Molecular assessment for TRBC use
Through genomic DNA analysis and the close linkage between J and C regions, the accurate problem of TRBC type in patients with peripheral T cell lymphoma is solved, and the diagnosis of high reliability and low error rate is achieved, ensuring the accuracy of targeted therapies and the protection of healthy T cells.
Patent Information
- Application Number
- CN201980051847.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2018-08-03
- Filing Date
- 2019-07-18
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2039-07-18
AI Technical Summary
The prior art is difficult to accurately determine the T cell receptor beta strand (TRBC) gene type in patients with peripheral T cell lymphoma (PTCL), resulting in inaccuracy of targeted therapies and risk of damage to healthy T cells. Existing methods such as IHC and RNA detection are subjective and unreliable.
Through genomic DNA analysis, the nucleotide sequence of the J region is determined and the TRBC type is inferred by using the close genetic linkage between the J region and the C region, and the binary answer (TRBC1 or TRBC2) is provided, suitable for fixed or fresh tissue samples.
The diagnosis of high reliability and low error rate of TRBC types is achieved, and the subjectivity and unreliability of existing methods are overcome, ensuring the accuracy of targeted therapies and the protection of healthy T cells.
Smart Images

Figure CN112534065B_ABST
Abstract
Description
Field of the Invention
[0001] The present invention is in the field of molecular assessment of T cell receptor beta chain (TRBC) usage, such as in peripheral T cell lymphoma (PTCL), and in particular determining the type of constant region gene expressed in specific cells such as PTCL. BACKGROUND OF THE INVENTION
[0003] Peripheral T-cell lymphoma (PTCL) accounts for 10% to 15% of non-Hodgkin lymphomas and is comprised of 23 distinct entities. Standards of care for this subset of diseases are variable, and 65% of patients are refractory or relapse after standard therapy. The lack of specific targets for PTCL has hampered the development of targeted immunotherapies for these diseases.
[0004] αβTCR is a pan-T cell antigen that is expressed on normal T cells and is a promising target for the treatment of PTCL.
[0005] Therefore, one approach to treating T-cell leukemias and / or lymphomas is to target the T-cell receptor as an antigen. This approach can effectively destroy cells bearing the antigen and is a very effective approach for B-cell malignancies. However, in contrast to B-cell ablation, removing T-cell populations from patients is poorly tolerated. The severe toxicity associated with partial ablation of T cells increases the risk of targeting antigens expressed on healthy T cells. This is extremely toxic and exposes patients to dangerous infections.
[0006] A hallmark of TCR β chain recombination is the presence of two genes associated with the β chain constant region: TRBC1 and TRBC2. Every T cell (and therefore every T cell cancer) irreversibly chooses either TRBC1 or TRBC2 to be integrated into the TCR.
[0007] About 35% of normal and virus-specific T cells express TRBC1, while 65% express TRBC2. Targeting tumors that express TRBC1 should deplete tumor cells while leaving the remaining T cells to expand, fill the T cell fraction, and fight infection.
[0008] CAR T cells targeting TRBC1 but not TRBC2 have been described for the treatment of mature T-cell cancers.17 Critical to the success of this strategy is the selection of patients with lymphomas expressing the correct TCR beta constant region.
[0009] Determining the TRBC1 or TRBC2 type of T cells (T-cell cancers) is a problem in the art.
[0010] A general diagnostic strategy for patients with T-cell lymphoma has been described, which relies on determining the percentage of total T cells in a tumor sample isolated from a subject to be positive for TRBC1 or TRBC2. The use of anti-TRBC1 chimeric antigen receptor (CAR) T cells to target and kill TRBC1+ T cells has been described (Maciocia et al 2017 Nature Medicine volume 23, pages 1416-1423). JOVI-1 mAb (which is specific for cells expressing TRBC1) is used to distinguish between cells expressing TRBC1 / TRBC2. This is laborious, and IHC methods can be subjective, which is a disadvantage of this method.
[0011] WO2016051205A1 discloses a method for studying the monotypia of a T cell population, which comprises detecting the expression of T cell receptor beta chain constant regions TRBC1 and TRBC2 and / or T cell receptor gamma chain constant regions TRGC1 and TRGC in the T cell population. The described techniques focus on IHC and / or direct RNA-based detection of constant regions. These methods can be unreliable (e.g., IHC) and / or require RNA preservation / extraction (e.g., direct detection), both of which are disadvantages of these methods.
[0012] WO2015 / 132598 (corresponding to AU2015225944) describes TRBC1 and TRBC2 specific chimeric antigen receptors (CARs) for the treatment of T-cell malignancies. However, accurately determining the TRBC1 / TRBC2 type of a malignancy remains a problem in the art.
[0013] The present invention seeks to overcome the problems associated with the prior art. SUMMARY OF THE INVENTION
[0015] Targeting only tumors expressing TRBC1 or Tumors expressing TRBC2 should be depleted of tumor cells, leaving the remaining T cells to expand, populate the T cell fraction and fight infection.
[0016] Methods are described herein that allow molecular diagnosis of a patient's tumor to determine whether the tumor is composed of cells expressing TRBC1 or TRBC2. This method offers significant advantages over other methods because it allows diagnosis to be performed on any patient sample from which nucleic acid, preferably genomic DNA, can be obtained.
[0017] Thus, the present invention provides a diagnostic test that enables TRBC typing of a sample from a patient. In this way, an appropriate therapy (ie targeting cells expressing TRBC1, or targeting cells expressing TRBC2) can be selected for the patient.
[0018] The method taught by the present invention advantageously uses genomic DNA analysis to determine the TRBC type of cells in a sample. The inventors discovered a surprisingly tight genetic linkage between the J region (junction region) and the C region (constant region) of the TCR gene. The inventors have realized that the TRBC type of a cell can be inferred by studying the J region, exploiting the newly discovered linkage between the J region and the C region, and inferring the TRBC type of the C region of interest.
[0019] Surprisingly, this approach was successful given that regions C and J are separated by a large amount of intermediate nucleic acid. This amount of genetic distance would normally result in much looser linkage between regions J and C. For these reasons, it was surprising to observe such reliable and tight linkage between regions J and C, making the diagnostic method of the present invention possible.
[0020] Another advantage of the present invention is that this precise genetic method is better and more accurate than any method based on immunohistochemistry (IHC) "by eye".
[0021] Prior art methods have taught the use of antibodies to determine the TRBC type of a sample. However, antibody-based methods require subjective judgment and / or human intervention to evaluate their output. The advantage of the present invention is that it provides a binary answer (TRBC1 or TRBC2).
[0022] The extremely high reliability and extremely low error rate (e.g., recombination rate) between the determined J region genes and the inferred C region genes that exist is very surprising. Even if the skilled artisan had considered that the two genes might be linked, they would never have anticipated that they would be so tightly linked to provide reliable diagnostic information as taught by the present invention.
[0023] It is well known in the art that many antibodies do not bind to epitopes in fixed tissues, but only to epitopes in fresh or frozen tissues. As is well known in the art, tissue fixation can affect protein structure, so it is very common for antibodies to recognize epitopes that are not present / available in one or other sample types. An advantage of the present invention is that by using genetic methods, the test is equally effective on fixed, fresh, or frozen tissues. Therefore, the present invention is widely applicable to any type of sample, overcoming the limitations of prior art methods such as IHC analysis.
[0024] Thus, in one aspect, the present invention relates to a method for determining the T cell receptor beta chain (TRBC) gene type of a cell, the method comprising
[0025] (a) determining the type of J gene expressed in said cell, and
[0026] (b) The type of TRBC gene expressed in the cells was inferred from (a).
[0027] "J gene" has its usual meaning in the art. Suitably, "J gene" refers to the zygosity or joining segment (J region) of a T cell receptor gene.
[0028] Suitably, the term "V region" has its normal meaning in the art, ie the variable region or section (V region) of a T cell receptor gene.
[0029] Suitably, the term "C region" has its normal meaning in the art, ie the constant region or constant segment (C region) of a T cell receptor gene.
[0030] Suitably, the term "D region" has its normal meaning in the art, ie the diversity region or diversity segment (D region) of a T cell receptor gene.
[0031] If further guidance is needed, annotated reference sequences are provided below.
[0032] Suitably, step (a) comprises:
[0033] (i) extracting nucleic acid from the cell;
[0034] (ii) determining the nucleotide sequence of at least one segment of the J gene from the nucleic acid; and
[0035] (iii) comparing the nucleotide sequence determined in (ii) to one or more J gene reference nucleotide sequences, and
[0036] (iv) identifying the J gene type from the sequence identity between the nucleotide sequence of the segment of the J gene of (ii) and the J gene reference nucleotide sequence of (iii).
[0037] Suitably, the J gene reference nucleotide sequence is as shown in Table 1.
[0038] When considering the sequence identity of the nucleotide sequence of the section of the J gene of (ii) and the J gene reference nucleotide sequence of (iii), it is necessary to have a sufficient level of sequence identity to identify the J gene reference nucleotide sequence (i.e., identify the J gene type) with appropriate scientific / statistical confidence. Suitably, it is necessary to match the sequence identity of 100% with the J gene reference nucleotide sequence. Suitably, sequence identity is assessed over the entire length of the J gene reference nucleotide sequence. Suitably, before sequence identity is determined, it may be necessary to compare the query sequence and the J gene reference nucleotide sequence. The comparison of sequences can be completed by the naked eye, or known sequence alignment tools can be used to carry out, such as discussed below.
[0039] Suitably, the nucleic acid comprises genomic DNA (gDNA).
[0040] Suitably, said segment of said J gene comprises the entire J region of a T cell receptor gene.
[0041] Suitably, said segment of said J gene is comprised in CDR3 of a T cell receptor gene.
[0042] Suitably, the segment of the J gene is selected from the group consisting of:
[0043]
[0044]
[0045] Suitably, step (ii) comprises:
[0046] (1) contacting the nucleic acid with a reagent for amplifying at least one segment of the J gene;
[0047] (2) incubation to allow amplification;
[0048] (3) Determine the nucleotide sequence of the amplified segment of the J gene.
[0049] Suitably, the reagents for amplification comprise at least one forward primer located in the V region of the T cell receptor gene and at least one reverse primer located in the J region of the T cell receptor gene, or The reagents for amplification comprise at least one reverse primer located in the V region of the T cell receptor gene and at least one forward primer located in the J region of the T cell receptor gene.
[0050] Suitably, the method further comprises:
[0051] (2a) performing electrophoresis on the amplified segment of the J gene;
[0052] (2b) Selecting the dominant amplification product from step (2a) for nucleotide sequencing.
[0053] Suitably, step (a) comprises clonality determination or immunosequencing of the cells to provide nucleotide sequence information of the J gene, and determining the J gene type from the nucleotide sequence information.
[0054] Suitably, determining the nucleotide sequence comprises NGS analysis.
[0055] In one embodiment, suitably, the cells are present within a cell population, and wherein step (a) comprises:
[0056] (i) extracting nucleic acid from the cell population;
[0057] (iia) determining the nucleotide sequence of at least one segment of the J gene from the nucleic acid to generate a population of nucleotide sequences;
[0058] (iib) selecting a nucleotide sequence from the population of nucleotide sequences;
[0059] (iii) comparing the nucleotide sequence selected in (iib) to one or more J gene reference nucleotide sequences, and
[0060] (iv) identifying the J gene type by the sequence identity between the nucleotide sequence of the segment of the J gene of (iib) and the J gene reference nucleotide sequence of (iii).
[0061] When determining nucleotide sequences by NGS and / or when determining the nucleotide sequence of nucleic acids from a cell population, it will be noted that multiple nucleotide sequences are generated during the sequence determination process. This is well known to those skilled in the art. Therefore, once determined by the NGS instrument, the "raw" nucleotide sequence data must be evaluated. Inappropriate data should be discarded.
[0062] For example, samples with two or more clonal rearrangements can be detected. Data from incomplete rearrangements (such as D / J rearrangements) are appropriately discarded. The focus is on complete V / J rearrangements. Therefore, for samples showing two or more clonal rearrangements, when a data row is associated with an incomplete rearrangement such as a D / J rearrangement or a non-J rearrangement or other incomplete rearrangement, the data row will be discarded. The V / J rearrangement sequence data is retained. Suitably, the nucleotide sequence data is from the nucleic acid of the V / J rearrangement.
[0063] For example, a sample may not exhibit clonality. Guidelines for assessing clonality are well known in the art and are explained below and presented in Table 3. For example, when the highest % total reads is less than 1.0%, the data is considered non-clonal. Non-clonal data is appropriately discarded. The focus is on clonal data. Suitably, the nucleotide sequence data is derived from clonal nucleic acids.
[0064] For example, using the LymphoTrack NGS system, the minimum DNA input requirement is 50 ng per sample. According to LymphoTrack NGS System IFU 280410, samples with less than 50 ng of nucleic acid are considered "unevaluable." Unevaluable data are appropriately discarded. The emphasis is on evaluable data. Suitably, the nucleotide sequence data is from an evaluable sample. Suitably, the nucleotide sequence data is from a sample containing at least 50 ng of nucleic acid.
[0065] Suitably, the cells are from a subject having or suspected of having peripheral T-cell lymphoma (PTCL).
[0066] Suitably, the cell is a peripheral T-cell lymphoma (PTCL) cell.
[0067] In one aspect, the present invention relates to a method for treating peripheral T-cell lymphoma (PTCL), comprising
[0068] (a) determining the T cell receptor β chain (TRBC) type of PTCL cells from the subject as described above; and
[0069] (b) administering to the subject a CAR T cell targeting the T cell receptor β chain (TRBC) type determined in (a).
[0070] In one aspect, the present invention relates to CAR T cells targeting T cell receptor beta chain (TRBC) type 1, or CAR T cells targeting T cell receptor beta chain (TRBC) type 2 for use in the treatment of peripheral T cell lymphoma (PTCL),
[0071] wherein said treatment comprises the method of treatment as described above.
[0072] In one aspect, the present invention relates to a nucleic acid probe comprising or consisting of a nucleotide sequence selected from the group consisting of:
[0073] SEQ ID NO: 1 tgaacactgaagctttctttggacaaggcaccagactcacagttgtag SEQ ID NO: 2 ctaactatggctacaccttcggttcggggaccaggttaaccgttgtag SEQ ID NO: 3 ctctggaaacaccatatattttggagagggaagttggctcactgttgtag SEQ ID NO: 4 caactaatgaaaaactgttttttggcagtggaacccagctctctgtcttgg SEQ ID NO: 5 tagcaatcagccccagcattttggtgatgggactcgactctccatcctag SEQ ID NO: 6 ctcctataattcacccctccactttgggaatgggaccaggctcactgtgacag SEQ ID NO: 7 ctcctataattcacccctccactttgggaacgggaccaggctcactgtgacag SEQ ID NO: 8 ctcctacaatgagcagttcttcgggccagggacacggctcaccgtgctag SEQ ID NO: 9 cgaacaccggggagctgttttttggagaaggctctaggctgaccgtactgg SEQ ID NO: 10 ctgagaggcgctgctgggcgtctgggcggaggactcctggttctgg SEQ ID NO: 11 agcacagatacgcagtattttggcccaggcacccggctgacagtgctcg SEQ ID NO: 12 agccaaaaacattcagtacttcggcgccgggacccggctctcagtgctgg SEQ ID NO: 13 accaagagacccagtacttcgggccaggcacgcggctcctggtgctcg SEQ ID NO: 14 ctctggggccaacgtcctgactttcggggccggcagcaggctgaccgtgctgg SEQ ID NO: 15 ctcctacgagcagtacttcgggccgggcaccaggctcacggtcacag SEQ ID NO: 16 ctcctacgagcagtacgtcgggccgggcaccaggctcacggtcacag
[0074] In one aspect, the present invention relates to a nucleic acid array comprising at least two different nucleic acid probes as described above. DETAILED DESCRIPTION OF THE INVENTION
[0076] TCR diversity is produced by somatic recombination, and the somatic recombination occurs when each TCR chain selects a variable (V), diversity (D), junction (J) and constant (C) region. The TCR β chain junction region is separated from the constant domain. VDJ recombination occurs at the genomic DNA level, and mRNA transcription splicing removes (splice out) any intervening sequences and allows translation of the full-length protein of the TCR β chain. Due to the presence of a large intervening region between the TRBC1 and TRBC2 constant regions at the DNA level, it is disclosed herein that the TCRs selecting TRBJ1-1 to TRBJ1-6 use TRBC1, while the TCRs selecting TRBJ2-1 to TRBJ2-7 use TRBC2. Therefore, we demonstrate that the C region use of TCR can be inferred by identifying the J region used.
[0077] When a given T cell is exposed to an antigen, the TCR does not undergo somatic hypermutation. Thus, once rearrangement occurs, the specificity of a given T cell clone remains unchanged. TCR clonality testing is commonly used as a diagnostic tool for T-cell lymphoproliferative disorders. Briefly, using multiple primers to amplify the VDJ-recombined variable regions, the presence of dominant clones can be visualized by electrophoresis, and sequencing of the dominant PCR products can elucidate the tumor clonotype. The combination of TCR clonality and next-generation sequencing (NGS) enables the simultaneous measurement of millions of segments of the genome and can overcome limitations associated with traditional sequencing, such as identifying clones in the presence of large numbers of infiltrating T cells.
[0078] Two genes for the constant region of the T-cell receptor β chain (TRBC) are known to exist—TRBC1 and TRBC2. These two genes are believed to arise from gene duplication and are considered functionally equivalent. The two gene products differ by only four amino acids. Despite their similarity, tumors are clonal, so this difference can be exploited to advantage. Therefore, in a given malignant tumor, every cell will have the same TRBC gene as the original T cell that gave rise to the tumor. Thus, in a given patient, all malignant cells will have either TRBC1 or TRBC2.
[0079] In any given individual, approximately 35% of normal T cells express TRBC1, while the remaining 65% express TRBC2. This provides the opportunity to selectively target all cells expressing TRBC1 while leaving all cells expressing TRBC2 alive (or vice versa). In this way, malignant tumors can be targeted, although this will also target the population of healthy T cells of the same TRBC type in that patient, but its will notTargeting the remaining healthy T cell population expresses another TRBC type. Therefore, regardless of which TRBC type is targeted, the remaining healthy T cell population should be retained in the patient, allowing them to perform immune effector functions while reducing or eliminating their malignancy. To implement this sophisticated therapy, it is crucial to accurately and efficiently determine the TRBC genes expressed on any given patient's malignant cells. The present invention provides a solution to this problem.
[0080] Through NGS analysis of healthy human T cells, we have demonstrated that in the vast majority of cases, TRBJ1 is linked to C1, while TRBJ2 is linked to C2. Therefore, TRBC1 or TRBC2 expression on patient tumors can be diagnosed by analyzing the J region using a clonality-based assay.
[0081] Previous strategies for identifying tumors expressing TRBC1 or TRBC2 were based on predictions based on antibody staining methods, which only worked with flow cytometry assays or on fresh tissue. Because the described method interrogates DNA at the genomic level, fixed tissue can be used as the source material, which is an advantage of the present invention.
[0082] The present invention relates to molecular assessment of the use of TRBC in T-cell lymphomas. Suitably, the molecular assessment is a nucleic acid-based assessment.
[0083] Suitably, the cell is an in vitro cell.
[0084] The present invention exploits the linkage between J1 / C1 and J2 / C2 using NGS analysis.
[0085] cell / sample
[0086] The present invention can be applied to any cell that expresses the T cell receptor beta chain. Suitably, the cell is a mammalian cell, suitably, the cell is a primate cell, suitably, the cell is a human cell. Suitably, the cell is a T cell or is derived from a T cell.
[0087] Cells derived from T cells include neoplastic cells, such as lymphoma cells and / or tumor cells.
[0088] Suitably, the cell may be a neoplastic cell. Suitably, the cell may be a malignant cell. Suitably, the cell may be a cancer cell. Suitably, the cell may be a tumor cell.
[0089] Suitably, the cell is comprised in or present in a sample from a subject of interest.Suitably, the sample may be a sample obtained from a tumour or suspected tumour in a subject.
[0090] Suitably, the sample may be a biopsy, such as a tumour biopsy.
[0091] Suitably, the sample may be a blood sample.This is particularly advantageous when using the present invention to monitor minimal residual disease (MRD).
[0092] The sample may be a tonsil sample.
[0093] Suitably, the method is an in vitro method. Suitably, the sample is an in vitro sample. Suitably, the sample has been previously collected from a subject. Suitably, the method does not involve collecting a sample from a human or animal body. Suitably, the method is not administered to a human or animal body. Suitably, the method does not require the presence of a human or animal body.
[0094] Computer Implementation
[0095] Suitably, the method may be performed at least partly on a computer.
[0096] Where the embodiments of the invention described above are implemented at least in part using software controlled data processing apparatus, it will be appreciated that the provision of such software controlled computer programs and the storage medium via which such computer programs are stored are contemplated as aspects of the invention.
[0097] The present invention therefore provides a method of operating a data processing device, a device arranged to perform the method and / or the computer program itself. The invention also relates to a physical medium carrying a program, such as a computer program product, such as a data carrier, a storage medium, a computer-readable medium or a signal carrying the program.
[0098] If a software-controlled sample processing device is used, then obviously, steps such as providing a sample will be encompassed by such computer program. However, if such steps are performed manually at the option of an operator, then the computer-implemented method steps should be understood to include or consist of the data processing steps of the method.
[0099] In one aspect, the present invention relates to a computer program product which, when executed on a computer, is operable to perform method steps (a) and (b) as described above, suitably method steps (ii) to (iv) as described above, more suitably method steps (iia) to (iv) as described above, most suitably method steps (iii) and (iv) as described above.
[0100] In one aspect, the invention relates to a data carrier or a storage medium carrying a computer program product as described above.
[0101] Cell population
[0102] The present invention can be applied to T cell groups. For example, the present invention can be applied to T cells in a sample of interest or to a colony of cells derived from T cells. In this case, it can be important to determine the TRBC type of a specific cell of interest within the colony. The selection of cells of interest within the colony can be accomplished physically, such as by using a sample from a tissue of interest (such as from a tumor of interest or a suspected tumor), or can be accomplished computationally, such as by selecting a specific clone from a colony of nucleotide sequences, the colony of which is determined from the cell population being analyzed. For example, it is desirable to select the sequence of a dominant clone (i.e., a clone that displays the maximum number of "reads" or nucleic acid molecules within the colony being analyzed). Alternatively, the amplified nucleic acid can be separated, for example, by electrophoresis, and dominant clones are selected at this stage for sequencing. The specific pattern used to select a single clone (and therefore a single cell) within the analysis depends on the operator's choice. In this way, the present invention can be advantageously applied to a specific one or more cells within the analysis performed on a cell population.
[0103] Nucleic Acids
[0104] In a broad sense, a nucleic acid can be any nucleic acid present in a cell.
[0105] Suitably, the nucleic acid is DNA or RNA. Suitably, the nucleic acid comprises or consists of DNA. Suitably, the nucleic acid comprises or consists of genomic DNA (gDNA).
[0106] Nucleic acids, such as DNA, are suitably extracted from the cells in the sample using any technique known to those skilled in the art. Suitably, nucleic acids are extracted using a standard commercially available DNA extraction kit. Most suitably, nucleic acids are extracted using the GeneRead DNA FFPE kit (Cat No. / ID: 180134) from QIAGEN Ltd., Skelton House, Lloyd Street North, Manchester, M15 6SH, UK.
[0107] Optionally, the method of the present invention comprises a further optional step of inferring the clonotype of the peripheral T-cell lymphoma (PTCL) based on the information determined in steps (a) and (b).
[0108] Suitably, the nucleic acid analyzed in the present invention is genomic DNA (gDNA). In one embodiment, RNA can be used as the starting material / nucleic acid to implement the present invention. However, RNA needs to be processed to be stored in a sample such as a biopsy. If this processing is not performed on the initial sample or biopsy, it may be necessary to perform a biopsy on the patient again, which is an undesirable invasive procedure for the second time. Therefore, an advantage of the present invention is that the nucleic acid analyzed is suitably gDNA. GDNA is generally more stable than RNA.
[0109] When analyzing minimal residual disease (MRD), RNA can be analyzed. However, at the stage of monitoring MRD, the sequence of the tumor VDJ region has usually been determined. Therefore, when tracking MRD in a patient, it is usually simple to detect known transcripts in RNA extracted from the patient's sample, such as primers in the CDR of the sequence. In this way, exquisite specificity is obtained from primers for (for example) a suitable portion of a nucleic acid (such as a nucleic acid encoding CDR3). Therefore, although the TRBC1 / 2 typing method of the present invention can also be used to monitor MRD, this can be advantageously combined with an RNA-based method (which detects specific transcripts of tumor clones that have been determined during patient treatment).
[0110] CDRs (complementarity determining regions) are well known in the art, see for example (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)), and numerous subsequent publications describing and defining these regions.
[0111] T cell receptor beta chain (TRBC) gene - reference sequence
[0112] Suitably, all sequences herein are discussed with reference to human TRBC.
[0113] It may be helpful to refer to the GenBank sequence of the wild-type human gene.
[0114] The structure of the entire locus / complex gene encompassing the VDJC region is known in the art and includes sequences of type C1, type C2, type J1, and type J2. There are at least seven J1 variants and nine J2 variants. For further guidance, we refer to Table 1.
[0115] GenBank is a sequence database as described in Benson, D. et al., Nucleic Acids Res. 45(D1): D37-D42 (2017). More specifically, GenBank is managed by the National Center for Biotechnology Information, National Library of Medicine, 38A, 8N805, 8600 Rockville Pike, Bethesda, MD 20894, USA. Where appropriate, reliance is placed on the current version of the sequence database. Alternatively, reliance is placed on the release in effect on the date of submission. For the avoidance of doubt, reliance is placed on NCBI-GenBank Release 225.0 (April 15, 2018).
[0116] If any further guidance is needed, we refer to the following reference sequence (SEQ ID NO: 31): >38675309_B97#1_TRBC2
[0117]
[0118] Bold = variable / v
[0119] Italics = Diversity / D
[0120] Underline = J
[0121]
[0122] Uppercase letters = match the template switch primer for 5' RACE
[0123]
[0124] Suitably, the junction or J region comprises, or more suitably consists of, a sequence corresponding to the above-underlined sequence. More suitably, the junction or J region comprises or consists of the above-underlined sequence.
[0125] In more detail, SEQ ID NO: 31 is the reference sequence of the rearranged beta chain. This is an example of an NGS library sequenced by the inventors.
[0126] When numerical addresses are used herein to refer to specific nucleotides, the numbering is in reference to the wild-type TRBC nucleotide sequence shown above (e.g., SEQ ID NO: 31). As is well known in the art, this sequence will be used to locate features / residues of interest. This is not always a strict counting exercise—the context must be considered. For example, if the length of the sequence of interest is slightly different, the position of the correct nucleotide in that sequence may require alignment of the sequences and selection of equivalent or corresponding nucleotides. This is well within the capabilities of the skilled reader.
[0127] Determine V / D / J / C regions
[0128] Obviously, sequence variation is expected between individual patients. This is true for all mammalian genes due to individual genetic variability / allelic differences. However, it is well known that this is particularly true for the hypervariable regions such as the TRBC gene region that are the subject of the present invention. Therefore, when examining a nucleotide or amino acid sequence and determining whether it is a V / J / D / C region or none of the above, standard methods can be used, such as using software (e.g., IMGT TM software) bioinformatics methods.
[0129] IMGT TM , International ImMunoGeneTics information system TM http: / / www.imgt.org, is the global reference in immunogenetics and immunoinformatics, founded in 1989 by Marie-Paule Lefranc (Université de Montpellier and CNRS). IMGT TM IMGT is a high-quality, comprehensive knowledge resource focused on immunoglobulins (TG) or antibodies, T-cell receptors (TR), major histocompatibility (MH) in humans and other vertebrate species, as well as immunoglobulin superfamily (IgSF), MH superfamily (MhSF) and immune system-related proteins (RPI) of vertebrates and invertebrates. TMBased on the concepts of IMGT-ONTOLOGY and the graphical rules of IMGT Scientific, we provide universal access to sequence, genomic and structural immunogenetic data. If any further information is needed, we refer to Lefranc MP, Giudicelli V, Duroux P, Jabado-Michaloud J, Folch G, Aouinti S, Carillon E, Duvergey H, Houles A, Paysan-Lafosse T, Hadi-Saljoqi S, Sasorith S, Lefranc G, Kossida S. Nucleic Acids Res. 2015 Jan;43(Database issue):D413-22. "IMGT TM , the international ImMunoGeneTics information system TM 25 years on." Lefranc, M.-P., Front Immunol. 2014 Feb 05;5:22 "Immunoglobulin (IG) and T cell receptor genes (TR): IMGT TM and the birth and rise of immunoinformatics." IMGT TM The use of the tools is well within the capabilities of the skilled person and full details have been published and regularly updated since 1989, for example Lefranc, M.-P., Cold Spring Harb Protoc. 2011 Jun 1; 2011(6) “IMGT TM , theInternational ImMunoGeneTics Information System”.
[0130] In the unlikely event that further guidance is needed, to identify the J region, one skilled in the art can align the sequences using known alignment tools such as IMGT / V-quest (Nucleic Acids Res., 31, 307-310 (2003)). IMGT / V-QUEST is a sequence alignment software for immunoglobulin (IG) and T-cell receptor (TR) nucleotide sequences of variable regions and domains. IMGT output contains joined nucleotide and amino acid sequences.
[0131] Analysis of VDJ rearrangements is shown below.
[0132]
[0133]
[0134] Other bioinformatics tools can be used to perform similar analyses to identify V / D / J / C regions, one example being MiXCR software (Bolotin et al 2015 Nature Methods Vol 12 No. 5 pages 380-381). Bolotin et al. disclose software that provides a general framework for processing large immunogenomic data from raw sequences to quantitative clonotypes, which can be used to identify V / D / J / C regions in the disclosed sequences. Bolotin et al 2015 is specifically incorporated herein by reference for the sole purpose of teaching such analysis methods and for no other purpose. The software can be obtained, for example, from MiLaboratory LLC, 534 S. Andres Dr., Solana Beach, CA 92075, USA.
[0135] Mutation has its normal meaning in the art and may refer to a substitution or truncation or deletion or addition of one or more nucleotides, motifs or domains.
[0136] sample
[0137] Suitably, the sample may comprise a biopsy. Suitably, the sample may comprise a tumor biopsy or a biopsy from a suspected tumor. Suitably, the sample may comprise blood. Suitably, the sample may comprise a biopsy rich in T cells, such as a lymph node biopsy or a spleen biopsy.
[0138] It should be noted that different sample types, such as tonsil biopsy, have been used to demonstrate the present invention. Tonsils are tissues rich in T cells. This is very helpful for demonstrating the effectiveness of the present invention, but is not necessarily an exemplary sample type when the present invention is applied to a patient. Therefore, although tonsils are samples suitable for the present invention, more suitably, the sample comprises a tumor biopsy, a suspected tumor biopsy, a lymph node biopsy, a spleen biopsy or blood: more suitably, the sample comprises a tumor biopsy or blood.
[0139] When the sample is from a tumour, suitably the sample may be from any tumour type or subtype. Suitably the sample may be from any tumour type or subtype mentioned in the Examples section below.
[0140] Readout
[0141] In principle, any method for reading sequence information from nucleic acids (e.g., PCR-amplified nucleic acids derived from a sample) can be used. For example, PCR products can be separated by size (e.g., using gel electrophoresis), and the dominant product can be excised and sequenced. Alternatively, TRBC1 / 2-specific primers can be used, for example, in a secondary PCR following the initial amplification step, thereby providing an indication of whether the sample is TRBC1 or TRBC2. However, more preferably, PCR primers specific for the J region being analyzed can be used in the PCR reaction following the initial amplification, thereby indicating which J region is present in the sample and thereby allowing the identity of the C region to be inferred according to the methods of the present invention.
[0142] In principle, hybridization of nucleic acid probes can be used to detect the identity of the J region of a PCR product, or the amplified nucleic acid can be applied to an array carrying one or more probe nucleic acids, hybridization can be allowed to occur, and the identity of the J region in the PCR product can be read out by analyzing the hybridization pattern to those probe sequences.
[0143] C / J Area
[0144] The key part of the present invention is to utilize the tight linkage between C and J to indirectly infer the TRBC1 / 2 status from the J type.
[0145] An advantage of the present invention is that it can be detected from gDNA (e.g. via nucleic acid amplification), which is preserved in larger quantities in tissue types and storage conditions than other nucleic acids such as RNA. Thus, suitably, the nucleic acid interrogated by the present invention is gDNA (i.e., the starting material or material analyzed is suitably gDNA).
[0146] This is an advantage because when the source material is DNA (such as gDNA), the introns between the J and C regions are too large to be covered using current sequencing technologies. Therefore, the present invention provides a technical advantage by inferring the C region type from analysis of the J region.
[0147] -PCR strategy
[0148] To determine the J type of a cell, nucleotide sequence information of the J region of the cell is generally required. Direct sequencing of gDNA from cells is currently not feasible. Therefore, to obtain nucleotide sequence information, an intermediate amplification step, such as polymerase chain reaction (PCR), is used to generate sufficient nucleic acid to generate nucleotide sequence information.
[0149] Advantageously, a two-step PCR strategy may be used.
[0150] For example, the first PCR ("PCR 1") is qualitative, to generate seed copies using many different primers in a low concentration mixture, and the second PCR ("PCR 2") is quantitative, to amplify these seed copies using adapter primers (sometimes called anchor primers or universal primers) (i.e., using the same primers regardless of which V / J sequences are present) to generate enough NGS material.
[0151] Of course, those skilled in the art will recognize that it is likely possible to amplify directly from the source material in a single PCR. Thus, a two-step PCR strategy is not necessary, but is advantageous. In practice, it is advantageous to perform a second "nested" PCR step, which has the benefit of increasing, for example, the yield and / or detection of clonal populations.
[0152] Multiplex PCR
[0153] Suitably, as a first step, once DNA is prepared, multiplex PCR is performed on it. It can contain many primers from the V district, and / or many primers from the D district, and / or many primers from the J district - most suitably many primers from each of the V and D and J districts. Therefore, these primers anneal at their respective sites in the entire nucleotide sequence being inquired, and the amplified product can be analyzed after the PCR reaction to ensure integrity / reliability and to proceed with sequencing. Suitably, the multiplex PCR product is used in the NGS sequencing method, thereby substantially sequencing the entire library (repertoire) of the PCR product. At this point, standard data analysis techniques are used to determine clonality and / or select clones (i.e., representing clones of interest / tumors of interest) that are obviously overrepresented. Clonality can be determined by any suitable technique known in the art, most suitably by following the IFU for LymphoTrack Dx TRB assay-MiSeq test kit to carry out, most suitably IFU (instructions for use) 280410, which is incorporated herein by reference.
[0154] Alternative methods for determining T cell clonality
[0155] Known TCR-based clonality assays have employed restriction enzyme digestion of DNA followed by gel electrophoresis and Southern blotting using probes to known TCR genes. While efficient and useful in practicing the present invention, this technique can be labor intensive, can take days to complete, can require running large amounts of intact DNA, and can have low sensitivity.
[0156] Therefore, it may be advantageous to use PCR-based techniques to determine clonality. PCR-based techniques are commonly used for clonality assessment. Internationally recognized PCR primer sets have been introduced to further standardize PCR-based T cell clonality assays. The most commonly used primers in PCR-based TCR clonality analysis are called the BIOMED primer set (van Dongen et al 2003). van Dongen et al 2003 (Leukaemia 2003 volume 17 pages 2257-2317) disclose certain PCR methods that may be used in the present disclosure. In more detail, van Dongen et al 2003 discloses standard primer sets for clonality determination, with particular reference to van Dongen 2003. Figure 4 b, Figure 5a, Figure 6b, Figure 7b, Figure 8b, Figure 10b, Figure 11a, Figure 12a and Figure 13a. Therefore, van Dongen et al. 2003 is specifically incorporated by reference solely for its teachings of such PCR methods and PCR primers and for no other purpose.
[0157] The assay based on these BIOMED (van Dongen 2003) primers allows the clonality of PCR products of Ig / TCR genes to be analyzed by heteroduplex analysis or GeneScanning. Amplification and sequencing of PCR products from such assays can be used to identify the J region, and therefore allow the C region to be inferred as described herein. However, it should be noted that such assays may include artifacts from infiltrating T cells, and rearranged TCR sequences may not be observed in the background of non-clonal T cells in the biopsy. In this case, it is desirable to sequence the product by NGS. For this reason, it is advantageous to use NGS technology as in the preferred embodiments described herein.
[0158] Alternatively, clonality can be determined by using the Immunoseq TCRB assay (Adaptive Biotechnologies, 1551 Eastlake Ave E, Ste 200, Seattle, WA 98102, USA).
[0159] Primers
[0160] Standard primers can be used, such as for example Those provided in the Dx TRB Assay Kit-MiSeq (Invivoscribe, eg10222 Barnes Canyon Road, Building 1, San Diego, CA 92121, USA).
[0161] Standard primers may be used, such as, for example, those provided in the BIOMED primer set (van Dongen et al. 2003 - see above).
[0162] Readout
[0163] Despite the possible methods mentioned above, or any other methods of reading nucleic acid sequences known to those skilled in the art, it is most appropriate to read (determine) nucleotide sequence information by performing next generation sequencing (NGS) on nucleic acids (such as PCR amplified nucleic acids). This is advantageous because it provides quantitative information, thereby allowing easy identification of dominant clones in NGS data. In addition, this represents a single step - PCR amplified nucleic acids can be directly subjected to NGS sequencing in a "one-step" procedure. Although alternative methods such as the above-mentioned probe- or primer-based methods are effective, they do not have the advantage of being combined with NGS sequencing because they will need to perform more time-consuming and / or expensive steps. Therefore, most appropriately, sequence information is read out by NGS.
[0164] Most suitably, the nucleotide sequence information is read (determined) by using the LymphoTrack Dx TRB assay - MiSeq assay (Invivoscribe, eg 10222 Barnes Canyon Road, Building 1, San Diego, CA 92121, USA).
[0165] The present invention can be applied to the monitoring of minimal residual disease because it provides the advantage of obtaining quantitative information. For example, in applying the present invention to the monitoring of minimal residual disease, the percentage of clones of interest (i.e., T cell cancer cells) is obtained from the NGS data, whereas simply detecting the presence or absence of transcripts characteristic of a particular patient's disease (e.g., using primers to their CDR / variable regions) would only give a binary (yes / no) answer to the question of whether MRD is present. By using the present invention to detect or monitor MRD, the quantitative information provided by the combination with the NGS readout is valuable and therefore advantageous.
[0166] A key part of the present invention is the use of linkage from the J region to the C region, that is, the identity of the C region can be inferred by determining the identity of the J region.
[0167] J-type
[0168] It will be apparent from the above that the particular reagents / techniques used to obtain sequence information from the J region of interest are not critical to the invention. The use of NGS to obtain information provides the advantages discussed.
[0169] However, rather than requiring sequencing to be performed using a specific NGS method as disclosed herein, it may be possible to use information from one or more existing NGS-based clonality determination methods to infer C region usage.
[0170] For example, one can use a kit that allows determination of clonality and use this information to type the J region. This information about the J region type can then be used with the C region correlation we demonstrated herein to infer TCR Beta constant region usage as described.
[0171] Therefore, it will be understood by those skilled in the art that, although the specific primer sets and / or design parameters exemplified herein provide certain advantages, the present invention should not be unduly limited to the specific primer sets and / or design parameters exemplified herein. Rather, one skilled in the art can use "off-the-shelf" or commercially available kits or services to perform sequence determination (e.g., clonality determination, more commonly known as "immunosequencing").
[0172] In short, immunosequencing refers to that the sequence of immune library in the colony of T cell or B cell is determined.In the case of the present invention, the cell of interest is T cell.In general, the method relates to focusing on the nucleic acid segment of interest, such as the first PCR amplification of the key CDR of TCR.Usually, this is followed by a second amplification using different primers, which are conveniently labeled to facilitate sequence determination.After this second amplification, the nucleic acid product is then sequenced, most typically using NGS (next generation sequencing) technology, which utilizes the large-scale parallel determination of millions of single sequences derived from the same original sample.Then capture the sequence data and analyze in a computational manner to answer questions of interest.In the context of the present invention, the output from immunosequencing will be used to check the sequence in J district, thereby allowing determination of the specific J gene present in each sequence.Therefore, although any commercially available immunosequencing (clone test) test kit or service can be used in the present invention, it is crucial that any such test kit or service provide the sequence information in J district.
[0173] For example, kits that can be used to obtain the desired data are: Dx TRB Assay Kit-MiSeq (Invivoscribe, e.g., Invivoscribe SARL, ZI Athélia IV-Le Forum- B, 515 Avenue de la Tramontane, 13600 La Ciotat, France) and / or Immunoseq TCRB assay (Adaptive Biotechnologies, 1551 Eastlake Ave E, Ste 200, Seattle, WA 98102, USA). More suitably, the kits that can be used to obtain the required data are: Dx TRB assay kit—MiSeq (Invivoscribe, eg10222 Barnes Canyon Road, Building 1, San Diego, CA 92121, USA) and / or clonoSEQ assay or Immunoseq TCRB assay (Adaptive Biotechnologies, 1551 Eastlake Ave E, Ste 200, Seattle, WA 98102, USA).
[0174] Regarding the Adaptive Biotech kit / service (see above), the focus is on the CDR3 region, which serves as a "unique" ID or tag for each individual clone within the sample. In this kit, the forward primer for the initial PCR reaction is located in the V region, while the reverse primer for the initial amplification is located in the J region. Therefore, in this way, the appropriate segment of the J region is analyzed, and the kit is therefore suitable for use in the present invention. In the context of the present invention, sequence information for the J region of each clone can be obtained from the output of the kit / service, and the J gene type expressed in the cell can be determined from this information, and the TRBC gene type expressed in the clone can be inferred from this J gene type according to the present invention.
[0175] Suitably, nucleic acid extraction protocols (if any) follow the manufacturer's instructions.
[0176] Nucleic acid sequencing
[0177] Of course, skilled artisans can implement their own sequencing protocols to determine the desired nucleotide sequence information, ie, to determine the nucleotide sequence of one or more characteristic segments of the J region as described herein.
[0178] Essentially, such methods require access to nucleotide sequence information of the J region from the T cell of interest. This can be accomplished using standard methods, such as amplifying a portion of the nucleic acid encompassing the relevant segment of the J region and then determining the sequence, for example, using standard NGS methods. Of course, other methods can also be employed, such as separating the amplification products by electrophoresis and sequencing the dominant products, or even by cloning and in vitro manipulation of the recombinant nucleic acid of interest, or, if desired, by performing diagnostic PCR using primers specific for a particular J type.
[0179] Such techniques are believed to be routine and capable of being performed by those skilled in the art, given the detailed disclosure provided herein. If any further guidance is needed, the key elements are summarized below.
[0180] - Primer design
[0181] Primer design can be done manually by a skilled artisan or using freely available tools such as the Primer Design Tool from Eurofins Genomics (Eurofins Genomics, Anzinger Str. 7a, 85560 Ebersberg, Germany), or the Primer-BLAST service from the National Center for Biotechnology Information (US National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA), or the Prime+ program from the BioComp or SeqWEB suites (formerly known as the Accelrys GCG package / GCG Wisconsin package), or any other suitable tool.
[0182] Alternatively, a number of commercially available primer design and production services can be used, for example from ThermoFisher (Thermo Fisher Scientific, 168 Third Avenue, Waltham, MA USA 02451), Eurofins Genomics (see above), or any other suitable service provider.
[0183] It is important to avoid PCR bias during amplification reactions to ensure accurate quantitative information is obtained.
[0184] PCR deviation can be reduced or eliminated using standard techniques. For example, in an overview, this relates to using a primer in the first scope of the same initial concentration to carry out the first or preliminary amplification. The result of this amplification is then analyzed. Usually, PCR deviation is observed because the different PCR products in different concentrations are found in the nucleic acid mixture of gained amplification. Without wishing to be bound by theory, this is usually attributed to the efficiency or performance differences of primers in the initial mixture. The PCR primer concentration is then adjusted, the concentration of the primer with the best performance is reduced (i.e., the primer causing the highest concentration of amplified nucleic acid), and the concentration of the primer with poor performance is improved (i.e., the primer causing the lowest concentration of nucleic acid in the amplified product). Like this, the influence of PCR deviation can be significantly reduced or eliminated, thereby causing the concentration of PCR product to be more evenly distributed in the nucleic acid mixture of final amplification. This type of optimization that reduces or eliminates PCR deviation is a routine problem for those skilled in the art, and can be analyzed by " trial and error " as outlined above.
[0185] Additionally, or alternatively, PCR bias can be reduced or eliminated by using primers selected from the libraries described below.
[0186] -Nested / anchored primer design
[0187] As is conventional in the art, qualitative initial amplification can be followed by quantitative amplification using universal primers located at the 5' end of the initial primers used for qualitative amplification. Thus, a "nest" or "anchor" 5' tail can be incorporated into the primers used for the initial amplification to subsequently allow for secondary / universal / quantitative amplification. As is well known in the art, the appropriate nest or anchor sequence is selected by the operator.
[0188] Exemplary nested primers (primer extension) or anchor sequences are provided below.
[0189] Data quality
[0190] The number of total sequencing reads obtained can affect data quality, as can the proportion of total sequencing reads attributable to a single clone in the total number of reads obtained. In determining whether the data can be relied upon, standard statistical techniques are applied, for example, as described in accordance with the LymphoTrack Dx TRB Assay-MiSeq Kit Instructions for Use (IFU), most preferably IFU (Instructions for Use) 280410.
[0191] Determination of J zone
[0192] Suitably, NGS is used to provide sequence information of nucleic acids derived / amplified from a sample.
[0193] This sequence information is then queried to determine which J region is present in the target sequence.
[0194] Although sequence comparison can be accomplished by any means, including by eye, a computer algorithm is typically used to compare the characteristic known sequence of a particular J region with the sequence information from the NGS analysis. A match between the query sequence (the known J region sequence) and the target sequence (the sequence from the NGS analysis of the nucleic acid from the patient sample) indicates the presence of the corresponding J region.
[0195] J region sequences that are diagnostic or indicative of the identity of the specific J region present are summarized below:
[0196]
[0197]
[0198] A skilled artisan may be able to shorten some of the sequences in Table 1 to, for example, about 30 bp, as long as the identity of the specific J region that is diagnostic or indicative of its presence is always maintained.
[0199] As can be seen from the table above, J1 has different subtypes (e.g., J1-1, J1-2, J1-3, etc.) Similarly, J2 has different subtypes (J2-1, J2-2, J2-2P, etc.).
[0200] As used herein, the term "J genotype" refers to the identity of the J region, i.e., whether the J region is J1 or J2. Thus, the process of identifying the J1 or J2 region present in a sample is generally as follows:
[0201] • Comparing sequence data from the J region of interest (ie from the cell / sample of interest) to a reference J region sequence.
[0202] Determine the type of J gene present in the cell / sample (i.e., J1 or J2 gene) by sequence comparison.
[0203] Examples of primers that can anneal in the J region are provided in Table 2 below.
[0204] Table 2 : Example of J region specific primer:
[0205]
[0206]
[0207] The forward primer can be designed by a skilled operator.
[0208] Once J1 or J2 determination has been made, the final step is to infer the identity of the C region from the knowledge of the J region.
[0209] As used herein, the term "C genotype" or "TRBC genotype" refers to the identity of the C region, ie, whether the C region is C1 or C2.
[0210] Therefore, suitably, the final steps are:
[0211] If the presence of the J1 gene is confirmed, the presence of the C1 gene is inferred; if the presence of the J2 gene is confirmed, the presence of the C2 gene is inferred.
[0212] When comparing a characteristic J region sequence (reference sequence) to a target sequence (nucleotide sequence from a cell / sample of interest), a 100% match is suitably desired.
[0213] Incomplete recombinant
[0214] Sometimes cells will undergo incomplete V / D chain rearrangements. In these cases, DJ joining (rather than VJ joining) may be observed. Typically, any information collected on DJ joining is ignored in favor of VJ joining.
[0215] Clinical considerations
[0216] From the exemplary data provided in this document, it can be seen that approximately 0.1115% of transcripts could be either J2-C1 or J1-C2 (0.1027% J1-C2 + 0.0088% J2-C1 = 0.1115%). It is important to note that linkage is at the transcript level. Therefore, this 0.1115% is not the risk of misdiagnosis; it is the rate at which the TCR on the cell surface may be "different" from the expected one due to the production of alternative transcripts at the intracellular nucleic acid level. In other words, the methods of the present invention robustly identify a single rearranged TCRβ gene in a cell as TRBC1 or TRBC2, as inferred from the J region, but very low levels of alternative transcripts may occasionally be produced within that cell. Thus, in practice, this means that the cell will display 99.8885% of the expected combinations, but may display 0.1115% of unexpected combinations due to this measurement of transcript variation. In all practical terms, this has minimal or no impact on the patient / therapeutic / diagnostic utility of the methods of the present invention. This is by no means a 0.1115% error rate / misdiagnosis.
[0217] More specifically, it is important to remember that the 0.115% error rate refers to the TCRs displayed on the cells, and not to any error rate in the sense of diagnosing the patient. Thus, even if, due to transcriptional variability due to natural processes within the cell, a TCR that occasionally produces (for example) J1-C2 or J2-C1, for all practical purposes, the vast majority of T cells in that patient will still accurately display the specific J / C combination determined by the methods of the present invention. Thus, treatments based on the information provided by the methods of the present invention will still be effective, and an advantage of the present invention is that any natural variability in transcripts produced in individual cells will not adversely affect the diagnostic value of the present invention.
[0218] The inventors assert that this method is at least 99% accurate in the sense that "unexpected" combinations (such as J1-C2 or J2-C1) are observed in less than 1% of cases. In other words, the inventors assert that at least 99% of the cases reflect the remarkable and surprisingly tight linkage of the J and C genes on which the present invention is based.
[0219] Further embodiments
[0220] In one aspect, the present invention relates to a method comprising
[0221] (a) determine the types of J genes expressed in the cell, and
[0222] (b) The T cell receptor beta chain (TRBC) gene type expressed in the cell was inferred from (a).
[0223] In one aspect, the present invention relates to a method as described above, wherein step (a) comprises:
[0224] (ai) determining the nucleotide sequence of at least a segment of the J gene from the cell; and
[0225] (aii) comparing the nucleotide sequence determined in (ai) to one or more J gene reference nucleotide sequences, and
[0226] (aiii) identifying the J gene type from the sequence identity between the nucleotide sequence of the segment of the J gene of (ai) and the J gene reference nucleotide sequence of (aii).
[0227] Further advantages
[0228] Prior art methods such as IHC may require the use of frozen tissue (e.g., for analysis of JOVI-1), which is labor-intensive and not always available. In addition, the qualitative nature of the IHC method may lead to misdiagnosis and / or may be prone to interpretation errors by diagnostic pathologists. Therefore, IHC may be subjective and / or prone to operator error, which is a problem in the art. An advantage of the present invention is that, since the extraction protocol and sequencing are conventional and can be automated, operator error is reduced in genomic assays.
[0229] A further advantage of the present invention is that once the disease-causing clone has been identified, molecular diagnostics can track minimal residual disease (MRD) in the blood with high accuracy.
[0230] Patent application WO2016 / 051205 describes an RNAscope method. However, a limitation of the RNAscope assay is that the probe detects RNA, which needs to be of sufficient length and integrity to be able to bind to the probe. Although RNAscope should be able to detect substances from fixed tissues, genomic assessments can be determined from DNA, thus providing a more stable source material for the assay, which is an advantage of the present invention. In addition, recent publications have shown the existence of a third transcript (called TRBCX - see Lethe et al 2017 (Immunity, Inflammation and Disease 2017; 5(3): 346-354)). This would make it impossible to distinguish TRBC1 / 2 RNA transcripts by probe design, as such RNAscope would not be suitable as an assay for this application, a problem that is advantageously addressed by the present invention.
[0231] A further advantage of the present invention is that it provides a higher level of accuracy compared to prior art methods (eg qualitative assays or "by eye" methods such as IHC).
[0232] One advantage of the present invention is that practitioners in the prior art had not associated the V / D chain junction (i.e., the J region) with a specific C region identity. This valuable insight, including the very surprising tight linkage between the J and C types within the TRBC gene, was the significant advance upon which the present invention is based.
[0233] Further particular and preferred aspects are set out in the accompanying independent and dependent claims. Features of the dependent claims may be combined with features of the independent claims as appropriate and in combinations other than those explicitly set out in the claims.
[0234] Where a device feature is described as being operable to provide a function, it will be understood that this includes device features that provide that function or that are adapted or configured to provide that function.
[0235] BRIEF DESCRIPTION OF THE DRAWINGS
[0236] Figure 1 A bar graph is shown.
[0237] Figure 2 A schematic diagram is shown.
[0238] Figure 3 A schematic diagram is shown.
[0239] Figure 4 shows the IMGT output.
[0240] The invention will now be described by way of examples which are intended to illustrate but not to limit the embodiments of the invention set forth in the claims. Example
[0241] Example 1: Correlation between the joining region and the constant region
[0242] TRBC transcripts were amplified from tonsil samples of four normal individuals using 5' RACE. Figure 2 , which shows the 4x10 6 NGS analysis of unique T cell transcripts.
[0243] PCR products of approximately 530-620 bp in length were pooled and sequenced using Miseq Illumina sequencing, yielding 2 x 300 bp paired-end reads.
[0244] The results are as follows Figure 1 As shown in .
[0245] Example 2: Application to DNA
[0246] We refer to Figure 3 .
[0247] Suitably, the DNA is genomic DNA.
[0248] Example 3: Sequence Reading
[0249] We refer to Figure 4 .
[0250] shows the IMGT output.
[0251] Example 4
[0252] In this study, various TRBC1 / 2 expressing cell lines were tested (Table 4).
[0253] Data from various T-cell lymphoma samples are also presented (Table 5).
[0254] We also provide an exemplary nucleic acid extraction protocol and an exemplary NGS protocol.
[0255] In this example, the Data were obtained using the Dx TRB assay.
[0256] method
[0257] Formalin-fixed paraffin-embedded (FFPE) cell lines (Jurkat, MJ, H9, HPB, and Raji) and FFPE T-cell lymphoma samples were analyzed using the LymphoTrack Dx TRB assay-MiSeq assay. Unless otherwise specified herein, DNA for each cell line and T-cell lymphoma sample was extracted from 10-15 5 μM FFPE sections using the Qiagen GeneRead DNA FFPE kit according to the manufacturer's instructions.
[0258] DNA concentration was quantified using Qubit 3.0. DNA was individually assayed using LymphoTrack Dx TRB assay-MiSeq according to Assay IFU (280410). FASTQ files from MiSeq runs were analyzed using LymphoTrack Dx software-MiSeq v2.4.3 according to Software IFU (280344).
[0259] FFPE tissue block sections
[0260] 1. Chill the paraffin-embedded tissue block on ice before sectioning. The cold wax allows thinner sections to be obtained by providing support for the harder elements within the tissue specimen. The small amount of moisture that seeps into the block from the melting ice will also make the tissue easier to cut.
[0261] 2. Fill a water bath with ultrapure water and heat to 40-45°C.
[0262] 3. Place the blade into the holder, making sure it is secure and set the clearance angle. The clearance angle prevents contact between the blade face and the block face. Follow the instructions of the microtome manufacturer for setting the clearance angle. For Leica blades, this is usually between 1° and 5° ( Figure 1 ).
[0263] 4. Insert the paraffin block and orient it so that the blade cuts straight through the block.
[0264] 5. Carefully approach the block with the blade and cut several thin slices to ensure correct positioning. Adjust if necessary.
[0265] 6. Trim the block so that the tissue surface is exposed at a level that allows representative sections to be cut. Trimming is typically performed at a thickness of 10-30 μm.
[0266] 7. Cut sections approximately 4-5 μm thick (you will likely need to discard the first few sections as they may contain holes caused by trimming).
[0267] 8. Pick up the slice strip using forceps and transfer to an autoclaved or DNAse-free microtube (1.5 mL).
[0268] 9. DNA was isolated using the Qiagen GeneRead DNA FFPE Kit according to the manufacturer's instructions.
[0269] Nucleic acid extraction protocol
[0270] Several DNA extraction kits can be used. In this example, DNA was extracted using Qiagen's GeneRead DNA FFPE kit.
[0271] The GeneRead DNA FFPE protocol removes paraffin and reverses formalin cross-links from DNA samples before they are attached to QIAamp MinElute columns. After heating to remove cross-links, the DNA can be subjected to uracil-N-glycosylase (UNG) specific removal of deaminated cytosine residues. The optimized reaction mixture provides conditions in which UNG can specifically remove artificially induced uracil from the DNA obtained from FFPE samples. After DNA is bound to the spin column, residual contaminants (such as salts) are washed away by buffer AW1 and AW2 and ethanol. Any residual ethanol that may interfere with subsequent enzymatic reactions is removed by an additional centrifugation step. DNA is eluted and can now be used in the next generation sequencing workflow.
[0272] Sequence determination protocol
[0273] In this example, the sequence was determined using the NGS protocol - LymphoTrack Dx TRB assay - MiSeq assay:
[0274] 1. Using gloved hands, remove the Master Mix from the refrigerator. Allow the tube to thaw; vortex gently to mix.
[0275] 2. In a sealed hood or dead air box, pipette 45 μl of the master mix into each well of a PCR plate, one well per master mix and one master mix per sample, positive, negative, or no-template control.
[0276] 3. Add 0.2ul EagleTaq DNA polymerase (EagleTaq@5U / uL) to each premix.
[0277] 4. Add 5 μL of sample DNA (minimum concentration is 10 ng / μL) and 5 μL of control sample to the wells containing their respective master mix reactions and pipette up and down 5-10 times to mix.
[0278] 5. Add 5 uL of molecular biology grade water to the wells containing the respective master mix for the no-template control and pipette up and down 5-10 times to mix.
[0279] 6. Amplify target DNA using the following thermal cycler program:
[0280]
[0281] 7. Remove the amplification plate from the thermal cycler.
[0282] 8. Purify the PCR product using the Agencourt AMPure XP PCR Purification System. Add 35 μl of particles to every 50 μl reaction and elute the DNA in 25 μl of elution buffer.
[0283] 9. Quantify the amplicon using the KAPA Library Quantification Kit according to the kit instructions. Dilute the amplicon 1:4000 before performing qPCR.
[0284] 10. Pool equal amounts of amplicons from samples (excluding no-template controls), dilute 1:1000, and quantify the library using the KAPA Library Quantification Kit.
[0285] 11. Denature and dilute libraries to 12 pM for MiSeq Reagent Kit v2, and 12-20 pM for MiSeq e= Reagent Kit v3 (MCS v2.6).
[0286] 12. Load 600ul of denatured and diluted library into the MiSeq Reagent Cartridge.
[0287] 13. Set up the MiSeq sample sheet using Illumina Experiment Manager (v1.4 to v1.13).
[0288] 14. Start the MiSeq run.
[0289] 15. Analyze and visualize acquired data using the associated LymphoTrack Dx Software-MiSeq package.
[0290] LymphoTrack Dx Software - MiSeq Package Interpretation and Reporting
[0291] Before determining clonality using the criteria listed in Table 3, the Merged Read Summary report should be used to identify the top merged read sequences and their frequencies.
[0292] Table 3
[0293]
[0294]
[0295] 1 Software calculations were rounded to the nearest tenth for comparison purposes.
[0296] result
[0297] Diagnostic and histological data for T-cell lymphoma samples are listed in Table 6 .
[0298] Referring to the table below, "Total Count" refers to the total number of reads obtained from the NGS instrument. "Length" refers to the length of the reads obtained. "V Gene" refers to the type of V gene detected. "J Gene" refers to the type of J gene detected. "Total Read Percentage" is the percentage of the total number of reads that matched that specific gene sequence, as determined.
[0299] It will be observed that some rows in the table show more than one V gene or J gene type from a single sample - this may occur when DJ joining as well as VJ joining is detected. As described elsewhere herein, any DJ joining detected is discarded as representing an incomplete recombination event. Suitably, the J gene type determined is from the J gene (J region) of the VJ joining.
[0300] cell lines
[0301] The DNA concentration, amplicon concentration, and top 1 and / or 2 clonal rearrangements of the cell lines are summarized in Table 4: Table 4. Top 1 and / or 2 clonal rearrangements of the cell lines
[0302]
[0303] Shading indicates incomplete DJ rearrangement
[0304] One cell line sample (MJ) was detected with two clonal rearrangements. The D / J rearrangement is Incomplete rearrangement , and will be removed with the VJC combination splice. Data from incomplete rearrangements (such as D / J rearrangements) will be appropriately discarded. The emphasis is on complete V / J rearrangements. Therefore, for "MJ", the "Db1" data line is discarded due to the incomplete rearrangement. The Vb28 data line is retained.
[0305] One cell line sample (Raji) was detected with a top % of total reads less than 1.0% and was non-clonal. Non-clonal data were appropriately discarded. The focus was on clonal data.
[0306] After discarding the data as described above, Table 4A is generated.
[0307] Table 4A. Top 1 and / or 2 clonal rearrangements in cell lines
[0308]
[0309]
[0310] Based on the J1-C1 and J2-C2 correlations, the MJ is C1.
[0311] Three cell line samples (Jurkat, HPB-ALL, and H9) were detected to have one VJ rearrangement. Based on the J1-C1 and J2-C2 associations, Jurkat and H9 cells were C1, and HPB-ALL cells were C2.
[0312] All cell line data were consistent with those reported in the literature.
[0313] sample
[0314] The DNA concentration, amplicon concentration, and top 1 and / or 2 clonal rearrangements of the T-cell lymphoma samples are summarized in Table 5 .
[0315] Four T-cell lymphoma samples (F19542.1a, F19539.1c, F19538.A1b, and TS18-1512A) were detected as having two clonal rearrangements. Data from incomplete rearrangements (such as D / J rearrangements) were appropriately discarded. The focus was on complete V / J rearrangements. Therefore, for these samples, the "Db1" or "Db2" data rows were discarded due to incomplete rearrangements. The Vb13, Vb29-1, Vb12-4, and Vb6-4 data rows were retained.
[0316] Two samples (TS18-1508A and TS18-1499A) were detected as having no-J or DJ rearrangements, and / or the highest % total reads were less than 1.0%, and were considered non-clonal. Data from the remaining samples determined to be non-clonal or not evaluable according to IFU 280410 of the LymphoTrack kit (more appropriately according to Table 3 above) were discarded. Non-clonal data were appropriately discarded. The focus was on clonal data.
[0317] After discarding the data as described above, Table 5A is generated.
[0318]
[0319]
[0320]
[0321] Table 6. Diagnostic and histological data of T-cell lymphoma samples
[0322]
[0323] a TCR immunohistochemistry (IHC) staining was performed to determine the presence of T cell receptors in the samples. By IHC, 8 / 10 samples were TCR positive, while 2 / 10 samples were TCR negative.
[0324] Based on the J1-C1 and J2-C2 correlations (Table 5A), F19542.1a was C1, and F19539.1c and TS18-1512A were C2.
[0325] One sample (F45038.b) was detected to have a VJ rearrangement (Vb12-4 / Jb1-6). Based on the J1-C1 and J2-C2 correlations, this sample was C1.
[0326] In summary, a sample was identified as TRBC1 (C1) or TRBC2 (C2) positive if it was determined to be clonal by LymphoTrack Dx TRB Assay-MiSeq; wherein the presence of the J1 sequence determined C1 positivity, or the presence of the J2 sequence determined C2 positivity.
[0327] Although illustrative embodiments of the present invention have been disclosed herein in detail with reference to the accompanying drawings, it should be understood that the invention is not limited to the precise embodiments shown and that various changes and modifications may be implemented therein by those skilled in the art without departing from the scope of the invention as defined by the appended claims and their equivalents.
[0328] All publications mentioned in the above specification are herein incorporated by reference.
Claims
1. A method for determining the T cell receptor β chain constant region (TRBC) gene type of a cell, the method comprising (a) determining the type of J gene expressed in said cell, and (b) inferring the type of TRBC gene expressed in the cell from (a), in, The TCRs selected for TRBJ1-1 to TRBJ1-6 use TRBC1, and the TCRs selected for TRBJ2-1 to TRBJ2-7 use TRBC2; Wherein step (a) comprises: (i) extracting nucleic acid from the cell; (ii) determining the nucleotide sequence of at least one segment of the J gene from the nucleic acid; and (iii) comparing the nucleotide sequence determined in (ii) to one or more J gene reference nucleotide sequences, wherein the J gene reference nucleotide sequences are SEQ ID NOs: 1 to 16, and (iv) identifying the J gene type from the sequence identity between the nucleotide sequence of the segment of the J gene of (ii) and the J gene reference nucleotide sequence of (iii), wherein the sequence identity is 100%; And wherein the method is for non-therapeutic purposes.
2. The method according to claim 1, wherein the nucleic acid comprises genomic DNA (gDNA).
3. Use of a reagent for determining the type of J gene expressed in a cell in the preparation of a kit or composition, wherein the kit or composition is used in a method for determining the type of T cell receptor β chain constant region (TRBC) gene in the cell, wherein the method comprises: (a) determining the type of J gene expressed in said cell, and (b) inferring the type of TRBC gene expressed in the cell from (a), Among them, the TCRs selected from TRBJ1-1 to TRBJ1-6 use TRBC1, and the TCRs selected from TRBJ2-1 to TRBJ2-7 use TRBC2; Wherein step (a) comprises: (i) extracting nucleic acid from the cell; (ii) determining the nucleotide sequence of at least one segment of the J gene from the nucleic acid; and (iii) comparing the nucleotide sequence determined in (ii) to one or more J gene reference nucleotide sequences, wherein the J gene reference nucleotide sequences are SEQ ID NOs: 1 to 16, and (iv) identifying the J gene type from the sequence identity between the nucleotide sequence of the segment of the J gene of (ii) and the J gene reference nucleotide sequence of (iii), wherein the sequence identity is 100%.
4. Use according to claim 3, wherein the nucleic acid comprises genomic DNA (gDNA).
5. The method or use according to any one of claims 1 to 4, wherein the segment of the J gene comprises the entire J region of a T cell receptor gene.
6. The method or use according to any one of claims 1 to 4, wherein the segment of the J gene is comprised in CDR3 of a T cell receptor gene.
7. The method or use according to any one of claims 1 to 4, wherein the segment of the J gene is selected from the group consisting of: 。 8. The method or use according to any one of claims 1 to 4, wherein step (ii) comprises: (1) contacting the nucleic acid with a reagent for amplifying at least one segment of the J gene; (2) incubation to allow amplification; (3) Determine the nucleotide sequence of the amplified segment of the J gene.
9. The method or use according to claim 8, wherein the reagents for amplification comprise at least one forward primer located in the V region of the T cell receptor gene and at least one reverse primer located in the J region of the T cell receptor gene, or wherein the reagents for amplification comprise at least one reverse primer located in the V region of the T cell receptor gene and at least one forward primer located in the J region of the T cell receptor gene.
10. The method or use according to claim 1 or 3, wherein step (a) comprises performing clonality determination or immunosequencing on the cells to provide nucleotide sequence information of the J gene, and determining the J gene type from the nucleotide sequence information.
11. The method or use according to any one of claims 1 to 4, wherein determining the nucleotide sequence comprises NGS analysis.
12. The method or use according to any one of claims 1 to 4, wherein the cells are from a subject suffering from or suspected of suffering from a T-cell leukemia and / or a T-cell lymphoma.
13. The method or use according to claim 12, wherein the T-cell lymphoma is peripheral T-cell lymphoma (PTCL).
14. The method or use according to any one of claims 1 to 4, wherein the cells are T-cell leukemia and / or T-cell lymphoma cells.
15. The method or use according to claim 14, wherein the cell is a peripheral T-cell lymphoma (PTCL) cell.
16. Use of CAR T cells targeting T cell receptor β chain constant region 1 (TRBC1) or CAR T cells targeting T cell receptor β chain constant region 2 (TRBC2) in the preparation of a medicament for treating T cell leukemia and / or T cell lymphoma, wherein the treatment comprises (a) determining the T cell receptor β chain constant region (TRBC) type of T cell leukemia and / or T cell lymphoma cells from a subject according to any one of claims 1 to 15; and (b) administering to the subject a CAR T cell targeting the T cell receptor β chain constant region (TRBC) type determined in (a).
17. A computer program product operable, when executed on a computer, to perform the method steps (a) to (b) of any one of claims 1 to 15.
18. A data carrier or a storage medium carrying a computer program product according to claim 17.
Citation Information
Patent Citations
Chimeric antigen receptor (CAR) with antigen binding domains to the T cell receptor beta constant region
AU2015225944A1
Chimeric antigen receptor (CAR) with antigen binding domains to the t cell receptor beta constant region
WO2015132598A1
Analysis of t-cell monotypia
WO2016051205A1
Method for simultaneously sequencing multi-sample CDR3 (complementary determining region 3) receptor library with high flux
CN102443624A