Methods and compositions for detecting microorganisms and viral particles

Abstract

The present invention relates to a rapid, safe, and accurate method for preparing samples containing microbial or viral nucleic acids for amplification and for detecting the presence of highly pathogenic viruses such as Ebola. The method involves heating the sample in the presence of reagents including a solvent and a detergent. Reagents and compositions are also provided.

Description

Technical Field

[0001] The present invention relates to the detection of microorganisms and virus particles, in particular to the detection of microorganisms or virus particles in crude samples. Background Art

[0002] Need for example for the rapid, simplified and relatively low-cost molecular diagnostic test of microbial or viral infection diagnosis to use when needed in remote areas.A recent relevant example is the Ebola virus (Ebola) outbreak in the Democratic Republic of Congo (DRC) in 2014 and the epidemic situation that is currently taking place in said area.The key in these environments is the ability to quickly triage patients, so that the patients who are really infected can be isolated from the patients who have fever due to other reasons such as malaria.Because viral hemorrhagic fevers such as Ebola virus have extremely strong infectiousness, it is crucial to stratify patients quickly and correctly in a field hospital environment.Equally important is the absolute requirement to maximize the safety of operators by minimizing exposure to the infected patient blood that is usually used for molecular testing in this case.Pathogen diagnosis is usually carried out after nucleic acid extraction is carried out to sample in order to purify any target pathogen nucleic acid, and said nucleic acid extraction is a major risk point for laboratory staff.Therefore, need a kind of simple, biosafety method that uses minimum laboratory facilities and does not need skilled operators.

[0003] Typically, the molecular methods for screening for the presence of high-protection-level pathogens (such as Ebola virus) require additional levels of biosafety to protect the operators performing the test. The first step in screening these viral hemorrhagic fevers is to draw venous blood from the patient. The individual collecting the sample will typically wear comprehensive personal protective equipment, including multiple pairs of gloves, protective clothing, and a mask. After collecting the blood sample, the outside of the collection container is disinfected by immersing it in bleach and then in a virucide (such as guanidine isothiocyanate) to make the virus non-infectious before nucleic acid extraction. These known methods comprise a multi-step procedure and therefore require well-trained users and access to a laboratory.

[0004] The typical volume of venous fluid drawn for this type of testing is 3-6 ml, so the risk of exposure to pathogens is high given the multiple transfers and cap removals that must be performed. This risk of exposure can be minimized if the volume is smaller, such as if smaller volumes of blood can be processed directly.

[0005] If smaller sample volumes (such as blood) are to be processed to maximize operator safety, sensitivity requirements increase. The World Health Organization's R&D Blueprint (https: / / www.who.int / blueprint / en / ) defines a level of 3,000 virions / ml of whole blood as a suitable assay level for low-cost diagnostics in developing countries. This would allow for the detection of a wide range of diseases, including HIV and hepatitis C, as well as the viral hemorrhagic fevers mentioned above (Ebola, Lassa, Marburg, Rift Valley fever, Crimean Congo fever, Nipah, yellow fever, and dengue). The 3,000 virions / ml figure provides the lower limit of detection requirement and guides the amount of blood needed to be added directly to the reaction, as 3,000 / ml represents three viral targets per microliter.

[0006] Current methods need to be improved to facilitate safer detection of pathogens, especially in settings where access to safety equipment is limited, such as in some third world countries, which coincide with high prevalence of some of the most deadly pathogens.

[0007] Blood is an easily accessible and common source of potential pathogens that is often used for diagnosis.

[0008] Pathogens are typically detected via PCR-based diagnostics, including rtPCR. However, PCR is typically inhibited by the presence of whole blood, both in the enzymatic amplification process and in the optics used to detect the presence of PCR products in certain forms of PCR, such as rtPCR. Whole blood contains inhibitors, such as heme, iron, immunoglobulins, and other inhibitors, which inhibit the polymerase required to perform PCR or the reverse transcriptase required to amplify from an RNA target. Likewise, the fluorophores used in the real-time process are quenched by substances in the blood, such as heme, and blood itself has its own absorption and emission spectra, with the end result that real-time PCR is considered unreliable in the presence of high concentrations of blood. The liability of sensitivity, particularly when using low volumes of blood, is that blood must account for a large percentage of the total reaction volume in the PCR, and a point will be reached where real-time PCR can no longer be performed due to the opacity of the reaction.

[0009] In view of the above, PCR-based diagnosis using blood samples typically requires multiple steps, such as removing red blood cells to allow the plasma or serum to enter the PCR reaction, extracting the pathogen nucleic acid so that PCR can be performed in the absence of any inhibitors in the lysate, and / or extracting the resulting PCR product so that it can be detected in the absence of red blood cells. These multiple steps require laboratory equipment, a biosafety environment, and safety equipment to ensure that clinical practitioners and laboratory personnel are not infected, which means that the detection is not simple and is not suitable for field-based rapid detection of pathogens.

[0010] It is well known that the presence of whole blood inhibits PCR, so there are few peer-reviewed papers on direct QPCR from blood because only very low amounts of blood can be added to the reaction before the process is completely optically inhibited. The amount of blood that can be added and the relatively small volume of the method (<50ul) mean that there are few descriptions of direct pathogen detection from blood. For standard QPCR, Minogue et al. (Minogue, Timothy D et al. "Cross-institute evaluations of inhibitor-resistant PCR reagents for direct testing of aerosol and blood samples containing biological warfare agent DNA" Applied and Environmental Microbiology, Vol. 80, 4 (2014): 1322-9.) describe the direct incorporation of spores into whole blood, but this only reaches 4%, and crucially, no rotation steps are described. There is little literature on reverse transcription QPCR directly from blood because there is even less literature on the use of reverse transcriptase in the presence of blood.Those that do exist focus on parasites like malaria, where large quantities of ribosomal RNA can be used as PCR targets, for example, there can be tens of thousands of ribosomal RNA transcripts per parasite (Taylor BJ, Lanke K, Banman SL, et al. "A Direct from Blood Reverse Transcriptase Polymerase Chain Reaction Assay for Monitoring Falciparum Malaria Parasite Transmission in Elimination Settings." Am J Trop Med Hyg. 2017;97(2):533-543), or tens of thousands of ribosomal RNA transcripts per virus (like Ebola), where viral titers can be in the millions per milliliter of whole blood (Kavit Shah, Emma Bentley, Adam Tyler, Kevin S Richards, Ed Wright, Linda Easterbrook, Diane Lee, Claire Cleaver, Louise Usher, Jane E Burton, James Pitman, Christine B Bruce, David Edge, Martin Lee, Nelson Nazareth, David A Norwood, Sterghios Athanasios Moschos. “Field-deployable, Quantitative, Rapid Identification of Active Ebola Virus Infection in Unprocessed Blood.” Chem. Sci., 2017; DOI: 10.1039 / C7SC03281A.Inhibition of PCR by whole blood has been shown to be multifactorial, including the presence of iron from heme-containing compounds, immunoglobulins, and simply due to the presence of competing cations such as calcium in the blood (Sidstedt, Maja et al. "Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR," Analytical and bioanalytical chemistry, vol. 410, 10 (2018): 2569-2583).

[0011] Methods for lysing cells such as blood cells are known, for example from WO2011157989. However, the method of WO2011157989 requires a large amount of energy to allow the required freezing and thawing cycles. Such methods are not suitable for field-based pathogen detection using battery-powered PCR machines.

[0012] WO2016139443 discloses a method for performing PCR directly on blood samples. However, this method is limited to using relatively low amounts of blood in each PCR reaction, which means limited sensitivity. It is also restricted to specific excitation and emission wavelengths. These wavelengths are not relevant for most commonly used fluorophores, although suitable fluorophore combinations do exist, such as CY5-BHQ2 and HiLyte647-QXL607, thus limiting the potential for multiplexing.

[0013] Given this, single-step, closed-tube, PCR-based methods for pathogen detection, particularly from blood samples, are not available that are inexpensive, simple, and suitable for use in the field where access to electricity is limited. Any instrument or assay capable of processing whole blood (such as the BioFire or SmartCycler) requires upstream processing and is inherently more complex due to its absolute requirement for automation of the nucleic acid extraction process, making each test very expensive.

[0014] BG Research has previously described methods for directly lysing cells and viruses from crude samples, WO 2011157989 Kavit Shah et al. "Field-deployable, Quantitative, Rapid Identification of Active Ebola Virus Infection in Unprocessed Blood." Chem. Sci., 2017; DOI: 10.1039 / C7SC03281A), and associated optical systems that enable multiplexed real-time PCR in the presence of whole blood, WO 2016139443.

[0015] The method described in WO 2011157989 causes ice crystal damage (for viruses), osmotic shock (for fungi) as cell thawing, and because both are used for more complex targets (such as spores and bacteria), this allows organisms to be detected. However, the freezing process increases the time of the method, and because these machines are operated using battery power on site, freezing / thawing consumes a lot of electricity. Therefore, the present invention provides reagents and methods that allow on-site diagnostic testing of patients infected with Ebola virus, thereby reducing detection time, operator exposure to pathogens, and eliminating the requirements for the establishment of trained operators and laboratories in outbreak areas.

[0016] It will then be clear that the present invention has particular utility in directly detecting pathogens from crude samples in response to new outbreaks of disease. The present invention is applicable to a variety of crude sample types and pathogen families. Further, it is possible to rapidly develop new assays to meet the requirements of responding to emerging disease outbreaks, i.e., optimized methods and reagents suitable for the detection of any specific pathogen. Since the technology is based on the well-proven RT-QPCR process, a key optimization step is to determine a thermal process that, in combination with the described reagents, can lyse and amplify any newly encountered pathogen. However, it will be clear from this specification that certain embodiments of the present invention are contemplated to not require optimization and can be used as described to detect infection with emerging pathogens.

[0017] Applicants have discovered that by using the methods described herein, the amount of crude sample, such as blood, that can be added to a reaction can be greatly increased. In the case of whole blood, this amount exceeds 35%. This has the combined benefits of increasing diagnostic sensitivity while also minimizing the final volume of the reaction, thereby allowing for faster thermal cycling and, consequently, reducing detection time, which is crucial in a point-of-care setting. Furthermore, it significantly reduces the cost per test by reducing the total reaction volume and, therefore, the cost of reagents in proportion.

[0018] Many blood-borne viral infections, including Lassa fever, CCHF, Ebola, etc., are found in remote, resource-poor settings, so the shortest detection time, ease of use, and cost per test are all critical. The World Health Organization R&D Blueprint states that simplified molecular diagnostic methods for developing countries must have a sensitivity of 3000 virions / ml and the cost per test must be equivalent to antibody-based methods. The present invention achieves this, increasing the sensitivity to less than 1000 virions / ml and reducing the cost of lateral flow immunodiagnostics. It has been shown that assays using the described methods are able to detect as few as 15 virions per reaction, so assuming that 15ul of blood has been added, this would be a final sensitivity of 1000 virions / ml.

[0019] Where the sample is a blood sample, applicants have discovered that certain reagent mixtures may be more denaturing of blood based on variables such as pH and the presence of supplements. As a result, the optical system described in WO 2016139443 (which describes a high-power laser-based spectroscopy-based method for multiplexed detection in the presence of whole blood) is no longer able to detect real-time PCR signals in blood concentrations up to 13% of the maximum value stated in said application under those conditions (Kavit Shah, Emma Bentley, Adam Tyler, Kevin S Richards, Ed Wright, Linda Easterbrook, Diane Lee, Claire Cleaver, Louise Usher, Jane E Burton, James Pitman, Christine B Bruce, David Edge, Martin Lee, Nelson Nazareth, David A Norwood, Sterghios Athanasios Moschos. “Field-deployable, Quantitative, Rapid Identification of Active Ebola Virus Infection in Unprocessed Blood”). This performance degradation is due to the fact that in more highly denatured reagents, blood changes from a red liquid to a "brown" colloidal suspension of denatured proteins, which increases the opacity of the liquid. At higher percentages of blood, a dark brown colloidal suspension is formed that completely prevents the collection of optical data. Although the applicants have been able to formulate reagents capable of performing reverse transcription quantitative PCR (RT-QPCR) in the presence of up to 40% whole blood, the process is not feasible because the optical data can no longer be recognized. Summary of the Invention

[0020] The present invention provides improved reagents and methods for processing and detecting microorganisms and viral particles in samples. The present invention is particularly advantageous when the sample is a crude sample such as whole blood. The methods of the present invention generally involve: a processing step in which viral or microbial nucleic acids are made amplifiable by, for example, a standard RT-PCR reaction; a subsequent amplification step in which any target nucleic acid is amplified; and a detection step in which the amplified nucleic acid is detected. The methods can be used with any fluorophore or suitable amplicon detection dye or real-time PCR chemistry known in the art, as any excitation and detection wavelengths can be used. This improves the number of target nucleic acid targets (in this case, pathogens from whole blood) that can be screened simultaneously. The present method also does not require a nucleic acid extraction step or centrifugation as in some previous methods, which means that the present method is simpler, requires less laboratory equipment and less sample handling.

[0021] In some embodiments, the method further involves multiple rounds of reverse transcription (RT), which has been shown to greatly enhance the sensitivity of the reaction and enable the detection of very low-abundance viruses directly from crude samples such as blood.

[0022] The method can be combined with the teachings of PCT / GB2019 / 051156 to serve as a system for directly detecting viral pathogens in whole blood, efficiently preparing plasma in a closed tube, lysing the pathogens contained therein, and then performing RT-QPCR directly on the target pathogen of interest, with an optional freeze-thaw cycle being performed after the centrifugation step (EP2585581), thus allowing direct amplification of multiple target pathogens. DETAILED DESCRIPTION

[0023] In one aspect, the present invention provides a method for preparing a sample for direct amplification of target microbial or viral nucleic acids that may be present in the sample. The present inventors have discovered that, while heating the sample may be sufficient in some cases to obtain nucleic acids accessible to PCR reagents and amplifiable, heating alone is unreliable and generally not widely applicable to different target microorganisms or viruses. This is particularly true when the sample is a crude sample, such as a blood sample obtained from a subject, which may itself contain compounds that inhibit PCR reactions.

[0024] Thus, in one aspect, the present invention provides a method for preparing a sample for direct amplification of microbial or viral particle nucleic acid by a polymerase, wherein the sample is obtained from a subject and may contain one or more microorganisms or viral particles, wherein the method comprises heating the sample in a container to a temperature of at least 70° C. in the presence of a reagent comprising a detergent, a solvent and one or more nucleic acid polymerases.

[0025] Current pathogen diagnostic methods are typically followed by nucleic acid extraction (e.g., salt / alcohol extraction) of the sample to purify any target pathogen nucleic acids. This typically requires the use of dedicated laboratory facilities and highly trained molecular biologists, making it unsuitable for responding to outbreaks of emerging pathogens, particularly in countries or regions with limited access to advanced laboratory equipment. Nucleic acid extraction is performed for two reasons: first, to ensure destruction of the pathogen to release the target nucleic acid, and second, to remove inhibitors present in the sample that could adversely affect the performance of molecular diagnostic assays, such as PCR inhibitors.

[0026] In order to perform direct diagnosis, it is necessary to complete this dual function in a single closed tube process. The pathogen must be lysed / to enable detection of nucleic acids, and the reagents must be able to perform the amplification process in the presence of a sufficiently crude sample to enable diagnostic testing. For example, taking Ebola virus as an example, the viral load of symptomatic individuals will exceed 1e6 virions / ml of blood and the viral load is directly related to the severity of the disease and the accompanying risk of death, which means that each microliter of whole crude blood will contain 1000 genomic targets and will have diagnostic utility (Hartley MA, Young A, Tran AM, Okoni-Williams HH, Suma M et al. (2017) "Predicting Ebola Severity: A Clinical Prioritization Score for Ebola Virus Disease". "PLOS Neglected Tropical Diseases" 11(2):e0005265.). The World Health Organization defines a sensitivity level of 3000 virions / ml as suitable for simple, low-cost testing in remote, impoverished areas. As an example, in developing country settings, where viral loads may be below 10,000 virions / ml, this would be sufficient to detect important diseases such as hepatitis C and HIV. As a result, in these cases, it is necessary to process large amounts of crude samples since each microliter contains only three genomic target regions. When the goal is to detect the presence of viral pathogens, the preferred sample type for this method is whole blood, with serum and plasma being the typical sample types used in molecular biology laboratories. Plasma and serum are commonly used because they avoid inhibitory compounds that may be produced during the extraction process and therefore produce false negative results. A disadvantage of using serum and plasma is that the centrifugation used may reduce the virus titer in the sample (Klungthong C, Gibbons RV, Thaisomboonsuk B, et al. "Dengue virus detection using whole blood for reverse transcriptase PCR and virus isolation." J Clin Microbiol. 2007; 45(8): 2480-5.).Therefore, an ideal method for directly detecting microbial or viral pathogens present in a sample such as blood is to add the sample (e.g., a certain volume of whole blood) directly to a sealed reaction vessel to maximize biosafety and sensitivity, thereby ensuring that the nucleic acids present in any microorganisms or viruses become amplifiable and undergo direct amplification. Amplifiable means that the nucleic acids inside the microorganism or virus are accessible to PCR components such as primers and one or more polymerases; and the effects of any amplification inhibitors are sufficiently mitigated so that the nucleic acids present in the container environment can be amplified, for example, by PCR or reverse transcription PCR (RT-PCR) or real-time (rt) PCR (rtPCR) or quantitative (q) PCR (qPCR) or reverse transcription quantitative PCR (RT-qPCR).

[0027] "Direct amplification" means that the sample can be subjected to amplification, such as PCR, RT-PCR, or RT-qPCR, following a sample preparation method, i.e., without further processing of the nucleic acid; and amplification can be performed if all components required for amplification are already present or added to the sample. Direct amplification also means that no components need to be removed from the sample after processing, i.e., it is not necessary to, for example, centrifuge the sample to remove particulate material or other fractions that may be considered to include amplification inhibitors. In a preferred embodiment, the container includes all components required for amplification, so that amplification can be performed once the sample is added to the container. Once the sample is added, in some embodiments, such as those in which the container includes all components required for amplification and detection, the container is sealed and does not need to be opened again. When the method prepares a sample for direct amplification of viral or microbial nucleic acids, the methods of the present invention are particularly useful in detecting highly pathogenic microorganisms and viruses. In these cases, minimizing exposure of clinicians / field staff to pathogens is crucial. The present invention provides that once the sample has been collected and added to the container, clinicians / field staff do not need to be exposed to any pathogens.

[0028] In some embodiments, the method is a closed tube method for preparing a sample. A skilled artisan will understand the meaning of a closed tube method and generally requires that once the sample is added to the container along with any necessary components for the preparation method or downstream amplification and detection steps, the container is closed, for example by closing or sealing a lid to the container, and the lid or cover is not opened again. For example, in some embodiments of the closed tube method, no additional materials are added or removed from the container, for example, the nucleic acid is not extracted or purified in any way.

[0029] In one embodiment, the microorganism or viral nucleic acid is not extracted, for example, the microorganism or viral nucleic acid is not precipitated with alcohol, for example, is not precipitated with ethanol. The technician will understand the meaning of nucleic acid extraction, and normally purifies nucleic acid from its environment. Therefore, in this embodiment, nucleic acid is not removed from its original environment, that is, not removed from other components of sample and reagent. In this embodiment and other embodiments, nucleic acid is not purified, that is, not separated from other components of cell or virus.

[0030] In the same or different embodiments, no portion of the sample or reagent is removed from the container at any stage of the preparation step, e.g., no portion of the sample or reagent is removed from the container:

[0031] a) prior to said heating; and / or

[0032] b) after said heating.

[0033] In one embodiment, once the sample is added to the container, no material is removed from the container. In another embodiment, no material is removed from the container during preparation, amplification and detection. In such embodiments, a container comprising an irreversible lock can be used so that once the sample is added and the container is sealed, the container cannot be opened again. Such containers are described in PCT / GB2019 / 051156. In one embodiment, the container is considered a biosafety container. A skilled person will understand the meaning of the term biosafety. In one embodiment, biosafety means that no pathogens contained in the container can escape from the container, so that people handling the container will not be exposed to any pathogens contained therein. In one embodiment, the biosafety container has a locking lid or cover. Preferably, the biosafety container is made of a pressure-resistant material, such as a carbon-loaded polymer. In another embodiment, the biosafety container also has two safety points in terms of sealing.

[0034] In a preferred embodiment, the container of the present invention is suitable for use in amplification reactions, such as PCR reactions, optionally reverse transcription (RT) PCR, and optionally quantitative (q) PCR or RT-qPCR. Containers suitable for such reactions typically have thin walls, approximately 0.5 to 0.8 mm thick, made of a carbon-supported polymer. This solves two problems: 1) allowing for faster absorption and loss of heat; and 2) reducing lag between the reaction vessel holder / test tube / liquid contents.

[0035] Some known methods for preparing samples for amplification involve repeated freezing and thawing of the sample. While such methods are suitable for the method of the present invention, they do not require freezing the sample. This is an advantage of the present invention over such methods, as freeze-thawing is energy-intensive, meaning that such methods are not optimal for field use, for example in countries where access to mains electricity is difficult, where the thermal cycler is battery-powered. The present invention addresses this shortcoming.

[0036] Thus, in one embodiment, the temperature of the sample is not reduced relative to ambient temperature, optionally wherein the sample is not frozen.

[0037] Other means for preparing samples for nucleic acid amplification involve centrifugation of the sample, which can: a) reduce particulate matter that interferes with amplicon detection; and b) reduce materials that may include PCR inhibitors. However, as with the cold-thaw method, centrifugation requires additional laboratory equipment and energy. As discussed above, centrifugation can also remove some viral or microbial material, which means that there is less target nucleic acid available to use as a template in amplification. The present invention is simpler, less energy-intensive, requires less skill, and solves the problem of particulate matter interfering with the optical path of the spectrophotometer and inhibiting amplification. The inhibitory effect of amplification can be mitigated to some extent by selecting one or more suitable polymerases, for example, enzymes that are tolerant to inhibitors present in blood or urine or saliva. The skilled person will understand enzymes that are tolerant to particular sample types and will also understand how to determine the most appropriate enzyme for use with a given sample type.

[0038] Thus, in one embodiment, the sample is not centrifuged:

[0039] a) before heating; and / or

[0040] b) after said heating.

[0041] However, centrifugation is appropriate in some cases, such as simply pulling samples and reagents that may have aggregated on the container lid into the container. For example, the sample can be pulse centrifuged at a speed of 1-2000 g, such as for 5 to 15 seconds, to simply pull the aggregate down into the container.

[0042] Preferably, the sample is a crude sample. Crude sample includes the following meanings: a sample to which no or minimal additional components have been added and / or to which processing steps that alter the composition of the sample have been applied after obtaining the sample from the subject. For example, a crude sample can be a crude biological sample, such as

[0043] a) blood, optionally whole blood;

[0044] b) urine;

[0045] c) serum;

[0046] d) plasma;

[0047] e) feces,

[0048] f) cerebrospinal fluid;

[0049] g) a swab, optionally from the eye, ear, nose or mouth; and / or

[0050] h) Eluate obtained from washing of the swab.

[0051] In some exemplary embodiments, a swab taken from a human, animal, or environmental surface, or another solid sample type, can be placed in water (e.g., 200 μl of water) and vortexed to release viral or microbial particles. Water can then be added to the container at up to 20% of the reaction volume. Similarly, a liquid environmental sample can be added directly to the container.

[0052] The skilled artisan will understand the meaning of a crude sample. In one embodiment, a crude sample is a sample in which no attempt is made to purify the target nucleic acid from its natural environment, such as from blood cells, urine samples, fecal samples, spinal fluid, or swabs. The eluate obtained from the washing of a swab is considered a crude sample because the target nucleic acid at this stage may still be associated with cellular material or viral particles.

[0053] Because the present invention can also be applied to the detection of animal diseases, the ability to use swabs or swab eluates as samples is important. In the veterinary field, the most commonly used sample type is a swab—these swabs are obtained from the eyes, nose, or mouth, depending on the suspected disease. Many virulent animal pathogens, such as rinderpest and PPRV, have a virological component, but for some economically important diseases, the time window during which viral pathogens can be found in the blood is very limited. However, using direct blood methods in remote, resource-poor settings where these diseases are prevalent has several disadvantages. First, obtaining blood samples from animals requires the input of a trained veterinarian, and second, viruses can be found in readily available samples that can be obtained by non-specialists. This application covers a method for performing direct detection of viral animal pathogens, without the need for nucleic acid extraction, from swab samples obtained from the mouth, eyes, or nose. The applicant has also recognized that this method can be applied to other important diseases, such as respiratory diseases in humans. Simply obtain a swab from the patient or animal, place the swab in a plastic tube containing 200 μl of water, and then shake the plastic tube to release the viral particles in the swab. A small portion of this liquid is then transferred directly into the reaction vessel in place of blood or other liquid sample types previously described.

[0054] A crude biological sample is considered to be any sample taken directly from an organism. Although the present invention is considered to have primary use in diagnosing pathogen infection, a crude sample can also be a crude environmental sample, in which case "subject" in the claims can be considered to refer to the surface or source of the environmental sample. Crude environmental sample includes the following meanings: samples such as food samples, swabs taken from the environment such as a surface, and any other sample type that is not taken directly from an organism (in which case it will be considered a crude biological sample taken directly from an organism).

[0055] A crude sample may also be a direct crude environmental sample, such as a direct water sample from a stream or lake, a direct soil or other environmental material sample. The sample may also be a plant sample.

[0056] A crude sample can also be a sample to which minimal processing has been applied after the sample has been obtained, such as in the preparation of plasma and serum from whole blood, or the eluate obtained from the washing of a swab, for example, for pathogens that are not highly contagious to the operator, such as when used on-site for the detection of veterinary pathogens. A crude sample can also have had some additional components added, such as preservatives, but these components are not considered to be generated by the purification of nucleic acids from the sample, in other words, all the original material is still present in the sample. In the case of a blood sample, EDTA can be added to the sample for storage, but the sample is still considered to be a crude sample. Swabs and samples can be frozen before preparation according to the method of the present invention, but preferably, once a sample has been obtained from a subject, the method is performed on the sample immediately or as quickly as possible to at least minimize contamination and infection.

[0057] As discussed, the processed sample is typically used in an amplification reaction to amplify the target nucleic acid. The amplified target or amplicon is then detected after or during amplification, for example using qPCR or RT-qPCR. It will be appreciated by those skilled in the art that qPCR and RT-qPCR typically require the use of fluorophores or other suitable nucleic acid intercalating or detection dyes and probe chemistries.

[0058] Those skilled in the art will understand the implications of qPCR. In this context, when the target pathogen has a high level of sequence heterogeneity, the reaction contains a primer or primer set, such as for Lassa fever, and a probe specific for the target sequence of interest. This may be a hydrolysis probe, where the 5' end is labeled with a fluorophore and the 3' end is labeled with a quencher moiety. During amplification, the probe is enzymatically hydrolyzed, resulting in a cycle-by-cycle increase in fluorescence. An excitation device is provided, and the resulting emission is captured through a window in the container, which in some embodiments is located in the lid.

[0059] In some preferred embodiments, a fluorophore or dye is present during the treatment step, for example as part of a fluorophore-labeled primer or probe. Crude samples will typically include particulate or cellular material, which in some embodiments can be considered to interfere with the excitation and / or capture emission wavelengths of the fluorophore and may otherwise interfere with the selection of a suitable fluorophore. Known methods to avoid these problems involve centrifugation and / or use a specific fluorophore combination that excites and emits at a wavelength not absorbed by the sample (e.g., a wavelength not absorbed by blood), such as a far-infrared fluorophore. However, the reagent used in this method solves this type of problem because it causes aggregation or coagulation of samples such as whole blood, thereby forming a large amount of sediment that sinks to the bottom of the blood vessels. The present invention is particularly suitable for whole blood samples, although the reagent provided will sink the proteinaceous material in any protein-rich sample. If the container is substantially not disturbed or agitated, the sediment is retained at the bottom of the container, leaving a clear top layer that can be used for fluorophore excitation and emission. Therefore, fluorophores or dyes that can excite and emit at any wavelength can be used together with the present invention without the need for a centrifugation step. For example, the sample can be excited at a wavelength between 300 nm and 800 nm, and the emitted light can be collected at any wavelength (e.g., between 300 nm and 800 nm). In some embodiments, the excitation wavelength used to excite the fluorophore associated with qPCR is between 630 nm and 645 nm, optionally between 633 nm and 642 nm; and / or the emitted light is collected at a wavelength between 650 nm and 750 nm. In another embodiment, the fluorophore is excited at a wavelength of approximately 475 nm and / or 635 nm; and / or the emitted light is collected at wavelengths of approximately 520 nm and 660 nm.

[0060] In one embodiment, PCR uses a 2-color system with LED excitation at 475 nm and 635 nm and emission collection at 400-900 nm using dual bandpass filters with windows of 520-580 nm and 660-750 nm.

[0061] Exemplary fluorophores include FAM, TET, JOE, VIC, HEX, NED, PET, ROX, TAMRA, CY5. However, the skilled artisan will appreciate that since the sample does not interfere with excitation or emission in the present method, the choice of suitable fluorophores or dyes is limited only by the excitation and collection capabilities of the thermal cycler used.

[0062] Although not required by the present invention, the sample may be subjected to a centrifugation step, which may be beneficial in certain circumstances. For example, by performing a centrifugation step, a crude sample, such as blood, may be removed more quickly from the light path.

[0063] It is considered preferable from a safety point of view if the sample is obtained and added directly to the container (which may or may not be a container according to PCT / GB2019 / 051156). Of course, the skilled person will understand that after obtaining the sample, the sample can be stored for a period of time, for example at low temperature, before being added to the reaction vessel.

[0064] As described above, the sample will typically be a biological sample, for example, a sample obtained from a mammal, such as a human, cow, pig, cow, sheep, pig, dog, camel, horse, llama, goat, rabbit, cat, rat, mouse, ferret, guinea pig, mink, or other model organism. In other embodiments, the sample is a sample obtained from a bird species. In other embodiments, the sample is a sample obtained from a fish. Preferably, the sample is a human sample or a sample from a cow.

[0065] The microorganism or virus particle ultimately detected can be any microorganism or virus particle, for example, any one of a virus, a bacterium, a protozoa, or a fungus. In a preferred embodiment, the microorganism or virus is a pathogenic microorganism or virus, for example, a Class 3 or Class 4 pathogen according to the "Classification of Biological Agents", the National Institute for Public Health and the Environment, RIVM Letter Report 205084002:

[0066]

[0067]

[0068] The pathogen can be a mammalian pathogen, such as a human pathogen, a bovine pathogen, a porcine pathogen, a dairy cow pathogen, a sheep pathogen, a pig pathogen, a dog pathogen, a camel pathogen, a horse pathogen, a llama pathogen, a goat pathogen, a rabbit pathogen, a cat pathogen, a rat pathogen, a mouse pathogen, a ferret pathogen, a guinea pig pathogen, a mink pathogen or other model organism pathogen, or an avian pathogen, or a fish pathogen.

[0069] In other or the same embodiments, the pathogen is an avian pathogen. Thus, in one embodiment, the one or more microorganisms or viral particles can be selected from the group consisting of:

[0070] a) a viral hemorrhagic fever selected from the group consisting of Ebola virus, Lassa fever, Marburg virus disease, Rift valley fever, Congo fever, and yellow fever; and / or

[0071] b) Japanese encephalitis, dengue fever, Zika virus, and chikungunya;

[0072] c) veterinary diseases with a viral component, including but not limited to PPRV, FMDV, BTV, Newcastle disease, swine influenza, BVDV;

[0073] d) Malaria, HIV, viral hepatitis, soil-transmitted helminth parasitic infections.

[0074] Virology includes the meaning of having a blood-borne component.

[0075] The present invention is believed to be particularly useful in the preparation and subsequent amplification and detection of microorganisms or viruses having an RNA genome.

[0076] In one embodiment, the viral particle is an RNA viral particle. In some embodiments, the RNA viral particle is selected from the group consisting of or includes:

[0077] Adeno-associated virus, Aichi virus, Australian batlyssavirus, BK polyomavirus, Banna virus, Barmah forest virus, Bunyamwera virus, Bunyavirus La Crosse, Bunyavirus snowshoe hare, Cercopithecine herpesvirus, Chandipura virus, Chikungunya virus, Cosavirus A, Cowpox virus, Coxsackievirus, Crimean-Congo hemorrhagic fever virus, dengue virus, Dhori virus, Dugbe virus, Duvenhage virus, Eastern equine encephalitis virus Ebola virus, Echovirus, Encephalomyocarditis virus, Epstein-Barr virus, European bat lyssavirus, GB virus C / Hepatitis G virus, Hantaan virus, Hendra virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis E virus, Hepatitis D virus, Horsepox virusvirus), human adenovirus, human astrovirus, human coronavirus, human cytomegalovirus, human enterovirus 68, 70, human herpesvirus 1, human herpesvirus 2, human herpesvirus 6, human herpesvirus 7, human herpesvirus 8, human immunodeficiency virus, human papillomavirus 1, human papillomavirus 2, human papillomavirus 16, 18, human parainfluenza virus, human parvovirus B19, human respiratory syncytial virus, human rhinovirus, human SARS coronavirus, human retrovirus, human T-lymphotropic virus, human torovirus, influenza A virus, influenza B virus, influenza C virus, Isfahan virus, JC polyomavirus, Japanese encephalitis virus, Juninarena virus, KI Polyomavirus, Kunjin virus, Lagos bat virus, Lake Victoria Marburg virus, Langat virus virus, Lassa virus, Lordsdale virus, Louping illvirus, Lymphocytic choriomeningitis virus, Machupo virus, Mayaro virus, Middle East respiratory syndrome (MERS) coronavirus, Measles virus Yukuniemi, Mengo encephalomyocarditis virus, Merkel cell polyomavirus, Mokola virus, Molluscum contagiosum virus, Monkeypox virus, Mumps virus, Murray valley encephalitis virus, New York virus, Nipah virus, Norwalk virus, O'nyong-nyong virus, Orf virus virus), Oropouche virus, Pichinde virus, Poliovirus, Punta Toru virustorophlebovirus, Puumala virus, Rabies virus, Rift Valley fever virus, Rosavirus A, Ross river virus, rotavirus A, rotavirus B, rotavirus C, Rubella virus, Sagiyama virus, Salivirus A, Sandfly fever Sicilian virus, Sapporo virus, Semliki forestvirus, Seoul virus, Simian foamy virus, Simian virus 5, Sindbis virus, Southampton virus, St. Louis encephalitis virus, Tick-borne powassan virus, Torque teno virus, Toscana virus virus), Uukuniemi virus, Vaccinia virus, Varicella-zoster virus, Variolavirus, Venezuelan equine encephalitis virus, Vesicular stomatitis virus, Western equine encephalitis virus, WU polyomavirus, West Nile virus, Yaba monkey tumor virus, Yaba-like disease virus, Yellow fever virus, and Zika virus.

[0078] The present invention is believed to be applicable to the processing and subsequent amplification of both enveloped and non-enveloped viruses.

[0079] As mentioned above, in the presence of a reagent comprising a detergent, a solvent and one or more nucleic acid polymerases, the sample is heated to a temperature of at least 70°C in a container. In a preferred embodiment, the sample is not subjected to further physical manipulation, or once the sample is added, no additional material is added to the container, so the reagent comprising a detergent and a solvent should be compatible with one or more nucleic acid polymerases to allow the enzyme to function in downstream amplification. Compatibility refers to that the reagent should substantially maintain the maximum activity of the enzyme. For example, the enzyme should retain at least 98%, 96%, 94%, 92%, 90%, 85%, 80%, 75%, 70%, 65%, 60% activity. Technicians will understand how to determine the relative change in the maximum activity of the polymerase and the activity of the polymerase when used in different reagents. For example, naked RNA templates can be used to carry out real-time PCR reactions, for example, using a buffer in which an enzyme is supplied can be considered to provide 100% activity. The effect of adding the various components of the reagent can be determined, for example, by adding tween and / or glycerol and measuring the performance of the polymerase. In some embodiments, a reagent is compatible with a polymerase if amplification, i.e., any amount of amplification, is performed with the polymerase in the presence of the reagent. Thus, in one embodiment, the reagent is compatible with one or more polymerases. In practice, a reagent is considered suitable if the Ct of the reaction in the presence of a particular reagent component is within 0.5 of the Ct of the reaction in the absence of the reagent component.

[0080] The skilled artisan will understand which components of the reagents will be compatible with a particular polymerase.

[0081] Further, in the same or alternative embodiments, the reagent is compatible with a reagent in which one or more polymerases are supplied. The skilled artisan will appreciate that commercially available polymerases are typically supplied in liquid form and are therefore already associated with various components. It is contemplated that in some cases, there may be interactions between the reagent in which the polymerase is supplied and the reagents of the present invention that may reduce or inhibit polymerase activity. As described above, the skilled artisan will be aware of this and can take steps to ensure that the reagents of the present invention are compatible with the reagents of the enzyme.

[0082] In other embodiments, the polymerase is supplied lyophilized, in which case it has not yet been associated with any reagents and so such compatibility is not an issue.Preferably, the lyophilized polymerase is supplied in a container to which the sample is added.

[0083] Those skilled in the art will appreciate that the polymerase may also be supplied in a neat enzyme liquid phase, ie, where the enzyme is not yet in any reagents or without any associated storage buffer.

[0084] Because in some cases, target nucleic acid is RNA, so the thermal stability of the RNA itself of release is another problem. Technicians are aware that RNA degrades when there is an alkaline solution containing divalent cations (Valles SM, Strong CA, Buss EA, Oi DH. " Non-enzymatic hydrolysis of RNA in workers of the ant Nylanderia pubens ". J Insect Science 2012; 12: 146. doi: 10.1673 / 031.012.14601). Therefore, if preparation method as herein described is used together with standard Taq polymerase buffer usually based on Tris and 4M MgCl , then any RNA of release will be rapidly degraded and target RNA cannot be amplified. Technicians will understand that, therefore, described reagent can include one or more buffers. Described reagent can include any buffer, and technicians know this type of agent. However, in one embodiment, reagent does not include Tris.

[0085] The applicant has developed a buffer that is substantially pH neutral at temperatures to which the sample is heated, i.e., above 70°C (e.g., where the target nucleic acid is the capsid Tm of a viral nucleic acid), and that becomes neutral above those temperatures. It will be understood by those skilled in the art that the PKA of a buffer indicates whether the pH of the buffer will be neutral at a given temperature. For example, the PKA of bicine is 0.018 pH / C. Further, the system buffers divalent cations such that free concentrations are minimized. In some embodiments, the reagent is therefore based on bicine or tricine, with a typical formulation of 50 mM bicine / tricine, 3.5 mM MgCl2, 115 mM potassium acetate and adjusted to a pH of 8.2 at 25°C. This reagent is essentially neutral at temperatures above 70°C, for example at the capsid Tm (capsid denaturation point), and thus, there are no excess hydroxide ions to attack the RNA, but the pH will meet the physiological requirements of the enzymes in the reverse transcription / amplification step, which will be carried out at a temperature of 55°C to 65°C and a pH of 7.4-7.6.

[0086] Thus, one embodiment provides a reagent having a pH of about 6.5-7.5 at a temperature between about 70°C-100°C, optionally between 72°C and 98°C, between 74°C and 96°C, between 76°C and 94°C, between 78°C and 92°C, between 80°C and 90°C, between 82°C and 88°C, or between 84°C and 86°C; optionally wherein the reagent has a pH of 7.45 at 70°C and / or a pH of 7.0 at 95°C.

[0087] Thus, in preferred embodiments, the reagents minimize RNA degradation and examples of suitable components are given above.

[0088] Since divalent cations are generally required as cofactors for polymerase activity, it is considered important in some embodiments if the reagent buffers the divalent cations. Suitable buffers include bicine and tricine.

[0089] In another embodiment, a bicine-based buffer is preferred. The concentration of bicine can be any concentration. Therefore, in one embodiment, the reagent comprises bicine. In another embodiment, the reagent comprises bicine at a concentration of between 20mM and 70mM, between 25mM and 65mM, between 30mM and 60mM, between 35mM and 55mM, between 40mM and 50mM, or about 50mM. In another or identical embodiment, the reagent comprises bicine at a concentration of at least 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, 55mM, 60mM, 65mM, or 70mM. In another or the same embodiment, the agent comprises bicine at a concentration of less than 70 mM, 65 mM, 60 mM, 55 mM, 50 mM, 45 mM, 40 mM, 35 mM, 30 mM, 25 mM or 20 mM.

[0090] In another embodiment, the reagent comprises tricine, for example, comprising tricine at the concentrations indicated above.

[0091] As discussed above, the reagents require at least one solvent and at least one detergent. In one embodiment, the solvent is glycerol. In the same or another embodiment, the detergent is a Tween, such as Tween 20. Thus, in one embodiment, the solvent is glycerol and / or the detergent is a Tween, such as Tween 20.

[0092] In one embodiment, the agent comprises Tween (polysorbate), such as Tween 20, at a concentration of up to 0.4%, for example, at a concentration of

[0093] a) at least 0.025%, 0.05%, 0.075%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%; and / or

[0094] b) less than 0.4%, 0.35%, 0.3%, 0.25%, 0.2%, 0.15%, 0.1%, 0.075%, 0.05%, 0.025%; and / or

[0095] c) between 0.025% and 0.4%, between 0.05% and 0.35%, between 0.075% and 0.3%, between 0.1% and 0.25%, between 0.15% and 0.2%;

[0096] For example, the concentration of Tween is between 0.15% and 0.3%.

[0097] In one embodiment, the agent comprises glycerol at a concentration of 11% or less, optionally wherein the agent comprises less than 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5% or less glycerol. In the same or alternative embodiments, the agent comprises glycerol at a concentration between 0.5% and 11%, between 1% and 10%, between 2% and 9%, between 3% and 8%, between 4% and 7%, or between 5% and 6%. In the same or alternative embodiments, the agent comprises glycerol at a concentration greater than 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or greater than 11%.

[0098] As discussed above, the sample is heated to at least 70°C in the presence of one or more polymerases. Heating microorganisms such as bacteria is known to destroy the bacteria and bring nucleic acid into close proximity with components required for amplification, such as polymerases and primers. Heating viruses is also known to bring nucleic acid into close proximity with nucleic acid stains (Tr) and destroy and neutralize viruses. TMThe protein conformation of the viral capsid is altered (Walter et al. 2012 J Virol Methods – PaSTRy Methods). The Tr described in Walter et al. 2012 is a temperature lower than the Tm. Although Tr is related to both viral inactivation and the accessibility of nucleic acids to nucleic acid stains, the present inventors have determined that heating the virus to this lower Tr temperature is insufficient to render viral nucleic acid amplifiable. In fact, even if the virus is heated to the Tm, the temperature at which the viral proteins change conformation (the capsid denaturation temperature) is insufficient to permit nucleic acid amplification. The present inventors have demonstrated that viral nucleic acid can only be amplified when the virus is heated to the viral Tm in the presence of detergents and solvents such as Tween and glycerol.

[0099] It will be appreciated that heating the sample in the presence of a polymerase is not a typical approach since most RNA-dependent DNA polymerases are denatured at temperatures above 70°C. Thus, the present invention requires a thermostable RNA-dependent DNA polymerase where such activity is desired. Examples of such enzymes are provided herein.

[0100] The inventors have found that for all viruses tested to date, the Tm (capsid denaturation temperature) of each individual virus is in the range of 76°C-81°C. However, certain viruses or microorganisms will require higher temperatures. Since the reagents of the present invention are believed to be protective for any DNA or RNA, it is believed that the use of higher temperatures is appropriate, especially when dealing with viruses or microorganisms that have not yet been used with the method and have not yet been optimized. However, the skilled person will understand that lower temperatures should be used to maintain nucleic acid and polymerase activity where possible. Alternatively, heating to a higher temperature means that a shorter heating duration can be used. In some embodiments, it is preferred to keep the heating duration short, even if this means using a higher temperature.

[0101] Sample is heated to 70 ℃ or higher and is thought to make at least some target viruses or microorganism nucleic acid in target virus or microorganism nucleic acid become amplifiable, for example become accessible polymerase and other amplification components, although 70 ℃ may not be best.Technician will know how to optimize temperature, for example, by repeatedly carrying out method of the present invention as discussed herein in some different temperatures by using the appropriate range.Yet, in a preferred embodiment, sample is heated to 93-95 ℃, because this is applicable to all samples and does not need to optimize.Technician will understand that, although for given sample type and virus / microorganism, will have between accessible nucleic acid and nucleic acid degradation, optimal temperature and the heating duration that provide best balance.

[0102] Heating to 95°C also has the advantage that although lower temperatures may make the nucleic acid accessible to amplification components, in some cases the nucleic acid will have secondary structure that prevents amplification. Heating to approximately 95°C ensures that any secondary structure in the nucleic acid is removed.

[0103] The applicants have observed that the Tm point—the point at which viral or microbial nucleic acids become accessible to the amplification components—can be lowered by adding solvents / detergents to the amplification reagent mixture. Numerous solvent-detergent combinations are commercially used for viral inactivation, although these have been found to be largely incompatible with many amplification methods. A suitable combination has been found to be 8-11% glycerol and 0.15-1% Tween 20 (optimally, 8-9% glycerol and 0.15-0.3% Tween). For Tween, increasing the percentage added does further lower the Tm point, but the applicants have also observed that higher Tween concentrations (0.4%) lower the hybridization temperature of any primers and probes used in the PCR process, and thus a decrease in PCR efficiency can be observed. Heating alone does not render viral RNA amplifiable, i.e., reaching the Tm point and making the RNA accessible to the intercalating dye, but the RNA cannot be amplified. It requires the correct heat treatment and the correct solvent / detergent mixture concentration. This is believed to be because the glycerol and Tween combination aids in the denaturation of the capsid proteins and ensures that no lipids or proteins remain associated with the released RNA, allowing it to be amplified by the polymerase.

[0104] A preferred set of reaction conditions is as follows: 50 mM bicine, 3.4 mM MgCl2, 115 mM potassium acetate, 8% glycerol, 0.2% Tween, pH 8.2 at 25°C. A range of MgCl2 concentrations from 2.5-4 mM MgCl2 produced amplicons, but 3.4 mM MgCl2 was optimal.

[0105] In one embodiment, the sample is heated to:

[0106] a) between about 70°C-100°C, optionally between 72°C and 98°C, between 74°C and 96°C, between 76°C and 94°C, between 78°C and 92°C, between 80°C and 90°C, between 82°C and 88°C or between 84°C and 86°C; and / or

[0107] b) at least 72°C, 74°C, 76°C, 78°C, 80°C, 82°C, 84°C, 96°C, 88°C, 90°C, 92°C, 94°C, 95°C, 96°C, 97°C, 98°C, 99°C, 100°C or greater.

[0108] In some embodiments, the sample is heated to between about 76° C. and 81° C., particularly in embodiments where the target nucleic acid in the sample is viral nucleic acid and the sample is suspected of containing viral particles. For example, the sample can be heated to at least 76.0° C., 76.5° C., 77.0° C., 77.5° C., 78.0° C., 78.5° C., 79.0° C., 79.5° C., 80.5° C., 81.0° C., or 81.5° C.

[0109] In other embodiments, such as particularly where the Tm (capsid denaturation) temperature of the virus has not been determined, the sample is heated to approximately 93-95°C for a period of 1-5 seconds.

[0110] In some embodiments, for example where the sample is a microorganism such as bacteria or fungi, the sample is heated to 90-95°C for, for example, 30 to 60 seconds.

[0111] The skilled artisan will appreciate that heating a sample comprising RNA (e.g., viral RNA) to 95°C is not a typical approach, as the RNA will be degraded using prior art methods. Similarly, heating RNA to 95°C in the presence of an RNA-dependent DNA polymerase is not a typical approach, as the polymerase will be degraded.

[0112] Thus, in one embodiment, the sample includes or is expected to include viral RNA or the target nucleic acid is viral RNA, and the polymerase has RNA-dependent DNA polymerase activity, and the sample is heated to above 90°C, for example to 95°C, for 1, 2, 3, 4 or 5 seconds.

[0113] The sample can be heated to the desired temperature for any length of time. However, and as mentioned above, the skilled artisan will appreciate that when working with nucleic acids, it is preferable to minimize exposure to high temperatures. Thus, in one embodiment, the sample is heated to the desired temperature for:

[0114] a) between 0.5 seconds and 5 seconds, between 1 second and 4.5 seconds, between 1.5 seconds and 4 seconds, between 2 seconds and 3.5 seconds or between 2.5 seconds and 3 seconds; and / or

[0115] b) at least 0.5 seconds, 1 second, 1.5 seconds, 2 seconds, 2.5 seconds, 3 seconds, 3.5 seconds, 4 seconds, 4.5 seconds, or at least 5 seconds; and / or

[0116] c) less than 5 seconds, 4.5 seconds, 4 seconds, 3.5 seconds, 3 seconds, 2.5 seconds, 2 seconds, 1.5 seconds, 1 second, 0.5 seconds, 0.25 seconds.

[0117] In a preferred embodiment, the sample is heated to the desired temperature for approximately 1 second, such as between 0.5 and 1.5 seconds.

[0118] In particularly preferred embodiments, for example where the target nucleic acid is viral RNA, the sample is heated to between approximately 74°C and 84°C, for example for approximately 1 second, for example between 0.5 seconds and 1.5 seconds; or to 95°C for approximately 1 second, for example between 0.5 seconds and 1.5 seconds.

[0119] An additional problem is the thermal stability of the released RNA itself, which degrades in the presence of alkaline solutions containing divalent cations (non-enzymatic RNA hydrolysis promoted by the combined catalytic activity of the buffer and magnesium ions). Therefore, if the process described herein is used with a standard Taq polymerase buffer based on Tris and 4M MgCl2, the released RNA will degrade rapidly and render the target pathogen RNA unamplifiable. To overcome this problem, the applicants have developed a buffer whose pH is essentially neutral at the capsid Tm temperature and which becomes neutral above these temperatures. Furthermore, the system buffers divalent cations (free metal ions consumed by "Good's" buffers, R Nakon, CR Krishnamoorthy, Science, August 19, 1983: Vol. 221, No. 4612, pp. 749-750), so that the free concentration is minimized based on bicine and tricine - a typical formulation might be 50 mM bicine / tricine, 3.4 mM MgCl2, 115 mM potassium acetate and adjusted to pH 8.2 at 25°C. This buffer is essentially neutral at the Tm (denaturation point of the capsid) and thus there will be no excess hydroxide ions to attack the RNA, but the pH will meet the physiological requirements of the enzymes in the reverse transcription / amplification step, pH 7.4-7.6.

[0120] In some embodiments, the reagent is advantageously at a neutral pH, e.g., pH 6.5-7.5, at a temperature between approximately 70°C-100°C, e.g., between 72°C and 98°C, between 74°C and 96°C, between 76°C and 94°C, between 78°C and 92°C, between 80°C and 90°C, between 82°C and 88°C, or between 84°C and 86°C; e.g., wherein the reagent has a pH of 7 at a temperature of 95°C.

[0121] In some embodiments, the reagent further comprises one or more divalent cations. Polymerases generally require metal ions to be active, and each enzyme may require different cofactors. For example, DNA-dependent DNA polymerases generally require Mg cations, while the RNA-dependent DNA polymerase activity of some polymerases requires Mn cations. Therefore, in some embodiments, the reagent comprises one or more divalent cations. Technicians are well versed in determining which cofactors are required for which polymerase to use.

[0122] Should be understood that if some or all of the components of reagent are freeze-dried and supplied, then it may be advantageous. For example, because the present invention is particularly suitable for use based on the field in hot areas that are difficult to obtain refrigeration, the freeze-dried components are supplied to reduce the degradation of components. Therefore, in some embodiments, the container can include freeze-dried components, such as polymerase. Freeze-dried components can also be supplied in a large amount. In the same or other embodiments, the freeze-dried components can be resuspended in "resuspended" reagents, and the resuspended reagents include those components that can not be freeze-dried and supplied. In a preferred embodiment, before the sample is added to the container, the freeze-dried components are resuspended in resuspension buffer and are placed in the container (if the freeze-dried components are not yet supplied in the container). The lid is then sealed and does not need to be opened again. Once amplification and detection have been carried out, sample and container can be safely destroyed.

[0123] Finally, after any lyophilized components are resuspended in a resuspension reagent, all the components necessary for the subsequent amplification reaction, including the polymerase, are present. The sample is then added before being heated to at least 70° C. For example, the resuspension buffer can be composed of glycerol, Tweem 20, and water, as well as some salts such as magnesium chloride. An agent such as sodium azide can be added to this resuspension buffer to prevent microbial growth, although other antimicrobial agents are known in the art.

[0124] As discussed, viruses or microorganisms can include target nucleic acids that are DNA or RNA. The skilled person will understand that, for example, in order to amplify DNA by a PCR reaction, a single polymerase activity is required, i.e., a DNA-dependent DNA polymerase. The skilled person will understand that there are many commercially available DNA-dependent DNA polymerases, such as Taq polymerase, Vent polymerase, KOD, Tli.

[0125] The skilled person also understands that when the template target nucleic acid is RNA, in order to amplify the RNA, it must first be converted into cDNA using an RNA-dependent RNA polymerase. Known RNA-dependent polymerases include Bioneer Rocketscript, superscript, AMV, MMULV, FIV, etc.

[0126] Reverse transcription is performed by an RNA-dependent DNA polymerase, and the resulting cDNA is then amplified by a DNA-dependent DNA polymerase. Thus, in some cases, the reagent may include more than one polymerase, and may, for example, include an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase. As described above, a thermostable polymerase is required to withstand the high temperatures associated with sample preparation and downstream amplification processes.

[0127] However, preferably, where the template target nucleic acid is RNA, a single polymerase is present in the reagents, said single polymerase being capable of performing both RNA-dependent DNA polymerase function and DNA-dependent DNA polymerase function.

[0128] Therefore, in one embodiment, the reagent includes at least two different polymerases as described above. Other combinations of enzymes are also envisioned, for example, the reagent can include a polymerase with RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity, but the reagent can also include another polymerase with DNA-dependent DNA polymerase activity, which is considered to increase the fluorescence yield obtained during / after the amplification period. These can be included in a ratio of, for example, 1:1, 2:1, or 3:1 to facilitate any polymerase. Suitable DNA polymerases include KOD, Tli, hemoTaq, Kapa blood, Phusion, and TTH.

[0129] In the same or another embodiment, the polymerase has RNA-dependent DNA polymerase activity and does not have DNA-dependent DNA polymerase activity, eg, the polymerase is Bioneer Rocketscript.

[0130] The polymerase should be one in which RNA-dependent DNA polymerase activity and / or DNA-dependent DNA polymerase activity can be transiently maintained at the temperature to which the sample is heated (eg, at a temperature that renders nucleic acids, such as viral nucleic acids, accessible to amplification components).

[0131] In the same or another embodiment, the polymerase has DNA-dependent DNA polymerase activity and does not have RNA-dependent DNA polymerase activity.

[0132] In yet further embodiments, the reagents include a polymerase having RNA-dependent DNA polymerase activity but not DNA-dependent DNA polymerase activity, and further include a separate polymerase having DNA-dependent DNA polymerase activity but not RNA-dependent DNA polymerase activity.

[0133] In preferred embodiments, the polymerase has DNA-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity, or both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity, optionally wherein the polymerase is selected from the group consisting of:

[0134] a) TTH polymerase (Promega) [SEQ ID NO: 3]

[0135] b) Hawk Z05 (Roche), [SEQ ID NO: 4]

[0136] c) Polymerase described in WO 2014 / 023318

[0137] d) a polymerase having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F;

[0138] e) a polymerase having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the M1 / M747K enzyme [SEQ ID NO: 2].

[0139] Preferred enzymes have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F; or are identical to the M1 / M747K enzyme [SEQ ID NO:2] polymerases having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity; because some of these enzymes are believed to be more tolerant to the presence of blood during amplification than Hawkz05 and better at reverse transcription than TTH. Amplification data generated by such enzymes are provided in the Examples.

[0140] It is also preferred if one or more polymerases are naturally resistant to, or have been engineered to be resistant to, inhibitors found in some samples such as blood. For example, the enzyme TTH is thought to be naturally resistant to inhibitors present in blood (Scientific Reports, Vol. 8, Article No. 3410 (2018)). Certain enzymes having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F; or an enzyme having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the M1 / M747K enzyme [SEQ ID NO: 2] are considered to be resistant to inhibitors found in blood.

[0141] SEQ ID NO: 1 refers to the amino acid sequence of Thermus aquaticus polymerase:

[0142]

[0143] SEQ I NO: 2 refers to the M1 polymerase with an M747K substitution as described in WO 2014 / 023318:

[0144]

[0145] SEQ ID NO: 3 refers to the TTH polymerase sequence:

[0146]

[0147] SEQ ID NO: 4 refers to the HawkZ05 polymerase sequence:

[0148]

[0149]

[0150] It will be understood that where the method of preparing a sample and subsequent amplification and detection of the product is to be a "closed tube", i.e., once the sample and materials required for amplification and detection are placed within the container, the container is closed and not opened again, and a polymerase is present therein such that both RNA-dependent DNA polymerase and DNA-dependent DNA polymerase activities are present (either because at least two different polymerases are present in the container, one having RNA-dependent DNA polymerase activity and the other having DNA-dependent DNA polymerase activity; or a single polymerase having both activities is present therein; or a single enzyme having both activities is present therein and at least one additional enzyme having either DNA-dependent DNA polymerase activity or RNA-dependent DNA polymerase activity is present), it is preferred that the RNA-dependent DNA polymerase activity does not require a co-factor for an inhibitor of DNA-dependent DNA polymerase activity, and / or the DNA-dependent DNA polymerase activity does not require a co-factor for an inhibitor of RNA-dependent DNA polymerase activity.

[0151] In a preferred embodiment, both the RNA-dependent DNA polymerase activity and the DNA-dependent DNA polymerase activity require magnesium cations as a cofactor. It will be clear to the skilled person that where the target nucleic acid is RNA, for example where the virus is an RNA virus, it is preferred if the polymerase has RNA-dependent DNA polymerase activity, or for example has both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity.

[0152] As discussed above, sample can be any sample type, but is preferably a thick sample.Sample can be any volume and can have any relative volume relative to the combined volume of sample and reagent.But present method is considered to be suitable for high relative volume sample, for example in one embodiment, sample accounts for at least 5% of the cumulative volume of sample and reagent, for example at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% or higher; Optionally account for 13% of the cumulative volume of sample and reagent.

[0153] As described in the Examples, where the sample is blood or serum, a preferred concentration is about 12-16% blood or serum. Without wishing to be bound by any theory, molecular crowding at such concentrations is believed to increase the efficiency of the amplification reaction.

[0154] In this way, sufficiently large sample can be used, for example thick sample, for example whole blood, but still amplify and detect with small volume.For example, in some embodiments, the volume of sample (for example thick sample, for example whole blood) is less than 100ul, for example, less than 90ul, 80ul, 70ul, 60ul, 50ul, 40ul, 30ul, 20ul, 15ul, 12ul, 10ul, 5ul, 4ul, 3ul, 2ul, 1ul, 0.5ul.The risk of being exposed to virus or microorganism can be reduced using the sample of small volume.For example, sample volume can be between 0.5ul and 100ul, for example, between 1ul and 90ul, for example, between 2ul and 80ul, between 3ul and 70ul, between 4ul and 60ul, between 5ul and 50ul, between 10ul and 40ul, between 15ul and 30ul or be 20ul.In some preferred embodiments, thick sample is 5ul, 10ul, 12ul, 15ul or 20ul.

[0155] The total volume of the sample and reagent in the container can be between 10ul and 500ul, between 20ul and 450ul, between 30ul and 400ul, between 40ul and 350ul, between 50ul and 300ul, between 60ul and 250ul, between 70ul and 200ul, between 80ul and 150ul, between 90ul and 140ul, between 100ul and 130ul, between 110ul and 120ul. For example, the total volume can be less than 500ul, 400ul, 300ul, 200ul, 100ul, 90ul, 80ul, 70ul, 60ul, 50ul, 40ul, 30ul, 20ul or 10ul. In some preferred embodiments, the total reaction volume is 50ul, 60ul, 70ul, 80ul, 90ul, 62ul, 72ul, 82ul, 92ul, 102ul, 75ul, 85ul, 95ul, 105ul, 110ul.

[0156] Thus, in some embodiments:

[0157] a) Volume of sample in the container

[0158] i) less than 100ul, for example, less than 90ul, 80ul, 70ul, 60ul, 50ul, 40ul, 30ul, 20ul, 15ul, 10ul, 5ul, 4ul, 3ul, 2ul, 1ul, 0.5ul; and / or

[0159] ii) between 0.5ul and 100ul, such as between 1ul and 90ul, such as between 2ul and 80ul, between 3ul and 70ul, between 4ul and 60ul, between 5ul and 50ul, between 10ul and 40ul, between 15ul and 30ul or 20ul; and / or

[0160] b) The total volume of sample and reagent in the container can be between

[0161] i) between 10ul and 500ul, between 20ul and 450ul, between 30ul and 400ul, between 40ul and 350ul, between 50ul and 300ul, between 60ul and 250ul, between 70ul and 200ul, between 80ul and 150ul, between 90ul and 140ul, between 100ul and 130ul, between 110ul and 120ul; and / or

[0162] ii) can be less than 500ul, 400ul, 300ul, 200ul, 100ul, 90ul, 80ul, 70ul, 60ul, 50ul, 40ul, 30ul, 20ul or 10ul.

[0163] In some preferred embodiments, the volume of the sample is 10ul and the total volume of the sample and reagents in the container is 60ul, 70ul, 80ul or 90ul, or the volume of the sample is 12ul and the total volume of the sample and reagents in the container is 62ul, 72ul, 82ul, 92ul, 102ul, or the volume of the sample is 15ul and the total volume is 75ul, 85ul, 95ul or 105ul.

[0164] As described above, in some embodiments, the method is field-based and suitable for use in the field. Field use includes the meaning of use in a non-standard laboratory environment. In one embodiment, field use means use in an environment where electricity is limited or can only be powered by batteries. In the same or different embodiments, field use includes the following meanings: wherein, given the nature of the substance with which the container will be used, no suitable safety equipment is provided to the clinician, laboratory scientist, or other person handling the container. For example, in some embodiments, the container will be used to detect highly pathogenic viruses and bacteria and will typically be used to hold samples from a subject or, in some cases, environmental samples such as for field use, the person handling the container may only be equipped with very basic safety equipment. It also includes the following meanings: the method is low-cost, simple, and biosafe, requiring minimal exposure to the sample and once the sample is added to the container, the container cannot be opened again. It also includes the following meanings: the method can be carried out using minimal energy, such as electrical energy, and does not require freezing or centrifuging the sample, and does not require amplification or the need for refrigerated or frozen reagent components.

[0165] In a preferred embodiment, the sample is obtained directly from the subject and placed directly into the container along with the reagents.

[0166] In some embodiments, particularly where the sample comprises blood or whole blood, the reagent includes an agent that aids in blood clotting. As discussed above, the presence of blood interferes with fluorescence detection of the amplified product and inhibits amplification itself due to the presence of PCR inhibitors. The inventors have discovered that if blood clots, it will sink relatively quickly to the bottom of the container, for example, during the time course of the amplification reaction. While clotted blood can be used to provide viral or microbial nucleic acids to the container, it is less able to leach amplification inhibitors.

[0167] As will be apparent from the above, the present invention provides a method for preparing a sample for the direct amplification of microbial or viral nucleic acids present.

[0168] Therefore, it can be concluded that the present invention also provides a method for amplifying microbial or viral nucleic acid present in a sample obtained from a subject, wherein the sample is prepared according to the method of the present invention. The preferences given for the characteristics of the method for preparing the sample apply throughout this specification, for example, to the amplification method. For example, the preferences given above for sample type, volume, reagent components, temperature, polymerase, etc., apply to the amplification method.

[0169] In one embodiment, amplification is performed using PCR or q-PCR. In some embodiments, amplification involves a reverse transcription step prior to PCR, such as reverse transcription PCR (RT-PCR), such as real-time reverse transcription PCR (RT-qPCR).

[0170] The present inventors unexpectedly discovered that when the target nucleic acid is RNA, such as viral RNA, it is possible and beneficial to perform more than one reverse transcriptase cycle, and this is particularly beneficial when the RNA abundance is low. For example, reverse transcription is typically only 10-20% efficient (Miranda JA; Steward GF, "Variables influencing the efficiency and interpretation of reverse transcription quantitative PCR (RT-qPCR): An empirical study using Bacteriophage MS2". Journal of Virological Methods. 2017; 241: 1-10), so when the number of RNA copies is expected to be less than 100 copies per reaction, multiple rounds of reverse transcription are considered to be particularly beneficial.

[0171] In this way, reverse transcription of RNA to cDNA is repeated, and the sample needs to be heated to a sufficiently high temperature to separate the resulting cDNA hybrid strands, for example, to 95° C. The skilled person will understand that this embodiment requires a polymerase that can withstand heating to 95° C.

[0172] While other apparent periodic RT methods have been reported (e.g., Bioneer WO 2008115002), those methods have never achieved denaturation temperatures for cDNA. It is well known that the melting point of DNA / RNA hybrids is higher than that of the corresponding DNA, so if the amplicon length exceeds 80 bp, any reaction must be heated to over 94°C to reliably denature the resulting hybrid. This means that the highest temperatures described in the publication will not denature the hybrid, and therefore the cDNA molecules produced will never exceed the number of RNA molecules present. BioRad describes a method in WO 2014138688 that performs at least two rounds of reverse transcription, but this describes a compartmentalized reaction strategy in which each sample is broken down into multiple nanoliter reactions, each of which theoretically reacts with a single target per reaction. This is a major difference, as it requires extracted nucleic acid, and there may not be enough pathogens per nanoliter in a crude sample for this method to work, and it specifically requires compartmentalized reactions. Essentially, this is a method that ensures successful transcription of a single target in each partition, in contrast to the methods described herein that are designed to produce more cDNA molecules than the number of RNA originally present. This preamplification is key to maximizing sensitivity when very low amounts of target are expected in the reaction.

[0173] The method can involve any number of reverse transcription cycles. A reverse transcription cycle involves allowing the RNA-dependent DNA polymerase activity of a suitable enzyme to reverse transcribe the RNA into a DNA strand. A second cycle will require heating the sample to a threshold temperature at which the RNA:DNA hybrid dissociates, allowing the polymerase to access the RNA. The temperature is then lowered to the extension temperature, and a second DNA strand is generated from the same template RNA molecule.

[0174] In some embodiments, amplification involves more than one reverse transcription step, i.e., involves repetitive reverse transcription, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 cycles of reverse transcription prior to PCR.

[0175] In some embodiments, the reverse primer that drives reverse transcription is the same as the reverse primer that drives PCR.

[0176] In this case, the applicant has found further improvement, i.e., manipulates the melting point of the primer driving reverse transcription, so that RT can be separated from PCR or both performances are maximized. If the Tm of the primer driving reverse transcription (i.e., 50% primer is bound to the point on the expected target) is separated from the Tm of its DNA, the applicant has proved that reaction can be only biased towards reverse transcription, that is, reaction can be carried out at a temperature only forming cDNA and PCR reaction can not be started, because reverse transcription is carried out at too high a temperature, so that primer is combined with any DNA in the reaction. A kind of such modification is that locked nucleic acid is incorporated into reverse primer sequence (" locked nucleic acid increases sensitivity and performance (Lockednucleic acids in PCR primers increase sensitivity and performance) ". " Genomics (Genomics) ", ISSN:1089-8646, volume 91, phase 3, page 301-5,2008), the RNA molecule of modification disproportionately increases the Tm of RNA template and therefore makes reaction biased towards the generation of cDNA. For example, the sequence GAGTAGGAG{T}{T}{T}GTGAAAGTGTC (where the brackets indicate LNA modification) has a Tm of 64°C for DNA, while the Tm of RNA is 78°C. Therefore, reverse transcription can be performed at, for example, 75°C without generating PCR products. Therefore, reproducible reverse transcription is characterized by a reverse primer Tm at least 9°C higher than the Tm of its corresponding DNA target, and reverse transcription can be performed at 6°C or greater (for DNA). At this point, less than 1% of the primers will bind to the DNA target, resulting in significant reverse transcription. Therefore, this pre-amplification step is crucial for this method, as when a patient is infected at 3,000 virions / ml, infected blood contains only 3 targets per microliter. Standard RT-QPCR requires the presence of dozens of copies before the reaction can begin, so this pre-amplification step is essential to improve diagnostic sensitivity.

[0177] Primers that drive repetitive reverse transcription and PCR can be designed to a) separate reverse transcription from PCR based on temperature; or b) allow reverse transcription and PCR to be performed simultaneously.

[0178] In some embodiments, the melting point of the reverse primer driving reverse transcription is different from the melting point of the forward primer driving PCR, so that, depending on the temperature of the reaction, a) reverse transcription is performed, b) PCR is performed, or c) both reverse transcription and PCR are performed simultaneously. If the Tm of the DNA of the forward primer differs by more than 6°C from the Tm of the RNA target of the reverse primer, efficient reverse transcription can be performed while preventing PCR from occurring.

[0179] In a preferred embodiment, the melting point difference between the primers is about 5-6°C.

[0180] The skilled artisan will understand that the Tm of a primer, RNA or DNA, is primarily driven by the GC content of the sequence.

[0181] In some embodiments, the temperature of the reverse transcription reaction exceeds the melting temperature of the DNA / RNA hybrid.

[0182] In some embodiments, one or more primers include one or more LNA, ZNA, and / or BNA modifications, for example, in some embodiments, the reverse primer includes one or more LNA, ZNA, and / or BNA modifications. One or more primers may also or alternatively include one or more LNA, ZNA, and / or BNA modifications.

[0183] It will be appreciated by those skilled in the art that amplification such as PCR or RT-PCR or RT-qPCR can be used to produce the amplicon of multiple length (for example 20bp to 5,000bp).But, for current purpose, i.e. disease diagnosis, preferably shorter amplicon, because the amplified reaction needed is shorter, this means that diagnostic result can be obtained faster.Therefore, in certain embodiments, amplification produces amplicon, the length of described amplicon is between 40bp and 500bp, for example, between 50bp and 450bp, for example, between 60bp and 400bp, for example, between 70bp and 350bp, for example, between 80bp and 300bp, for example, between 90bp and 250bp, for example, between 100bp and 200bp, for example, about 150bp.Preferably, the size of gained amplicon is 60bp to 100bp.

[0184] As discussed above, for example, for biosafety reasons, it is advantageous to perform the amplification reaction in the same container to which the sample has been added and in which the sample has been prepared. Thus, in one embodiment, the amplification reaction is performed in the same container in which the sample was prepared according to the method for preparing a sample according to the present invention.

[0185] In another embodiment, once the sample and reagents are in the container, the container is sealed and not opened throughout the amplification reaction.

[0186] In the same or different embodiments, once the sample and reagents are in the container, no portion of the sample or reagents is removed from the container:

[0187] a) prior to said heating; and / or

[0188] b) after said heating;

[0189] c) before RT; and / or

[0190] d) before PCR; and / or

[0191] e) during the RT period; and / or

[0192] f) during PCR; and / or

[0193] g) after RT; and / or

[0194] h) After PCR.

[0195] In some embodiments, the method is a closed tube method for amplifying nucleic acids. A skilled artisan will understand the meaning of a closed tube method and generally requires that once the sample is added to the container along with any necessary components for the preparation method or downstream amplification and detection steps, the container is closed, for example by closing or sealing a lid to the container, and the lid or cover is not opened again. For example, in some embodiments of the closed tube method, no additional materials are added or removed from the container, for example, the nucleic acid is not extracted or purified in any way.

[0196] It will be understood by those skilled in the art that amplification (e.g., PCR) is performed using at least a forward primer and a reverse primer. In some cases, such as qPCR or RT-qPCR, primers may be labeled with a suitable fluorophore or other dye that allows detection of the amplicon. The reaction may also use a probe, such as a fluorescently labeled probe.

[0197] In the case where the sample is blood and the blood seeps out of the light path, or for samples other than blood, the collection wavelength range of suitable fluorophores spans from FAM at 500 nm to alexa fluor 680 at 750 nm, and encompasses any fluorophore known in the art, such as TET, HEX, Cy5. In the case of non-sinking (or centrifugation), blood samples require far-red dyes, including Cy5; alexa fluor 657, 680, 594; pulsar 650; quasar 670; CY5.5; quasar 705, and other dyes emitting between 630 nm and 750 nm.

[0198] Because in preferred embodiments the sample is not disturbed once added to the container, in some embodiments the sample and reagents are not manipulated between the reverse transcription step and the PCR step. [One-Step RT-PCR]

[0199] The skilled person will appreciate that in addition to providing a method for preparing a sample for amplification and a method for providing amplification, the present invention also provides a method for detecting the presence of microorganisms or viral particles in a sample obtained from a subject, wherein the sample has been prepared according to the invention and / or wherein nucleic acid from the microorganism or viral particle has been amplified according to the invention, and the amplified nucleic acid is subsequently detected.

[0200] As described above, in some embodiments, amplification produces a fluorescent signal corresponding to the number of amplicons. For example, fluorescently labeled primers can be incorporated into the amplicons, or fluorescently labeled probes can be used to quantify the amount of prepared amplicons or the presence of amplicons. Technicians are aware of quantitative PCR (qPCR / RT-qPCR) and available options for performing the reaction and detecting amplicons.

[0201] In some embodiments, such as when fluorescently labeled dyes / primers have been used in the reaction, amplicons are detected spectrophotometrically.

[0202] The skilled person will understand that a spectrophotometer can capture all emitted light, for example between 300-900 nm, and can then use filters that allow it to be viewed within a specific range (for example in two windows of 510-580 nm and 655-750 nm). This means that any dye falling within these wavelength ranges can be used without the need for calibration samples or calculations for spectral overlap or any other problems with normal optical systems.

[0203] Thus, in one embodiment, amplicons are labeled during amplification with one or more fluorescently labeled primers or one or more probes and the resulting fluorescence is detected using a spectrophotometer that captures all light between 300-900 nm using two windows of 510-580 nm and 655-750 nm.

[0204] For non-pathogenic viruses or microorganisms, or pathogenic viruses or microorganisms not considered dangerous, the closed tube embodiments of the present invention are considered less important and therefore other means of detecting amplicons such as electrophoresis can be used, and / or the amplicons can be sequenced for epidemiological studies.

[0205] The present invention also provides a reagent for use in any method of the present invention, such as for sample preparation and / or for use in the amplification method of the present invention, and / or for use in the detection method according to the present invention, wherein the reagent comprises a detergent, a solvent and one or more nucleic acid polymerases.

[0206] Preferences for features of this aspect of the invention are as defined elsewhere herein, for example preferences for solvents, detergents, polymerases, concentrations of each component, pH, etc. are as defined herein.

[0207] As discussed above, in some embodiments, the agent minimizes RNA degradation.

[0208] As also discussed above, in some embodiments, the reagent does not include Tris.

[0209] The reagent may include bicine, for example, may include bicine at a concentration of between 20mM and 70mM, such as between 25mM and 65mM, such as between 30mM and 60mM, such as between 35mM and 55mM, such as between 40mM and 50mM, such as approximately 50mM Bicine.

[0210] In preferred embodiments, the reagent buffers divalent cations.

[0211] In some embodiments, the solvent is glycerol and / or the detergent is Tween, e.g., Tween 20. In particular embodiments, the reagent comprises Tween, e.g., Tween 20 at a concentration of up to 0.4%, and / or comprises glycerol at a concentration of up to 11%, e.g., wherein the reagent comprises 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5% or less glycerol.

[0212] As described above, the reagents include one or more polymerases. In some embodiments, the reagents include at least two different polymerases.

[0213] For example, in one embodiment, the polymerase has DNA-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity, or both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity, optionally wherein the polymerase is selected from the group consisting of:

[0214] a) TTH polymerase (Promega) [SEQ ID NO: 3]

[0215] b) Hawk Z05 (Roche), [SEQ ID NO: 4]

[0216] c) Polymerase described in WO 2014 / 023318

[0217] d) a polymerase having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F;

[0218] e) a polymerase having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the M1 / M747K enzyme [SEQ ID NO: 2].

[0219] Preferred enzymes have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F; or are identical to the M1 / M747K enzyme [SEQ ID NO:2] polymerases having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity; because some of these enzymes are believed to be more tolerant to the presence of blood during amplification than Hawkz05 and better at reverse transcription than TTH. Amplification data generated by such enzymes are provided in the Examples.

[0220] It is also preferred if one or more polymerases are naturally resistant to, or have been engineered to be resistant to, inhibitors found in some samples such as blood. For example, the enzyme TTH is thought to be naturally resistant to inhibitors present in blood. Certain enzymes having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, 3, 4, optionally wherein the polymerase comprises 1, 2, 3, 4, 5, 6, 7 or 8 of the following mutations relative to SEQ ID NO: 1, 2, 3 or 4: S515R, I638F, M747K, L322M, L459M, S739G, E773G and L789F; or an enzyme having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the M1 / M747K enzyme [SEQ ID NO: 2] are considered to be resistant to inhibitors found in blood.

[0221] The reagents may further include a first polymerase having RNA-dependent DNA polymerase activity and a second polymerase having DNA-dependent DNA polymerase activity.

[0222] The reagents may further include a first polymerase having RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity and a second polymerase having DNA-dependent DNA polymerase activity.

[0223] In either case, the reagents can include a ratio of the first polymerase to the second polymerase of 1:1 to 5:1, for example, can include a ratio of the first polymerase to the second polymerase of at least 1:1, 1:2, 1:3, 1:4, or at least 1:5.

[0224] The reagents can also include a ratio of the second polymerase to the first polymerase between 1:1 and 5:1, for example, can include a ratio of the first polymerase to the second polymerase of at least 1:1, 1:2, 1:3, 1:4, or at least 1:5.

[0225] For example, the reagent may include a first polymerase having RNA-dependent DNA polymerase activity and a second polymerase having DNA-dependent DNA polymerase activity, wherein the ratio of the first polymerase to the second polymerase is between 1:1 and 5:1, for example, the ratio of the first polymerase to the second polymerase may be at least 1:1, 1:2, 1:3, 1:4 or at least 1:5; or wherein the ratio of the second polymerase to the first polymerase is between 1:1 and 5:1, for example, the ratio of the first polymerase to the second polymerase may be at least 1:1, 1:2, 1:3, 1:4, or at least 1:5.

[0226] In another example, the reagent may include a first polymerase having RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity and a second polymerase having DNA-dependent DNA polymerase activity, wherein the ratio of the first polymerase to the second polymerase is between 1:1 and 5:1, for example, the ratio of the first polymerase to the second polymerase may be at least 1:1, 1:2, 1:3, 1:4 or at least 1:5; or wherein the ratio of the second polymerase to the first polymerase is between 1:1 and 5:1, for example, the ratio of the first polymerase to the second polymerase may be at least 1:1, 1:2, 1:3, 1:4 or at least 1:5.

[0227] The reagents may include 1, 2, 3, 4, 5 or more polymerases having the same or different activities.

[0228] Further, in some embodiments, the reagent includes an agent that assists blood clotting. Preferences for agents that assist blood clotting are described elsewhere herein.

[0229] It will be appreciated that since, in some embodiments, the amplification reaction is a closed tube biosafe reaction, the reagents should include all components necessary for amplification and subsequent detection, thereby blocking the sample itself. Thus, in one embodiment, the reagents include the components necessary for PCR and / or RT-PCR and / or RT-qPCR, and may include, for example:

[0230] one or more primers, such as one or more fluorophore-labeled primers; and / or

[0231] one or more fluorescent dyes;

[0232] Magnesium chloride; BSA; dNTPs; arginine; random RNA, such as yeast RNA; and excipients required to maintain enzyme activity during lyophilization.

[0233] As also described above, some of the components of the reagent can be lyophilized, which has advantages because refrigeration of the lyophilized components is generally not required. Therefore, in one embodiment, one or more of the components of the reagent are in lyophilized form, optionally in a container. In one embodiment, one or more of the components of the reagent are in lyophilized form, optionally in a container, optionally wherein one or more of the polymerase, BSA, one or more primers, one or more probes, or dNTPs are lyophilized, optionally lyophilized together.

[0234] As mentioned above, the inventors have found that carrying out multiple rounds of reverse transcription is possible and useful. Multiple rounds of reverse transcription increase the sensitivity of target nucleic acid amplification and detection, and by using reagent of the present invention to protect sample to a great extent, particularly any RNA in sample is exempted from degradation, which makes it possible. Therefore, the present invention also provides a kind of method for carrying out RT-PCR, wherein said method is included in more than one reverse transcription step before PCR or during it, for example 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 or more than 20 reverse transcription steps. Said method is considered to be independent of other methods of the present invention, but can be used in combination with other methods. Preference to reverse transcriptase and repeatability reverse transcription is as described elsewhere herein.

[0235] As described above, in repetitive RT methods, in some embodiments, the reverse primer driving reverse transcription is the same as the reverse primer driving PCR.

[0236] Further, and as also described above, in some embodiments, the melting point of the reverse primer driving reverse transcription is different from the melting point of either the forward primer or the reverse primer driving PCR, such that, depending on the temperature of the reaction, a) reverse transcription is performed, b) PCR is performed, or c) both reverse transcription and PCR are performed simultaneously. For example, the difference in the melting points of the primers can be about 5°C or more, and the temperature at which reverse transcription is performed is 6°C or more above the TM of the DNA, such that only RT can occur.

[0237] The primer may comprise one or more LNA, ZNA and / or BNZ modifications, optionally wherein the reverse primer comprises one or more LNA, ZNA and / or BNZ modifications.

[0238] In some embodiments, the temperature of the reverse transcription reaction exceeds the melting temperature of the DNA / RNA hybrid.

[0239] Repeatability RT can be used to increase the amplicon of any size.Yet in a preferred embodiment, amplification produces amplicon, the length of described amplicon is between 40bp and 500bp, optionally between 50bp and 450bp, optionally between 60bp and 400bp, optionally between 70bp and 350bp, optionally between 80bp and 300bp, optionally between 90bp and 250bp, optionally between 100bp and 200bp, optionally about 150bp.Amplicon will preferably be in the scope of 60-100bp.

[0240] The present invention also provides a method for determining the temperature at which viral nucleic acid becomes available for amplification, wherein

[0241] a) the method comprises preparing a plurality of samples according to the method of the invention, wherein the plurality of samples are each individually heated to one of a range of different temperatures prior to PCR or RT-PCR, for example wherein a single sample is prepared and heated to one of 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, optionally to 76°C, 77°C, 78°C, 79°C, 80°C, 81°C; and then

[0242] b) amplifying the viral nucleic acid, for example, by a method according to the invention; and then

[0243] c) detecting the amplicon, optionally detecting the amplicon according to the present invention.

[0244] It will be apparent that the methods described herein can be used to determine the presence or absence of a virus or microorganism in a sample and can therefore be used in diagnostic methods. Accordingly, the present invention provides a method for diagnosing the presence or absence of a microbial or viral infection, wherein a sample obtained from a subject is prepared according to the present invention and then:

[0245] a) amplifying viral nucleic acid, for example, by a method according to the invention; and then

[0246] b) detecting the amplicon, for example according to the invention,

[0247] Wherein detecting the presence of the amplicon indicates that the subject is suffering from the microbial or viral infection.

[0248] It will also be clear to the skilled artisan that various aspects and embodiments of the present invention lend themselves to provision as a kit. For example, the present invention provides a kit comprising a detergent, a solvent, and one or more nucleic acid polymerases. Preferences for the detergent, solvent, and one or more polymerases are as defined herein. In some embodiments, the kit further comprises a reaction vessel, for example, a vessel comprising 35 irreversible locks such that once the sample is added and the vessel is sealed, the vessel cannot be opened again. Such vessels are described in PCT / GB2019 / 051156.

[0249] The various components of the kit can be in liquid form or in lyophilized form. A preference for lyophilized components is described herein.

[0250] The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an admission that the document is part of the current state of the art or is common general knowledge.

[0251] Unless the context indicates otherwise, preferences and options for a given aspect, feature or parameter of the invention should be considered to have been disclosed in conjunction with any and all preferences and options for all other aspects, features and parameters of the invention. For example, the invention provides a reagent comprising a polymerase having RNA-dependent DNA polymerase activity and a polymerase having DNA-dependent DNA polymerase activity, 0.3% Tween and 8% glycerol. The invention also provides a method for preparing a sample for amplification of viral nucleic acid, the sample may include a virus, wherein the method comprises heating the sample to 95°C for 1 second in a sealed container in the presence of a polymerase having both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity. The invention also provides a method for diagnosing a subject infected with Ebola virus, wherein the method comprises preparing a 2 ul blood sample taken from the subject for amplification, wherein the preparation step comprises heating the sample to 95°C for 1 second and performing RT-PCR or RT-qPCR directly on the sample, and then detecting the amplicon (if present). BRIEF DESCRIPTION OF THE DRAWINGS

[0252] Figure 1

[0253] A) Shows heating at 85, 87, 89, 91, 93, 95°C for 1 second. B) Shows heating at 71 / 73 / 74 / 76 / 78 / 80°C for 45 seconds. C) Shows heating at 78 / 79 / 80 / 81 / 82°C for 20 seconds. For this virus, 81 / 82 are optimal - but all temperatures do allow viral nucleic acid to be amplified to a similar degree. The assay used was the GP14 assay (Trombley AR, Wachter L, Garrison J, et al. "Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses." Am J Trop Med Hyg. 2010;82(5):954–960. doi:10.4269 / ajtmh.2010.09-0636). The target was 100 virions of the accuplex ZEBOV control (Seracare LLC, catalog number 0505-001). 50 μl rxn, 800 nM F and R primers, 200 nM Cy5-labeled probe, and reagents as described - 50 mM Bicine, pH 8.2, 3.4 mM MgCl2, 0.4 mM dNTPs, 115 mM potassium acetate, 0.1 μg / ul BSA, 0.2% Tween, 8.5% glycerol, 5 units / rxn of enzyme >95% identical to SeqID 2. Thermocycling protocol was 85 / 87 / 89 / 91 / 93 / 95: denaturation at 95°C for 1 second (virus lysis), denaturation at 63°C for 90 seconds (RT step), denaturation at 96°C for 3 seconds (hybrid denaturation), denaturation at 57°C for 45 seconds (PCR), denaturation at 95°C for 3 seconds - repeated 40 times.

[0254] Figure 2 - The method of the present invention is suitable for use with a variety of sample types.

[0255] A) shows the amplification of nucleic acids from 100 virions in serum (0% blood) and at 9% blood and 15% blood. Surprisingly, the preferred amount for blood was 12-16% and the preferred amount for serum was 12-16%.

[0256] B) Direct detection of PPRV virus from cells isolated from lesions of infected animals.

[0257] C) Serial dilution of nasal swabs from pigs infected with PPRV

[0258] D) Direct detection of Ebola pseudoviruses from cerebrospinal fluid

[0259] E) Whole blood spiked with a) Staphylococcus epidermidis or b) Escherichia coli at 1000 bacteria / rxn. This demonstrates that bacterial infection in blood can be detected without nucleic acid extraction, as the method allows amplification of bacterial nucleic acids.

[0260] F) Direct detection of CCHF from viral cultures

[0261] G) Direct detection of Lassa virus from frozen infected patient samples

[0262] For all reactions above, the conditions were as follows: 50 μl rxn, 400-800 nM F and R primers, 120-200 nM Cy5-labeled probe, and reagents as described—50 mM Bicine, pH 8.2, 3.4 mM MgCl2, 0.4 mM dNTPs, 115 mM potassium acetate, 0.1 μg / ul BSA, 0.2% Tween. 8.5% glycerol, 5 units / rxn of enzyme >95% identical to SeqID 2. The thermal cycling protocol was 95°C for 1 second denaturation (viral lysis), 63°C for 90 seconds denaturation (RT step), 96°C for 3 seconds denaturation (hybrid denaturation), 57°C for 45 seconds denaturation (PCR), and 95°C for 3 seconds denaturation—repeated 40 times. All assays were performed in a closed tube format, whereby samples were added directly to the mixture. Experiments E and A were carried out in a container according to the method of PCT / GB2019 / 051156, whereby after the reaction container was sealed, it was subjected to centrifugation at 500 g for 30 seconds in a centrifuge to pull the red blood cells contained therein to the bottom of the container and prepare plasma in which virions could be directly detected. Use appropriate primers and probes, for Ebola virus these are the GP14 assay (Trombley AR, Wachter L, Garrison J, et al. "Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses." Am J Trop Med Hyg. 2010;82(5):954–960. doi:10.4269 / ajtmh.2010.09-0636).For CCHF these were from (Barry Atkinson, John Chamberlain, Christopher H. Logue, Nicola Cook, Christine Bruce, Stuart D. Dowall and Roger Hewson. Vector-Borne and Zoonotic Diseases. September 2012), for PPRV assays from the following publications (“A real time RT-PCR assay for the specific detection of Peste des petits ruminants virus”. Journal of Virological Methods, ISSN: 1879-0984, Vol. 171, No. 2, pp. 401-4: 2011), for Lassa virus assays (Trombley AR, Wachter L, Garrison J et al. “Comprehensive panel of real-time TaqMan polymerase chain reaction assays for the detection and absolute quantification of filoviruses, arenaviruses and New World hantaviruses”. TaqManpolymerase chain reaction assays for detection and absolute quantification offiloviruses,arenaviruses,and New World hantaviruses)". Am J Trop Med Hyg. 2010;82(5):954–960), and finally for Escherichia coli and Staphylococcus epidermidis, the following primers and probes were used:.

[0263] Escherichia coli A2_F2 GTAACGCGCTTTCCCACC

[0264] Escherichia coli A2_R2 TGTGGGCATTCAGTCTGGATC

[0265] Escherichia coli A2_P2 CTGATCAATTCCACAGTTTTCGCG

[0266] Staphylococcus epidermidis_aap_P04-F CTGTTAATGGGTTCTTAGTTGTTGG

[0267] Staphylococcus epidermidis_aap_P04b-R CAAAATATGGTCCAGTTGATGGAGA

[0268] Staphylococcus epidermidis_aap_P04-P GTTGTAATTGTTTTTGTTCCTGGTTCACCT

[0269] Figure 3 - Tween (polysorbate) allows access of amplification components to nucleic acids, resulting in amplification, whereas Triton X does not.

[0270] A) Shown are reactions including no detergent and minimal solvents including 6% glycerol, 0.1% Tween and 6% glycerol, and 0.2% Tween and 6% glycerol.

[0271] B) Reactions with 0.6%, 0.9% and 1.0% Tween are shown.

[0272] C) shows the reaction including 0.2% Tween 20 and 6% glycerol and the reaction including 0.2% Tween 20 and 0% glycerol

[0273] D) shows the reaction including Triton X.

[0274] Figure 4

[0275] A) Data for TTH enzyme - 9% blood with 1000 virions per reaction are shown.

[0276] B) Data for Hawkz305 enzyme are shown - 6% blood, 100 copies per reaction.

[0277] C) shows data for the enzyme with SEQ ID NO: 2.

[0278] A 50 μl reaction, 800 nM F and R primers, 200 nM Cy5-labeled probe, and reagents as described—50 mM Bicine, pH 8.2, 3.4 mM MgCl2, 0.4 mM dNTPs, 115 mM potassium acetate, 0.1 μg / ul BSA, 0.2% Tween. 8.5% glycerol, 5 units / rxn of an enzyme >95% identical to SeqID 2. The thermal cycling protocol was 95°C for 1 second denaturation (bacterial lysis), 63°C for 90 seconds denaturation (RT step), 96°C for 3 seconds denaturation (hybrid denaturation), 57°C for 45 seconds denaturation (PCR), and 95°C for 3 seconds denaturation—repeated 40 times. Reactions were spiked with human blood at 15% of the final reaction volume.

[0279] Figure 5

[0280] Data showing that the reagents of the present invention prevent RNA degradation. Reactions were performed at 95°C with concentrations of 3, 3.2, 3.4, 3.6, 3.8, and 4.0 mM magnesium, with the temperature held for 1 minute. This was performed in bicine buffer.

[0281] Figure 6 -Effect of glycerol on the reaction.

[0282] A) Reactions performed with 6%, 7%, 8%, 9% and 10% glycerol v / v are shown. 8-9% was found to be the best compromise.

[0283] B) shows the reaction with 0% and 6% glycerol in the presence of 0.2% Tween 20

[0284] Figure 7 - Effect of Tween on blood sinking.

[0285] A) Effect of 0.1%, 0.4% and 1.0% Tween on blood sinking in Eppendorf tubes.

[0286] B) Effect of Tween on blood sinking in PCR reaction tubes at different concentrations. Images before and after PCR are shown, where a clear clear layer is formed after PCR at higher Tween concentrations, while the clear layer is absent or almost absent at lower Tween concentrations.

[0287] C) Amplification data based on the reaction setup in B.

[0288] Figure 8 - Effects of multiple short-term retention on reverse transcriptase

[0289] A) A single 4 minute reverse transcription step was run as either i) a single hold (0 denaturations), or ii) many shorter holds of cDNA comprising multiple denaturation steps, but where the total hold time was equal to that of (i).

[0290] B) A set of 15 identical reactions, each containing 16% whole human blood and spiked with 10 viruses per reaction - with high sensitivity, allowing many opportunities to initiate PCR from the start, yet with very low copy numbers - key to commercially meeting the crucial 3,000 virions / ml required by the World Health Organization for low-cost diagnostics.

[0291] C) Typical thermal profile of the method - the correct temperature needs to be determined for each step

[0292] Figure 9

[0293] A) PCR using Tet-labeled blood; and B) PCR using CY5-labeled blood.

[0294] The reactions were identical except that the probes were labeled with TET dye or Cy5 and the quenchers BHQ1 or BHQ2, respectively. The target was accuplex Ebola virus reference material. 50 μl of rxn, 800 nM F and R primers, 200 nM Cy5-labeled probe, and reagents as described—50 mM Bicine, pH 8.2, 3.4 mM MgCl2, 0.4 mM dNTPs, 115 mM potassium acetate, 0.1 μg / μl BSA, 0.2% Tween. 8.5% glycerol, 5 units / rxn of enzyme >95% identical to SeqID 2. The thermal cycling protocol was 95°C for 1 second denaturation (virus lysis), 63°C for 90 seconds denaturation (RT step), 96°C for 3 seconds denaturation (hybrid denaturation), 57°C for 45 seconds denaturation (PCR), and 95°C for 3 seconds denaturation—repeated 40 times.

[0295] Figure 10 -Sequence alignment

[0296] Figure 11 - Additional example of direct detection from crude samples:

[0297] a) Direct detection of Rift Valley fever virus from an infected mouse model using frozen blood added at 6% of the final reaction volume

[0298] b) Direct detection of Crimean-Congo hemorrhagic fever virus from virus culture medium.

[0299] c) Direct detection of PPR virus from blood or nasal swabs of infected pigs.

[0300] d) Detection of foot-and-mouth disease virus from viral culture in PBMCs.

[0301] 50 μl rxn, 800 nM F and R primers, 200 nM Cy5-labeled probe, and reagents as described: 50 mM Bicine, pH 8.2, 3.4 mM MgCl2, 0.4 mM dNTPs, 115 mM potassium acetate, 0.1 μg / ul BSA, 0.2% Tween, 8.5% glycerol, 5 units / rxn of enzyme >95% identical to SeqID 2. The thermal cycling protocol was 95°C for 1 second denaturation (viral lysis), 63°C for 90 seconds denaturation (RT step), 96°C for 3 seconds denaturation (hybrid denaturation), 57°C for 45 seconds denaturation (PCR), and 95°C for 3 seconds denaturation, repeated 40 times.

[0302] The primer sequences are as follows:

[0303] CCHF S122F CCTTTTTGAACTCTTCAAAACC

[0304] CCHF S1R TCTCAAAGAAACACGTGCC

[0305] CCHF probe ACTCAAGGKAACACTGTGGGCGTAAG

[0306] RVF Weid F TGCCACGAGTYAGAGCCA

[0307] RVF Weid R GTGGGTCCGAGAGTYTGC

[0308] RVF Weid PTCCTTCTCCCAGTCAGCCCCAC

[0309] PPRVF AGAGTTCAATATGTTRTTAGCCTCCAT

[0310] PPRVR TTCCCCARTCACTCTYCTTTGT

[0311] PPRVP CACCGGAYACKGCAGCTGACTCAGAA

[0312] Examples

[0313] Example 1 - Required Temperature for Making Target Nucleic Acids Accessible to Amplification Components

[0314] Figures 1a, b and c show that heating the sample to a higher temperature for a shorter period of time is more preferable than heating the sample to a lower temperature for a longer period of time.

[0315] Temperatures exceeding 76°C allow viral nucleic acid to be accessible to the amplification components. However, RNA degrades over time, so shorter holds are more preferred, with brief, cooler holds being most preferred. A preferred embodiment is to heat the sample to 93-95°C for 1 second.

[0316] Example 2 - Multiple Sample Types and Viruses / Microorganisms

[0317] The present invention is applicable to multiple sample types, including blood and plasma ( Figure 2A ), cells from diseased areas of infected animals ( Figure 2B ), porcine nasal swabs, cerebrospinal fluid, viral cultures, frozen serum samples from infected patients, and can be used to detect at least Lassa virus, CCHF, Staphylococcus epidermidis, Escherichia coli, Ebola pseudovirus, and PPRV. There is no reason to doubt that the present invention cannot be used to detect any virus or microorganism that includes an amplifiable nucleic acid.

[0318] Example 3 - Effects of Tween and Glycerol

[0319] A detergent is required to make viral or microbial nucleic acids amplifiable. Therefore, simply heating to above 70°C is not sufficient to make nucleic acids amplifiable. Tween can make viral or microbial nucleic acids amplifiable, but Triton X cannot.

[0320] The present invention also has the advantages that the enzyme buffer of described method and reagent of the present invention is compatible with the enzyme mixture component.Polysorbate 80 has more lipophilicity and polysorbate 20 has more hydrophilicity, so all tests all use Tween 20 (polysorbate 20) to carry out, but there is no reason to think that other forms of Tween will also not work.Expectedly, because enzyme buffer comprises detergent Brij and Brij may be incompatible with Triton, so Triton is inoperative.Therefore, although may need to assess the compatibility with enzyme mixture component in some cases, detergent rather than Tween is considered to be applicable to method of the present invention and reagent of the present invention.Suppose that other nonionic detergents will be compatible with described process and be known in the art.

[0321] Detergent-free means that the target nucleic acid is kept away from the amplification components, as detergents might be needed, for example, to alter capsid conformation or remove proteins from the nucleic acid, resulting in fragmentation and irreproducible data. Adding any amount of Tween above 0.1% can make the reaction reproducible. When the concentration of Tween is too high, it can lower the Tm of the primers / probes. This can then compromise PCR itself by reducing PCR efficiency and detection. In fact, in this particular reaction, amounts above 0.7% cannot be used as they begin to decrease.

[0322] In the case where the sample is blood, Tween also helps the sample sink. Figure 7 shows the effect of different concentrations of Tween on blood sinking and amplification. Starting from 0.1% Tween, a clear layer forms at the top of the tube upwards, where the size of the clear layer depends on the Tween concentration (the 0% Tween tube does not show a clear layer at the top at all). However, at higher concentrations, Tween can lower the Tm of the primers and reduce PCR efficiency. 0.2-0.3% Tween is considered optimal because it provides a clear layer without reducing PCR efficiency.

[0323] The presence of both solvents and detergents is required for efficient and reproducible lysis and amplification.

[0324] Example 4 The method of the present invention is applicable to a range of polymerases.

[0325] Figure 4A Data obtained for the TTH enzyme, which has both RNA-dependent and DNA-dependent polymerase activities, are shown. Figure 4B Data are shown for the Hawkz05 enzyme, which has two activities.

[0326] Although TTH and Hawkz05 enzymes can be used, they are not as sensitive as enzymes having 90% or 95% identity to SEQ ID NO: 2 because TTH has poor reverse transcriptase performance and Hawkz05 is more inhibited by the presence of blood.

[0327] Example 5: Protection of RNA by Reagents

[0328] It is well known that the combination of Tris and Mg produces nicked RNA (Abou Haidar and Ivanov, 1999 Z Naturforsch 54:542-548).

[0329] The methods and reagents of the present invention minimize RNA degradation.

[0330] The best evidence for low RNA degradation is consistent performance across a range of magnesium concentrations and hold times. Figure 5 Data are shown for a 1 minute heating step at 94°C with Mg at 3, 3.2, 3.4, 3.6, 3.8, 4.0 mM. This is a relatively long time at high temperature with Mg at 3, 3.2, 3.4, 3.6, 3.8, 4.0 mM. 2+ The Ct values ​​were higher, but the Ct values ​​were the same. This suggests that a 25% increase in MgCl2 resulted in no difference in RNA degradation. A possible mechanism, and therefore the reason for the choice of bicine / tricine, is that they are known to buffer the amount of free metal ions in solution, and this effect, combined with the lower pH, minimizes hydroxyl attack on RNA ("Good's" buffer depletes free metal ions, R Nakon, CR Krishnamoorthy, Science, August 19, 1983: Vol. 221, No. 4612, pp. 749-750, DOI: 10.1126 / science.6879173).

[0331] - This means that the RNA remains in the reaction and can therefore be used for multiple reverse transcription cycles if necessary.

[0332] In some embodiments, the buffers of the present invention are also pH neutral at temperatures above 70°C to which the sample is subjected.

[0333] Temperature dependence of pH of commonly used buffers.

[0334] Buffer system <![CDATA[pK a / 20℃]]> <![CDATA[ΔpK a / 10℃]]> MES 6.15 -0.110 ADA 6.60 -0.110 PIPES 6.80 -0.085 ACES 6.90 -0.200 BES 7.15 -0160 MOPS 7.20 -0.013 TES 7.50 -0.200 HEPES 7.55 -0.140 Trldne 8.15 -0.210 Trls 8.30 0.310 Bicine 8.35 -0.180 Glycine 8.40 -0.280

[0335] References

[0336] Good, NE (1986) Biochemistry 5, 467.

[0337] According to published data, Bicine drops 0.18 pH units / C.

[0338] Therefore, at 95°C, the pH of the bicine buffer is 7.0 and therefore RNA attack cannot occur during the denaturation step, as this would require an excess of hydroxide ions.

[0339] Bicine buffer is considered particularly preferred because it is the only buffer in which all three enzymes (TTH, Hawk305, and the enzyme with SEQ ID NO: 2) have been shown to function. TTH will perform PCR in Tris buffer, but only RT in bicine. Hawk305 will function in either bicine or tricine, making it likely that tricine could replace bicine. Bicine buffer has also been shown to aid RNA survival by being immune to high temperatures and MgCl2 concentrations.

[0340] Example 6 - Repetitive Reverse Transcriptase

[0341] The inventors of the present invention have found that it is possible and beneficial to perform reverse transcriptase in a series of shorter holds (including a cDNA denaturation step) rather than a single longer hold of equal time.

[0342] Figure 8 shows data for a single 4 minute reverse transcription step that was run either as a single long hold or as a series of shorter holds broken down by a cDNA denaturation step. Each reaction was run for the same total length of time.

[0343] It should be noted that after performing more RT cycles within the same fixed time period, the final fluorescence is higher, indicating that more RNA is converted to cDNA.

[0344] Reactions contained 250 virions and 9% whole human blood.

[0345] Five denaturations yielded the earliest Ct, so 6 × 41-second RT steps took the same amount of time as a 14-minute RT step, improving the data because the RNA survived and new cDNA was generated with each cycle.

[0346] The bond between RNA and DNA is energetically stronger than the DNA / DNA bond. As a practical example, the Tm of DNA of the primer sequence GATACACTGGGATGACTCTTTGCCGAAC is 71C, while the Tm of the target RNA is 76C.

[0347] This means that reverse transcription at 76°C will result in a successful RT reaction, but if performed for multiple cycles, very little PCR product will be produced because only 1.74% of the primers are able to bind at an annealing temperature that is 5°C above the Tm of their DNA.

[0348] Thus, by performing multiple high temperature RT steps, multiple cDNA molecules can be generated from the same RNA strand, and sensitivity is thus increased by performing this pre-amplification step. The reagents ensure that the RNA molecules survive the elevated temperature long enough to allow multiple cycles to be achieved.

[0349] Another strategy is to design primers in which the Tm of RNA and the Tm of DNA are brought closer together by using locked nucleic acids (LNA). LNA is an RNA species whose DNA is locked in a 3'-endonucleotide with stable intrastrand binding. Therefore, while the LNA portion raises the Tm toward the RNA target, the Tm of the forward and reverse DNA are brought closer together. The assay can then be designed so that RT and PCR can be performed efficiently at the same temperature - PCR is an amplification chemistry based on doubling the initial target copy number, as opposed to simple single-copy transcription or reverse transcription. Therefore, if both can be performed efficiently at the same temperature, sensitivity will be maximized because efficient PCR will be initiated at the same time, and the RT function still provides an initial opportunity for the initial low-copy number RNA target to be converted into cDNA that can then be amplified and detected.

[0350] Because the reagents minimize RNA degradation, this means that target nucleic acids, such as viral RNA, remain in solution and each cycle provides more opportunities for RNA to be converted into cDNA.

[0351] Figure 8B A set of 15 identical reactions is shown, each containing 16% whole human blood and spiked with 10 viruses. The high sensitivity comes from having many opportunities to initiate PCR from the outset, yet the copy number is very low—key to commercially meeting the crucial 3,000 virions / ml required by the World Health Organization for low-cost diagnostics. In this case, primers were designed to allow simultaneous RT and PCR. This approach was found to be the most sensitive.

[0352] A disadvantage of using an enzyme that can perform both RT and PCR is that it is difficult to separate the two functions. To determine the optimal temperature for reproducible RT, the sensitivity of the assay must be compared over a range of temperatures (see Figure 8C The higher the temperature and the longer it is held, the more inhibitors may be released from a sample such as blood, so it is desirable to minimize the temperature and hold it for as long as possible, which also speeds up detection time.

[0353] The method described in Example 7 is applicable to any fluorophore that emits and is excited at any wavelength.

[0354] Viral nucleic acid from a sinbis virus expressing the Ebola virus genome (Accuplex Seracare) was amplified from a blood sample and labeled with a Tet tag ( FIG. 9 a ) or a CY5 tag ( FIG. 9 b ). The Tet tag excites at approximately 521 nm and emits at approximately 536 nm, whereas the CY5 tag excites at approximately 625 nm or 650 nm and emits at approximately 670 nm. Therefore, since the methods and reagents are suitable for detecting amplicons labeled with red and green fluorophores at opposite ends of the spectrum, the present invention is believed to be applicable to any fluorophore.

[0355] Example 8 - Preferred embodiment

[0356] The optimal reaction conditions found to be applicable to various sample types / viruses / microorganisms were 50 mM Bicine, 3.4 mM MgCl2, 115 mM potassium acetate, 8% glycerol, 0.4% Tween at pH 8.2 at 25°C. A range of MgCl2 concentrations from 3-4 mM MgCl2 produced amplicons, but 3.4 mM MgCl2 proved to be optimal. Preferably, the enzyme M1 / M747K (SEQ ID NO: 2) is used.

[0357] A method for detecting viral pathogens directly from crude samples in a closed tube assay can be as follows.

[0358] The crude sample is added to a reaction vessel containing 50 mM Bicine, 3.5 mM MgCl2, 115 mM potassium acetate, 8% glycerol, 0.4% Tween at pH 8.2 at 25°C, and an enzyme, preferably M1 / M747K or an enzyme having at least 90% or at least 95% identity to SEQ ID NO: 2, primers specific for one or more targets of interest, and a sequence-specific fluorescent probe.

[0359] Raise the temperature of the reaction vessel to 95°C for 1 second. (To make viral / microbial nucleic acids accessible to the amplification components)

[0360] The temperature is lowered to the optimal temperature for the reverse transcription step, as determined by the primer sequences specific for the target of interest.

[0361] Denature the target at 96°C for 3 seconds.

[0362] Multiple rounds of repetitive reverse transcription are optionally performed.

[0363] QPCR amplification is performed from the resulting cDNA and the resulting amplicon is detected. This preferred thermal cycling protocol is as follows: Figure 8C shown.

[0364]

[0365]

[0366]

[0367] Example 9

[0368] This specification describes reagents and methods that enable direct amplification of pathogen nucleic acids, and in particular RNA viruses, directly from whole blood samples suspected of infection. The methods can also be applied to bacterial and fungal pathogens and can be obtained from a variety of input samples, including serum, plasma, urine, cerebrospinal fluid, feces, and swabs from the eyes, nose, and mouth.

[0369] Additionally, methods are described for establishing maximum sensitivity by subjecting the reaction to multiple rounds of reverse transcription where the target pathogen is a virus, and for determining the point at which individual viral pathogens will be lysed and thus detected.

[0370] The present disclosure contains the necessary methods to perform direct amplification of viral pathogens from crude whole blood samples in a single closed tube process without resorting to nucleic acid extraction, thereby enabling rapid and low-cost on-site diagnostics.

[0371] Many methods have been shown to be suitable for inactivating viral pathogens, including UV, solvents / detergents, and heat. Heat treatment is commonly used to inactivate viral pathogens in bioactive substrates such as blood or blood products, where slow heating to 60°C in a zone has been shown to not render pathogens such as HIV and Hep C infectious. Recent research (Fry et al., "A plate-based high-throughput assay for virus stability and vaccine formulation," Journal of Virological Methods, Vol. 185, No. 1, 2012, pp. 166-170), known as PaSTRy technology, has shown that heat inactivation is a two-stage process, with the viral genome being released from the capsid at a lower temperature (T) and the capsid itself being degraded at a higher temperature (T). Either of these processes renders the virus non-infectious. The authors have developed a vaccine production method that, for any given virus, makes it possible to determine when genome release occurs while the capsid itself remains intact, thereby making attenuated vaccines more reliable. The authors of this specification have discovered that the Tm point coincides with the point at which amplifiable viral nucleic acid is released, and that at the Tr point, some protein components, presumably nucleoproteins, remain associated with the viral genome, rendering them inaccessible to molecular biology methods such as isothermal amplification or PCR. It would be advantageous to have a method that allows viral pathogens to be amplified directly from crude samples, as this typically requires a time-consuming extraction process that requires skilled operators and can expose them to potentially lethal pathogens.

[0372] The authors of this specification propose that if it were possible to add a crude sample to a reaction vessel suspected of containing a viral pathogen and raise the temperature to the viral Tm point, it would be possible to directly amplify the viral genome released therein. The applicant (BG Research) has previously described a method for closed tube lysis of pathogens to release amplifiable nucleic acids (EP 2585581), the method herein having the benefit of reduced energy requirements since it does not require freezing and has the additional benefit of being faster than multiple cycles of freezing.

[0373] Applicants have tested the PaSTRy method on a number of pathogens, including dengue fever, and have found that the Tm of all significant pathogens tested to date is within the 74-84°C range. Therefore, if a single, brief hold within the 74-84°C range is added to the nucleic acid amplification process, it is theoretically possible to directly amplify the viral pathogens involved. It should be noted that most significant and lethal pathogens, including Ebola, Lassa, SARS, and others, have positive-strand RNA genomes, making the reverse transcription step crucial for successful pathogen amplification. Most natural reverse transcriptases in the literature, such as MMULV, and more modern modified enzymes, will denature at these higher temperatures, which are necessary for viral capsid denaturation at these Tm points. Therefore, the process described in this specification requires the use of thermostable enzymes, such as Bioneer Rocketscript, which can be brought to these temperatures in a short period of time.

[0374] Another problem is the thermal stability of the released RNA itself, which degrades in the presence of alkaline solutions containing divalent cations (non-enzymatic RNA hydrolysis promoted by the combined catalytic activity of the buffer and magnesium ions). Therefore, if the process described herein is used with a standard Taq polymerase buffer based on Tris and 4M MgCl2, the released RNA will rapidly degrade and render the target pathogen RNA non-amplifiable. To overcome this problem, the applicant has developed a buffer whose pH is essentially neutral at the capsid Tm temperature and becomes neutral above these temperatures. The buffer buffers divalent cations such that the free concentration is minimized based on bicine and tricine - a typical formulation would be 50mM bicine / tricine, 3.5mM MgCl2, 115mM potassium acetate and adjusted to a pH of 8.2 at 25°C. This buffer is essentially neutral at the Tm (capsid denaturation point) and thus does not have excess hydroxide ions to attack the RNA, but the pH will meet the physiological requirements of the enzymes in the reverse transcription / amplification step, at a pH of 7.4-7.6.

[0375] Applicants have observed that the Tm point can be lowered by adding solvents / detergents to the amplification reagent mixture. Many solvent-detergent compositions are commercially used for viral inactivation, although these have been found to be largely incompatible with many amplification methods. A suitable composition has been found to be 8% glycerol and 0.1-0.4% Tween 20. The percentage added does further lower the Tm point, but Applicants have also observed that higher Tween concentrations (0.4%) lower the hybridization temperature of any primer and probe, such as the hybridization temperature of a PCR process.

[0376] The optimal reaction conditions were found to be 50 mM Bicine, 3.5 mM MgCl2, 115 mM potassium acetate, 8% glycerol, 0.4% Tween at pH 8.2 at 25°C.

[0377] The method for detecting viral pathogens directly from crude samples is as follows.

[0378] The crude sample was added to a reaction vessel containing 50 mM Bicine, 3.5 mM MgCl2, 115 mM potassium acetate, 8% glycerol, 0.4% Tween at pH 8.2 at 25°C, and enzymes appropriate for reverse transcription and cDNA amplification / detection.

[0379] Raise the temperature of the reaction vessel to 76-81°C within 15-60 seconds. (Virus Lysis Step)

[0380] Lower the temperature to the optimal temperature for the reverse transcription step

[0381] Amplification from the obtained cDNA

[0382] To date, 76-81°C has been shown to be the correct range for the Tm (capsid denaturation) of all viruses tested, as temperatures above this temperature lead to rapid RNA degradation, thus reducing sensitivity.

[0383] Veterinary testing methods

[0384] In veterinary medicine, the most commonly used sample type is a swab – these are taken from the eyes, nose, or mouth, depending on the suspected disease. Many virulent animal pathogens, such as rinderpest and PPRV, have a virological component, but for some economically important diseases, the time window during which viral pathogens can be detected in the blood is very limited. The applicants have described methods for direct detection of whole blood and have shown applicability to the detection of acute viral diseases such as foot-and-mouth disease and PPRV (Kavit Shah, Emma Bentley, Adam Tyler, Kevin S Richards, Ed Wright, Linda Easterbrook, Diane Lee, Claire Cleaver, Louise Usher, Jane E Burton, James Pitman, Christine B Bruce, David Edge, Martin Lee, Nelson Nazareth, David A Norwood, Sterghios Athanasios Moschos. "Field-deployable, Quantitative, Rapid Identification of Active Ebola Virus Infection in Unprocessed Blood." Chem. Sci., 2017; DOI: 10.1039 / C7SC03281A) - however, there are a number of drawbacks to using direct blood methods in remote, low-resource settings where these diseases are prevalent. First, obtaining blood samples from animals requires the input of a trained veterinarian, and second, viruses can be found in readily available samples that are accessible to non-specialists. This application covers a method for performing direct detection of viral animal pathogens without the aid of nucleic acid extraction, directly from swab samples obtained from the mouth, eyes, or nose.

[0385] Example 10

[0386] The practicality of the method for detecting viral pathogens in crude samples in the real world is further demonstrated by the ability to detect a range of important viral pathogens. Figure 11 (A) shows direct detection of Rift Valley fever virus from infected mice, (B) detection of Crimean-Congo hemorrhagic fever virus directly from viral cultures, and (C) detection of Peste des Petits Ruminants virus directly from blood or nasal swab samples. This demonstrates the practicality of the method in creating rapid, low-cost diagnostic methods for emerging diseases that affect animals and humans. The ability to extract information from swabs means that respiratory diseases can be easily identified, and the technology has the ability to detect the top 10 viral pathogens listed by the World Health Organization and has been used to generate proof of concept data for Ebola virus, Lassa virus, dengue virus, Rift Valley fever virus, Marburg virus, Crimean-Congo fever, and important veterinary diseases such as foot-and-mouth disease (D) and PPRV, which have caused huge economic impacts in developing countries and have commercial applications worldwide for animal screening in production basins and key ports.

[0387] Example 11

[0388] It was demonstrated that in combination with the container and teachings from PCT / GB2019 / 051156, viral pathogens can be detected in whole blood at up to 3% of the final volume per reaction, which has high sensitivity and meets the technical target of direct-from-blood testing, which meets the World Health Organization R&D Blueprint target of 3,000 virions / ml. Figure 8B Fifteen identical reactions performed at 1042 virions / ml are shown, which easily meets the sensitivity requirement and demonstrates the utility of the method. Figure 12A and B demonstrate that the reagents and methods work reliably with up to 35% whole blood in the reaction volume, and interestingly, the sensitivity appears to improve in the 12-16% range. This is thought to be due to molecular crowding (Sasaki, Y., Miyoshi, D., and Sugimoto, N. (2006). "Effect of molecular crowding on DNA polymerase activity." Biotechnology Journal, 1(4), 440-446.), where the point at which the benefits of molecular crowding are maximized while minimizing inhibition by blood components must correspond to this 12-16% range. In practice, this means that a 95ul reaction containing 15ul whole blood is approximately 16%, and Figure 8B There are 10 copies / rxn and therefore a sensitivity of 1042 virions / ml.

Claims

1. A method for amplifying viral RNA present in a sample for non-diagnostic purposes, said sample being obtained from a subject, wherein The sample is prepared by heating the sample in a container to a temperature of at least 70° C. in the presence of a reagent comprising a detergent, a solvent, and a nucleic acid polymerase having both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity; The viral RNA is amplified by PCR; Primers were designed so that reverse transcription and PCR occurred simultaneously; The amplification includes more than one reverse transcription step during PCR; The reagent is compatible with the nucleic acid polymerase; The detergent is 0.15-1% Tween 20; The solvent is 8-11% glycerol; The reagent comprises bicine and magnesium cations and does not comprise Tris; and The agent minimizes degradation of the viral RNA by minimizing nonspecific catalysis of the viral RNA by the magnesium cation.

2. The method of claim 1, wherein the amplification comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more reverse transcription steps during PCR.

3. The method of claim 1, wherein both the RNA-dependent DNA polymerase activity and the DNA-dependent DNA polymerase activity require the same cofactor.

4. The method according to claim 3, wherein both the RNA-dependent DNA polymerase activity and the DNA-dependent DNA polymerase activity require magnesium cations as a cofactor.

5. The method of claim 1, wherein the sample and the reagents are not manipulated between the reverse transcription step and the PCR step. The method according to claim 5 , wherein the reverse transcription step and the PCR step are combined into a one-step reverse transcription-PCR (RT-PCR).

7. The method of claim 1, wherein the nucleic acid polymerase having both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity is selected from the group consisting of: (a) TTH polymerase represented by SEQ ID NO: 3; (b) Hawk Z05 shown in SEQ ID NO: 4; (c) a polymerase consisting of the amino acid sequence shown in SEQ ID NO: 1; or (d) M1 / M747K enzyme shown in SEQ ID NO:

2.

8. The method of claim 1, wherein the viral RNA is not extracted.

9. The method of claim 8, wherein the viral RNA is not precipitated using alcohol.

10. The method of claim 9, wherein the viral RNA is not precipitated using ethanol.

11. The method of claim 1, wherein the sample: (i) is a crude sample; and / or (ii) contain or release substances that are inhibitory to PCR.

12. The method according to claim 11, wherein the sample is: (a) blood; (b) urine; (c) serum; (d) plasma; (e) feces, (f) cerebrospinal fluid; (g) swab; and / or (h) Eluate obtained from washing of the swab.

13. The method of claim 12, wherein the swab is a swab from the eye, ear, nose or mouth. The method of claim 11 , wherein the sample releases a substance that is inhibitory to PCR when heated.

15. The method of claim 1, wherein one or more primers comprise one or more LNA, ZNA and / or BNA modifications.

16. The method of claim 15, wherein the reverse primer comprises one or more LNA, ZNA and / or BNA modifications.

Images