Genome editing method, composition, cell, cell preparation, and method for producing cell preparation
By using homologous arms less than 500 bp in the 5’ and 3’ ends of exogenous DNA, the problem of low homologous recombination frequency is solved, and the frequency of homologous recombination is significantly improved without damaging the cell's ability, and the application scope of genome editing is broadened.
Patent Information
- Application Number
- CN201980034209.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2018-03-29
- Filing Date
- 2019-03-28
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2039-03-28
AI Technical Summary
In the prior art, the frequency of homologous recombination is low, making it difficult to increase without damaging the non-homologous terminal binding ability of the cell, limiting the practicality and clinical application of genome editing.
The frequency of homologous recombination is increased and the frequency of non-homologous terminal binding occurs by using homologous arms less than 500 bp at the 5' and 3' ends of exogenous DNA.
Without damaging the non-homologous terminal binding ability of cells, the frequency of homologous recombination is significantly increased and the possibility of application of genome editing technology in medical and industrial industries is broadened.
Smart Images

Figure CN112534051B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a genome editing method, composition, cell, cell preparation, and method for producing a cell preparation.
[0002] This application claims priority based on Japanese Patent Application No. 2018-66174 filed on March 29, 2018, the content of which is incorporated herein by reference. Background Art
[0003] In the case of wanting to insert a specific gene into a specific site of the genome of a eukaryotic cell and completely replace the target genomic DNA with a desired base sequence, homologous recombination is generally used. Specifically, an operation is performed using a gene introduction vector (hereinafter referred to as a targeting vector) having DNAs (hereinafter referred to as homologous arms) having sequences homologous to the site for insertion on the genome at both ends (5' end and 3' end) of the exogenous DNA to be inserted. If the vector involved is introduced into a target cell, homologous recombination occurs between the genomic DNA and the vector, and the desired base sequence of the target genomic DNA can be replaced. The feature of this replacement is error-free.
[0004] However, in mammalian-derived cells, since the frequency of occurrence of such homologous recombination is extremely low, one in a million, the practical application of homologous recombination, especially in the medical field, is very difficult.
[0005] In recent years, the discovery of genome editing nucleases has made it possible to cleave double-stranded DNA at any position on the genome. As a result, it has become easier to induce homologous recombination between genomic DNA and an introduced exogenous gene (for example, refer to Patent Document 1, Non-Patent Documents 1 to 2).
[0006] In Patent Document 1, a method is disclosed in which the genome of a cell of a 1-cell stage embryo is cleaved using a Cas9 protein, and a nucleic acid insert (introduced exogenous gene) is introduced into the cell using a targeting vector having homologous arms hybridizing to the 5' end and 3' end of a target sequence, respectively, and a nucleic acid insert adjacent to the homologous arms.
[0007] In Non-Patent Document 1, it is disclosed that for hematopoietic stem cells derived from β-thalassemia patients, a normal HBB (haemoglobin beta) gene is introduced by homologous recombination using a CRISPR / Cas9 system combining a Cas9 protein and an adeno-associated vector.
[0008] However, in recent technologies, the occurrence frequency of non-homologous recombination is higher than that of homologous recombination. Even in the highest case, the occurrence frequency of homologous recombination is only about one-tenth. Therefore, in order to realize the practical application of homologous recombination, it is necessary to further increase the homologous recombination frequency.
[0009] As an attempt to increase the frequency of homologous recombination, for example, the methods cited in Non-Patent Documents 3 to 4 have been proposed.
[0010] In Non-Patent Document 2, low-molecular-weight compounds that inhibit non-homologous end joining or promote homologous recombination were explored in gene introduction by homologous recombination using the CRISPR / Cas9 system. It was disclosed that Scr7, L755507, and resveratrol were used as such low-molecular-weight compounds, and homologous recombination in porcine fetal fibroblasts was promoted.
[0011] Non-Patent Document 3 discloses a method of reducing the frequency of non-homologous recombination by suppressing the expression of KU70, DNA ligase IV, etc. by RNA interference, thereby relatively increasing the frequency of homologous recombination.
[0012] Non-Patent Document 4 discloses a method of increasing the frequency of homologous recombination by providing complementary single-stranded DNA to the 3' end of the cleaved DNA that is not complementary to the sgRNA and is asymmetrically released before Cas9 dissociates from double-stranded DNA in genome editing using the CRISPR / Cas9 system.
[0013] Prior Art Documents
[0014] Patent Documents
[0015] Patent Document 1: International Publication No. WO2016 / 081923
[0016] Non-Patent Documents
[0017] Non-Patent Document 1: Nature. 2016 Nov 17; 539(7629): 384 - 389. CRISPR / Cas9 β-globingene targeting in human haematopoietic stem cells. Dever D. et al.
[0018] Non-Patent Document 2: Sci Rep. 2017; 7: 8943. Small molecules enhance CRISPR / Cas9-mediated homology-directed genome editing in primary cells Guoling Li, et al.
[0019] Non-Patent Document 3: Nat Biotechnol. 2015 May; 33(5): 543-548. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Chu VT., et al.
[0020] Non-Patent Document 4: Nat Biotechnol. 2016; 34: 339-344, Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Richardson C, et al. Summary of the Invention
[0021] Problems to be Solved by the Invention
[0022] However, even with the methods in Non-Patent Documents 3 to 4, the frequency of homologous recombination is still low, and there is room for improvement.
[0023] Regarding the DNA repair mechanism for double-strand DNA cleavage, non-homologous end joining and homologous recombination are known. Non-homologous end joining occurs in a shorter time than homologous recombination. Therefore, in order to increase the frequency of homologous recombination, a method is needed to relatively reduce the occurrence frequency of non-homologous end joining. However, if the structure itself that inhibits non-homologous end joining is suppressed, the repair ability of cells for double-strand DNA cleavage will be greatly impaired, and thus the harm to organisms (inability to survive, tumorigenesis) becomes too large. As a result, practical application and clinical application in this direction are difficult.
[0024] An object of the present invention is to provide a genome editing method, composition, cell, cell preparation, and method for manufacturing a cell preparation that can increase the frequency of homologous recombination without impairing the non-homologous end joining ability originally possessed by cells.
[0025] Technical Means for Solving the Problem
[0026] The inventors found that if shorter homologous arms that are not usually used for homologous recombination are used for the targeting vector at the 5' end and 3' end of the exogenous DNA, when the double strands of the target genomic DNA are cleaved, the frequency of homologous recombination relative to non-homologous recombination is significantly higher, thus completing the present invention.
[0027] That is, the present invention is described as follows.
[0028] (1) A method for genome editing in isolated cells, characterized in that when cutting the double strands of the target genomic DNA, homologous recombination is performed on at least one of the 5'-end and 3'-end of the exogenous DNA, so as to introduce the exogenous DNA having homologous arms with a length of less than 500 bp at the 5'-end and 3'-end into the target genome.
[0029] (2) The genome editing method according to (1), wherein the exogenous DNA is introduced into the target genome by performing homologous recombination on both of the 5'-end and 3'-end of the exogenous DNA.
[0030] (3) The genome editing method according to (1) or (2), wherein the cell is a blood cell or an undifferentiated cell.
[0031] (4) The genome editing method according to any one of (1) to (3), wherein the cell is a stem cell.
[0032] (5) The genome editing method according to any one of (1) to (4), wherein the cell is a hematopoietic stem cell.
[0033] (6) The genome editing method according to (1), wherein the exogenous DNA is introduced into the target genome by performing homologous recombination on one of the 5'-end and 3'-end of the exogenous DNA and performing non-homologous recombination on the other end.
[0034] (7) A method for genome editing in isolated cells, characterized in that the exogenous DNA having homologous arms with a length of less than 500 bp is introduced into the target genome by performing homologous recombination on both of the 5'-end and 3'-end of the exogenous DNA.
[0035] (8) The genome editing method according to (7), wherein the cell is a blood cell or an undifferentiated cell.
[0036] (9) The genome editing method according to (7) or (8), wherein the cell is a stem cell.
[0037] (10) The genome editing method according to any one of (7) to (9), wherein the cell is a hematopoietic stem cell.
[0038] (11) A composition, characterized in that it contains exogenous DNA, and the exogenous DNA has homologous arms with a length of less than 500 bp at both ends.
[0039] (12) The composition according to (11), further comprising a target genomic DNA cleavage enzyme, or DNA or mRNA encoding said enzyme.
[0040] (13) The composition according to (11) or (12), wherein the composition is for medicinal use.
[0041] (14) The composition according to any one of (11) to (13), wherein the composition is used for treating severe combined immunodeficiency.
[0042] (15) A method for manufacturing a cell preparation for treating severe combined immunodeficiency, characterized in that in a cell, when cleaving the double strand of a target genomic DNA, at least one of the 5'-end and 3'-end of an exogenous DNA is subjected to homologous recombination, thereby introducing an exogenous DNA having a homologous arm with a length of less than 500 bp and at least a part of the wild-type DNA of the target genomic DNA into the genome of the cell.
[0043] (16) The method for manufacturing a cell preparation according to (15), wherein the exogenous DNA is introduced into the target genomic DNA by performing homologous recombination on both of the 5'-end and 3'-end of the exogenous DNA.
[0044] (17) The method for manufacturing a cell preparation according to (15) or (16), wherein the cell is a blood cell or an undifferentiated cell.
[0045] (18) The method for manufacturing a cell preparation according to any one of (15) to (17), wherein the cell is a stem cell.
[0046] (19) The method for manufacturing a cell preparation according to any one of (15) to (18), wherein the cell is a hematopoietic stem cell.
[0047] (20) The method for manufacturing a cell preparation according to (15), wherein the exogenous DNA is introduced into the target genomic DNA by performing homologous recombination on one of the 5'-end and 3'-end of the exogenous DNA and performing non-homologous recombination on the other end.
[0048] (21) A method for manufacturing a cell preparation for treating severe combined immunodeficiency, characterized in that in a cell, by performing homologous recombination on both of the 5'-end and 3'-end of the exogenous DNA, thereby introducing an exogenous DNA having a homologous arm with a length of less than 500 bp and at least a part of the wild-type DNA of the target genomic DNA into the genome of the cell.
[0049] (22) The method for manufacturing a cell preparation according to (21), wherein the cell is a blood cell or an undifferentiated cell.
[0050] (23) The method for manufacturing a cell preparation according to (21) or (22), wherein the cell is a stem cell.
[0051] (24) The method for manufacturing a cell preparation according to any one of (21) to (23), wherein the cell is a hematopoietic stem cell.
[0052] (25) A cell, characterized in that it has a fragment derived from exogenous DNA at the 5'-end or 3'-end of the exogenous DNA insertion site in the target genome of the cell.
[0053] (26) A cell preparation, characterized in that it contains the cell according to (25).
[0054] Effects of the Invention
[0055] According to the present invention, a homologous recombination frequency higher than that of non-homologous recombination in the target genome is achieved without impairing the non-homologous end joining ability originally possessed by the cell. Description of the Drawings
[0056] Figure 1 It is a schematic diagram of repairing the IL2RG gene mutation of SCID pigs by homologous recombination. Only homologous recombination was detected by a targeting vector with shorter homologous arms.
[0057] Figure 2 It is the electrophoresis result confirming that the IL2RG gene mutation of hematopoietic stem cells derived from SCID pigs was repaired only by homologous recombination through genomic PCR.
[0058] Figure 3 It is the electrophoresis result confirming the following situation: in SCID pigs autotransplanted with hematopoietic stem cells whose genomes were repaired by the genomic editing method of the present invention, the hematopoietic stem cells engrafted, and only blood cells repaired by homologous recombination were detected.
[0059] Figure 4 It is a schematic diagram of repairing the IL2RG gene mutation of SCID pigs by homologous recombination occurring only at one end of the exogenous DNA. The 5'-end of the exogenous DNA was repaired by non-homologous recombination and the 3'-end was repaired by homologous recombination. In this case, a fragment derived from the exogenous DNA remains at the 5'-end of the exogenous DNA insertion site in the target genome.
[0060] Figure 5The electrophoresis results show that the 5'-end of the IL2RG gene mutation in bone marrow stromal cells derived from SCID pigs was repaired by homologous recombination, and the 3'-end was repaired by non-homologous recombination, as confirmed by genomic PCR.
[0061] Figure 6 The electrophoresis results show that the GFP gene was inserted into the Rosa26 region of the mouse hematopoietic stem cell genome only by homologous recombination, as confirmed by genomic PCR.
[0062] Figure 7A The fluorescence image of a mouse fertilized egg microinjected with the genome editing tool of the present invention. In the fertilized eggs in which GFP was detected, at least the 5'-end of the GFP gene was inserted into the β-Actin (Actb) locus by homologous recombination.
[0063] Figure 7B The electrophoresis results show that the 5'-end of the GFP gene was inserted into the Actb locus of the mouse fertilized egg by homologous recombination, and the 3'-end was inserted by non-homologous recombination, as confirmed by genomic PCR.
[0064] Figure 8 The electrophoresis results show that the GFP gene was inserted into the hypoxanthine phosphoribosyltransferase (HPRT) locus of the human T cell leukemia cell line (Jurkat cells) only by homologous recombination, as confirmed by genomic PCR.
[0065] Figure 9A The electrophoresis results show that the GFP gene was inserted into the Lamin B1 (LMNB1) locus of the human fetal kidney cell line (HEK293T cells) only by homologous recombination, as confirmed by genomic PCR.
[0066] Figure 9B The fluorescence image of HEK293T cells with the GFP gene inserted into the LMNB1 locus. Through homologous recombination, the fusion protein of LMNB1 and GFP was expressed, and it was locally present in the nuclear membrane. Since GFP was locally present in the nuclear membrane in all GFP-positive cells, it can be known that the GFP gene was inserted into the LMNB1 locus only by homologous recombination.
[0067] Figure 9C The results of confirming the insertion efficiency of the GFP gene into the LMNB1 locus in HEK293T cells by flow cytometry.
[0068] Figure 10 The electrophoresis results show that the GFP gene was inserted into the HPRT locus of human bone marrow stromal cells only by homologous recombination, as confirmed by genomic PCR.
[0069] Figure 11 The electrophoresis results confirmed by genomic PCR that the GFP gene was inserted into the HPRT locus of human iPS cells only by homologous recombination.
[0070] Figure 12 The electrophoresis results confirmed by genomic PCR that even when ZFN and TALEN were used, gene insertion by only homologous recombination occurred in mouse hematopoietic stem cells. Detailed implementation mode
[0071] [Genome editing method]
[0072] The genome editing method of the present invention is a method for introducing an exogenous DNA having a homologous arm with a length of less than 500 bp into a target genome by performing homologous recombination at at least one of the 5'-end and 3'-end of the exogenous DNA when cutting the double strand of the target genomic DNA.
[0073] <First embodiment>
[0074] In one embodiment, the present invention provides a method which is a genome editing method in a cell, and an exogenous DNA having a homologous arm with a length of less than 500 bp is introduced into the genome of the cell by homologous recombination at the 5'-end and 3'-end of the exogenous DNA when cutting the double strand of the target genomic DNA.
[0075] In this embodiment, first, the double strand of the target genomic DNA involved is cut at the position on the target genomic DNA where the exogenous DNA is to be introduced. As the system for cutting the double strand of the target genomic DNA, there is no particular limitation, and examples include the CRISPR-Cas9 system, the transcription activator-like effector nuclease (TALEN) system, and the zinc finger nuclease system. As the method for introducing these systems into the cell, there is no particular limitation, and the target genomic DNA cleavage enzyme itself can be introduced into the cell, or the target genomic DNA cleavage enzyme expression vector can be introduced into the cell. The system for cutting the double strand of the target genomic DNA is introduced into the cell simultaneously with the exogenous DNA or before or after the exogenous DNA.
[0076] For example, in the CRISPR-Cas9 system, methods such as introducing a Cas9 expression vector and an expression vector encoding a guide RNA that induces Cas9 at the position to be cleaved into cells, and methods of introducing the expressed and purified recombinant Cas9 protein and the guide RNA into cells can be cited. The guide RNA can be divided into two types, tracrRNA and crRNA, or can also be a single-stranded sgRNA.
[0077] In the present embodiment, the system for cleaving the double strand of the target genomic DNA is preferably the CRISPR-Cas9 system.
[0078] In the present embodiment, as the method for introducing foreign genes, nucleic acids, and proteins into cells, there is no particular limitation, and it can be any one of a method using a viral vector, a non-viral transfection method, or other known methods. As the method using a viral vector, for example, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, Sendai virus vectors, Sindbis virus vectors, etc. can be cited. As the non-viral transfection method, for example, calcium phosphate method, liposome transfection method, electroporation method, microinjection method, whisker method, plasma method, laser injection method, gene gun method, and Agrobacterium method, etc. can be cited.
[0079] In the present embodiment, the cells that are the targets of the genome editing method of the present invention are not particularly limited. Preferably, they are isolated cells, and examples include animal cells, plant cells, insect cells, fungi such as yeast and molds, and bacteria such as Escherichia coli.
[0080] As examples of animal cells, stem cells, germ cells, germ line cells, immortalized cells, primary cultured cells, and cells induced from stem cells or prepared from primary cultured cells derived from animals can be cited. The stem cells can be immortalized cells or primary cultured cells.
[0081] The genome editing method of the present invention is not necessarily limited to isolated cells. The animal individual itself or somatic cells and stem cells in the individual can also be used as targets.
[0082] As cells derived from animals, stem cells are preferred. Stem cells derived from animals have the following characteristics: (i) having self-renewal ability, and (ii) having multi-directional differentiation ability.
[0083] Animal stem cells can be classified into pluripotent stem cells, multipotent stem cells, oligopotent stem cells, and unipotent stem cells according to their different differentiation abilities.
[0084] Examples of animal stem cells include: embryonic stem cells such as ES cells and EG cells, ES-like stem cells such as induced pluripotent stem cells (iPS cells), fetal stem cells, multi-lineage differentiating stress enduring cells, placental stem cells, hematopoietic stem cells, mesenchymal stem cells (such as dental pulp-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, and synovium-derived mesenchymal stem cells), hair follicle stem cells, mammary gland stem cells, neural stem cells, satellite cells, and adult stem cells such as intestinal epithelial stem cells, as well as germline stem cells such as GS cells.
[0085] Animal stem cells can be cells in which the stem cells have been genetically modified. Examples of such cells include, for example, pluripotent stem cells in which immune rejection has been suppressed by shuffling human leukocyte antigen (HLA).
[0086] As the animal cell, a hematopoietic stem cell is preferred.
[0087] Examples of germ cells and germline cells include eggs, oocytes, oogonia, sperm, spermatocytes, spermatogonia, sperm stem cells (spermatogonial stem cells), primordial germ cells, etc. It can be a fertilized egg obtained after fertilization of an egg and sperm. In addition, it can be a 2-cell to 8-cell embryo after cleavage of the fertilized egg, or a morula to blastocyst (blastocyst) before implantation.
[0088] The established cells of an animal are not particularly limited. Examples of the established cells of an animal include: cells derived from Chinese hamster ovary tissue (CHO cells), established cells derived from African green monkey kidney (Vero cells), cells derived from human liver cancer (HepG2 cells), cell line derived from canine renal tubular epithelial cells (MDCK cells), human fetal kidney cell line (HEK293 cells), and immortalized cell line derived from human liver cancer tissue (huGK-14), etc.
[0089] The primary cultured cells of an animal are not particularly limited and can be either from normal tissue or diseased tissue. Examples of the primary cultured cells of an animal include dermal papilla cells, endothelial cells, epithelial cells, epidermal keratinocytes, melanocytes, cardiomyocytes, smooth muscle cells, skeletal muscle cells, skeletal muscle myoblasts, osteoblasts, chondrocytes, fibroblasts, hepatocytes, nerve cells, and immune cells such as regulatory T cells, cytotoxic T cells, and γδT cells.
[0090] Cells induced from animal stem cells can be stem cells or differentiated cells. Examples of cells induced from animal stem cells include: iPS cell-derived retinal pigment epithelial cells, iPS cell-derived nerve cells, iPS cell-derived immune cells such as iPS cell-derived cytotoxic T cells, iPS cell-derived cardiac progenitor cells, and iPS cell-derived hepatocytes.
[0091] Cells prepared from primary cultured cells of an animal are not particularly limited. Typically, cells prepared from primary cultured cells of an animal are cells obtained by genetically modifying the primary cultured cells of the animal. Examples of cells prepared from primary cultured cells of an animal include CAR (chimeric antigen receptor)-T cells and the like.
[0092] As described in the examples below, the present inventors found that the ease of homologous recombination does not depend on the animal species, target locus, introduced gene, or type of nuclease that cleaves the target genome.
[0093] In the present embodiment, blood cells or undifferentiated cells are preferred. As undifferentiated cells, stem cells are more preferred, and hematopoietic stem cells are particularly preferred.
[0094] Plant cells are not particularly limited. Examples of plant cells include cells derived from the meristem or seeds of a plant, and callus. Callus can be any one of a variety of tissues, including those induced from plant tissue pieces, wound-induced tissues, bacteria-induced tissues, tissues formed in interspecific hybrids, and cultured cells. Typically, cells derived from the meristem or seeds of a plant and callus have the characteristic of expressing at least one of pluripotency markers such as PLT1, PLT5, LBD16, LBD17, LBD18, LBD29, ARR1, ARR21, ESR1, ESR2, WIND1, WIND2, WIND3, WIND4, LEC1, LEC2, AGL15, BBM, RKD1, RKD2, and WUS. The method for genome editing in plant cells will be described later.
[0095] Next, in the present embodiment, a targeting vector having homology arms of less than 500 bp at both ends of the exogenous DNA is introduced into the cell. A homology arm refers to a DNA having a sequence homologous to the site where the exogenous DNA is to be inserted, provided at the 5' end and 3' end of the exogenous DNA to be inserted.
[0096] The upper limit value of the length of the homologous arm is less than 500 bp, preferably 300 bp or less, more preferably 100 bp or less, particularly preferably 50 bp or less, and may be 10 bp or less. The introduced homologous arm facilitates homologous recombination at both the 5'-end and the 3'-end.
[0097] The lower limit value of the length of the homologous arm is preferably 5 bp or more, more preferably 10 bp or more.
[0098] The length of the homologous arm is preferably 5 to 499 bp, more preferably 5 to 300 bp, further preferably 5 to 100 bp, particularly preferably 5 to 50 bp, and most preferably 10 to 50 bp.
[0099] The length of the exogenous DNA is not particularly limited as long as it can be inserted into the genome. Examples of the length of the exogenous DNA include 50 bp to 10 kbp, 100 to 5 kbp, 100 to 1 kbp, and 100 to 500 bp, etc. Examples of the exogenous DNA include wild-type DNA of the target sequence, codon-optimized sequence DNA, tagged exogenous DNA, promoter sequence, transcription termination sequence, functional gene sequence, fluorescent protein marker gene sequence, drug selection gene sequence, multiple cloning site sequence, and combinations thereof, etc.
[0100] In the present embodiment, the type of the targeting vector used is not particularly limited, and known vectors such as plasmid vectors and viral vectors can be used.
[0101] Examples of the viral vector include retroviral vector, lentiviral vector, adenoviral vector, adeno-associated virus (AAV) vector, herpesvirus vector, Sendai virus vector, Sindbis virus vector, etc.
[0102] Examples of the targeting vector include various vectors for editing the genome using the CRISR / Cas9 system. For example, targeting vectors using the HITI (homology-independent targeted integration) system can be mentioned.
[0103] Generally, from the viewpoint of increasing the proportion of the homologous region, it can be considered that a gene targeting vector for homologous recombination with a longer homologous arm can perform homologous recombination with high efficiency. However, the present inventors have found a completely unexpected result, that is, when the double-stranded target genomic DNA is cleaved, exogenous DNA with shorter homologous arms at both the 5'-end and the 3'-end undergoes homologous recombination at a frequency significantly higher than that of non-homologous recombination.
[0104] The genome editing method according to the present embodiment can achieve a very high frequency of homologous recombination relative to non-homologous recombination at both the 5'-end and 3'-end of exogenous DNA. Specifically, in the method of the present invention, by using a targeting vector with shorter homologous arms less than 500 bp, it is possible to achieve a significantly higher frequency of homologous recombination than non-homologous recombination while maintaining the cell's repair ability for double-strand breaks of DNA, and without inhibiting the non-homologous end joining structure originally possessed by the cell.
[0105] Therefore, the genome editing method of the present embodiment broadens the application possibilities of genome editing technology in the medical and industrial fields. The present invention can prepare blood cells that can be used to treat individuals suffering from diseases caused by gene mutations. The diseases caused by gene mutations are not particularly limited. For example, they can be congenital immunodeficiency diseases (in addition to X-SCID in the examples, there are adenosine deaminase [ADA] deficiency, chronic granulomatous disease, X-linked agammaglobulinemia [XLA], ZAP-70 deficiency disease, hyper IgM syndrome, IgA deficiency disease, IgG subclass deficiency disease, Bloom syndrome, Wiscott-Aldrich syndrome, Ataxia telangiectasia, DiGeorge syndrome), Fanconi anemia, thalassemia, sickle cell anemia, leukodystrophy, hemophilia, mucopolysaccharidosis, etc. Since the present invention achieves a higher frequency of homologous recombination than non-homologous recombination, it is extremely useful for treating various diseases that are difficult to treat by non-homologous recombination and are expected to be treated by homologous recombination. For example, diseases with mutations in giant genes (such as muscular dystrophy) and diseases with long and large gene mutations (such as trinucleotide repeat diseases like Huntington's disease). The application of the present invention is not necessarily limited to the treatment of diseases caused by gene mutations. For example, the present invention can be widely used for functional modification of mesenchymal stem cells and T cells. For example, modification of the HLA locus of mesenchymal stem cells and CAR-T cells. These genome-modified cells prepared by the present invention can be used to treat various cancers, leukemia, hematopoietic dysfunction, myelodysplastic syndrome, ischemic diseases such as myocardial infarction, cerebral infarction, and obstructive arteriosclerosis, Buerger's disease, peripheral diseases, severe lower limb ischemia, pulmonary hypertension, autoimmune diseases, lupus nephritis, Crohn's disease, corneal diseases, corneal disorders, glaucoma, optic nerve disorders, retinitis pigmentosa, macular degeneration, etc. The application of the present invention is not limited to medicine. For example, the application possibilities of the genome editing method of the present invention in producing beef cattle containing a large amount of highly unsaturated fatty acids and having excellent taste and tuna with an increased proportion of the large belly can be cited.
[0106] <Second Embodiment>
[0107] In one embodiment, the present invention provides a method, which is a genome editing method in cells. When cutting the double strands of the target genomic DNA, homologous recombination is carried out on one of the 5'-end and 3'-end of the exogenous DNA, and non-homologous recombination is carried out on the other end, so as to introduce the exogenous DNA with a homologous arm having a length of less than 500 bp into the genome of the cell.
[0108] As an example of this embodiment, mouse fertilized eggs and porcine bone marrow stromal cells, etc. can be cited.
[0109] As a method for improving the efficiency of genome editing of this embodiment, the length of one homologous arm in the exogenous DNA is preferably more than 2 times, more preferably more than 3 times, further preferably more than 4 times, and particularly preferably more than 5 times the length of the other homologous arm.
[0110] As the length of the shorter homologous arm, it is preferably 50 bp or less, more preferably 30 bp or less, particularly preferably 10 bp or less, and may also be 0 bp. As the length of the longer homologous arm, it is preferably 30 bp or more, more preferably 40 bp or more, and particularly preferably 50 bp or more.
[0111] The introduced shorter homologous arm contributes to non-homologous recombination, and the longer homologous arm contributes to homologous recombination. In this embodiment, non-homologous recombination refers to non-homologous end joining.
[0112] As the length of the exogenous DNA, as long as it is a length that can be inserted into the genome, there is no particular limitation, and for example, 100 bp to 10 kbp can be cited.
[0113] The occurrence mechanism of unilateral homologous recombination in the genome editing method of this embodiment is not yet clear and is speculated as follows. The shorter homologous arm is more difficult to undergo homologous recombination than the longer homologous arm, and the position where the double strands of the genomic DNA are cut is connected to the shorter homologous arm through the mechanism of non-homologous recombination (non-homologous end joining). In this way, one end of the introduced gene is connected to the genomic DNA, and thus, this becomes a fulcrum, and the longer homologous arm at the other end is located near the homologous sequence on the genome, and homologous recombination becomes likely to occur. That is, it can be considered that one end of the exogenous DNA is first connected through non-homologous recombination, and then the exogenous DNA is integrated into the genome through homologous recombination on the other end side.
[0114] <The Third Embodiment>
[0115] In one embodiment, the present invention provides a method, which is a genome editing method in isolated cells. By carrying out homologous recombination on both the 5'-end and 3'-end of the exogenous DNA, the exogenous DNA with a homologous arm having a length of less than 500 bp is introduced into the target genome.
[0116] In the present embodiment, as the targeting vector, a vector that can cause homologous recombination without double-strand cleavage of the target genomic DNA is used. As the targeting vector involved, an AAV vector containing single-stranded DNA can be cited.
[0117] Except for not performing double-strand cleavage of the target genomic DNA, it is the same as the first embodiment.
[0118] [Composition]
[0119] The composition of the present invention contains exogenous DNA, and the exogenous DNA has homologous arms with a length of less than 500 bp at both ends.
[0120] The composition of the present invention may contain a target genomic DNA cleavage enzyme or DNA or mRNA encoding the enzyme, or may not be a DNA cleavage enzyme, but a nickase that introduces a nick on one side of double-stranded DNA, or a helicase that separates double-stranded DNA into single strands.
[0121] In the present invention, as the target genomic DNA cleavage enzyme, Cas9, Transcriptionactivator-like effector nuclease (TALEN), zinc finger nuclease, etc. can be cited. In addition, as the DNA or mRNA encoding the enzyme, DNA or mRNA encoding these proteins can be cited.
[0122] When Cas9 is used as the target genomic DNA cleavage enzyme, the composition preferably contains a guide RNA that induces Cas9. In addition, the composition may also contain an expression vector encoding the guide RNA.
[0123] In the present invention, the length of the homologous arms provided at both ends of the exogenous DNA is less than 500 bp, preferably 300 bp or less, which is the same as in the above [Genome editing method].
[0124] In the present invention, the exogenous DNA is the same as the exogenous DNA in the above [Genome editing method], and the composition of the present invention may include a targeting vector containing the exogenous DNA. The targeting vector is the same as the one in the above [Genome editing method].
[0125] In the present invention, the above exogenous DNA may be contained in one vector or in multiple vectors. The vector is not particularly limited and is the same as in the above [Genome editing method].
[0126] The composition of the present invention is preferably medicinal, and more preferably contains a pharmaceutically acceptable carrier. The medicinal composition of the present embodiment is orally administered, for example, in the form of tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, emulsions, etc., or non-orally administered in the form of injections, suppositories, skin external preparations, etc.
[0127] As the pharmaceutically acceptable carrier, the preparations generally used for pharmaceutical compositions can be used without particular limitation. More specifically, for example, binders such as gelatin, corn starch, tragacanth, and gum arabic; excipients such as starch and crystalline cellulose; swelling agents such as alginic acid; solvents for injections such as water, ethanol, and glycerol; adhesives such as rubber-based adhesives and silicone-based adhesives, etc. The pharmaceutically acceptable carrier can be used alone or in combination of two or more.
[0128] The composition of the present invention may further include additives. As additives, for example, lubricants such as calcium stearate and magnesium stearate; sweeteners such as sucrose, lactose, saccharin, and maltitol; flavoring agents such as mint and Gaultheria oil; stabilizers such as benzyl alcohol and phenol; buffers such as phosphates and sodium acetate; solubilizing aids such as benzyl benzoate and benzyl alcohol; antioxidants; preservatives, etc.
[0129] The additives can be used alone or in combination of two or more.
[0130] The composition of the present invention is preferably used for treating severe combined immunodeficiency disease. In severe combined immunodeficiency disease (SCID), the most frequent disease type is the X-linked type, which is caused by mutations in the interleukin-2 receptor gamma gene (IL2RG).
[0131] In the present invention, the exogenous DNA contained in the composition for treating X-linked severe combined immunodeficiency disease preferably contains at least a part of the wild-type interleukin-2 receptor gamma gene. In addition, when Cas9 is used as the target genomic DNA cleavage enzyme, it preferably contains a guide RNA hybridizing with the interleukin-2 receptor gamma gene on the target genome or an expression vector encoding the guide RNA.
[0132] By using the composition of the present invention, the genome editing method of the present invention can be provided.
[0133] [Gene Therapy Method]
[0134] The gene therapy method of the present invention is a method of administering a pharmaceutical composition to a subject, the pharmaceutical composition containing: an enzyme that cleaves a target genomic DNA having a mutation, or DNA or mRNA encoding the enzyme, and an exogenous DNA having at least a part of the wild-type DNA of the target genomic DNA and having homologous arms with a length of less than 500 bp at both ends.
[0135] In the present invention, the mutation is caused by deletion, substitution, insertion of any sequence, etc. of a part or all of the exon and intron of the target genomic DNA, or the expression regulatory region of the target genomic DNA.
[0136] In the present invention, the administration method is not particularly limited and can be appropriately determined according to the symptoms, body weight, age, sex, etc. of the patient. For example, tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, emulsions, etc. are for oral administration. In addition, injections are administered intravenously alone or in combination with conventional excipients such as glucose and amino acids, and can also be administered intramedullary, intraarterial, intramuscular, intradermal, subcutaneous or intraperitoneal as needed.
[0137] In the present invention, the dosage of the pharmaceutical composition varies depending on the symptoms, body weight, age, sex, etc. of the patient and cannot be generalized. In the case of oral administration, it can be administered with an active ingredient of, for example, 1 μg to 10 g per day, such as 0.01 to 2000 mg per day. In addition, in the case of injections, it can be administered with an active ingredient of, for example, 0.1 μg to 1 g per day, such as 0.001 to 200 mg per day.
[0138] [Cell]
[0139] In the second embodiment, the cell of the present invention is characterized in that a fragment derived from the foreign DNA remains at the 5'-end or 3'-end of the site where the foreign DNA is inserted into the target genome. According to the genome editing method of the above second embodiment, one end of the foreign DNA is first ligated to one end of the target genomic DNA generated by cleavage of the double strand by non-homologous recombination. Therefore, the cell of the present invention has a fragment derived from the foreign DNA at the 5'-end or 3'-end of the site where the foreign DNA is inserted into the genome. As Figure 4 shown by the results, when non-homologous recombination occurs at the 5'-end of the target genomic DNA, a fragment derived from the foreign DNA is present at the 5'-end of the site where the foreign DNA is inserted into the genome. When non-homologous recombination occurs at the 3'-end of the target genomic DNA, a fragment derived from the foreign DNA is present at the 3'-end of the site where the foreign DNA is inserted into the genome.
[0140] [Cell preparation]
[0141] By using the genome editing method of the above-described second embodiment, the cell preparation of the present invention contains, for example, cells in which the target genomic DNA having a mutation is edited to the wild type. In addition, as described in the [Cells] section above, the cell preparation of the present invention contains such cells in which, on their target genomes, fragments derived from the exogenous DNA remain at the 5'-end or 3'-end of the site where the exogenous DNA is inserted into the genome.
[0142] [Method for manufacturing cell preparation]
[0143] The method for manufacturing the cell preparation of the present invention is a method for manufacturing a cell preparation for treating severe combined immunodeficiency disease. In the cell, by performing homologous recombination on at least one of the 5'-end and 3'-end of the exogenous DNA when cutting the double strand of the target genomic DNA, an exogenous DNA having a homologous arm with a length of less than 500 bp and having at least a part of the wild type DNA of the target genomic DNA is introduced into the genome of the cell.
[0144] In one embodiment, the present invention provides a method for manufacturing a cell preparation, which is a method for manufacturing a cell preparation for treating severe combined immunodeficiency disease. In the cell, by performing homologous recombination on both the 5'-end and 3'-end of the exogenous DNA when cutting the double strand of the target genomic DNA, an exogenous DNA having a homologous arm with a length of less than 500 bp and having at least a part of the wild type DNA of the target genomic DNA is introduced into the genome of the cell.
[0145] In one embodiment, the present invention provides a method for manufacturing a cell preparation, which is a method for manufacturing a cell preparation for treating severe combined immunodeficiency disease. In the cell, by performing homologous recombination on one of the 5'-end and 3'-end of the exogenous DNA and performing non-homologous recombination on the other end when cutting the double strand of the target genomic DNA, an exogenous DNA having a homologous arm with a length of less than 500 bp and having at least a part of the wild type DNA of the target genomic DNA is introduced into the genome of the cell.
[0146] In one embodiment, the present invention provides a method for manufacturing a cell preparation, which is a method for manufacturing a cell preparation for treating severe combined immunodeficiency disease. In the cell, by performing homologous recombination on both the 5'-end and 3'-end of the exogenous DNA, an exogenous DNA having a homologous arm with a length of less than 500 bp and having at least a part of the wild type DNA of the target genomic DNA is introduced into the genome of the cell.
[0147] The cells used as the host for the cell preparation are not particularly limited, and examples include the same cells as those in the above [Genome Editing Method], or cells derived from bone marrow taken from a human body.
[0148] In this way, after the genome-edited cells are proliferated in vitro, as a cell preparation, they are administered to a patient by intravenous injection or the like.
[0149] By using the method for manufacturing the cell preparation of the present invention, a homologous recombination frequency higher than that of non-homologous recombination is achieved in the target genome. As a result, a cell preparation can be efficiently manufactured.
[0150] By the method for manufacturing the cell preparation of the present invention, it is possible to provide a cell preparation that, through homologous recombination, correctly repairs the mutant target genomic DNA in bone marrow-derived cells of a patient with severe combined immunodeficiency disease into a healthy base sequence, thereby curing severe combined immunodeficiency disease.
[0151] [Genome Editing Method for Plant Cells]
[0152] In one embodiment, a method is provided, which is a genome editing method for plant cells. By performing homologous recombination at the 5' end and 3' end of exogenous DNA when cleaving the double strand of the target genomic DNA, an exogenous DNA having a homologous arm with a length of less than 500 bp is introduced into the genome of the cell.
[0153] In the present embodiment, the system for cleaving the double strand of the target genomic DNA is not particularly limited, and is the same as the system in the above [Genome Editing Method]. The method for introducing these systems into the cell is also not particularly limited, and is the same as the method in the above [Genome Editing Method].
[0154] In the present embodiment, the method for introducing the exogenous gene into the cell is not particularly limited, and is the same as the method in the above [Genome Editing Method].
[0155] The plant cells are not particularly limited, and are the same as the plant cells in the above [Genome Editing Method]. As the plant cells, cells derived from the meristem or seeds of a plant, callus, etc. are preferred.
[0156] The upper limit value of the length of the homologous arm is less than 500 bp, preferably 300 bp or less, more preferably 100 bp or less, particularly preferably 50 bp or less, and may also be 10 bp or less. The lower limit value of the length of the homologous arm is preferably 5 bp or more, more preferably 10 bp or more. The length of the homologous arm within the range between the upper limit value and the lower limit value is not particularly limited, and is the same as that in the above [Genome Editing Method].
[0157] As the length of the exogenous DNA, as long as it is a length that can be inserted into the genome, there is no particular limitation, which is the same as in the above [genome editing method].
[0158] In the present embodiment, the type of the targeting vector used is not particularly limited, which is the same as in the above [genome editing method].
[0159] Genome editing in plant cells can be carried out in an in vitro culture system or in vivo in a plant. In the genome editing method in an in vitro culture system, for callus or tissue pieces, the introduction of exogenous genes, nucleic acids, and proteins into cells is carried out using well-known methods such as the Agrobacterium method, the gene gun method, and the whisker method. In the genome editing method in vivo in a plant, for the shoot tips of naked immature embryos and mature embryos, the introduction of exogenous genes, nucleic acids, and proteins into cells is carried out using well-known methods. For cereals such as wheat, rice, corn, or soybeans, from the perspective of the efficiency of introducing into the plant body, it is preferably to use the gene gun method to introduce into the mature seed embryos. In addition, it is applicable to barley and potatoes as cereals, tomatoes and rapeseed as vegetables, or carnations, roses, sweet peas, chrysanthemums, etc. as flowers.
[0160] The genome editing method in the plant cells of the present embodiment broadens the application possibilities of genome editing technology in the agricultural field. Specifically, the production of sake rice with less carbohydrates and less likely to cause hangovers can be cited.
[0161] [Examples]
[0162] Hereinafter, the present invention will be further described in detail by experimental examples, but the present invention is not limited by these examples.
[0163] [Experimental Example 1]
[0164] [Construction of Donor Plasmid]
[0165] In order to repair the mutation (85bp and 1bp deletions, 2bp and 1bp base substitutions) in the Interleukin-2 receptor gamma gene (hereinafter, also referred to as IL2RG.) from the 5' control region to the middle of exon 1 on the genome of hematopoietic stem cells derived from SCID model pigs described in Watanabe M et al., PloS One., 2013 Oct 9; 8(10): e76478., a donor plasmid was prepared using a donor plasmid (HITI targeting vector). The structure of the donor plasmid is as Figure 1 shown. The donor plasmid has a structure in which homologous arms of the following combinations are added to the 155bp exogenous DNA containing the mutation site:
[0166] (a) Homologous arms with a 10-bp 5'-end and a 50-bp 3'-end
[0167] (b) Homologous arms with both 5'-end and 3'-end being 50 bp
[0168] (c) Homologous arms with a 50-bp 5'-end and a 10-bp 3'-end
[0169] (d) Homologous arms with both 5'-end and 3'-end being 10 bp.
[0170] The base sequence of the 10-bp homologous arm on the 5'-side is as follows:
[0171] 5'-GGCCCAGGTT-3' (SEQ ID NO: 1).
[0172] The base sequence of the 50-bp homologous arm containing the 5'-side is as follows:
[0173] 5'-CAAAAGGAAATGTGTGGGTGGGGAGGGGTAGTGGGTAAGGGGCCCAGGTT-3' (SEQ ID NO: 2).
[0174] The base sequence of the foreign DNA is as follows. In addition, the lowercase letters are the 5'-control region deleted in SCID pigs, and the capital letters are the base sequence of codon-optimized Ex1 (exon 1):
[0175] 5'-cctgacacagtctacacccaggaaacaaggagtaagcgccATGCTCAAACCCCCCCTCCCCGTCAAGTCTCTCCTCTTCCTCCAGCTCCCTCTGCTCGGCGTCGGCCTCAATCCTAAGGTCCTCACCCACAGCGGCAACGAGGACATCACCGCTG-3' (SEQ ID NO: 3)
[0176] The base sequence of the 50-bp homologous arm on the 3'-side is as follows:
[0177] 5'-GTGGGAAACTGGGACGTTGGGGGTAGGGTTGGTGAGCCGGGGGAGGCTGG-3' (SEQ ID NO: 4).
[0178] The base sequence of the 10-bp homologous arm on the 3'-side is as follows:
[0179] 5'-GTGGGAAACT-3' (SEQ ID NO: 5).
[0180] The HITI base sequences added to both ends of the homologous arms are as follows:
[0181] 5’-CCTTCGGGTTCAGTCCCACCCCA-3’ (SEQ ID NO: 6).
[0182] [Introduction of wild-type IL2RG-Ex1 gene into IL2RG-deficient porcine hematopoietic stem cells using CRISPR-Cas9]
[0183] The Cas9 protein, the crRNA shown in SEQ ID NO: 7 (5’-UGGGGUGGGACUGAACCCGAGUUUUAGAGCUAUGCU-3’), the tracrRNA (Alt-R® CRISPR-Cas9 tracrRNA, catalog number 1072534, manufactured by Integrated DNA Technologies), and the above-mentioned donor plasmid were introduced into IL2RG-deficient porcine hematopoietic stem cells by electroporation. Porcine hematopoietic stem cells used various (CD3, CD16, and CD45RA) differentiation marker-negative cells (Lin-) in porcine bone marrow.
[0184] [Confirmation of insertion by genomic PCR]
[0185] Seven days after electroporation, genomic DNA was purified from the cells, and confirmation of exogenous DNA insertion by PCR was performed. The primers used for insertion confirmation were Figure 1 the combinations of A and B, and the combinations of C and D shown. If homologous recombination occurred at the 5’ end, a 335-bp DNA was amplified by PCR using the combination of primers A and B. If homologous recombination occurred at the 3’ end, a 197-bp DNA was amplified by PCR using the combination of primers C and D.
[0186] Figure 2 The results of electrophoresis of the amplified PCR products are shown. As Figure 2 shown, only the bands of the sizes indicating homologous recombination at the 5’ end and 3’ end were seen. Figure 2 In, NHEJ (Non-homologous end joining) indicates the band size corresponding to non-homologous recombination, and HDR (Homology directed repair) indicates the band size corresponding to homologous recombination.
[0187] [Confirmation of the recombination method by sequencing]
[0188] The PCR products of TA cloning were introduced into Escherichia coli, and sequencing of each formed colony was performed.
[0189] The combinations of homologous arms used are as follows:
[0190] (a) Homologous arms with a 10-bp 5' end and a 50-bp 3' end
[0191] (b) Homologous arms with 50-bp 5' and 3' ends
[0192] (c) Homologous arms with a 50-bp 5' end and a 10-bp 3' end
[0193] (d) Homologous arms with 10-bp 5' and 3' ends.
[0194] It was confirmed that homologous recombination occurred in all of the clones of (a) clone 4, (b) clone 8, (c) clone 7, and (d) clone 6 in which recombination occurred at the 5' end. At the 3' end, homologous recombination occurred in all of the clones of (a) clone 8, (b) clone 7, (c) clone 8, and (d) clone 10 in which recombination occurred. Homologous recombination occurred at extremely high frequencies (100%) at both the 5' and 3' ends. In addition, it was confirmed that the mutant sequence repaired by such homologous recombination was the sequence of Ex1 (exon 1) encoding wild-type IL2RG (error-free repair).
[0195] [Transplantation of IL2RG-deficient porcine hematopoietic stem cells transfected with the IL2RG-Ex1 gene into SCID pigs and detection]
[0196] The IL2RG-deficient porcine hematopoietic stem cells that had undergone the above-described genomic repair were autotransplanted into an IL2RG-deficient pig of the same individual. Four weeks after transplantation, cells derived from the peripheral blood of this individual were taken, and the presence or absence of cells that had undergone genomic repair by homologous recombination was confirmed by PCR analysis. As a result, only the band corresponding to homologous recombination was detected, and no band corresponding to non-homologous recombination was detected ( Figure 3 ). In addition, after sequence analysis of the obtained PCR product, it was confirmed that the gene mutation in the SCID pig was repaired error-free to a healthy base sequence by homologous recombination. This indicates that the gene abnormality in this pig was repaired only by homologous recombination of the targeting vector.
[0197] <Experimental Example 2>
[0198] [Construction of the donor plasmid]
[0199] In order to repair IL2RG on the genome of bone marrow stromal cells derived from SCID model pigs described in Watanabe M et al., PloS One., 2013 Oct 9; 8(10): e76478., the donor plasmid (targeting vector) shown in Figure 4 was produced.
[0200] The base sequence of the 5'-side homologous arm (10 bp) is the same as that of SEQ ID NO: 1.
[0201] The base sequence of Ex1 (exon 1) is the same as that of SEQ ID NO: 3.
[0202] The base sequence of the 3'-side homologous arm (50 bp) is the same as that of SEQ ID NO: 4.
[0203] The HITI base sequence added to both ends of the homologous arm is the same as that of SEQ ID NO: 6.
[0204] [Insertion of wild-type IL2RG-Ex1 gene into IL2RG-deficient pig cells using CRISPR-Cas9]
[0205] The Cas9 protein, the crRNA shown in SEQ ID NO: 7, the tracrRNA, and the above-mentioned donor plasmid were introduced by electroporation. As the pig-derived bone marrow stromal cells, adherent cells obtained by liquid culturing pig bone marrow monocytes were used.
[0206] [Confirmation of insertion by genomic PCR]
[0207] Genomic DNA was purified from the cells 3 days after electroporation, and confirmation of DNA insertion by PCR was performed. As the primers for insertion confirmation, the combinations of A and B, and the combinations of C and D shown in Figure 4 were used. By PCR using the combination of primers A and B, if non-homologous recombination occurred, a 389-bp DNA was amplified. By PCR using the combination of primers C and D, if non-homologous recombination occurred, a 399-bp DNA was amplified, and if homologous recombination occurred, a 301-bp DNA was amplified.
[0208] Figure 5 The results of electrophoresis of the PCR products are shown. As Figure 5 shown, a band corresponding to the size of non-homologous recombination was seen at the 5'-end, and bands corresponding to the sizes of homologous recombination and non-homologous recombination were seen at the 3'-end. Figure 5 In , NHEJ indicates the band size corresponding to non-homologous recombination, and HDR indicates the band size corresponding to homologous recombination. That is, unilateral homologous recombination occurred in the pig-derived bone marrow stromal cells, where non-homologous recombination occurred at the 5'-end of the foreign DNA and homologous recombination occurred at the 3'-end. This indicates that non-homologous recombination occurred at the 5'-end (10 bp) of the shorter side of the homologous arm, and homologous recombination occurred at the 3'-end (50 bp) of the longer side of the homologous arm.
[0209] [Confirmation of the recombination method by sequencing]
[0210] The PCR products of TA cloning were introduced into Escherichia coli, and sequencing of each formed colony was performed. It was confirmed that non-homologous recombination occurred at the 5'-end in all clones of clone 5, and homologous recombination occurred at a high frequency in clone 6 of clone 7 at the 3'-end.
[0211] <Experimental Example 3>
[0212] To knock-in the MCS (Multicloning Site), GFP, and blasticidin S deaminase (BSR) genes into the Rosa26 region and the β-Actin (Actb) locus of the mouse hematopoietic stem cell genome, donor plasmids containing 10-bp homologous arms at both ends, donor plasmids containing 50-bp homologous arms at both ends, and donor plasmids containing 100-bp homologous arms at both ends were prepared. Mouse hematopoietic stem cells were used from various (CD5, CD45R, CD11b, Gr-1, 7-4, and Ter-119) differentiation marker-negative cells (Lin-) in mouse bone marrow.
[0213] The base sequence of the 10-bp homologous arm targeting the 5'-side of the Rosa26 region is shown below:
[0214] 5'-TGCAACTCCA-3' (SEQ ID NO: 8).
[0215] The base sequence of the 50-bp homologous arm targeting the 5'-side of the Rosa26 region is shown below:
[0216] 5'-TGGGCCTGGGAGAATCCCTTCCCCCTCTTCCCTCGTGATCTGCAACTCCA-3' (SEQ ID NO: 9).
[0217] The base sequence of the 100-bp homologous arm targeting the 5'-side of the Rosa26 region is shown below:
[0218] 5'-AATACCTTTCTGGGAGTTCTCTGCTGCCTCCTGGCTTCTGAGGACCGCCCTGGGCCTGGGAGAATCCCTTCCCCCTCTTCCCTCGTGATCTGCAACTCCA-3' (SEQ ID NO: 10).
[0219] The base sequence of the 10-bp homologous arm targeting the 3'-side of the Rosa26 region is shown below:
[0220] 5'-ACAGGTGTAA-3' (SEQ ID NO: 11).
[0221] The base sequence of the 50-bp homologous arm targeting the 3'-side of the Rosa26 region is shown below:
[0222] 5’-ACAGGTGTAAAATTGGAGGGACAAGACTTCCCACAGATTTTCGGTTTTGT-3’ (SEQ ID NO: 12).
[0223] The base sequence of the 100 bp homologous arm targeting the 3'-side of the Rosa26 region is as follows:
[0224] 5’-ACAGGTGTAAAATTGGAGGGACAAGACTTCCCACAGATTTTCGGTTTTGTCGGGAAGTTTTTTAATAGGGGCAAATAAGGAAAATGGGAGGATAGGTAGT-3’ (SEQ ID NO: 13).
[0225] The base sequence of the exogenous DNA containing the GFP gene is as follows:
[0226] 5’-actagttctagcatctgtagggcgcagtagtccagggtttccttgatgatgtcatacttatcctgtcccttttttttccacagctcgcggttgaggacaaactcttcgcgcatgcggatccggtaccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAgaattc-3’(SEQ ID NO: 14).
[0227] In the case of targeting the Rosa26 region, the HITI base sequences added at both ends of the homologous arms are as follows:
[0228] 5’-CCATCTTCTAGAAAGACTGGAGT-3’(SEQ ID NO: 15).
[0229] Using the same method as in Experimental Examples 1 and 2, Cas9 protein, crRNA represented by SEQ ID NO: 16 (5’-ACUCCAGUCUUUCUAGAAGAGUUUUAGAGCUAUGCU-3’) targeting the Rosa26 region, tracrRNA, and the above-mentioned donor plasmid were introduced into mouse hematopoietic stem cells by electroporation.
[0230] Three days after electroporation, genomic DNA was purified from the cells, and confirmation of DNA insertion by PCR was performed. As Figure 6 shown, only bands corresponding to the size of homologous recombination were observed at the 5’ end and the 3’ end. That is, the GFP gene was inserted into the Rosa26 region of the mouse hematopoietic stem cell genome only by homologous recombination.
[0231] <Experimental Example 4>
[0232] To knock-in the GFP gene into the Actb locus of mouse fertilized eggs, a donor plasmid containing 100-bp homologous arms at both ends was prepared. Since a stop codon was present outside the 5’-end homologous arm (5’-end side), GFP was expressed when homologous recombination occurred at the 5’ end.
[0233] The base sequence of the 100-bp homologous arm on the 5’ side is as follows:
[0234] 5’-GGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTGCACCGCAA-3’ (SEQ ID NO: 17).
[0235] The base sequence of the 100-bp homologous arm on the 3’ side is as follows:
[0236] 5’-GGACTGTTACTGAGCTGCGTTTTACACCCTTTCTTTGACAAAACCTAACTTGCGCAGAAAAAAAAAAAATAAGAGACAACATTGGCATGGCTTTGTTTTT-3’ (SEQ ID NO: 18).
[0237] The HITI base sequences added to both ends of the homologous arms are as follows:
[0238] 5’-AGTCCGCCTAGAAGCACTTGCGG-3’ (SEQ ID NO: 19).
[0239] The base sequence of the exogenous DNA containing the GFP gene is the same as that in Experimental Example 3.
[0240] The Cas9 protein, the crRNA shown in SEQ ID NO: 20 (5’-AGUCCGCCUAGAAGCACUUGGUUUUAGAGCUAUGCU-3’), the tracrRNA, and the above-mentioned donor plasmid were introduced into mouse fertilized eggs by microinjection.
[0241] Six days after microinjection, genomic DNA was extracted from the cells, and confirmation of DNA insertion by PCR was performed. As Figure 7A shown, since the cells showed green fluorescence when observed under a fluorescence microscope, it was confirmed that the GFP gene was knocked in at the 5’ end by homologous recombination. In addition, as Figure 7B shown, a PCR band corresponding to the size of homologous recombination was seen at the 5’ end, and a PCR band corresponding to the size of non-homologous recombination was seen at the 3’ end. That is, it was knocked into mouse fertilized eggs by single-sided homologous recombination. The results showed that for single-sided homologous recombination, the lengths of the homologous arms did not necessarily have to be different at both ends.
[0242] <Experimental Example 5>
[0243] To knock the GFP gene into the HPRT locus of the genome of human T cell leukemia cells (Jurkat cells), donor plasmids containing homologous arms of approximately 60 bp at both ends and donor plasmids containing homologous arms of approximately 240 bp at both ends were prepared.
[0244] The base sequence of the 60-bp homologous arm on the 5’ side is as follows:
[0245] 5’-GATGAACCAGGTTATGACCTTGATTTATTTTGCATACCTAATCATTATGCTGAGGATTTG-3’ (SEQ ID NO: 21).
[0246] The base sequence of the 244-bp homologous arm on the 5’ side is as follows:
[0247] 5’-CCGGCCTGTTGTTTTCTTACATAATTCATTATCATACCTACAAAGTTAACAGTTACTAATATCATCTTACACCTAAATTTCTCTGATAGACTAAGGTTATTTTTTAACATCTTAATCCAATCAAATGTTTGTATCCTGTAATGCTCTCATTGAAACAGCTATATTTCTTTTTCAGATTAGTGATGATGAACCAGGTTATGACCTTGATTTATTTTGCATACCTAATCATTATGCTGAGGATTTG-3’ (SEQ ID NO: 22).
[0248] The base sequence of the 61bp homologous arm on the 3' side is as follows:
[0249] 5'-GAAAGGGTGTTTATTCCTCATGGACTAATTATGGACAGGTAAGTAAGATCTTAAAATGAGG-3' (SEQ ID NO: 23).
[0250] The base sequence of the 239bp homologous arm on the 3' side is as follows:
[0251] 5'-GAAAGGGTGTTTATTCCTCATGGACTAATTATGGACAGGTAAGTAAGATCTTAAAATGAGGTTTTTTACTTTTTCTTGTGTTAATTTCAAACATCAGCAGCTGTTCTGAGTACTTGCTATTTGAACATAAACTAGGCCAACTTATTAAATAACTGATGCTTTCTAAAATCTTCTTTATTAAAAATAAAAGAGGAGGGCCTTACTAATTACTTAGTATCAGTTGTGGTATAGTGGGACTC-3' (SEQ ID NO: 24).
[0252] The base sequence of the exogenous DNA containing the GFP gene is as follows:
[0253] 5’-gaattcATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTtCAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGcGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAcCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGgTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAggatcc-3’ (SEQ ID NO: 25).
[0254] The HITI base sequences added to both ends of the homologous arms are shown as follows:
[0255] 5’-ACCCTTTCCAAATCCTCAGCATAATG-3’ (SEQ ID NO: 26).
[0256] The plasmid (px330-HPRT) co-expressing the Cas9 protein and the sgRNA with the recognition sequence shown in SEQ ID NO: 27 (5’-UUAUGCUGAGGAUUUGGAAA-3’), and the above donor plasmid were introduced into Jurkat cells by electroporation.
[0257] Three days after electroporation, genomic DNA was purified from the cells, and confirmation of DNA insertion by PCR was performed. As Figure 8 shown, bands corresponding to the size of homologous recombination were seen at the 5'-end and 3'-end. That is, in human T-cell leukemia cells, knock-in by homologous recombination on both sides was confirmed. It was confirmed by the following sequencing that this knock-in was achieved by error-free homologous recombination.
[0258] The PCR products of TA cloning were introduced into Escherichia coli, and sequencing of each formed colony was performed. In the case of the 60-bp arm, it was confirmed that homologous recombination occurred in all clones in clone No. 8 at the 5'-end, and homologous recombination occurred in all clones in clone No. 7 at the 3'-end. In the case of the 240-bp arm, homologous recombination occurred in all clones in clone No. 6 at the 5'-end, and homologous recombination occurred in all clones in clone No. 8 at the 3'-end.
[0259] <Experimental Example 6>
[0260] To knock-in the GFP gene into the LMNB1 locus of the genome of the human fetal kidney cell line (HEK293T), a donor plasmid containing homologous arms of 101 bp at both ends was prepared.
[0261] The base sequence of the 101-bp homologous arm on the 5'-side is as follows:
[0262] 5'-CGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCA-3' (SEQ ID NO: 28).
[0263] The base sequence of the 101-bp homologous arm on the 3'-side is as follows:
[0264] 5'-acCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGA-3' (SEQ ID NO: 29).
[0265] The base sequence of the foreign DNA containing the GFP gene is as follows:
[0266] 5’-gatcTGACAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTtCAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGcGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAcCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGgTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGCCGGCTCCGgtac-3’(SEQ ID NO: 30).
[0267] The HITI base sequences added at both ends of the homologous arms are as follows:
[0268] 5’-GGGGTCGCAGTCGCCATGGCGGG-3’(SEQ ID NO: 31).
[0269] The rcHITI base sequences added at both ends of the homologous arms (the reverse complement of HITI, i.e., the guide RNA recognition sequence containing the PAM sequence is in the same direction as the genome at both ends of the foreign DNA) are as follows:
[0270] 5’-CCCGCCATGGCGACTGCGACCCC-3’ (SEQ ID NO: 32).
[0271] A plasmid (px330-LMNB1) co-expressing Cas9 protein and sgRNA with the recognition sequence shown in SEQ ID NO: 33 (5’-GGGGUCGCAGUCGCCAUGGC-3’), and the above-mentioned donor plasmid were transfected by liposome transfection.
[0272] As Figure 9A shown, regardless of whether the guide RNA recognition sequence has either HITI or rcHITI, only the bands corresponding to homologous recombination were observed.
[0273] As Figure 9B shown, 4 days after liposome transfection, GFP-positive cells were purified by FACS and cultured for another week. Since the nuclear membrane showed green when observed under a fluorescence microscope, it was confirmed that GFP was locally present in the nuclear membrane. The above-mentioned donor plasmid was designed such that if homologous recombination occurred at both ends, the LMNB1 gene would fuse with the GFP gene and its product would be locally present in the nuclear membrane. Therefore, the occurrence of homologous recombination at the 5’ end and the 3’ end was also confirmed from the fluorescence images.
[0274] In addition, as Figure 9C shown, one week after liposome transfection, GFP-expressing cells were quantified by flow cytometry, and it was confirmed that homologous recombination occurred at 8.9 to 9.2% in the case of using a donor plasmid with a base sequence added with HITI or rcHITI.
[0275] <Experimental Example 7>
[0276] To knock the GFP gene into the HPRT locus of human-derived bone marrow stromal cells, donor plasmids containing 10-bp homologous arms at both ends, donor plasmids containing approximately 60-bp homologous arms at both ends, and donor plasmids containing approximately 240-bp homologous arms at both ends were prepared.
[0277] The base sequence of the 10-bp homologous arm on the 5’ side is as follows:
[0278] 5’-TGAGGATTTG-3’ (SEQ ID NO: 34).
[0279] The base sequence of the 10-bp homologous arm on the 3’ side is as follows:
[0280] 5’-GAAAGGGTGT-3’ (SEQ ID NO: 35).
[0281] The base sequences of the homologous arms of about 60 bp to about 240 bp at both ends, the base sequence of HITI, and the base sequence of the exogenous DNA are the same as those in Experimental Example 6.
[0282] A plasmid (px330-HPRT) co-expressing the Cas9 protein and the sgRNA with the recognition sequence shown in SEQ ID NO: 27, and the above-mentioned donor plasmid were transfected into human-derived bone marrow stromal cells by liposome transfection.
[0283] Three days after liposome transfection, genomic DNA was purified from the cells, and confirmation of DNA insertion by PCR was performed. As Figure 10 shown, bands corresponding to the size of homologous recombination were observed at the 5'-end and 3'-end. That is, the knock-in in human-derived bone marrow stromal cells is bilateral homologous recombination.
[0284] <Experimental Example 8>
[0285] To knock-in the GFP gene into the HPRT locus of human iPS cells, donor plasmids containing homologous arms of 10 bp at both ends, donor plasmids containing homologous arms of about 60 bp at both ends, and donor plasmids containing homologous arms of about 240 bp at both ends were prepared.
[0286] The base sequences of the homologous arms of 10 bp to about 240 bp at both ends, the base sequence of HITI, and the base sequence of the exogenous DNA are the same as those in Experimental Example 7.
[0287] Similar to Experimental Example 1, the Cas9 protein, the crRNA shown in SEQ ID NO: 36 (5'-UUAUGCUGAGGAUUUGGAAAGUUUUAGAGCUAUGCU-3'), the tracrRNA, and the above-mentioned donor plasmid were introduced into human iPS cells by electroporation.
[0288] Four days after electroporation, genomic DNA was purified from the cells, and confirmation of DNA insertion by PCR was performed. As Figure 11 shown, bands corresponding to the size of homologous recombination were observed at the 5'-end and 3'-end. In addition, homologous recombination was confirmed by sequencing. That is, the knock-in in human iPS cells is bilateral homologous recombination.
[0289] <Experimental Example 9>
[0290] The experiment in <Experimental Example 3> was performed using ZFN and TALEN. A donor plasmid containing homologous arms of 100 bp at both ends was used. The results are as Figure 12As shown, in the case of using ZFN and TALEN, similarly, at the 5'-end and 3'-end, bands corresponding to the size of homologous recombination were observed. In the present invention, it has been clarified that as a target genomic DNA cleavage enzyme, not limited to CRISPR / Cas9, either one of ZFN or TALEN can be used.
[0291] In the above experimental example, similar to <Experimental Example 1>, the results of the recombination method were confirmed by sequencing as shown in Table 1. The efficiency of homologous recombination is shown in parentheses.
[0292] As shown in Table 1, it was confirmed that knock-in was performed by homologous recombination regardless of the animal species and the target locus.
[0293] [Table 1]
[0294]
[0295] Industrial applicability
[0296] According to the present invention, it is possible to achieve a homologous recombination frequency higher than non-homologous recombination in a target genome without impairing the ability of the cell to inherently have non-homologous end joining. Sequence Listing <110> School Corporation Jichi Medical University <120> Genome Editing Method, Composition, Cell, Cell Preparation, and Method for Producing Cell Preparation <130> PC27495 <150> JP2018-66174 <151> 2018-03-29 <160> 36 <170> PatentIn version 3.5 <210> 1 <211> 10 <212> DNA <213> Sus scrofa <400> 1 ggcccaggtt 10 <210> 2 <211> 50 <212> DNA <213> Sus scrofa <400> 2 caaaaggaaa tgtgtgggtg gggaggggta gtgggtaagg ggcccaggtt 50 <210> 3 <211> 155 <212> DNA <213> Artificial Sequence <220> <223> Exon1 of IL2RG <400> 3 cctgacacag tctacaccca ggaaacaagg agtaagcgcc atgctcaaac cccccctccc 60 cgtcaagtct ctcctcttcc tccagctccc tctgctcggc gtcggcctca atcctaaggt 120 cctcacccac agcggcaacg aggacatcac cgctg 155 <210> 4 <211> 50 <212> DNA <213> Sus scrofa <400> 4 gtgggaaact gggacgttgg gggtagggtt ggtgagccgg gggaggctgg 50 <210> 5 <211> 10 <212> DNA <213> Sus scrofa <400> 5 gtgggaaact 10 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL2RG HITI <400> 6 ccttcgggtt cagtcccacc cca 23 <210> 7 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> IL2RG crRNA <400> 7 ugggguggga cugaacccga guuuuagagc uaugcu 36 <210> 8 <211> 10 <212> DNA <213> Mus musculus <400> 8 tgcaactcca 10 <210> 9 <211> 50 <212> DNA <213> Mus musculus <400> 9 tgggcctggg agaatccctt ccccctcttc cctcgtgatc tgcaactcca 50 <210> 10 <211> 100 <212> DNA <213> Mus musculus <400> 10 aatacctttc tgggagttct ctgctgcctc ctggcttctg aggaccgccc tgggcctggg 60 agaatccctt ccccctcttc cctcgtgatc tgcaactcca 100 <210> 11 <211> 10 <212> DNA <213> Mus musculus <400> 11 acaggtgtaa 10 <210> 12 <211> 50 <212> DNA <213> Mus musculus <400> 12 acaggtgtaa aattggaggg acaagacttc ccacagattt tcggttttgt 50 <210> 13 <211> 100 <212> DNA <213> Mus musculus <400> 13 acaggtgtaa aattggaggg acaagacttc ccacagattt tcggttttgt cgggaagttt 60 tttaataggg gcaaataagg aaaatgggag gataggtagt 100 <210> 14 <211> 853 <212> DNA <213> Artificial Sequence <220> <223> GFP <400> 14 actagttcta gcatctgtag ggcgcagtag tccagggttt ccttgatgat gtcatactta 60 tcctgtccct tttttttcca cagctcgcgg ttgaggacaa actcttcgcg catgcggatc 120 cggtaccatg gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga 180 gctggacggc gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc 240 cacctacggc aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg 300 gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct accccgacca 360 catgaagcag cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac 420 catcttcttc aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt tcgagggcga 480 caccctggtg aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct 540 ggggcacaag ctggagtaca actacaacag ccacaacgtc tatatcatgg ccgacaagca 600 gaagaacggc atcaaggtga acttcaagat ccgccacaac atcgaggacg gcagcgtgca 660 gctcgccgac cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga 720 caaccactac ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca 780 catggtcctg ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta 840 caagtaagaa ttc 853 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Rosa26 HITI <400> 15 ccatcttcta gaaagactgg agt 23 <210> 16 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Rosa26 crRNA <400> 16 acuccagucu uucuagaaga guuuuagagc uaugcu 36 <210> 17 <211> 100 <212> DNA <213> Mus musculus <400> 17 ggatcggtgg ctccatcctg gcctcactgt ccaccttcca gcagatgtgg atcagcaagc 60 aggagtacga tgagtccggc ccctccatcg tgcaccgcaa 100 <210> 18 <211> 100 <212> DNA <213> Mus musculus <400> 18 ggactgttac tgagctgcgt tttacaccct ttctttgaca aaacctaact tgcgcagaaa 60 aaaaaaaaat aagagacaac attggcatgg ctttgttttt 100 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Actb HITI <400> 19 agtccgccta gaagcacttg cgg 23 <210> 20 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Actb crRNA <400> 20 aguccgccua gaagcacuug guuuuagagc uaugcu 36 <210> 21 <211> 60 <212> DNA <213> Homo sapiens <400> 21 gatgaaccag gttatgacct tgatttattt tgcataccta atcattatgc tgaggatttg 60 <210> 22 <211> 244 <212> DNA <213> Homo sapiens <400> 22 ccggcctgtt gttttcttac ataattcatt atcataccta caaagttaac agttactaat 60 atcatcttac acctaaattt ctctgataga ctaaggttat tttttaacat cttaatccaa 120 tcaaatgttt gtatcctgta atgctctcat tgaaacagct atatttcttt ttcagattag 180 tgatgatgaa ccaggttatg accttgattt attttgcata cctaatcatt atgctgagga 240 tttg 244 <210> 23 <211> 61 <212> DNA <213> Homo sapiens <400> 23 gaaagggtgt ttattcctca tggactaatt atggacaggt aagtaagatc ttaaaatgag 60 g 61 <210> 24 <211> 239 <212> DNA <213> Homo sapiens <400> 24 gaaagggtgt ttattcctca tggactaatt atggacaggt aagtaagatc ttaaaatgag 60 gttttttact ttttcttgtg ttaatttcaa acatcagcag ctgttctgag tacttgctat 120 ttgaacataa actaggccaa cttattaaat aactgatgct ttctaaaatc ttctttatta 180 aaaataaaag aggagggcct tactaattac ttagtatcag ttgtggtata gtgggactc 239 <210> 25 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> GFP <400> 25 gaattcatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 60 ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 120 acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 180 cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 240 atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca ggagcgcacc 300 atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac 360 accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg 420 gggcacaagc tggagtacaa cttcaacagc cacaacgtct atatcatggc cgacaagcag 480 aagaacggca tcaaggcgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag 540 ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac 600 aaccactacc tgaccaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac 660 atggtcctgg tggagttcgt gaccgccgcc gggatcactc tcggcatgga cgagctgtac 720 aagtaaggat cc 732 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HPRT HITI <400> 26 accctttcca aatcctcagc ataatg 26 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> HPRT gRNA <400> 27 uuaugcugag gauuuggaaa 20 <210> 28 <211> 101 <212> DNA <213> Homo sapiens <400> 28 cgccggtttg tgccttcggt ccccgcttcg ccccctgccg tcccctcctt atcacggtcc 60 cgctcgcggc ctcgccgccc cgctgtctcc gccgcccgcc a 101 <210> 29 <211> 101 <212> DNA <213> Homo sapiens <400> 29 acccccgtgc cgccgcggat gggcagccgc gctggcggcc ccaccacgcc gctgagcccc 60 acgcgcctgt cgcggctcca ggagaaggag gagctgcgcg a 101 <210> 30 <211> 740 <212> DNA <213> Artificial Sequence <220> <223> GFP <400> 30 gatctgacaa tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 60 gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat 120 gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc 180 tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac 240 cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc 300 accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 360 gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc 420 ctggggcaca agctggagta caacttcaac agccacaacg tctatatcat ggccgacaag 480 cagaagaacg gcatcaaggc gaacttcaag atccgccaca acatcgagga cggcagcgtg 540 cagctcgccg accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc 600 gacaaccact acctgaccac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 660 cacatggtcc tggtggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg 720 tacaaggccg gctccggtac 740 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LMNB1 HITI <400> 31 ggggtcgcag tcgccatggc ggg 23 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rcHITI <400> 32 cccgccatgg cgactgcgac ccc 23 <210> 33 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> LMNB1 gRNA <400> 33 ggggucgcag ucgccauggc 20 <210> 34 <211> 10 <212> DNA <213> Homo sapiens <400> 34 tgaggatttg 10 <210> 35 <211> 10 <212> DNA <213> Homo sapiens <400> 35 gaaagggtgt 10 <210> 36 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> HPRT crRNA <400> 36 uuaugcugag gauuuggaaa guuuuagagc uaugcu 36
Claims
1. A genome editing method, which is a genome editing method in isolated cells, characterized in that when cutting the double strands of the target genomic DNA, non-homologous recombination is performed on one end of the 5' end and the 3' end of the exogenous DNA, and homologous recombination is performed on the other end, so as to introduce the exogenous DNA into the target genome. Among them, one end of the 5' end and the 3' end of the exogenous DNA has no homologous arm, and the other end has a homologous arm with a length of more than 50 bp.
2. The genome editing method according to claim 1, wherein the cell is a blood cell, an undifferentiated cell or a nerve cell.
3. The genome editing method according to claim 1 or 2, wherein the cell is a stem cell.
4. The genome editing method according to claim 1 or 2, wherein the cell is a hematopoietic stem cell.
5. The genome editing method according to claim 1 or 2, wherein the length of each of the homologous arms is less than 500 bp.
6. A method for manufacturing a cell preparation for treating severe combined immunodeficiency disease, the method for manufacturing the cell preparation is characterized in that in the cell, when cutting the double strands of the target genomic DNA, non-homologous recombination is performed on one end of the 5' end and the 3' end of the exogenous DNA, and homologous recombination is performed on the other end, so as to introduce the exogenous DNA into the genome of the cell. Among them, One end of the 5' end and the 3' end of the exogenous DNA has no homologous arm, and the other end has a homologous arm with a length of more than 50 bp.
7. The method for manufacturing a cell preparation according to claim 6, wherein the length of each homologous arm is less than 500 bp.
Citation Information
Patent Citations
Position determination device, position determination method and program, and keyless entry system
JP2018066174A
METHODS AND COMPOSITIONS FOR TARGETED GENETIC MODIFICATION USING PAIRED GUIDE RNAs
WO2016081923A2
Chemically modified guide RNAs for CRISPR / CAS-mediated gene regulation
CN107787367A