR3 consisting of SEQ ID NO: 62, 63 and 64 respectively.

2. The bispecific construct according to claim 1, wherein the anti-CD27 binding domain comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO:

20.

3. The bispecific construct according to claim 1 or 2, wherein the anti-PD-L1 binding domain comprises: (a) a heavy chain variable region containing SEQ ID NO: 83 and a light chain variable region containing SEQ ID NO: 84; or (b) a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO:

88.

4. The bispecific construct according to claim 1, wherein: (a) the anti-CD27 binding domain comprises heavy chain variable region CDR1, CDR2 and CDR3 domains consisting of SEQ ID NO: 7, 8 and 9 respectively, and light chain variable region CDR1, CDR2 and CDR3 domains consisting of SEQ ID NO: 10, 11 and 12 respectively; and the anti-PD-L1 binding domain comprises heavy chain variable region CDR1, CDR2 and CDR3 consisting of SEQ ID NO: 59, 60 and 61 respectively, and light chain variable region CDR1, CDR2 and CDR3 consisting of SEQ ID NO: 62, 63 and 64 respectively; or (b) the anti-CD27 binding domain comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO: 20; and the anti-PD-L1 binding domain comprises a heavy chain variable region containing SEQ ID NO: 87 and a light chain variable region containing SEQ ID NO:

88.

5. The bispecific construct according to any one of the preceding claims, wherein (i) (a) The anti-PD-L1 binding domain further comprises a human IgG1 constant domain, or (b) the anti-CD27 binding domain further comprises a human IgG1 constant domain; (ii) (a) The anti-CD27 binding domain is linked to the C-terminus of the heavy chain of the anti-PD-L1 binding domain, or (b) the PD-L1 binding domain is linked to the C-terminus of the heavy chain of the anti-CD27 binding domain; (iii) (a) The anti-CD27 binding domain is a scFv or (b) the anti-PD-L1 binding domain is a scFv; (iv) The anti-PD-L1 binding domain and the anti-CD27 binding domain are gene-fused; and / or (v) The anti-PD-L1 binding domain and the anti-CD27 binding domain are chemically conjugated.

6. The bispecific construct according to any one of claims 1-5, wherein the construct is a bispecific tetravalent antibody comprising: i) two IgG heavy chains; ii) two light chains; and iii) two single-chain Fv (scFv) domains; wherein the two IgG heavy chains and two light chains form the IgG portion that specifically binds to human PD-L1, and wherein the two scFv domains each specifically bind to human CD27, and wherein each scFv domain is linked to the C-terminal residue of an IgG heavy chain by a linker sequence.

7. The bispecific construct according to claim 6, wherein (a) the IgG heavy chain is an IgG1 heavy chain; or (b) the light chain is a κ light chain; or (c) Each scFv domain has the following structural order: i) N-terminus - variable heavy chain domain - linker - variable light chain domain - C-terminus; or ii) N-terminus - variable light chain domain - linker - variable heavy chain domain - C-terminus; and wherein in each case, the linker contains (G4S) m amino acid sequence and wherein m is an integer of at least 3; or (d) the linker sequence comprises the amino acid sequence of G4S.

8. The bispecific construct according to claim 6, wherein the linker sequence comprises the amino acid sequence of GS2G4S or (G4S)4.

9. An anti-CD27 antibody or an antigen-binding fragment thereof, which comprises heavy chain CDR1, CDR2 and CDR3 domains consisting of the sequences shown in SEQ ID NO: 7, 8 and 9 respectively, and light chain CDR1, CDR2 and CDR3 domains consisting of the sequences shown in SEQ ID NO: 10, 11 and 12 respectively.

10. The antibody of claim 9, which comprises a heavy chain variable region containing SEQ ID NO: 19 and a light chain variable region containing SEQ ID NO:

20.

11. A composition comprising the bispecific construct according to any one of claims 1 to 8, or the antibody or an antigen-binding fragment thereof according to claim 9 or 10, and a pharmaceutically acceptable delivery vehicle.

12. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain and light chain variable regions of an antibody, wherein the heavy chain and light chain variable regions comprise the amino acid sequences shown in SEQ ID NO: 19 and 20.

13. An expression vector comprising the nucleic acid molecule according to claim 12.

14. Use of the bispecific construct according to any one of claims 1-8, the antibody or an antigen-binding fragment thereof according to claim 9 or 10, or the composition according to claim 11 in the preparation of a medicament for treating colorectal cancer, ovarian cancer, renal cell carcinoma, head and neck squamous cell carcinoma and glioblastoma in a subject.

Images