CRISPR / Cas system-based gene editing methods

Abstract

A method for gene editing in cells based on the CRISPR-Cas system is provided, wherein the Cas enzyme is a Cas9 enzyme with an enzyme activity of 0-1 nmol. A method for constructing universal T cells is also provided, along with the prepared T cells and their applications, wherein the TCR and MHC genes of the T cells are edited using gene editing technology. A gRNA construct is also provided.

Description

Technical Field

[0001] This invention relates to methods for gene editing. More specifically, it relates to methods for gene editing in cells using a CRISPR / Cas system. Background Technology

[0002] Gene editing involves altering the genome by deleting, inserting, mutating, or replacing specific nucleic acid sequences. The CRISPR-Cas system consists of regularly clustered, spaced short palindromic repeats (CRISPR) and associated Cas proteins. RNA-guided Cas endonucleases specifically target and cleave DNA in a sequence-dependent manner (Jinek, M. et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337, 816–821 (2012); Sternberg, SH et al., “DNA interrogation by the CRISPR RNA-guided endonuclease Cas9,” Nature 507, 62 (2014)), and have been widely used for gene editing in various biological and model systems.

[0003] However, there are still problems with low gene editing efficiency in the gene editing process. For example, when CRISPR-Cas9 edits T cells, since T cells are terminally differentiated primary cells, the time window for in vitro expansion is limited, and the gene transfection efficiency is low. For example, the efficiency of knocking out genes encoding TCR receptors or genes encoding HLA proteins alone, as disclosed in Clin Cancer Res; 23(9) May 1, 2017, can reach up to about 80%, while the efficiency of knocking out both at the same time is only about 60%.

[0004] Therefore, how to quickly and efficiently knock out genes in cells, or quickly and efficiently knock out multiple genes at once, has become a challenge in this field. Summary of the Invention

[0005] The purpose of this invention is to provide a rapid and efficient method for gene knockout in cells, particularly a method for rapidly and efficiently knocking out multiple genes at once.

[0006] In a first aspect of the present invention, a method for gene editing of cells based on a CRISPR / Cas system is provided, wherein a complex of Cas enzyme and gRNA is introduced into the cells for gene editing, wherein the ratio of Cas enzyme to gRNA in the complex is 1:3 to 1:5.

[0007] In one specific embodiment, the Cas enzyme is a Cas9 enzyme.

[0008] In one specific embodiment, the enzyme activity of the Cas9 enzyme is 0.1-1 nmol, preferably 0.2-0.7 nmol, more preferably 0.3-0.5 nmol, and most preferably 0.37 nmol.

[0009] In one specific embodiment, the Cas enzyme is a Cas9 enzyme, and in the complex, the molar ratio of Cas9 enzyme to gRNA is 1:1 to 1:10, preferably 1:3 to 1:5, and more preferably 1:4.

[0010] In this invention, for example, a Cas9 enzyme from NEB can be used, and of course, those skilled in the art can choose other Cas9 enzymes with the same or similar functions.

[0011] In one specific embodiment, the Cas9 enzyme can achieve the following function: in a 30 μl Cas9 enzyme reaction system (containing 20 mM HEPES, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, and at 25°C, pH 6.5), with 1 nM PvuII linearized pBR322 DNA (one target site SEQ ID NO:94:CGCTTGTTTCGGCGTGGGTA), 40 nM sgRNA, and 20 nM Cas9 enzyme, after incubation at 37°C for 1 hour, 90% of the pBR322 DNA is confirmed to be degraded by agarose gel electrophoresis. In this reaction system, the amount of Cas9 enzyme required to completely convert 1 nmol of substrate (PvuII linearized pBR322 DNA) into the product in 1 minute is 0.37 nmol, and the Cas9 enzyme content is 59.57 ng. The Cas9 enzyme has an activity of 0.37 nmol (the amount of enzyme that catalyzes the conversion of 1 nmol of substrate into product in 1 minute). In this invention, taking the NEB enzyme as an example, the enzyme activity is 0.37 nmol.

[0012] Those skilled in the art will understand that the molar ratio of Cas9 enzyme to the desired gRNA is calculated based on the aforementioned Cas9 enzyme activity, and the concentration of Cas9 enzyme in the delivery complex is confirmed. When the activity of Cas9 enzyme changes, those skilled in the art can convert the ratio determined herein based on the description of activity in the instructions for different enzymes to select the concentration of Cas9 enzyme to be used and its molar ratio to gRNA.

[0013] Those skilled in the art will also understand that the Cas enzyme with an enzyme activity of 0.37 nmol described above is merely an example. For other Cas9 enzymes, if the enzyme activity is different from that of the Cas enzyme, those skilled in the art can use the enzyme activity to calculate and determine the amount of Cas9 enzyme used and its molar ratio with gRNA.

[0014] In one specific embodiment, the present invention relates to a method for editing two genes, specifically, introducing a complex of Cas9 enzyme and a first gRNA and a complex of Cas9 enzyme and a second gRNA into the cell for gene editing.

[0015] In one specific embodiment, a complex of the Cas9 enzyme, the first gRNA, and the second gRNA is simultaneously introduced into the cell for gene editing.

[0016] In one specific embodiment, complex one and complex two are sequentially introduced into the cell for gene editing.

[0017] In complex one, complex two, or complex three, the molar ratio of Cas9 enzyme to gRNA is 1:1 to 1:10, preferably 1:3 to 1:5, and more preferably 1:4.

[0018] For example, in complex one, the molar ratio of Cas9 enzyme to gRNA is 1:1 to 1:10, preferably 1:3 to 1:5, and more preferably 1:4. In complex two, the molar ratio of Cas9 enzyme to gRNA is 1:1 to 1:10, preferably 1:3 to 1:5, and more preferably 1:4. In complex three, the molar ratio of Cas9 enzyme to the sum of the first gRNA and the second gRNA is 1:1 to 1:10, preferably 1:3 to 1:5, and more preferably 1:4.

[0019] In this document, the molar ratio refers to the ratio between the amounts of Cas9 enzyme and gRNA, wherein the amount or activity of Cas9 enzyme is calculated based on the manufacturer's instructions for Cas9 enzyme, and the amount of gRNA is calculated based on the RNA base composition and the concentration of in vitro transcription.

[0020] In one specific embodiment, the ratio of the Cas enzyme to gRNA is 1:4.

[0021] In one embodiment, the cell is a eukaryotic cell; in another embodiment, the eukaryotic cell is an immune effector cell; in yet another embodiment, the immune effector cell is a T cell.

[0022] In one specific embodiment, the concentration of the Cas enzyme in the complex of the Cas enzyme and gRNA is approximately 0.1 μM to 3 μM; preferably, approximately 0.125 μM to 3 μM; more preferably, approximately 0.2 μM to 3 μM; even more preferably, approximately 0.25 μM to 3 μM; and even more preferably, approximately 0.5 μM to 3 μM.

[0023] In one specific embodiment, in the complex formed by the Cas9 enzyme and gRNA, or complex one, complex two, or complex three, the concentration of the Cas9 enzyme is about 0.1 μM to 3 μM; preferably, about 0.125 μM to 3 μM; more preferably, about 0.2 μM to 3 μM; even more preferably, about 0.25 μM to 3 μM; even more preferably, about 0.5 μM to 3 μM.

[0024] In one specific embodiment, the concentration of the Cas enzyme in the complex of the Cas enzyme and gRNA is about 0.1 μM to 2 μM; preferably, about 0.125 μM to 2 μM; more preferably, about 0.5 μM to 2 μM; even more preferably, about 0.5 μM to 2 μM; even more preferably, about 0.5 μM to 2 μM.

[0025] In a specific embodiment, the cell is a T cell, and the CRISPR / Cas system edits the genes of the T cell; in a specific embodiment, gene editing is performed on any one or both strands of the α and β chains of the T cell's TCR; in a specific embodiment, gene editing is performed on the TRAC; in a specific embodiment, gene editing is performed on the constant region of the TRAC; in a specific embodiment, gene editing is performed on the TRAC containing the sequence shown in SEQ ID NO: 1.

[0026] In a specific embodiment, the cell is a T cell, and the genes of the T cell are edited using the CRISPR / Cas9 system; including:

[0027] Gene editing is performed on any one or both strands of the α and β chains of the T cell's TCR using the CRISPR / Cas9 system; preferably, gene editing is performed on the TRAC; more preferably, gene editing is performed on the constant region of the TRAC; even more preferably, gene editing is performed on the sequence in the TRAC as shown in SEQ ID NO: 45; even more preferably, gene editing is performed on the TRAC containing the sequence shown in SEQ ID NO: 1, and / or

[0028] The MHC gene of the T cell is edited using the CRISPR / Cas9 system, preferably the B2M gene, more preferably the sequence shown in SEQ ID NO: 38 of the B2M gene, and even more preferably the sequence shown in SEQ ID NO: 10 of the B2M gene is included in the gene editing.

[0029] In one specific implementation, gRNA is designed based on the PAM sequence shown in SEQ ID NO: 1.

[0030] In one specific embodiment, the gRNA is approximately 15-50 bp, preferably approximately 15-30 bp, more preferably approximately 17-21 bp; even more preferably 20 bp.

[0031] In one specific embodiment, the gRNA used to edit the TRAC contains a sequence shown in SEQ ID NO: 2, 3, 4, or 5; preferably, the gRNA used contains a sequence shown in SEQ ID NO: 2.

[0032] In one specific embodiment, the gRNA used to edit the TRAC contains a sequence shown in SEQ ID NO: 2, 3, 4, 5, 32, 33, 39 or 40; preferably, the gRNA used contains a sequence shown in SEQ ID NO: 2, 32 or 33.

[0033] In one specific embodiment, the gRNA used to edit the TRAC is a sequence as shown in SEQ ID NO: 2, 3, 4, 5, 32, 33, 39 or 40; preferably, the gRNA used is a sequence as shown in SEQ ID NO: 2, 32 or 33.

[0034] Specifically, the first gRNA mentioned above may contain the sequence shown in SEQ ID NO: 2, 3, 4, 5, 32, 33, 39 or 40.

[0035] In one specific embodiment, the concentration of the Cas enzyme is about 0.1 μM to 0.5 μM; preferably, about 0.125 μM to 0.5 μM, and more preferably, about 0.25 μM to 0.5 μM.

[0036] In a specific embodiment, the cell is a T cell, and the CRISPR / Cas system performs gene editing on the B2M gene of the T cell; in a specific embodiment, gene editing is performed on the B2M gene containing the sequence shown in SEQ ID NO: 10; in a specific embodiment, gRNA is designed based on the PAM sequence in the sequence shown in SEQ ID NO: 10.

[0037] In one specific embodiment, the gRNA used to edit the B2M gene contains the sequence shown in SEQ ID NO: 11, 12, 13, or 14; preferably, the gRNA used contains the sequence shown in SEQ ID NO: 12.

[0038] In one specific embodiment, the gRNA used to edit the B2M gene is a sequence as shown in SEQ ID NO: 11, 12, 13, or 14; preferably, the gRNA used is a sequence as shown in SEQ ID NO: 12.

[0039] Specifically, the second gRNA mentioned above may contain the sequence shown in SEQ ID NO: 11, 12, 13, or 14.

[0040] In the following text, the descriptions of complex one, complex two, or complex three are consistent with those above, as are the descriptions of the first gRNA and the second gRNA. It should be understood that complex, complex one, complex two, or complex three are intended to represent different complexes, and there is no priority order in their numbering. The same applies to the first gRNA and the second gRNA, which are intended to represent two different gRNAs. They can also be represented by one gRNA and another gRNA. That is, one gRNA may contain the sequence shown in SEQ ID NO: 2, 3, 4, 5, 32, 33, 39, or 40, and the other gRNA may contain the sequence shown in SEQ ID NO: 11, 12, 13, or 14.

[0041] In one specific embodiment, the concentration of the Cas enzyme is about 0.25 μM to 3 μM, preferably about 0.5 μM to 3 μM, and more preferably about 1 μM to 3 μM.

[0042] In a specific embodiment, the cell is a T cell, and the CRISPR / Cas system performs gene editing on the TRAC and B2M genes of the T cell; in a specific embodiment, gene editing is performed on the first exon of the TRAC and B2M genes.

[0043] In one specific implementation, the TRAC and / or B2M genes are gene-edited, and the TRAC and / or B2M genes are silenced.

[0044] In one specific embodiment, the gRNA used for editing the TRAC contains the sequence shown in SEQ ID NO: 2, 3, 4, or 5, and the gRNA used for editing the B2M gene contains the sequence shown in SEQ ID NO: 11, 12, 13, or 14; preferably, the gRNA used for editing the TRAC contains the sequence shown in SEQ ID NO: 2, and the gRNA used for editing the B2M gene contains the sequence shown in SEQ ID NO: 12.

[0045] In a specific embodiment, the gRNA is approximately 15-50 bp, preferably approximately 15-30 bp, and more preferably approximately 20 bp; in one specific embodiment, it is 20 bp.

[0046] In one specific embodiment, when editing the TRAC and B2M genes, the ratio of the gRNA used to edit B2M to the gRNA used to edit TRAC is approximately 1.5:1 to 0.5:1; preferably, it is approximately 1:1. In one specific embodiment, the concentration of the Cas enzyme is approximately 1 μM to 3 μM.

[0047] In a specific embodiment, the T cells also express chimeric receptors, exogenous cytokines, inhibitory / activating receptors or ligands, and co-stimulatory factors; in a specific embodiment, the T cells also express chimeric antigen receptors.

[0048] In a second aspect of the invention, a method for gene editing of the TRAC gene in T cells based on a CRISPR / Cas system is provided, wherein a complex of Cas enzyme and gRNA is introduced into the cells for gene editing, wherein the ratio of Cas enzyme to gRNA is 1:3 to 1:5; in one specific embodiment, the Cas enzyme is Cas9 enzyme.

[0049] In a specific embodiment, gene editing is performed on one or both strands of the α and β chains of the T cell's TCR; in a specific embodiment, gene editing is performed on the T cell's TRAC; in a specific embodiment, gene editing is performed on the constant region of the T cell's TRAC; in a specific embodiment, gene editing is performed on the T cell's TRAC containing the sequence shown in SEQ ID NO: 1; in a specific embodiment, gRNA is designed based on the PAM sequence in the sequence shown in SEQ ID NO: 1.

[0050] In a specific embodiment, the ratio of the Cas enzyme to gRNA is 1:4.

[0051] In a specific embodiment, the concentration of the Cas enzyme is approximately 0.1 μM to 0.5 μM; preferably, approximately 0.125 μM to 0.5 μM, and more preferably, approximately 0.25 μM to 0.5 μM.

[0052] In a specific implementation, the gRNA used to edit the TRAC contains the sequence shown in SEQ ID NO: 2, 3, 4, or 5; preferably, the gRNA used contains the sequence shown in SEQ ID NO: 2.

[0053] In a specific embodiment, when editing TRAC, the ratio of Cas enzyme to gRNA is 1:4; the concentration of Cas enzyme is 0.25μM to 0.5μM; and the gRNA used contains the sequence shown in SEQ ID NO: 2.

[0054] In a third aspect of the present invention, a method for gene editing of the B2M gene in T cells based on a CRISPR / Cas system is provided, wherein a complex of Cas enzyme and gRNA is introduced into the cells for gene editing, wherein the ratio of Cas enzyme to gRNA is 1:3 to 1:5; in a specific embodiment, the Cas enzyme is Cas9 enzyme.

[0055] In a specific implementation, the B2M gene contains the sequence shown in SEQ ID NO: 10 and is used for gene editing.

[0056] In a specific embodiment, the gRNA is designed based on the PAM sequence shown in SEQ ID NO: 10. In a specific embodiment, the ratio of the Cas enzyme to the gRNA is 1:4.

[0057] In a specific embodiment, the concentration of the Cas enzyme is approximately 0.25 μM to 3 μM, preferably approximately 0.5 μM to 3 μM, and more preferably approximately 1 μM to 3 μM.

[0058] In a specific embodiment, the gRNA used to edit the B2M gene contains the sequence shown in SEQ ID NO: 11, 12, 13, or 14; preferably, the gRNA used contains the sequence shown in SEQ ID NO: 12.

[0059] In a specific embodiment, when editing the B2M gene, the ratio of the Cas enzyme to the gRNA is 1:4; the concentration of the Cas enzyme is 1μM to 3μM; and the gRNA used contains the sequence shown in SEQ ID NO: 12.

[0060] In a fourth aspect of the invention, a method for gene editing of the TRAC and B2M genes of T cells based on a CRISPR / Cas system is provided, wherein a complex of Cas enzyme and gRNA is introduced into the cells, wherein the ratio of Cas enzyme to total gRNA is 1:3 to 1:5; in one specific embodiment, the Cas enzyme is Cas9 enzyme.

[0061] In a specific embodiment, gene editing is performed on the B2M gene containing the sequence shown in SEQ ID NO: 10; in a specific embodiment, gRNA is designed based on the PAM sequence in the sequence shown in SEQ ID NO: 10.

[0062] In a specific implementation, gene editing is performed on any one or both strands of the α and β chains of the TCR; in a specific implementation, gene editing is performed on the TRAC.

[0063] In a specific implementation, gene editing is performed on the constant region of TRAC;

[0064] In a specific embodiment, gene editing is performed on the TRAC containing the sequence shown in SEQ ID NO: 1; in a specific embodiment, gRNA is designed based on the PAM sequence in the sequence shown in SEQ ID NO: 1.

[0065] In a specific embodiment, the ratio of the Cas enzyme to total gRNA is 1:4. In a specific embodiment, the concentration of the Cas enzyme is 1 μM to 3 μM.

[0066] In a specific implementation, the ratio of gRNA used for editing the B2M gene to editing the TRAC is 0.5:1 to 1.5:1, preferably 1:1.

[0067] In a specific embodiment, the gRNA used for editing the B2M gene contains the sequence shown in SEQ ID NO: 11, 12, 13, or 14; preferably, the gRNA used contains the sequence shown in SEQ ID NO: 12. In a specific embodiment, the gRNA used for editing the TRAC contains the sequence shown in SEQ ID NO: 2, 3, 4, or 5; preferably, the gRNA used contains the sequence shown in SEQ ID NO: 2.

[0068] In a specific embodiment, the ratio of the Cas enzyme to the total gRNA is 1:4; the concentration of the Cas enzyme is 1 μM to 3 μM; and the gRNA used contains the sequence shown in SEQ ID NO: 12 and the sequence shown in SEQ ID NO: 2.

[0069] In specific embodiments, the T cells described in the second, third, and fourth aspects above also express chimeric receptors that recognize tumor antigens or pathogen antigens. These chimeric receptors have an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically recognizes the target antigen.

[0070] In a specific embodiment, the target antigen is a tumor antigen selected from: thyroid-stimulating hormone receptor (TSHR); CD171; CS-1; C-type lectin-like molecule-1; ganglioside GD3; Tn antigen; CD19; CD20; CD22; CD30; CD70; CD123; CD 138; CD33; CD44; CD44v7 / 8; CD38; CD44v6; B7H3 (CD276), B7H6; KIT (CD117); Interleukin-13 receptor subunit α (IL-13Rα); Interleukin-11 receptor α (IL-11Rα); Prostate stem cell antigen (PSCA); Prostate-specific membrane antigen (PSMA); Carcinoembryonic antigen (CEA); NY-ESO-1; HIV-1 Gag; MART-1; gp100; Tyrosinase; Mesothelin; EpCAM; Protease serine 21 (PRSS21); Vascular endothelial growth factor receptor; Lewis (Y) antigen; CD24; Platelet-derived growth factor receptor β (PDGFR-β); Stage-specific embryonic antigen-4 ( SSEA-4); cell surface-associated mucin 1 (MUC1), MUC6; epidermal growth factor 20 receptor family and its mutants (EGFR, EGFR2, ERBB3, ERBB4, EGFRvIII); neural cell adhesion molecule (NCAM); carbonic anhydrase IX (CAIX); LMP2; liver ligand A receptor 2 (EphA2); fucose GM1; sialic acid Lewis adhesion molecule (sLe); o-acetyl GD2 ganglioside (OAcGD2); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TGS5; high molecular weight melanoma-associated antigen (HMWMAA); folate receptor; tumor vascular endothelial marker 25 1 (TEM1 / CD248); Tumor vascular endothelial marker 7 associated (TEM7R); Claudin6, Claudin18.2 (CLD18A2), Claudin18.1; ASGPR1; CDH16; 5T4; 8H9; αvβ6 integrin; B cell maturation antigen (BCMA); CA9; κ light chain (kappa light) chain); CSPG4; EGP2, EGP40; FAP; FAR; FBP; embryonic AchR; HLA-A1, HLA-A2; MAGEA1, MAGE3; KDR; MCSP; NKG2D ligand; PSC1; ROR1; Sp17; SURVIVIN; TAG72; TEM1; fibronectin; tendinin; carcinoembryonic variant in tumor necrosis zone; G protein-coupled receptor class C5-member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK);Polysialic acid; Placental specific 1 (PLAC1); Hexose moiety of globoH glycoceramide (GloboH); Breast differentiation antigen (NY-BR-1); Uroplakin 2 (UPK2); Hepatitis A virus cell receptor 1 (HAVCR1); Adrenaline receptor β3 (ADRB3); Pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); Lymphocyte antigen 6 complex locus K9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCRγ alternating reading frame protein (TARP); Nephroblastoma protein (WT1); ETS translocation variant gene 6 (ETV6-AML); Sperminin 17 (SPA17); X antigen family member 1A (XAGE1); Angiopoietin-binding cell surface receptor 2 (Tie2); Melanoma cancer testis antigen-1 (MAD-CT-1); Melanoma cancer testis antigen-2 ( MAD-CT-2); Fos-associated antigen 1; p53 mutant 10; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosamine transferase V (NA17); pairing box protein Pax-3 (PAX3); androgen receptor; cyclin B1; V-myc avian myeloma virus oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (Rh oC); Cytochrome P4501B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORIS); Squamous cell carcinoma antigen 3 recognized by T cells (SART3); Pairing box protein Pax-5 (PAX5); Proacrosin-binding protein sp32 (OYTES1); Lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); Synovial sarcoma X breakpoint 2 (SSX2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LA IR1); Fc fragment of IgA receptor (FCAR); Leukocyte immunoglobulin-like receptor subfamily member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); Bone marrow stromal cell antigen 2 (BST2); EGF-like module mucin-like hormone receptor-like 2 (EMR2); Lymphocyte antigen 75 (LY75); Phosphatidylinositol proteoglycan-3 (GPC3); Fc receptor-like 5 (FCRL5); Immunoglobulin λ-like polypeptide 1 (IGLL1);

[0071] In a specific embodiment, the target antigen is a pathogen antigen, which is selected from antigens of viruses, bacteria, fungi, protozoa, or parasites; in one embodiment, the viral antigen is selected from cytomegalovirus antigen, Epstein-Barr virus antigen, human immunodeficiency virus antigen, or influenza virus antigen.

[0072] In a specific embodiment, the chimeric receptor is selected from chimeric antigen receptor (CAR) or T-cell antigen coupler (TAC).

[0073] In a specific embodiment, the chimeric receptor is a chimeric antigen receptor. In a specific embodiment, the chimeric antigen receptor includes:

[0074] (i) Antibodies that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD28, and CD3ζ; or

[0075] (ii) Antibodies that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD137, and CD3ζ; or

[0076] (iii) Antibodies that specifically bind to tumor antigens, transmembrane regions of CD28 or CD8, co-stimulatory signaling domains of CD28, co-stimulatory signaling domains of CD137, and CD3ζ.

[0077] In a specific embodiment, the chimeric receptor is a TAC, comprising:

[0078] (a) Extracellular domain: The extracellular domain includes an antibody domain having an antigen-binding domain and a single-chain antibody that binds to CD3;

[0079] (b) Transmembrane region;

[0080] (c) Intracellular domain, which connects to protein kinase LCK.

[0081] In a specific embodiment, the antibody that specifically binds to the tumor antigen of the chimeric antigen receptor is a full-length antibody, scFv, Fab, (Fab'), or a single-domain antibody.

[0082] In a fifth aspect of the invention, the use of the T cells described in the second, third, and fourth aspects above is provided for preparing T cells expressing a chimeric receptor, wherein the chimeric receptor has an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically recognizes a target antigen.

[0083] In a specific implementation, the target antigen is a tumor antigen or a pathogen antigen.

[0084] In a specific embodiment, the target antigen is a tumor antigen selected from: thyroid-stimulating hormone receptor (TSHR); CD171; CS-1; C-type lectin-like molecule-1; ganglioside GD3; Tn antigen; CD19; CD20; CD22; CD30; CD70; CD123; CD138; CD33; CD44; CD44v7 / 8; CD38; CD44v6; B7H3 (CD276), B7H6; KIT (CD117); interleukin-13 receptor subunit α (IL-13Rα); interleukin-11 receptor α (IL-11Rα). α); Prostate stem cell antigen (PSCA); Prostate-specific membrane antigen (PSMA); Carcinoembryonic antigen (CEA); NY-ESO-1; HIV-1 Gag; MART-1; gp100; Tyrosinase; Mesothelin; EpCAM; Protease serine 21 (PRSS21); Vascular endothelial growth factor receptor; Lewis (Y) antigen; CD24; Platelet-derived growth factor receptor β (PDGFR-β); Stage-specific embryonic antigen-4 (SSEA-4); Cell surface-associated mucin 1 (MUC1), MUC6; Epidermal growth factor 20 receptor family and its mutants ( EGFR, EGFR2, ERBB3, ERBB4, EGFRvIII); Neural cell adhesion molecule (NCAM); Carbonic anhydrase IX (CAIX); LMP2; Hepatic ligand A receptor 2 (EphA2); Fucosyl GM1; Sialyl Lewis adhesion molecule (sLe); O-acetyl GD2 ganglioside (OAcGD2); Ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TGS5; High molecular weight melanoma-associated antigen (HMWMAA); Folate receptor; Tumor vascular endothelial marker 25 1 (TEM1 / CD248); Tumor vascular endothelial marker 7 associated (TEM7R); Claudin6, Claudin18.2 (CLD18A2), Claudin18.1; ASGPR1; CDH16; 5T4; 8H9; αvβ6 integrin; B cell maturation antigen (BCMA); CA9; κ light chain (kappa light) chain); CSPG4; EGP2, EGP40; FAP; FAR; FBP; embryonic AchR; HLA-A1, HLA-A2; MAGEA1, MAGE3; KDR; MCSP; NKG2D ligand; PSC1; ROR1; Sp17; SURVIVIN; TAG72; TEM1; fibronectin; tendinin; carcinoembryonic variant in tumor necrosis region; G protein-coupled receptor class C5-member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a;Anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexose moiety of globoH glycoceramide (GloboH); breast differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cell receptor 1 (HAVCR1); adrenaline receptor β3 (ADRB3); pannexin3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCRγ alternating reading frame protein (TARP); nephroblastoma protein (WT1); ETS translocation variant gene 6 (ETV6-AML); spermin 17 (SPA17); X antigen family member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-associated antigen 1; p53 mutant 10-cell variant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosamine transferase V (NA17); pairing box protein Pax-3 (PAX3); androgen receptor; cyclin B1; V-myc avian myeloma virus oncogene neuroblastoma Derived homologs (MYCN); Ras homolog family member C (RhoC); cytochrome P4501B1 (CYP1B1); CCCTC binding factor (zinc finger protein)-like (BORIS); squamous cell carcinoma antigen 3 recognized by T cells (SART3); pairing box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OYTES1); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); synovial sarcoma X breakpoint 2 (SSX2); CD79a; CD79b; CD72; leukocyte phase Immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR); Leukocyte immunoglobulin-like receptor subfamily member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); Bone marrow stromal cell antigen 2 (BST2); EGF-like module mucin-like hormone receptor-like 2 (EMR2); Lymphocyte antigen 75 (LY75); Phosphatidylinositol proteoglycan-3 (GPC3); Fc receptor-like 5 (FCRL5); Immunoglobulin λ-like polypeptide 1 (IGLL1);

[0085] In a specific embodiment, the target antigen is a pathogen antigen, which is selected from antigens of viruses, bacteria, fungi, protozoa, or parasites; in one embodiment, the viral antigen is selected from cytomegalovirus antigen, Epstein-Barr virus antigen, human immunodeficiency virus antigen, or influenza virus antigen.

[0086] In a specific embodiment, the chimeric receptor is selected from chimeric antigen receptor (CAR) or T-cell antigen coupler (TAC).

[0087] In a specific embodiment, the chimeric receptor is a chimeric antigen receptor (CAR);

[0088] In a specific embodiment, the chimeric antigen receptor includes:

[0089] (i) Antibodies that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD28, and CD3ζ; or

[0090] (ii) Antibodies that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD137, and CD3ζ; or

[0091] (iii) Antibodies that specifically bind to tumor antigens, transmembrane regions of CD28 or CD8, co-stimulatory signaling domains of CD28, co-stimulatory signaling domains of CD137, and CD3ζ.

[0092] In a specific embodiment, the chimeric receptor is a TAC, comprising:

[0093] (a) Extracellular domain: The extracellular domain includes an antibody domain having an antigen-binding domain and a single-chain antibody that binds to CD3;

[0094] (b) Transmembrane region;

[0095] (c) Intracellular domain, which connects to protein kinase LCK.

[0096] In a specific embodiment, the antibody that specifically binds to the tumor antigen of the chimeric antigen receptor is a full-length antibody, scFv, Fab, (Fab'), or a single-domain antibody.

[0097] In this invention, there is no specific limitation on the electro-switching conditions. For example, the electro-switching conditions can be 150-600V, 0.5ms-20ms, or preferably 150V-300V, 2ms-15ms.

[0098] In one specific embodiment, the molar ratio of the gRNA used for gene editing of the TCR gene to the gRNA used for gene editing of the MHC gene is approximately 1:5 to 5:1, preferably 1:2 to 2:1; and more preferably approximately 1:1.

[0099] In one specific embodiment, the T cell is as described above.

[0100] In one specific embodiment, the chimeric receptor is a chimeric antigen receptor (CAR), as described above.

[0101] In a seventh aspect, the invention relates to a universal T cell constructed by the method of the present invention described above.

[0102] In an eighth aspect of the invention, there is a universal T cell in which the TRAC and / or B2M genes are silenced.

[0103] In one specific embodiment, the TRAC gene silencing is achieved by gene editing containing the sequence shown in SEQ ID NO: 1. More preferably, the TRAC gene silencing is achieved by gene editing containing the sequence shown in SEQ ID NO: 45 of the sequence shown in SEQ ID NO: 1.

[0104] B2M gene silencing is achieved by gene editing containing the sequence shown in SEQ ID NO: 10, and more preferably by gene editing containing the sequence shown in SEQ ID NO: 38 of the sequence shown in SEQ ID NO: 10.

[0105] In one specific embodiment, the TRAC gene is silenced by gene editing of the TRAC gene using gRNA with a sequence as shown in SEQ ID NO: 2, 32 or 33, and the B2M gene is silenced by gene editing of the B2M gene using gRNA with a sequence as shown in SEQ ID NO: 12.

[0106] In one specific embodiment, the T cells also express chimeric antigen receptors, preferably the T cells also express chimeric receptors that recognize tumor antigens or pathogen antigens, the chimeric receptors having an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, the extracellular antigen-binding domain specifically recognizing the target antigen.

[0107] The T cells are as described above. The chimeric antigen receptors are as described above.

[0108] In a ninth aspect of the invention, there is a gRNA construct comprising a nucleotide sequence selected from one of SEQ ID NO: 2, 3, 4, 5, 32, 33, 39, 40, 11, 12, 13 or 14.

[0109] In one specific embodiment, the gRNA construct of the present invention comprises: a nucleotide sequence selected from one of SEQ ID NO: 2, 3, 4, 5, 32, 33, 39 or 40, and a nucleotide sequence selected from one of SEQ ID NO: 11, 12, 13 or 14.

[0110] In one specific embodiment, the gRNA construct of the present invention comprises: a sequence selected from the sequence shown in SEQ ID NO: 2, 32 or 33, and / or the sequence shown in SEQ ID NO: 12.

[0111] This invention relates to the modification of T cells using gene editing technology. By knocking out multiple genes, the function of the T cell antigen receptor (TCR) and the major histocompatibility complex (MHC) in T cells can be effectively inhibited. The gene encoding the TCR is TRAC, and the gene encoding MHC I is B2M. Based on Cas9 / CRISPR gene technology, and improvements and optimizations to the RNP (RNA-protein complex) electroporation method, the knockout of both TRAC and B2M genes can be achieved in a short time and with high efficiency (over 90%). Attached Figure Description

[0112] Figure 1 This is a schematic diagram of the binding site between sgRNA and the TRAC gene;

[0113] Figure 2 The effect of different composition ratios of RNP on the TRAC knockout effect is shown;

[0114] Figure 3 shows the effect of different gRNA sequences on the TRAC knockout effect;

[0115] Figure 4 The effect of different concentrations of Cas9 enzyme on TRAC knockout was shown;

[0116] Figure 5 A schematic diagram of the gRNA binding site to the B2M gene is shown.

[0117] Figure 6 The effects of different gRNAs on the knockout effect of the B2M gene were shown;

[0118] Figure 7 The effect of different concentrations of Cas9 enzyme on the knockout effect of the B2M gene was shown;

[0119] Figure 8 This study demonstrates the effects of different gRNA components on the simultaneous knockout of TRAC and B2M.

[0120] Figure 9 The effect of the concentration of the RNP complex formed between the gRNA mixture targeting TRAC and B2M genes and the Cas9 enzyme on the knockout efficiency was shown.

[0121] Figures 10(a)-(d) show the Tide online software's prediction efficiency for TRAC and B2M gene mutations;

[0122] Figure 11 The results of cloning and sequencing verification of TRAC and B2M gene mutations are shown.

[0123] Figure 12 The efficiency of TRAC and B2M gene knockout in CAR T cells targeting BCMA was demonstrated. Detailed Implementation

[0124] The inventors discovered that when using the CRISPR / Cas9 system for gene editing, the choice of gRNA and the ratio of Cas9 enzyme to gRNA have a significant impact on editing efficiency, and based on this, the present invention was completed.

[0125] the term

[0126] Unless specifically defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the fields of gene therapy, biochemistry, genetics, and molecular biology. All methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the invention, wherein suitable methods and materials are described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, this specification, including definitions, shall prevail. Furthermore, unless otherwise specified, materials, methods, and examples are illustrative only and not intended to be limiting.

[0127] Unless otherwise stated, the practice of this invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, all of which fall within the scope of this art. These techniques are fully explained in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and Son Inc., Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al., 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gaited., 1984); Mullis et al. US Pat. No. 4,683,195; Nucleic AcidHybridization (BD Harries&S.J.Higginseds.1984); Transcription And Translation (BDHames&S.J.Higginseds.1984); Culture Of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B.Perbal, APractical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J.Abelson and M.Simon, eds.-in-chief, Academic Press, Inc., New York), especially Vols.154 and 155 (Wuetal.eds.) and Vol.185, "Gene Expression Technology" (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (JHMiller and MPCaloseds.Mayer and Walker, eds., Academic Press, London, 1987; Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Hand book of Experimental Immunology, Volumes I-IV (DM Weir and CC Blackwell, eds., 1986); and Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). In the disclosure, all aspects of the claimed subject matter are presented in scope. It should be understood that the scope description is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the claimed subject matter. Therefore, the scope description should be considered as having specifically disclosed all possible sub-scopes and individual numerical values ​​within that scope. For example, in the case of providing a range of values, it should be understood that every intermediate value between the upper and lower limits of the range, as well as any other stated or intermediate value within the range, is included within the claimed subject matter, and the upper and lower limits of the range also fall within the scope of the claimed subject matter. The smaller ranges may independently include the upper and lower limits of these smaller ranges, which also fall within the scope of the claimed subject matter, unless the upper and lower limits of the range are explicitly excluded. When a range is defined to include one or two limits, the claimed subject matter also includes a range excluding one or both of those limits. This applies regardless of the width of the range.

[0128] As used herein, the term "about" refers to the general range of error for values ​​that is readily known to those skilled in the art. Referring to a value or parameter as "about" herein includes (and describes) embodiments pointing to that value or parameter itself. For example, a description of "about X" includes a description of "X". For example, "about" or "comprising" may mean within or greater than 1 according to actual standard deviations in the art. Or "about" or "comprising" may mean a range of up to 10% (i.e., ±10%). For example, about 5 μM may include any number between 4.5 μM and 5.5 μM. When a specific value or composition is provided in the claims and claims,

[0129] Unless otherwise stated, “about” or “includes” shall be assumed to be within the acceptable error range of that particular value or composition.

[0130] Any concentration range, percentage range, proportion range, or integer range mentioned herein shall be understood to be any integer included within the range, and, where appropriate, its fraction (e.g., one-tenth and one-hundredth of an integer), unless otherwise indicated.

[0131] To facilitate a better understanding of this invention, the relevant terms are defined as follows:

[0132] The term "gene editing" refers to the ability for humans to "edit" target genes, such as knocking out or adding specific DNA segments.

[0133] The term "molecular silencing" or "gene silencing" refers to the phenomenon of genes not being expressed or being expressed at low levels without damaging the original DNA, due to various reasons. Gene silencing occurs at two levels: transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects, and post-transcriptional gene silencing, which is gene inactivation at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-inhibition, gene repression, RNA interference, and microRNA-mediated translational repression. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and Cas9 (CRISPR-associated nuclease) are CRISPR-related nucleases. CRISPR / Cas9 is a newly emerging RNA-guided technology that uses the Cas9 nuclease to edit target genes.

[0134] The "CRISPER / Cas9 system" is collectively referred to as transcripts and other elements involved in the expression of the Cas9 enzyme gene or directing its activity. This includes sequences encoding the Cas9 gene, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or the active portion of tracrRNA), tracr pairing sequences (covering "direct repeats" and partial direct repeats processed by tracrRNA in the context of an endogenous CRISPR system), directing sequences (also known as "spacers" in the context of an endogenous CRISPR system, i.e., gRNA), or other sequences and transcripts derived from CRISPR loci. Generally, the CRISPR system is characterized by elements that promote the formation of the CRISPR complex (also known as the pre-spacer region in the context of an endogenous CRISPR system) at the target sequence site.

[0135] The term "target sequence" refers to a sequence that is complementary to the guide sequence. The complementary pairing between the target and guide sequences promotes the formation of a CRISPR complex. Perfect complementarity is not required; sufficient complementarity is necessary to induce hybridization and promote the formation of a CRISPR complex. A target sequence can contain any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is located in the cell nucleus or cytoplasm.

[0136] Generally, a guide sequence (gRNA) is any polynucleotide sequence that is sufficiently complementary to a target polynucleotide sequence to hybridize with the target sequence and to guide the CRISPR complex to bind sequence-specifically to the target sequence. In some embodiments, when optimal alignment is performed using a suitable alignment algorithm, the complementarity between the guide sequence and its corresponding target sequence is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. The best alignment can be determined using any suitable algorithm for aligning sequences. Non-limiting examples include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (such as the Burrows WheelerAligner), ClustalW, ClustalX, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0137] In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more domains other than the CRISPR enzyme). The CRISPR enzyme fusion protein may comprise any other protein, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, but are not limited to, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza virus hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP). CRISPR enzymes can be fused to a gene sequence encoding a protein or protein fragment that binds to DNA molecules or other cellular molecules, including but not limited to maltose-binding protein (MBP), S-tag, Lex A DNA-binding domain (DBD) fusions, GAL4 DNA-binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that can form part of a fusion protein containing a CRISPR enzyme are described in US 20110059502, which is incorporated herein by reference.

[0138] The term "Cas9 enzyme" can refer to wild-type Cas9 or any modified version of Cas9, including any naturally occurring bacterial Cas9 and any chimera, mutant, homolog, or ortholog. Cas9 enzymes can contain one or more mutations and can function as universal DNA-binding proteins with or without fusion with functional domains. These mutations can be artificially introduced mutations or gain-and-loss functional mutations. These mutations can include, but are not limited to, mutations in one of the catalytic domains (D10 and H840) in the RuvC and HNH catalytic domains, respectively.

[0139] In this invention, for example, the Cas9 enzyme from NEB can be used; of course, those skilled in the art can choose other Cas9 enzymes with the same or similar functions. In this document, the function that the Cas9 enzyme can achieve is that, in a 30 μl reaction system of the Cas9 enzyme (the reaction system includes: 20 mM HEPES, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, and pH 6.5 at 25°C), when containing 1 nM PvuII linearized pBR322 DNA (one target site SEQ ID NO:94:CGCTTGTTTCGGCGTGGGTA), 40 nM sgRNA, and 20 nM Cas9 enzyme, after incubation at 37°C for 1 hour, 90% of the pBR322 DNA is confirmed to be degraded by agarose gel electrophoresis. In this reaction system, the amount of Cas9 enzyme required to completely convert 1 nmol of substrate (PvuII-linearized pBR322 DNA) into product in 1 minute is 0.37 nmol, and the Cas9 enzyme gram weight is 59.57 ng. The enzyme activity of the Cas9 enzyme is 0.37 nmol (the amount of enzyme required to convert 1 nmol of substrate into product in 1 minute).

[0140] Those skilled in the art will understand that the molar ratio of Cas9 enzyme to the desired gRNA is calculated based on the aforementioned Cas9 enzyme activity, and the concentration of Cas9 enzyme in the delivery complex is confirmed. When the activity of Cas9 enzyme changes, those skilled in the art can convert the ratio determined herein based on the description of activity in the instructions for different enzymes to select the concentration of Cas9 enzyme to be used and its molar ratio to gRNA.

[0141] In one aspect, the Cas enzyme is a nicking enzyme. In a preferred embodiment, the Cas9 is delivered to the cell as mRNA. This allows for transient expression of the enzyme, thereby reducing toxicity. Cas9 can also be delivered to the cell in a nucleotide construct encoding and expressing the Cas9 enzyme. Alternatively, Cas9 can be expressed under the control of an inducible promoter.

[0142] The terms CRISPR and Cas enzyme are generally used interchangeably herein unless otherwise stated. As mentioned above, many residue numbers used herein refer to Cas9 enzymes derived from the type II CRISPR locus in Streptococcus pyogenes. However, it should be understood that the present invention includes Cas9 from other microbial species, such as SpCas9, SaCa9, St1Cas9, etc. Those skilled in the art will be able to determine the appropriate corresponding residues in Cas9 enzymes other than SpCas9 by comparing relevant amino acid sequences. The term sgRNA refers to a short gRNA. During gene editing, the gRNA, tracr pairing sequence, and tracr sequence may be given individually or as a complete RNA sequence. The binding of the Cas9 protein to gRNA enables DNA cleavage at a specific site. The CRISPR / Cas system derived from Streptococcus pyogenes recognizes a 23 bp sequence and can target 20 bp. The last three NGG sequences at its recognition site are called the PAM (protospacer adjacent motif) sequence.

[0143] Unless otherwise stated, the terms Cas enzyme, CRISPR enzyme, CRISPR protein, Cas protein, and CRISPR Cas are generally used interchangeably.

[0144] Cas transgenes can be delivered via vectors (e.g., AAV, adenovirus, lentivirus), and / or particles and / or nanoparticles, and / or electrotransfer.

[0145] In one embodiment, the exons of the corresponding coding genes in the constant regions of one or both of the α and β chains of the TCR are knocked out using CRISPER / Cas technology, rendering the endogenous TCR inactive. Preferably, the first exon of the constant region of the α chain of the endogenous TCR is knocked out at a specific site.

[0146] "Inhibition" or "containment" of B2M or TCR expression means a reduction in B2M or TCR expression in cells of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%. More specifically, "inhibition" or "containment" of B2M expression means a reduction in B2M content in cells of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%. The expression or content of the protein in cells can be determined using a B2M or TCR-specific antibody by any suitable method known in the art, such as ELISA, immunohistochemistry, Western blotting, or flow cytometry.

[0147] As used in this invention, the term "modification" refers to an alteration in the state or structure of the protein or polypeptide of this invention. Modifications can be chemical, structural, or functional. T-cell receptors (TCRs) are cell surface receptors involved in T-cell activation in response to antigen presentation. TCRs typically consist of two chains, α and β, which can assemble to form heterodimers and associate with the CD3 transducing subunit to form a T-cell receptor complex present on the cell surface. The α and β chains of the TCR are composed of immunoglobulin-like N-terminal variable (V) and constant (C) regions, hydrophobic transmembrane domains, and short cytoplasmic regions. For immunoglobulin molecules, the variable regions of the α and β chains are generated by V(D)J recombination, resulting in a large diversity of antigen specificity within the T-cell population. However, unlike immunoglobulins that recognize intact antigens, T cells are activated by processed peptide fragments associated with MHC molecules, introducing an additional dimension to antigen recognition through T cells, known as MHC restriction. MHC differences between donor and receptor recognition via T-cell receptors lead to cell proliferation and the potential development of GVHD. It has been shown that normal surface expression of the TCR depends on the co-synthesis and assembly of all seven components of the complex (Ashwell and Klusner 1990). Inactivation of TCRα or TCRβ can lead to the elimination of the TCR from the surface of T cells, thereby preventing the recognition of allogeneic antigens and the resulting GVHD.

[0148] The term "MHC" stands for Histocompatibility Complex, a collective term for all gene groups encoding biocompatibility complex antigens. MHC antigens are expressed in the tissues of all higher vertebrates and are called HLA antigens in human cells. They play a crucial role in transplant responses, mediated by T cells that react to histocompatibility antigens on the surface of the implanted tissue. MHC proteins play a vital role in T cell stimulation. Antigen-presenting cells (usually dendritic cells) display peptides, degradation products of foreign proteins on the cell surface belonging to the MHC. In the presence of co-stimulatory signals, T cells are activated and act on target cells that also display the same peptide / MHC complex. For example, stimulated T helper cells target macrophages that display antigens that bind to their MHC, or cytotoxic T cells (CTLs) act on virus-infected cells that display foreign viral peptides. MHC antigens are classified into NHC class I antigens and MHC class II antigens. In humans, class I HLA gene clusters include three major loci: HLA-A, HLA-B, and HLA-C, as well as several minor loci. Class II HLA clusters also include three major loci: HLA-DP, HLA-DQ, and HLA-DR.

[0149] The term "human leukocyte antigen" (HLA) refers to the genes encoding the major histocompatibility complex in humans, located on chromosome 6 (6p21.31). It comprises a series of tightly linked loci and is closely related to the function of the human immune system. HLA includes class I, II, and III genes. The antigens expressed by HLA class I and II genes are located on the cell membrane and are encoded by MHC-I (HLA-A, HLA-B, and HLA-C loci) and MHC-II (HLA-D region). Class I antigens are distributed on the surface of almost all cells in the body and are heterodimers composed of heavy chains (α chains) and β2-microglobulins (B2M). Class II antigens are mainly glycoproteins located on the surface of macrophages and B lymphocytes.

[0150] The term "B2M" stands for β-2 microglobulin, also known as B2M, which is the light chain of an MHC class I molecule. In humans, B2M is encoded by the b2m gene located on chromosome 15, in contrast to other MHC genes located as gene clusters on chromosome 6. A mouse model of β-2 microglobulin deficiency has shown that B2M is essential for cell surface expression of MHC class I and the stability of peptide-binding grooves. Furthermore, hematopoietic grafts from mice lacking normal cell surface MHC I expression were rejected by NK1.1+ cells in normal mice due to targeted mutations in the β-2 microglobulin gene, indicating that defective expression of MHC I molecules makes bone marrow cells susceptible to rejection by the host immune system (Bix et al. 1991).

[0151] Therefore, in order to provide T cells with lower allogeneic reactivity, the T cells provided by the present invention comprise T cells with an inactivated or mutated TCR gene and an HLA gene.

[0152] The term "TCR inactive" refers to the inactivation of at least one subunit of the endogenous TCR, particularly the inactivation of the TCRα and / or TCRβ genes, and more preferably the TCRα gene.

[0153] The term "MHC inactive" refers to genes that have inactivated at least one subunit of endogenous MHC, particularly genes that have inactivated MHC I, and more preferably, B2M genes.

[0154] The term "T-cell antigen coupler (TAC)" comprises three functional domains: a tumor-targeting domain, including single-chain antibodies, designed ankyrin repeat proteins (DARPin), or other targeting groups; an extracellular domain, containing single-chain antibodies that bind to CD3, thereby bringing the TAC receptor closer to other TCR receptors; and a transmembrane domain and an intracellular domain of the CD4 co-receptor, wherein the intracellular domain connects to protein kinases (LCKs), catalyzing the phosphorylation of immune receptor tyrosine activation motifs (ITAMs) of the TCR complex as an initial step in T-cell activation.

[0155] As used herein, the terms “activation” and “activation” are used interchangeably, and they, along with their other grammatical forms, can refer to the process by which a cell transitions from a quiescent state to an active state. This process can include a response to antigens, migration, and / or phenotypic or genetic changes in a functionally active state. For example, the term “activation” can refer to the process of stepwise activation of T cells. For instance, T cells may require at least two signals to be fully activated. The first signal may occur after binding of the TCR by the antigen-MHC complex, while the second signal may occur through the binding of co-stimulatory molecules (see Table 1 for a list of co-stimulatory molecules). In vitro, anti-CD3 can mimic the first signal, and anti-CD28 can mimic the second signal. For example, engineered T cells can be activated by expressed CARs. As used herein, T cell activation or T cell triggering can refer to the state of T cells that have been adequately stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function.

[0156] The term "chimeric receptor" refers to a fusion molecule created by linking DNA fragments or corresponding cDNAs of proteins from different sources using gene recombination technology. Chimeric receptors include, but are not limited to, chimeric antigen receptors (CARs), modified T-cell (antigen) receptors (TCRs), T-cell fusion proteins (TFPs), and T-cell antigen couplers (TACs).

[0157] The term "co-stimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to the same co-stimulatory molecule on T cells, thereby providing a signal that, together with a first signal provided by the binding of, for example, the TCR / CD3 complex to a peptide-loaded MHC molecule, mediates T cell responses, including but not limited to proliferation, activation, and differentiation. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin β receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, in particular, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0158] The term "co-stimulatory molecule" refers to an identity binding partner on a T cell that specifically binds to a co-stimulatory ligand, thereby mediating a co-stimulatory response in the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0159] The term "co-stimulatory signal" refers to a signal that binds to cellular stimulatory signaling molecules, such as TCR / CD3, and in combination leads to the upregulation or downregulation of T cell proliferation and / or key molecules.

[0160] The term "chimeric antigen receptor" or "CAR" refers to an engineered molecule that can be expressed by immune cells, including but not limited to T cells. CARs are expressed in T cells and can redirect T cells to induce the specific killing of target cells determined by the artificial receptor. The extracellular binding domain of a CAR can be derived from mouse, humanized, or fully human monoclonal antibodies. When present in immune effector cells, it provides the cells with specificity against target cells (typically cancer cells) and has intracellular signaling generation. A CAR typically comprises at least one extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain"), which includes functional signaling domains derived from stimulatory and / or co-stimulatory molecules as defined below. In some aspects, the polypeptide group is adjacent to each other. The polypeptide group includes dimerization switches that allow the polypeptides to couple to each other in the presence of dimerizing molecules, for example, that can couple the antigen-binding domain to the intracellular signaling domain. In one aspect, the stimulatory molecule is a ζ-chain that binds to the T cell receptor complex. In one aspect, the cytoplasmic signaling domain further includes one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the co-stimulatory molecule is selected from the co-stimulatory molecules described herein, such as 4-1BB (i.e., CD137), CD27, and / or CD28. In one aspect, the CAR includes a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR includes a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR includes a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and two functional signaling domains derived from one or more co-stimulatory molecules.

[0161] The term "signal transduction domain" refers to a functional portion of a protein that functions by transmitting information within the cell, acting as an effector through a defined signal transduction pathway to regulate cellular activity by generating a second messenger or by responding to such a messenger.

[0162] The term "cell" and its other grammatical forms can refer to cells of human or non-human animal origin. Engineered cells can also refer to cells that express CAR.

[0163] The term "transfection" refers to the introduction of exogenous nucleic acids into eukaryotic cells. Transfection can be achieved through a variety of techniques known in the art, including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, and biolistics.

[0164] The term "stable transfection" or "stable transfection" refers to the introduction and integration of foreign nucleic acids, DNA, or RNA into the genome of a transfected cell. The term "stable transfectant" refers to a cell in which foreign DNA is stably integrated into the genomic DNA.

[0165] The terms "nucleic acid molecule encoding," "encoding DNA sequence," and "encoding DNA" refer to the sequence or order of deoxyribonucleotides along a deoxyribonucleic acid (DNA) chain. This sequence of deoxyribonucleotides determines the sequence of amino acids along a polypeptide (protein) chain. Therefore, a nucleic acid sequence encodes an amino acid sequence.

[0166] The term "individual" refers to any animal, such as a mammal or marsupial. Individuals of this invention include, but are not limited to, humans, non-human primates (such as rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any kind of poultry.

[0167] The term "peripheral blood mononuclear cell" (PBMC) refers to cells in peripheral blood that have a single nucleus, including lymphocytes, monocytes, etc.

[0168] The term "T cell activation" or "T cell activation" and its other grammatical forms can refer to the state of T cells that have been adequately stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function. In some cases, "complete T cell activation" can be analogous to triggering T cell cytotoxicity. T cell activation can be measured using a variety of assays known in the art. These assays may include ELISA, ELISPOT for measuring cytokine secretion, flow cytometry assays (CD107) for measuring intracellular cytokine expression, flow cytometry assays for measuring proliferation, and cytotoxicity assays (51Cr release assays) for determining target cell elimination. These assays typically use a comparison between control (non-engineered cells) and engineered cells (CAR T) to determine the relative activation of engineered cells compared to the control. Furthermore, the assays may be compared with engineered cells incubated or contacted with target cells that do not express the target antigen. For example, the comparison may be a comparison with GPC3-CART cells incubated with target cells that do not express GPC3.

[0169] When used to refer to nucleotide sequences, the term "sequence" as used herein, and its other grammatical forms, can include DNA or RNA, and can be single-stranded or double-stranded. Nucleic acid sequences can mutate. Nucleic acid sequences can have any length.

[0170] The term "effective amount" as used in this article refers to the amount that provides therapeutic or preventative benefits.

[0171] As used herein, the term "expression vector" refers to a vector containing recombinant polynucleotides that include expression regulatory sequences effectively linked to the nucleotide sequence to be expressed. Expression vectors contain sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or an in vitro expression system. Expression vectors include all those known in the art, such as viscera, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0172] As used in this article, the term "lentivirus" refers to the genus *Lentinvirus* within the family Retroviridae. Retroviruses are unique among retroviruses in their ability to infect non-dividing cells; they can deliver large amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Lentiviral vectors provide a means to achieve significant levels of gene transfer in vivo.

[0173] As used herein, the term "vector" refers to a composition containing isolated nucleic acids and capable of delivering those isolated nucleic acids into the cell. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, etc.

[0174] The term "sequence identity" as used herein is determined by comparing two best-matched sequences across a comparison window (e.g., at least 20 positions), where portions of the polynucleotide or polypeptide sequence within the comparison window may contain additions or deletions (i.e., gaps), such as 20% or less gaps (e.g., 5 to 15%, or 10 to 12%) for two best-matched sequences compared to a reference sequence (which does not contain additions or deletions). The percentage is typically calculated by determining the number of positions where identical nucleic acid bases or amino acid residues occur in both sequences to produce the number of correctly matched positions. This number is then divided by the total number of positions in the reference sequence (i.e., the window size), and the result is multiplied by 100 to produce the percentage of sequence identity.

[0175] As used in this article, the term "exogenous" refers to a nucleic acid molecule or polypeptide that is not endogenously expressed in cells, or whose expression level is insufficient to achieve the function it would have if overexpressed. Therefore, "exogenous" includes recombinant nucleic acid molecules or polypeptides expressed in cells, such as exogenous, heterologous, and overexpressed nucleic acid molecules and polypeptides.

[0176] The term "endogenous" refers to a nucleic acid molecule or polypeptide originating from a gene within an organism's own genome. In some embodiments, the chimeric receptor of this invention is a chimeric antigen receptor. As used herein, the term "Chimeric Antigen Receptor (CAR)" refers to a tumor antigen-binding domain fused to an intracellular signal transduction domain that activates T cells. Commonly, the extracellular binding domain of a CAR is derived from mouse, humanized, or human monoclonal antibodies.

[0177] Chimeric antigen receptors typically include a (fine) extracellular antigen-binding region. In some embodiments, the extracellular antigen-binding region may be entirely human. In other embodiments, the extracellular antigen-binding region may be humanized. In still other embodiments, the extracellular antigen-binding region may be murine, or the chimera in the extracellular antigen-binding region may consist of amino acid sequences from at least two different animals. In some embodiments, the extracellular antigen-binding region may be non-human. A variety of antigen-binding regions can be designed. Non-limiting examples include single-chain variable fragments (scFv) derived from antibodies, fragment antigen-binding regions (Fab) selected from libraries, single-domain fragments, or natural ligands that bind to their homologous receptors. In some embodiments, the extracellular antigen-binding region may comprise scFv, Fab, or a natural ligand, and any derivatives thereof. An extracellular antigen-binding region may refer to a molecule other than a complete antibody, which may contain a portion of the complete antibody and may bind to an antigen bound to the complete antibody. Examples of antibody fragments may include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; bifunctional antibodies, linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. Extracellular antigen-binding regions, such as scFv, Fab, or natural ligands, may be part of a CAR that determines antigen specificity. Extracellular antigen-binding regions can bind to any complementary target. Extracellular antigen-binding regions can be derived from antibodies with known variable region sequences. Extracellular antigen-binding regions can be obtained from antibody sequences derived from available mouse hybridomas. Alternatively, extracellular antigen-binding regions can be obtained from whole-extracellular cleavage sequencing of tumor cells or primary cells such as tumor-infiltrating lymphocytes (TILs).

[0178] In some cases, the binding specificity of extracellular antigen-binding regions can be determined by complementarity-determining regions (CDRs) or core-determining regions (CDRs), such as light chain CDRs or heavy chain CDRs. In many cases, binding specificity can be determined by both light chain CDRs and heavy chain CDRs. A given combination of heavy chain CDRs and light chain CDRs can provide a given binding bag that can confer greater affinity and / or specificity to an antigen (e.g., GPC3) compared to other reference antigens. For example, CDRs specific to phosphatidylinositol proteoglycan-3 can be expressed in the extracellular binding region of a CAR, allowing a GPC3-targeting CAR to target T cells to GPC3-expressing tumor cells.

[0179] In some aspects of any of the embodiments disclosed herein, the extracellular antigen-binding region, such as the scFv, may comprise an antigen-specific light chain CDR. The light chain CDR may be a complementation-determining region of the scFv light chain of an antigen-binding unit, such as a CAR. The light chain CDR may comprise a continuous sequence of amino acid residues, or two or more continuous sequences of amino acid residues separated by non-complementation-determining regions (e.g., framework regions). In some cases, the light chain CDR may comprise two or more light chain CDRs, which may be referred to as light chain CDR-1, CDR-2, etc. In some cases, the light chain CDR may comprise three light chain CDRs, which may be referred to as light chain CDR-1, light chain CDR-2, and light chain CDR-3, respectively. In some instances, a group of CDRs present on a common light chain may be collectively referred to as light chain CDRs.

[0180] In some aspects of any of the embodiments disclosed herein, the extracellular antigen-binding region, such as the scFv, may contain an antigen-specific heavy chain CDR. The heavy chain CDR may be a heavy chain complementarity-determining region of the antigen-binding unit, such as the scFv. The heavy chain CDR may contain a continuous sequence of amino acid residues, or a continuous sequence of two or more amino acid residues separated by non-complementarity-determining regions (e.g., framework regions). In some cases, the heavy chain CDR may contain two or more heavy chain CDRs, which may be referred to as heavy chain CDR-1, CDR-2, etc. In some cases, the heavy chain CDR may contain three heavy chain CDRs, which may be referred to as heavy chain CDR-1, heavy chain CDR-2, and heavy chain CDR-3, respectively. In some cases, a group of CDRs present on a common heavy chain may be collectively referred to as heavy chain CDRs.

[0181] Extracellular antigen-binding regions can be modified in various ways using genetic engineering. In some cases, the extracellular antigen-binding region can be mutated to select for a higher affinity for its target. In others, the affinity of the extracellular antigen-binding region for its target can be optimized for targets that are expressed at low levels in normal tissues. This optimization can be performed to minimize potential toxicity. In still others, clones of extracellular antigen-binding regions with higher affinity for the membrane-bound form of the target may be superior to their soluble counterparts. This modification can be performed because different levels of the soluble form of the target can also be detected, and their targeting can cause undesirable toxicity.

[0182] In some cases, the extracellular antigen-binding region includes a hinge or spacer region. The terms hinge and spacer region are used interchangeably. A hinge can be considered part of the CAR that provides flexibility to the extracellular antigen-binding region. In some cases, the hinge can be used to detect CARs on the cell surface, particularly when antibodies that detect the extracellular antigen-binding region are ineffective or unavailable. For example, the length of a hinge derived from an immunoglobulin may need to be optimized depending on the location of the epitope on the target of the extracellular antigen-binding region.

[0183] In some cases, the hinge may not belong to an immunoglobulin, but to the natural hinge of another molecule, such as the CD8α molecule. The CD8α hinge may contain cysteine ​​and proline residues known to play a role in the interaction between the CD8 co-receptor and MHC molecules. These cysteine ​​and proline residues can affect the performance of the CAR. The CAR hinge can be size-tunable. This morphology of the immune synapse between T cells and target cells also defines the distance at which the CAR cannot functionally bridge the synaptic distance due to distal membrane epitopes on the cell surface target molecules; even using a short-hinge CAR cannot achieve a synaptic distance close enough for signal transduction. Similarly, proximal membrane CAR target antigen epitopes only show signal output in the context of long-hinge CARs. The hinge can be tuned depending on the extracellular antigen-binding region used. The hinge can be of any length. Transmembrane domains can anchor the CAR to the cell's plasma membrane. The natural transmembrane portion of CD28 can be used in CARs. In other cases, the natural transmembrane portion of CD8α can also be used in CARs. "CD8" can be a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity with NCBI reference number NP_001759 or a fragment thereof that has stimulatory activity. "CD8 nucleic acid molecule" can be a polynucleotide encoding a CD8 polypeptide. In some cases, the transmembrane region can be the native transmembrane portion of CD28. "CD28" can refer to a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity with NCBI reference number NP_006130 or a fragment thereof that has stimulatory activity. "CD28 nucleic acid molecule" can be a polynucleotide encoding a CD28 polypeptide. In some cases, the transmembrane portion can contain the CD8α region. The intracellular signaling domain of the CAR can be responsible for activating at least one of the effector functions of a T cell to which the CAR has been placed. The CAR can induce effector functions of the T cell, such as cytolytic activity or co-operational activity, including the secretion of cytokines. Therefore, the term "intracellular signaling domain" refers to the portion of a protein that transduces effector functional signals and guides the cell to perform specific functions. While the entire intracellular signaling region can often be used, in many cases it is not necessary to use the entire chain of the signaling domain. In some cases, a truncated portion of the intracellular signaling region is used. In some cases, the term intracellular signaling domain is therefore intended to include any truncated portion of the intracellular signaling region sufficient to transduce effector functional signals.

[0184] Preferred examples of signaling domains used in CARs may include cytoplasmic sequences of T-cell receptors (TCRs) and co-receptors that work together to initiate signal transduction after target-receptor binding, as well as any derivative or variant sequences thereof and any synthetic sequences of the same functionality.

[0185] In some cases, the intracellular signaling domain may contain a signaling motif of a known immune receptor tyrosine activation motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include functional signaling domains of proteins derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, DAP10, or DAP12. However, in a preferred embodiment, the intracellular signaling domain is derived from the CD3ζ chain. An example of a T cell signaling domain containing one or more ITAM motifs is the CD3ζ domain, also known as the T cell receptor T3ζ chain or CD247. This domain is part of the T cell receptor-CD3 complex and plays an important role in linking antigen recognition with the main effector activation of T cells in several intracellular signal transduction pathways. As used herein, CD3ζ primarily refers to human CD3ζ and its isotypes, including proteins having substantially the same sequence, as known from Swissprot entry P20963. As part of the chimeric antigen receptor, it is reiterated that the whole T-cell receptor T3ζ chain is not required, and any derivative thereof containing the signaling domain of the T-cell receptor T3ζ chain is appropriate, including any of its functional equivalents.

[0186] Intracellular signal transduction domains can be selected from any of the domains in Table 1. In some cases, domains can be modified such that the identity with the reference domain can be from about 50% to about 100%. Any of the domains in Table 1 can be modified such that the modified form can contain about 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, or up to about 100% identity. The intracellular signal transduction region of the CAR can further include one or more co-stimulatory domains. The intracellular signal transduction region can contain a single co-stimulatory domain, such as the ζ chain (first-generation CAR) or its combination with CD28 or 4-1BB (second-generation CAR). In other instances, the intracellular signal transduction region can contain two co-stimulatory domains, such as CD28 / OX40 or CD28 / 4-1BB (third-generation).

[0187] Along with intracellular signaling domains such as CD8, these co-stimulatory domains can generate downstream activation of kinase pathways, thereby supporting gene transcription and functional cellular responses. The co-stimulatory domains of CARs can activate proximal signaling proteins associated with the CD28 (phosphatidylinositol-4,5-bisphosphate 3-kinase) or 4-1BB / OX40 (TNF-α receptor-associated factor adaptor) pathways, as well as MAPK and Akt activation.

[0188] In some cases, signals generated via CAR may combine with auxiliary or co-stimulatory signals. For co-stimulatory signaling domains, chimeric antigen receptor-like complexes can be engineered to include several possible co-stimulatory signaling domains. As is well known in the art, in naive T cells, binding of the T cell receptor alone is insufficient to induce complete activation of T cells into cytotoxic T cells. Complete activation of productive T cells requires a second co-stimulatory signal. Several receptors that provide co-stimulation for T cell activation have been reported, including but not limited to CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. The signaling pathways used by these co-stimulatory molecules all synergize with the main T cell receptor activation signal. The signals provided by these co-stimulatory signaling regions can synergize with the main effector activation signal derived from one or more ITAM motifs (e.g., the CD3zeta signaling domain) and can fulfill the requirements for T cell activation.

[0189] In some cases, adding a co-stimulatory domain to a chimeric antigen receptor-like complex can enhance the efficacy and durability of engineered cells. In another embodiment, the T cell signaling domain and the co-stimulatory domain are fused together to form a signal transduction region.

[0190] Table 1. Costimulatory domains

[0191]

[0192] The term "adjustment" as used in this article refers to positive or negative changes. Examples of adjustments include changes of 1%, 2%, 10%, 25%, 50%, 75%, or 100%.

[0193] As used in this article, the term "treatment" refers to a clinical intervention in the process of attempting to alter an individual's or treat a disease caused by cells, which can be preventative or intervention in the clinicopathological process. Treatment effects include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the condition, and alleviating or improving prognosis.

[0194] T cells

[0195] The T cells mentioned in this article refer to T cells modified by the method of this invention, wherein the endogenous TCR gene and / or MHC gene of the T cells are silenced.

[0196] In some cases, T cells can be stem memory TSCM cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+, and / or IL-7Rα+. These stem memory cells may also express CD95, IL-2Rβ, CXCR3, and / or LFA-1 and exhibit many functional properties different from those of the stem memory cells. Alternatively, immunoreactive cells can also be central memory TCM cells containing L-selectin and CCR7, wherein the central memory cells may secrete, for example, IL-2, but not IFNγ or IL-4. Immunoreactive cells can also be effector memory TEM cells containing L-selectin or CCR7 and producing, for example, effector cytokines such as IFNγ and IL-4.

[0197] Typically, the vector is delivered to an individual patient via systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local application, as described below. Alternatively, the vector can be delivered ex vivo to cells, such as cells removed from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and then typically re-implanted into the patient after selecting cells incorporating the vector. Cell expansion can be performed before or after selection.

[0198] The T cells can be obtained from many sources, including PBMCs, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some cases, T cells can be obtained from blood collected from an individual using any number of techniques known to those skilled in the art, such as Ficoll™ isolation. In one embodiment, cells from an individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In one embodiment, cells collected via apheresis can be washed to remove plasma fractions and placed in a suitable buffer or culture medium for subsequent processing steps. Alternatively, cells can be derived from healthy donors, specifically from patients diagnosed with cancer.

[0199] In some implementations, the cells may be part of a mixed cell population with different phenotypic characteristics. Cell lines can also be obtained from transformed T cells according to the methods described above. Cells can also be obtained from cell therapy libraries.

[0200] In some cases, suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subsets, such as, but not limited to, T cells, natural killer cells, monocytes, natural killer T cells, monocyte precursor cells, hematopoietic stem cells, or non-pluripotent stem cells. In other cases, the cells can be any T cell, such as tumor-infiltrating cells (TILs), such as CD3+ T cells, CD4+ T cells, CD8+ T cells, or any other type of T cell. T cells can also include memory T cells, memory stem T cells, or effector T cells. T cells can also be selected from a large population, such as from whole blood. T cells can also be expanded from a large population. T cells may also be predisposed to specific populations and phenotypes. For example, T cells may be predisposed to phenotypes including CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells may be selected from one or more markers from the following list: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells also include stem cells, such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, and mesenchymal stem cells. Suitable cells may comprise any number of primary cells, such as human cells, non-human cells, and / or mouse cells. Suitable cells may be progenitor cells. Suitable cells may be derived from the subject to be treated (e.g., a patient).

[0201] The amount of therapeutically effective cells required in a patient can vary depending on cell viability and the efficiency of cell genetic modification (e.g., the efficiency of transgene integration into one or more cells, or the expression level of proteins encoded by the transgene). In some cases, the product of genetically modified cell viability (e.g., doubling) and the efficiency of transgene integration may correspond to the therapeutic amount of cells available to be administered to the subject. In some cases, an increase in genetically modified cell viability may correspond to a reduction in the amount of cells required for therapeutic efficacy in the patient. In some cases, an increase in the efficiency of transgene integration into one or more cells may correspond to a reduction in the number of cells required for therapeutic efficacy in the patient. In some cases, determining the required amount of therapeutically effective cells may include determining the function associated with changes in cell function over time. In some cases, determining the required amount of therapeutically effective cells may include determining the function corresponding to changes in the efficiency of transgene integration into one or more cells based on time-related variables (e.g., cell culture time, electroporation time, cell stimulation time). In some cases, therapeutically effective cells may be a cell population containing approximately 30% to approximately 100% expression of chimeric receptors on the cell surface. In some cases, as measured by flow cytometry, therapeutically effective cells can express approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than approximately 99.9% of the chimeric receptor on their cell surface.

[0202] Pharmaceutical Composition

[0203] The T cells of the present invention can be used to prepare pharmaceutical compositions. In addition to comprising an effective amount of T cells, the pharmaceutical compositions may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that when the molecular matrix and composition are appropriately administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.

[0204] Specific examples of substances that can serve as pharmaceutically acceptable carriers or components include antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers.

[0205] The compositions of the present invention can be formulated into various dosage forms as needed, and the dosage beneficial to the patient can be determined by a physician based on factors such as patient type, age, weight, general disease condition, and route of administration. The route of administration can be, for example, parenteral administration (e.g., injection) or other treatment methods.

[0206] "Parenteral" administration of the composition includes techniques such as subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection or infusion.

[0207] A formulation containing a population of T cells administered to an individual contains multiple T cells effective in treating and / or preventing a specific indication or disease. Therefore, a therapeutically effective population of immune-responsive cells can be administered to an individual. Typically, an administration of approximately 1 × 10⁻⁶ T cells is given. 4 To approximately 1×10 10 A formulation containing approximately 1 × 10⁶ immune reactive cells. In most cases, the formulation will contain approximately 1 × 10⁶ immune reactive cells. 5 To approximately 1×10 9 5 × 10 immune reactive cells 5 Approximately 5×10 8 One immune reactive cell, or approximately 1 × 102 6 To approximately 1×10 7 The number of CAR immune-reactive cells administered to an individual will vary widely depending on factors such as the location, origin, identity, extent, and severity of the cancer, as well as the individual's age and physical condition. The physician will ultimately determine the appropriate dose to use.

[0208] In some embodiments, chimeric antigen receptors are used to stimulate immune cell-mediated immune responses. For example, a T cell-mediated immune response is an immune response involving T cell activation. Activated antigen-specific cytotoxic T cells are able to induce apoptosis in target cells displaying exogenous antigen epitopes on their surfaces, such as cancer cells displaying tumor antigens. In another embodiment, chimeric antigen receptors are used to deliver antitumor immunity in mammals. Due to the T cell-mediated immune response, the subject will develop antitumor immunity.

[0209] In some cases, methods of treating subjects with cancer may involve administering one or more of the T cells described in this invention to the subject in need of treatment. These T cells can bind to tumor target molecules and induce cancer cell death.

[0210] As described above, the present invention also provides a method for treating pathogen infection in an individual, comprising administering a therapeutically effective amount of the present invention's T cells to the individual.

[0211] Combined with anti-tumor drugs

[0212] In some embodiments, the T cells of the present invention can be administered in combination with another therapeutic agent. In some embodiments, the other therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents that can be used in combination with the T cells of the present invention include, but are not limited to, mitotic inhibitors (vinblastine alkaloids), including vincristine, vinblastine, vindesin, and novibine™ (vinorelbine, 5'-dehydrosulfuric acid); topoisomerase I inhibitors, such as camptothecin compounds, including Camptosar™ (irinotecan HCl), Hycamtin™ (topotecan HCl), and other compounds derived from camptothecin and its analogues; podophyllotoxin derivatives, such as etoposide, teniposide, and midocizol; alkylating agents cis... Platinum, cyclophosphamide, nitrogen mustard, trimethylene thiophosphamide, carmustine, busulfan, chlorambucil, briquette, uracil mustard, chlorprofen, and dacarbazine; antimetabolites, including cytarabine, fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine; antibiotics, including but not limited to doxorubicin, bleomycin, daunorubicin, daunorubicin, mitomycin, sarcomacin C, and donomycin; and other chemotherapeutic agents, including but not limited to antitumor antibodies, dacarbazine, cytidine, amsacon, melphalan, ifosfamide, and mitoxantrone.

[0213] In some embodiments, chemotherapeutic agents that can be used in combination with the T cells of the present invention include, but are not limited to, anti-angiogenic agents, including anti-VEGF antibodies (including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides) and other angiogenesis inhibitors, such as angiostatin, endostatin, interferon, retinoic acid and tissue inhibitors of metalloproteinases-1 and-2.

[0214] Reagent test kit

[0215] The present invention also provides a kit comprising the T cells of the present invention. The kit can be used to treat or prevent cancer, pathogen infection, immune disorders, or allogeneic transplantation. In one embodiment, the kit may comprise a therapeutic or preventative composition containing an effective amount of one or more unit doses of T cells.

[0216] In some implementations, the kit includes a sterile container that may contain a therapeutic or preventative composition.

[0217] In some cases, the kit may include approximately 1 × 10 4 One to approximately 1 × 10⁹ cells 6 100 cells. In some cases, the kit may contain at least approximately 1 × 10⁶ cells. 5 1 × 10⁶ cells, at least approximately 1 × 10⁶ 6 1 × 10⁶ cells, at least approximately 1 × 10⁶ 7 10 cells, at least approximately 4 × 10 710 cells, at least approximately 5 × 10 7 10 cells, at least approximately 6 × 10 7 10 cells, at least approximately 6 × 10 7 8 × 10 cells 7 10 cells, at least approximately 9 × 10 7 1 × 10⁶ cells, at least approximately 1 × 10⁶ 8 10 cells, at least approximately 2 × 10 8 10 cells, at least approximately 3 × 10 8 10 cells, at least approximately 4 × 10 8 10 cells, at least approximately 5 × 10 8 10 cells, at least approximately 6 × 10 8 10 cells, at least approximately 6 × 10 8 Cells, at least approximately 8 × 10 8 10 cells, at least approximately 9 × 10 8 Cells, at least about 1 × 10 9 10 cells, at least approximately 2 × 10 9 10 cells, at least approximately 3 × 10 9 10 cells, at least approximately 4 × 10 9 10 cells, at least approximately 5 × 10 9 10 cells, at least approximately 6 × 10 9 10 cells, at least approximately 8 × 10 9 10 cells, at least approximately 9 × 10 9 1 × 10⁶ cells, at least approximately 1 × 10⁶ 10 10 cells, at least approximately 2 × 10 10 10 cells, at least approximately 3 × 10 10 10 cells, at least approximately 4 × 10 10 10 cells, at least approximately 5 × 10 10 10 cells, at least approximately 6 × 10 10 10 cells, at least approximately 9 × 10 10 10 cells, at least approximately 9 × 10 10 1 × 10⁶ cells, at least approximately 1 × 10⁶ 11 10 cells, at least approximately 2 × 10 11 10 cells, at least approximately 3 × 10 11 10 cells, at least approximately 4 × 10 11 10 cells, at least approximately 5 × 10 11 10 cells, at least approximately 8 × 10 11 10 cells, at least approximately 9 × 10 11 One cell, or at least about 1 × 10⁻⁶ cells. 12 Cells. For example, approximately 5 × 10⁶ cells can be included in the kit. 10 Each cell.

[0218] In some cases, the kit may include allogeneic cells. In some cases, the kit may include cells that may contain genomic modifications. In some cases, the kit may contain "off-the-shelf" cells. In some cases, the kit may include cells that can be expanded for clinical use. In some cases, the kit may contain contents for research purposes.

[0219] Advantages of this invention:

[0220] Gene editing using the method of this invention not only has high editing efficiency but also excellent cell survival rate.

[0221] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0222] For example, in the following embodiments, T cells are selected to illustrate the method of the present invention.

[0223] T cells are obtained by separating human peripheral blood mononuclear cells (PBMCs) from peripheral blood collected from healthy donors, adding beads conjugated with CD3 / CD28 antibodies for activation, and then culturing and expanding them to obtain T cells.

[0224] Example 1: Design and synthesis of sgRNA targeting the TRAC gene

[0225] Targeting the first exon of the TRAC (TCRαC, T cell receptor α constant locus) gene (nucleotide sequence as shown in SEQ ID NO:1), such as Figure 1 As shown, eight sgRNA sequences targeting the TRAC gene were designed and obtained: sg-TRAC-1 (SEQ ID NO:2), sg-TRAC-2 (SEQ ID NO:3), sg-TRAC-3 (SEQ ID NO:4), sg-TRAC-4 (SEQ ID NO:5), sg-TRAC-5 (SEQ ID NO:32), sg-TRAC-6 (SEQ ID NO:33), sg-TRAC-7 (SEQ ID NO:39), and sg-TRAC-8 (SEQ ID NO:40).

[0226] The following samples were selected for experiments: sg-TRAC-1 (SEQ ID NO:2), sg-TRAC-2 (SEQ ID NO:3), sg-TRAC-3 (SEQ ID NO:4), sg-TRAC-5 (SEQ ID NO:32), sg-TRAC-6 (SEQ ID NO:33), sg-TRAC-7 (SEQ ID NO:39), and sg-TRAC-8 (SEQ ID NO:40). Primers shown in SEQ ID NO: 20 and 21 were synthesized in vitro, and sg-TRAC-1 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). Primers shown in SEQ ID NO: 22 and 23 were synthesized in vitro, and sg-TRAC-2 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). Primers shown in SEQ ID NO: 24 and 25 were synthesized in vitro, and sg-TRAC-3 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). Primers shown in SEQ ID NO: 34 and 35 were synthesized in vitro, and sg-TRAC-5 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). Primers shown in SEQ ID NO: 36 and 37 were synthesized in vitro, and sg-TRAC-6 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). Primers shown in SEQ ID NO: 41 and 42 were synthesized in vitro, and sg-TRAC-6 was transcribed and amplified using an in vitro gRNA transcription kit (Thermo Fisher). The sg-TRAC-7 was transcribed and amplified using a gRNA transcription kit (purchased from Thermo Fisher). Primers shown in SEQ ID NO: 43 and 44 were synthesized in vitro. The sg-TRAC-8 was transcribed and amplified using an in vitro gRNA transcription kit (purchased from Thermo Fisher).

[0227] TRAC-exon 1 sequence (SEQ ID NO:1):

[0228] ATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGAC AAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGG

[0229] sg-TRAC-1 (SEQ ID NO: 2): AGAGTCTCTCAGCTGGTACA

[0230] sg-TRAC-2 (SEQ ID NO:3):TCTCTCAGCTGGTACACGGC

[0231] sg-TRAC-3 (SEQ ID NO:4):GAGAATCAAAATCGGTGAAT

[0232] sg-TRAC-4 (SEQ ID NO:5): CTCTCAGCTGGTACACGGCA

[0233] sg-TRAC-5 (SEQ ID NO:32):GTCTCTCAGCTGGTACA

[0234] sg-TRAC-6 (SEQ ID NO:33): AGTCTCTCAGCTGGTACA

[0235] sg-TRAC-7 (SEQ ID NO:39):TTAGAGTCTCTCAGCTGGTACA

[0236] sg-TRAC-8 (SEQ ID NO:40):TTTAGAGTCTCTCAGCTGGTACA

[0237] Example 2: Effect of different ratios of Cas9 enzyme and sg-TRAC on knockout efficiency

[0238] Activated T cells were collected and counted to a cell density of 2*10^7 / ml. sg-TRAC-1 (SEQ ID NO:2) was selected as the sgRNA.

[0239] Cas 9 enzyme (purchased from NEB) and sg-TRAC-1 were mixed in molar ratios of 1:2, 1:3, 1:4, and 1:5 to form RNP complexes. After incubation at room temperature for 10 minutes, the mixture was added to 1*10^6 T cells (final concentration of Cas 9 enzyme: 0.3 μM). The molar number of sg-TRAC-1 was calculated based on the base composition of the gRNA and a concentration of 4.03 μg / μl (OD260 / OD280 = 1.98).

[0240] The RNP complex was introduced into T cells using a BTX electroporator (Harvard Instruments, USA) with electroporation parameters of 250V and 5ms. On day 5 post-transfection, T cells were harvested for CD3 antibody flow cytometry staining (BD Biosciences) to verify the efficiency of TCR knockout. Flow cytometry results are shown below. Figure 2 As shown in Table 1, the knockout efficiency was above 70% when the molar ratio of Cas9 enzyme to sg-TRAC-1 was between 1:3 and 1:5. The highest knockout efficiency, reaching 87.2%, was achieved when the molar ratio of Cas9 enzyme to sg-TRAC-1 was 1:4. This indicates that a molar ratio of Cas9 enzyme to gRNA of 1:4 yields the best gene knockout effect.

[0241] Table 1. Statistical analysis of the effects of RNPs with different composition ratios on TCR knockout

[0242]

[0243] Example 3: Effects of different sgRNAs on TRAC gene knockout

[0244] Three different sgRNAs targeting the TRAC gene were selected: sg-TRAC-1, sg-TRAC-2, and sg-TRAC-3.

[0245] The effect on TRAC gene knockout was examined. The three sgRNAs synthesized in Example 1 (sg-TRAC-1, sg-TRAC-2, and sg-TRAC-3) were mixed with Cas9 enzyme (0.5 μM) at a 4:1 ratio to form RNP complexes. These complexes were then introduced into T cells via electroporation using a Maxcyte electroporator (Maxcyte Corporation) based on the instrument's set parameters. On day 5 post-transfection, T cells were subjected to CD3 antibody flow cytometry staining (BD Biosciences) to verify the efficiency of TCR knockout. The flow cytometry results are shown in Figure 3 and Table 2. The knockout effect of sg-TRAC-1 was significantly better than that of sg-TRAC-2 and sg-TRAC-3, indicating that sg-TRAC-1 had the best knockout effect. Simultaneously, the effect of different sg-TRAC-1 lengths on knockout efficiency was tested. Four sgRNAs, sg-TRAC-1(-3bp)(sg-TRAC-5), sg-TRAC-1(-2bp)(sg-TRAC-6), sg-TRAC-1(+3bp)(sg-TRAC-7), and sg-TRAC-1(+2bp)(sg-TRAC-8), were synthesized and mixed with Cas9 enzyme (0.5 μM) at a molar ratio of 4:1 to form RNP complexes. These complexes were then introduced into T cells under the aforementioned conditions. On day 5 post-transfection, T cells were harvested for CD3 antibody flow cytometry staining to verify the TCR knockout efficiency. The experimental results are as follows: Figure 3b As shown, sg-TRAC-1 truncated by 2 or 3 bases has little effect on TCR knockout efficiency, while adding 2 or 3 bases will reduce TCR knockout efficiency. This indicates that the length of sgRNA designed for this site can be varied, and in particular, truncating by 3 or less bases can also achieve a relatively high knockout effect.

[0246] Table 2. Statistical analysis of the effects of different gRNA sequences on TCR knockout

[0247] sgRNA sg-TRAC-1 sg-TRAC-2 sg-TRAC-3 KO efficiency (Day 5) 98.1％ 48.3％ 48.2％

[0248] It should be noted that although sg-TRAC-1 can achieve a TCR knockout efficiency of 90% in publicly published articles, the knockout method used in those articles was an optimized two-electrolysis knockout method, which was relatively cumbersome (see ClinCancer Res. 2017 May 1; 23(9):2255-2266, Fig. 1A shows a TCR knockout rate of 95.7%). Our method can achieve a knockout rate of over 90% with a single electrolysis, which has a clear advantage.

[0249] Example 4: Effect of Cas9 enzyme concentration on TRAC gene knockout

[0250] sg-TRAC-1 (SEQ ID NO:2) was selected as the sgRNA. When the molar ratio of Cas9 enzyme to sg-TRAC-1 was 1:4, different concentrations of Cas9 enzyme (0.0625μM, 0.125μM, 0.25μM, 0.5μM) were set to detect the effect on TRAC gene knockout.

[0251] After incubating the RNP complex at room temperature for 10 minutes, the RNP complex was introduced into T cells using a Maxcyte electroporator (Maxcyte Corporation) according to the instrument settings. On day 5 post-transfection, T cells were harvested for CD3 antibody flow cytometry staining (BD Biosciences) to verify the efficiency of TCR knockout.

[0252] Flow cytometry results as follows Figure 4 As shown in Table 3, when the concentration of Cas9 enzyme is greater than 0.1 μM, the TCR knockout efficiency can reach over 70%, such as over 75% at 0.125 μM; especially at concentrations greater than 0.2 μM, the TCR knockout efficiency can reach over 90%, such as over 94.5% at 0.25 μM; when the concentration of Cas9 enzyme is between 0.3 and 0.5 μM, the TCR knockout efficiency can reach over 95%, and at 0.5 μM, the TCR knockout efficiency can reach 97.4%, while the cell viability is over 90%.

[0253] Table 3. Statistical analysis of the effects of different concentrations of Cas9 enzyme on TCR knockout

[0254]

[0255] Example 5: Design and synthesis of sgRNA targeting the B2M gene

[0256] like Figure 5 As shown, based on the first exon B2M-exon 1 of the B2M gene, the nucleotide sequence of which is shown in SEQ ID NO: 10, four sgRNA sequences targeting the B2M gene were obtained: sg-B2M-1 (SEQ ID NO: 11), sg-B2M-2 (SEQ ID NO: 12), sg-B2M-3 (SEQ ID NO: 13), and sg-B2M-4 (SEQ ID NO: 14).

[0257] sg-B2M-1, sg-B2M-2, and sg-B2M-3 were selected for experiments. Primers shown in SEQ ID NO: 26 and 27 were synthesized in vitro, and sg-B2M-1 was transcribed and amplified using an in vitro gRNA transcription kit (purchased from Thermo Fisher). Primers shown in SEQ ID NO: 28 and 29 were synthesized in vitro, and sg-B2M-2 was transcribed and amplified using an in vitro gRNA transcription kit (purchased from Thermo Fisher). Primers shown in SEQ ID NO: 30 and 31 were synthesized in vitro, and sg-B2M-3 was transcribed and amplified using an in vitro gRNA transcription kit (purchased from Thermo Fisher).

[0258] B2M-exon 1 sequence (SEQ ID NO: 10):

[0259] AATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGC

[0260] sg-B2M-1 (SEQ ID NO: 11): GGCCACGGAGCGAGACATCT

[0261] sg-B2M-2 (SEQ ID NO: 12): GAGTAGCGCGAGCACAGCTA

[0262] sg-B2M-3 (SEQ ID NO: 13): CGCGAGCACAGCTAAGGCCA

[0263] Example 6: The effect of different sgRNA sequences on B2M gene knockout.

[0264] The effects of the sgRNA sequences sg-B2M-1, sg-B2M-2, and sg-B2M-3 targeting the B2M gene obtained in Example 5 on B2M gene knockout were compared.

[0265] After Cas9 enzyme (0.5 μM) and gRNA were mixed at a molar ratio of 1:4 to form an RNP complex, the RNP complex was introduced into T cells using a Maxcyte electroporator (Maxcyte Corporation) according to the instrument's settings. On day 5 post-transfection, T cells were harvested for flow cytometry staining with β-microglobulin antibody (BD Biosciences) to verify the efficiency of B2M knockout. The flow cytometry results are shown below. Figure 6As shown in Table 4, the knockout effects of sg-B2M-1 and sg-B2M-2 reached over 90%, which was significantly better than sg-B2M-3, indicating that both sg-B2M-1 and sg-B2M-2 have excellent knockout effects.

[0266] Table 4. Statistical analysis of the effects of different gRNA sequences on B2M knockout

[0267] gRNA sg-B2M-1 sg-B2M-2 sg-B2M-3 KO efficiency (Day 5) 95.0％ 90.0％ 67.0％

[0268] Using the same sg-B2M-1 sequence, the publicly reported knockout rate is only 50-60% (Nature. 2017 Mar2; 543(7643): 113-117, Fig. 3c shows that the B2M knockout rate is 55%). After optimization by our method, the knockout rate of B2M is greatly improved to 95%.

[0269] Example 7: Effect of Cas9 enzyme concentration on knockout efficiency

[0270] sg-B2M-2 was selected as the sgRNA. With a Cas9 enzyme to sgRNA ratio of 1:4, different concentrations of Cas9 enzyme (0.125 μM, 0.25 μM, 0.5 μM, 1.0 μM, 2.0 μM, 3.0 μM) were used to detect the effect on B2M gene knockout. After incubating the RNP complex at room temperature for 10 minutes, the RNP complex was introduced into T cells using a Maxcyte electroporator (Maxcyte Corporation) according to the instrument's electroporation conditions. On day 5 post-transfection, T cells were collected for flow cytometry staining with B2M antibody (BD Biosciences) to verify the efficiency of B2M knockout. Flow cytometry analysis was performed.

[0271] The results are as follows Figure 7 As shown in Table 5, when the concentration of Cas9 enzyme is greater than 0.2 μM, the knockout efficiency can reach over 70%.

[0272] At 0.25 μM, the knockout efficiency was 72.2%; when the concentration of Cas9 enzyme was not lower than 1 μM, the knockout efficiency could reach more than 90%. Good knockout efficiency was shown in the range of 1 μM to 3 μM, especially in the range of 1 μM to 2 μM, where the knockout efficiency was around 93%.

[0273] Table 5. Statistical analysis of the effects of different concentrations of Cas9 enzyme on B2M knockout

[0274]

[0275] Example 8: Simultaneous and efficient knockout of TRAC and B2M genes in T cells

[0276] 1. The influence of the proportion of gRNA components

[0277] In current reports, the highest efficiency of TCR and B2M dual knockout is only about 60% (see Clin Cancer Res. 2017 May 1; 23(9):2255-2266). Figure 3b (See Fig. 3a in Oncotarget, 2017, Vol. 8, (No. 10), pp: 17007-17011). Therefore, in this embodiment, it is desirable to further utilize the above-described optimized method to screen for a highly efficient combination of dual knockout B2M and TCR.

[0278] To investigate the effect of the sg-TRAC-1 to sg-B2M-2 ratio on the double knockout of TRAC and B2M genes, the ratios of sg-B2M-2 and sg-TRAC-1 were set to 1.5:1, 1:1, and 0.5:1, respectively, with a Cas9 enzyme to total gRNA molar ratio of 1:4, to assess their impact on gene knockout. After introducing the RNP complex into T cells using a Maxcyte electroporator (Maxcyte Corporation), flow cytometry staining with CD3 antibody and B2M antibody (BD Biosciences) was performed on day 5. The flow cytometry results are shown below. Figure 8 As shown in Table 6, the double knockout of TRAC and B2M genes is most effective when the ratio of sg-B2M-2 to sg-TRAC-1 is 1:1.

[0279] Table 6. Effects of different gRNA components on TRAC and B2M double knockout

[0280] gRNA ratio 1.5:1 1:1 0.5:1 KO efficiency (Day 5) 74.3％ 93.0％ 82.7％

[0281] 2. Optimization of RNP concentration.

[0282] To determine the concentration of the RNP complex formed between the gRNA mixture targeting the TRAC and B2M genes and the Cas9 enzyme, different concentrations of Cas9 enzyme (0.25 μM, 0.5 μM, 1.0 μM, 2.0 μM, and 3.0 μM) were set at an optimized Cas9 enzyme to gRNA molar ratio of 1:4 to investigate its effect on gene knockout. After introducing the RNP complex into T cells using a Maxcyte electroporator (Maxcyte Corporation), flow cytometry staining with CD3 and B2M antibodies (BD Biosciences) was performed on day 5. The flow cytometry results are shown in the figure. Figure 9 As shown in Table 7, when the final concentration of Cas9 enzyme is not less than 1 μM, the double knockout effect of TRAC and B2M can reach more than 90%, and 93.4% at 3 μM.

[0283] Table 7. Statistical analysis of the effects of different concentrations of Cas9 enzyme on TRAC and B2M double knockout.

[0284]

[0285] Example 9: Molecular-level verification of simultaneous knockout of TRAC and B2M genes in T cells

[0286] 1. The Tide method was used to verify the knockout of TRAC and B2M genes.

[0287] Genomic DNA was extracted from T cells for single TRAC and B2M genes, as well as from knockout samples of both genes. Gene fragments containing the knockout sites were amplified using PCR. The PCR products were purified and recovered after gel electrophoresis, and then sequenced. In the control group, the sequencing results for TRAC and B2M genes showed a single peak, while in the knockout group, the sequencing results for TRAC and B2M genes showed multiple overlapping peaks, indicating that mutations occurred in the TRAC and B2M genes.

[0288] The sequencing results were submitted to https: / / tide.deskgen.com / for analysis to obtain the predicted mutation efficiency. The results are shown in Figure 10, indicating that TCR and B2M were effectively knocked out.

[0289] 2. Cloning and sequencing to verify the knockout of TRAC and B2M genes.

[0290] Genomic DNA from single TRAC and B2M genes, as well as from the two knockout genes, was extracted from T cells. Gene fragments containing the knockout sites were amplified by PCR. The PCR products were purified and recovered after gel electrophoresis, ligated into a T vector, transformed, and single colonies were randomly selected for sequencing identification. Figure 11 As shown, the selected clones

[0291] Sequencing comparison revealed that, compared to the original sequences of TRAC and B2M, the knockout group sequences all showed deletions or insertions of bases, indicating that both the TCR and B2M genes had mutated.

[0292] Example 10: Highly efficient knockout of TRAC and B2M genes by BCMA CAR-T cells

[0293] Furthermore, we used the prepared BCMA CAR-T cells to test the effect of TRAC and B2M dual gene knockout.

[0294] 1. Preparation of BCMA-targeted CAR-T cells. Referring to Chinese Invention Patent 201810065525.1, a CAR vector containing an anti-BCMA chimeric antigen receptor, T cell co-stimulatory factor 41-BB, and T cell activating factor CD3ζ was designed and constructed, and packaged with lentivirus, named PRRL-BCMA-BBZ(TM). After T cell activation and expansion for 48 hours, the cell density was adjusted to 2*10^6 / mL, and PRRL-BCMA-BBZ(TM) lentivirus was added at an MOI of 4. After 24 hours, the medium was changed to obtain BCMA-targeted CAR-T cells.

[0295] 2. Targeted knockout of TCR and B2M genes in BCMA CAR-T cells. After expanding CAR-T cells in vitro for 48 hours, the cell density was adjusted to 2*10^7 / mL. sg-TRAC-1, sg-B2M-2, and a mixture of sg-TRAC-1 / sg-B2M-2 were incubated at room temperature for 10 minutes with Cas9 enzyme and gRNA at a 1:4 ratio. 1*10^6 cells were then mixed with RNP (Cas9 enzyme final concentration 3 μM), and the RNP complex was introduced into CAR-T cells using a Maxcyte electroporator. Cell viability was assessed at 24, 48, and 72 hours (Table 8). CAR-T cells recovered well after electroporation. On day 5 after electroporation, flow cytometry was used to detect the knockout of TRAC and B2M genes. Both single and double gene knockout of TRAC and B2M reached over 90%, indicating efficient achievement of TCR and B2M dual knockout (see [link to study]). Figure 12 ).

[0296] Table 8. Cell viability of CAR-T cells after electroporation

[0297]

[0298] The sequences used in this article are as follows:

[0299]

[0300] sequence list <110> Kafa Pharmaceutical Co., Ltd. <120> CRISPR / Cas system-based gene editing methods <130> PE01421A <150> 201811117875.4 <151> 2018-09-21 <150> 201811140870.3 <151> 2018-09-28 <150> 201910809475.8 <151> 2019-08-29 <150> 201910809598.1 <151> 2019-08-29 <160> 94 <170> PatentIn version 3.5 <210> 1 <211> 274 <212> DNA <213> Artificial sequence <220> <223> TRAC-exon 1 sequence <400> 1 atatccagaa ccctgaccct gccgtgtacc agctgagaga ctctaaatcc agtgacaagt 60 ctgtctgcct attcaccgat tttgattctc aaacaaatgt gtcacaaagt aaggattctg 120 atgtgtatat cacagacaaa actgtgctag acatgaggtc tatggacttc aagagcaaca 180 gtgctgtggc ctggagcaac aaatctgact ttgcatgtgc aaacgccttc aacaacagca 240 ttattccaga agacaccttc ttccccagcc cagg 274 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-1 <400> 2 agagtctctc agctggtaca 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-2 <400> 3 tctctcagct ggtacacggc 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-3 <400> 4 gagaatcaaa atcggtgaat 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-4 <400> 5 ctctcagctg gtacacggca 20 <210> 6 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-1 corresponds to TRAC <400> 6 ccgtgtacca gctgagagac tct 23 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-2 corresponds to TRAC <400> 7 cctgccgtgt accagctgag aga 23 <210> 8 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-3 corresponds to TRAC <400> 8 cctattcacc gattttgatt ctc 23 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-4 corresponds to TRAC <400> 9 ccctgccgtg taccagctga gag 23 <210> 10 <211> 127 <212> DNA <213> Artificial sequence <220> <223> B2M-exon 1 sequence <400> 10 aatataagtg gaggcgtcgc gctggcgggc attcctgaag ctgacagcat tcgggccgag 60 atgtctcgct ccgtggcctt agctgtgctc gcgctactct ctctttctgg cctggaggct 120 atccagc 127 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-1 <400> 11 ggccacggag cgagacatct 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-2 <400> 12 gagtagcgcg agcacagcta 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-3 <400> 13 ggccgagatg tctcgctccg 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-4 <400> 14 aagtggaggc gtcgcgctgg 20 <210> 15 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-B2M-1 corresponds to B2M <400> 15 ccgagatgtc tcgctccgtg gcc 23 <210> 16 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-B2M-2 corresponds to B2M <400> 16 ccttagctgt gctcgcgcta ctc 23 <210> 17 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-B2M-3 corresponds to B2M <400> 17 ggccgagatg tctcgctccg tgg 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> B2M corresponding to sg-B2M-4 <400> 18 aagtggaggc gtcgcgctgg cgg 23 <210> 19 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> scfv nucleic acid sequence of bcma antibody <400> 19 gaggtgcaat tgctggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctccggatt cacctttggc ggtaatgcca tgtcctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagca attagtggta atggtggtag tacattctac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcagatga acagcctgag agccgaggac acggccgtat attactgtgc gaaagttcgt 300 ccattctggg gtactttcga ctactggggc caaggaaccc tggtcaccgt ctcgagtggt 360 ggaggcggtt caggcggagg tggttctggc ggtggcggat cggaaatcgt gttaacgcag 420 tctccaggca ccctgtcttt gtctccaggg gaaagagcca ccctctcttg cagggccagt 480 cagagtgtta gcagcagcta cttagcctgg taccagcaga aacctggcca ggctcccagg 540 ctcctcatct atggagcatc cagcagggcc actggcatcc cagacaggtt cagtggcagt 600 ggatccggga cagacttcac tctcaccatc agcagactgg agcctgaaga ttttgcagtg 660 tattactgtc agcagtactt caacccacca gaatacacgt tcggccaggg gaccaaagtg 720 gaaatcaaac gt 732 <210> 20 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-1-F <400> 20 taatacgact cactatagag agtctctcag ctggtaca 38 <210> 21 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-1-R <400> 21 ttctagctct aaaactgtac cagctgagag actct 35 <210> 22 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-2-F <400> twenty two taatacgact cactatagtc tctcagctgg tacacggc 38 <210> twenty three <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-2-R <400> twenty three ttctagctct aaaacgccgt gtaccagctg agaga 35 <210> twenty four <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-3-F <400> twenty four taatacgact cactatagga gaatcaaaat cggtgaat 38 <210> 25 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-3-R <400> 25 ttctagctct aaaacattca ccgattttga ttctc 35 <210> 26 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-1-F <400> 26 taatacgact cactataggg ccacggagcg agacatct 38 <210> 27 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-1-R <400> 27 ttctagctct aaaacagatg tctcgctccg tggcc 35 <210> 28 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-2-F <400> 28 taatacgact cactatagga gtagcgcgag cacagcta 38 <210> 29 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-2-R <400> 29 ttctagctct aaaactagct gtgctcgcgc tactc 35 <210> 30 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-3-F <400> 30 taatacgact cactataggg ccgagatgtc tcgctccg 38 <210> 31 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-B2M-3-R <400> 31 ttctagctct aaaaccggag cgagacatct cggcc 35 <210> 32 <211> 17 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-5 <400> 32 gtctctcagc tggtaca 17 <210> 33 <211> 18 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-6 <400> 33 agtctctcag ctggtaca 18 <210> 34 <211> 40 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-5-F <400> 34 taatacgact cactatagtt agagtctctc agctggtaca 40 <210> 35 <211> 37 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-5-R <400> 35 ttctagctct aaaactgtac cagctgagag actctaa 37 <210> 36 <211> 41 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-6-F <400> 36 taatacgact cactatagtt tagagtctct cagctggtac a 41 <210> 37 <211> 38 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-6-R <400> 37 ttctagctct aaaactgtac cagctgagag actctaaa 38 <210> 38 <211> 14 <212> DNA <213> Artificial sequence <220> <223> B2M editing target <400> 38 tagctgtgct cgcg 14 <210> 39 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-7 <400> 39 ttagagtctc tcagctggta ca 22 <210> 40 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-8 <400> 40 tttagagtct ctcagctggt aca 23 <210> 41 <211> 36 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-7-F <400> 41 taatacgact cactatagag tctctcagct ggtaca 36 <210> 42 <211> 33 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-7-R <400> 42 ttctagctct aaaactgtac cagctgagag act 33 <210> 43 <211> 35 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-8-F <400> 43 taatacgact cactataggt ctctcagctg gtaca 35 <210> 44 <211> 32 <212> DNA <213> Artificial sequence <220> <223> sg-TRAC-8-R <400> 44 ttctagctct aaaactgtac cagctgagag ac 32 <210> 45 <211> 15 <212> DNA <213> Artificial sequence <220> <223> TRAC edit site <400> 45 tgtaccagct gagag 15 <210> 46 <211> 94 <212> DNA <213> Artificial sequence <220> <223> TRAC-WT sequence <400> 46 ccagaaccct gaccctgccg tgtaccagct gagagactct aaatccagtg acaagtctgt 60 ccagaaccct gaccctgccg tgtaccagct gagagactct aaatccagtg acaagtctgt 60 ctgcctattc accgattttg attctcaaac aaat 94 ctgcctattc accgattttg attctcaaac aaat 94 <210> 47<210> 47 <211> 94<211> 94 <212> DNA<212> DNA <213> 人工序列<213> Artificial sequence <220><220> <223> TRAC‑WT序列<223> TRAC-WT sequence <400> 47<400> 47 ggtcttggga ctgggacggc acatggtcga ctctctgaga tttaggtcac tgttcagaca 60 ggtcttggga ctgggacggc acatggtcga ctctctgaga tttaggtcac tgttcagaca 60 gacggataag tggctaaaac taagagtttg ttta 94 gacggataag tggctaaaac taagagtttg ttta 94 <210> 48<210> 48 <211> 107<211> 107 <212> DNA <212> DNA <213> 人工序列<213> Artificial sequence <220> <220> <223> TRAC‑WT序列 <223> TRAC-WT sequence <400> 48 <400> 48 aatataagtg gaggcgtcgc gctggcgggc attcctgaag ctgacagcat tcgggccgag 60 aatataagtg gaggcgtcgc gctggcgggc attcctgaag ctgacagcat tcgggccgag 60 atgtctcgct ccgtggcctt agctgtgctc gcgctactct ctctttc 107 atgtctcgct ccgtggcctt agctgtgctc gcgctactct ctctttc 107 <210> 49 <210> 49 <211> 107 <211> 107 <212> DNA <212> DNA <213> 人工序列 <213> Artificial sequence <220> <220> <223> TRAC‑WT序列 <223> TRAC-WT sequence <400> 49 <400> 49 ttatattcac ctccgcagcg cgaccgcccg taaggacttc gactgtcgta agcccggctc 60 ttatattcac ctccgcagcg cgaccgcccg taaggacttc gactgtcgta agcccggctc 60 tacagagcga ggcaccggaa tcgacacgag cgcgatgaga gagaaag 107 <210> 50 <211> 69 <212> DNA <213> Artificial sequence <220> <223> TRAC-WT sequence / B2M and TRAC KO-TRAC <400> 50 cagatatcca gaaccctgac cctgccgtgt accagctgag agactctaaa tccagtgaca 60 agtctgtct 69 <210> 51 <211> 28 <212> DNA <213> Artificial sequence <220> <223> TRAC-clone 1 / B2M and TRAC KO-TRAC <400> 51 cagatatcca gaaccctgac cctgccag 28 <210> 52 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 2 / B2M and TRAC KO-TRAC <400> 52 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 53 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 3 / B2M and TRAC KO-TRAC <400> 53 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 54 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 4 / B2M and TRAC KO-TRAC <400> 54 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 55 <211> 64 <212> DNA <213> Artificial sequence <220> <223> TRAC-clone 5 / B2M and TRAC KO-TRAC <400> 55 cagatatcca gaaccctgac cctgccgtgt atgagagact ctaaatccag tgacaagtct 60 gtct 64 <210> 56 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-clone 6 / B2M and TRAC KO-TRAC <400> 56 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 57 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 7 / B2M and TRAC KO-TRAC <400> 57 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 58 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 8 / B2M and TRAC KO-TRAC <400> 58 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 59 <211> 63 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 9 / B2M and TRAC KO-TRAC <400> 59 cagatatcca gaaccctgac cctgaccagc tgagagactc taaatccagt gacaagtctg 60 tct 63 <210> 60 <211> 70 <212> DNA <213> Artificial sequence <220> <223> TRAC-clone 10 / B2M and TRAC KO-TRAC <400> 60 cagatatcca gaaccctgac cctgccgtgt aaccagctga gagactctaa atccagtgac 60 aagtctgtct 70 <210> 61 <211> 66 <212> DNA <213> Artificial sequence <220> <223> TRAC-WT sequence / TRAC KO-TRAC <400> 61 gatatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc cagtgacaag 60 tctgtc 66 <210> 62 <211> 55 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 1 / TRAC KO-TRAC <400> 62 gatatccaga accctgaccc agctgagaga ctctaaatcc agtgacaagt ctgtc 55 <210> 63 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 2 / TRAC KO-TRAC <400> 63 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 64 <211> 61 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 3 / TRAC KO-TRAC <400> 64 gatatccaga accctgaccc tgagccagct gagagactct aaatccagtg acaagtctgt 60 c 61 <210> 65 <211> 55 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 4 / TRAC KO-TRAC <400> 65 gatatccaga accctgaccc agctgagaga ctctaaatcc agtgacaagt ctgtc 55 <210> 66 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 5 / TRAC KO-TRAC <400> 66 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 67 <211> 55 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 6 / TRAC KO-TRAC <400> 67 gatatccaga accctgaccc tgctgagaga ctctaaatcc agtgacaagt ctgtc 55 <210> 68 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 7 / TRAC KO-TRAC <400> 68 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 69 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 8 / TRAC KO-TRAC <400> 69 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 70 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 9 / TRAC KO-TRAC <400> 70 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 71 <211> 67 <212> DNA <213> Artificial sequence <220> <223> TRAC-Clone 10 / TRAC KO-TRAC <400> 71 gatatccaga accctgaccc tgccgtgtaa ccagctgaga gactctaaat ccagtgacaa 60 gtctgtc 67 <210> 72 <211> 68 <212> DNA <213> Artificial sequence <220> <223> B2W-WT-Sequence / B2M and TRAC KO-B2M <400> 72 ggccagaaag agagagtagc gcgagcacag ctaaggccac ggagcgagac atctcggccc 60 gaatgctg 68 <210> 73 <211> 45 <212> DNA <213> Artificial sequence <220> <223> B2W-clone 1 / B2M and TRAC KO-B2M <400> 73 ggccagaaag agagagtagc gcgagacatc tcggcccgaa tgctg 45 <210> 74 <211> 70 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 2 / B2M and TRAC KO-B2M <400> 74 ggccagaaag agagagtagc gcgagcacag agctaaggcc acggagcgag acatctcggc 60 ccgaatgctg 70 <210> 75 <211> 69 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 3 / B2M and TRAC KO-B2M <400> 75 ggccagaaag agagagtagc gcgagcacag gctaaggcca cggagcgaga catctcggcc 60 cgaatgctg 69 <210> 76 <211> 69 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 4 / B2M and TRAC KO-B2M <400> 76 ggccagaaag agagagtagc gcgagctcac cctacggatg ctgaccgaga catcactgcc 60 cgaatgctg 69 <210> 77 <211> 66 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 5 / B2M and TRAC KO-B2M <400> 77 ggccagaaag agagagtagc gcgagcacct aaggccacgg agcgagacat ctcggcccga 60 atgctg 66 <210> 78 <211> 19 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 6 / B2M and TRAC KO-B2M <400> 78 ggccagaaag agagagtag 19 <210> 79 <211> 45 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 7 / B2M and TRAC KO-B2M <400> 79 ggccagaaag agagagtagc gcgagacatc tcggcccgaa tgctg 45 <210> 80 <211> 44 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 8 / B2M and TRAC KO-B2M <400> 80 ggccagaaag agagagtagc gcgagcacag cggcccgaat gctg 44 <210> 81 <211> 45 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 9 / B2M and TRAC KO-B2M <400> 81 ggccagaaag agagagtagc gcgagacatc tcggcccgaa tgctg 45 <210> 82 <211> 67 <212> DNA <213> Artificial sequence <220> <223> B2W-Clone 10 / B2M and TRAC KO-B2M <400> 82 ggccagaaag agagagtagc gcgagcacac gaaggccacg gagcgagaca tctcggcccg 60 aatgctg 67 <210> 83 <211> 68 <212> DNA <213> Artificial sequence <220> <223> B2W‑WT‑Sequence / B2M KO‑B2M <400> 83 tccaggccag aaagagagag tagcgcgagc acagctaagg ccacggagcg agacatctcg 60 gcccgaat 68 <210> 84 <211> 44 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 1 / B2M KO‑B2M <400> 84 tccaggccag aaagagccac ggagcgagac atctcggccc gaat 44 <210> 85 <211> 45 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 2 / B2M KO‑B2M <400> 85 tccaggccag aaagagagag tagcgcgaga catctcggcc cgaat 45 <210> 86 <211> 69 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 3 / B2M KO‑B2M <400> 86 tccaggccag aaagagagag tagcgcgagc acaggctaag gccacggagc gagacatctc 60 ggcccgaat 69 <210> 87 <211> 49 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 4 / B2M KO‑B2M <400> 87 tccaggccag aaagagagag tagcgcgagc gagacatctc ggcccgaat 49 <210> 88 <211> 60 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 5 / B2M KO‑B2M <400> 88 tccaggccag aaagagagag tagcgcgagt agccacggag cgagacatct cggcccgaat 60 <210> 89 <211> 36 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 6 / B2M KO‑B2M <400> 89 tccaggccag aaagagagag acatgtcagc acgaac 36 <210> 90 <211> 64 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 7 / B2M KO‑B2M <400> 90 tccaggccag aaagagagag tagcgcgagc acagggccac ggagcgagac atctcggccc 60 gaat 64 <210> 91 <211> 40 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 8 / B2M KO‑B2M <400> 91 tccaggccag aaagagagag cgagacatct cggcccgaat 40 <210> 92 <211> 41 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 9 / B2M KO‑B2M <400> 92 tccaggccag aagccacgga gcgagacatc tcggcccgaa t 41 <210> 93 <211> 69 <212> DNA <213> Artificial sequence <220> <223> B2W‑Clone 10 / B2M KO‑B2M <400> 93 tccaggccag aaagagagag tagcgcgagc acaggctaag gccacggagc gagacatctc 60 ggcccgaat 69 <210> 94 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthesized sequences <400> 94 cgcttgtttc ggcgtgggta 20

Claims

1. A method for gene editing in cells based on a CRISPR / Cas system, characterized in that, Gene editing was performed by introducing a complex of Cas enzyme and gRNA into the cells, wherein the Cas enzyme was a Cas9 enzyme, and the TRAC gene was edited. The concentration of the Cas9 enzyme is 0.25~3 μM; In the complex, the molar ratio of Cas9 enzyme to gRNA is 1:3 to 1:5; The gRNAs include the first gRNA used for gene editing in TRAC. The first gRNA is the sequence shown in SEQ ID NO: 2, 32 or 33.

2. The method as described in claim 1, wherein, The molar ratio of the Cas9 enzyme to gRNA is 1:

4.

3. The method as described in claim 1, wherein, It also includes gene editing of the B2M gene, wherein the gRNA includes a second gRNA for gene editing of B2M.

4. The method of claim 3, wherein, The second gRNA performs gene editing on the B2M gene containing the sequence shown in SEQ ID NO:

10.

5. The method of claim 4, wherein, The second gRNA is a sequence as shown in SEQ ID NO: 11, 12 or 13.

6. The method as described in claim 3, characterized in that, The molar ratio of the first gRNA to the second gRNA is 1:5 to 5:

1.

7. The method as described in claim 6, characterized in that, The molar ratio of the first gRNA to the second gRNA is 1:2 to 2:

1.

8. The method as described in claim 6, characterized in that, The molar ratio of the first gRNA to the second gRNA is 1:

1.

9. The method as described in claim 1, characterized in that, The cells in question are eukaryotic cells.

10. The method as described in claim 9, characterized in that, The eukaryotic cells mentioned are immune effector cells.

11. The method as described in claim 10, characterized in that, The immune effector cells are T cells.

12. The method as described in claim 3, characterized in that, The first or second gRNA is 15-50 bp.

13. The method as described in claim 12, characterized in that, The first or second gRNA is 15-30 bp.

14. The method as described in claim 13, characterized in that, The first or second gRNA is 17-20 bp.

15. The method as described in claim 13, characterized in that, The first or second gRNA is 20 bp.

16. The method according to any one of claims 3-12, characterized in that, The second gRNA is a sequence as shown in SEQ ID NO: 11, 12 or 13.

17. The method as described in claim 11, characterized in that, The T cells also express chimeric receptors, exogenous cytokines, inhibitory / activating receptors or ligands, and co-stimulatory factors.

18. The method as described in claim 17, characterized in that, The T cells also express chimeric antigen receptors.

19. A method for constructing universal T cells, comprising: Gene editing of the TCR and B2M genes in T cells was performed using CRISPR / Cas9 gene editing technology. Gene editing of the TRAC gene in T cells; the gRNA used for TRAC gene editing is the sequence shown in SEQ ID NO: 2; and The gRNA used for gene editing in B2M is the sequence shown in SEQ ID NO: 12; among which, The molar ratio of gRNA used for gene editing of the TRAC gene to gRNA used for gene editing of the B2M gene is 1:2 to 2:

1.

20. The method of claim 19, wherein, The concentration of the Cas9 enzyme used for gene editing is 1 μM to 3 μM.

21. The method of claim 20, wherein, The concentration of the Cas9 enzyme was 3 μM.

22. The method of claim 19, wherein, The molar ratio of gRNA for gene editing of the TRAC gene to gRNA for gene editing of the B2M gene is 1:2 to 3:

2.

23. The method of claim 22, wherein, The molar ratio of gRNA used for gene editing of the TRAC gene to gRNA used for gene editing of the B2M gene is 1:

1.

24. The method as described in claim 19, characterized in that, The T cells also express chimeric antigen receptors.

25. The method as described in claim 18 or 24, characterized in that, The T cells also express chimeric receptors that recognize tumor antigens or pathogen antigens. These chimeric receptors have an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain. The extracellular antigen-binding domain specifically recognizes the target antigen.

26. The method as described in claim 25, characterized in that, The target antigen is a tumor antigen selected from: thyroid-stimulating hormone receptor (TSHR); CD171; CS-1; C-type lectin-like molecule-1; ganglioside GD3; Tn antigen; CD19; CD20; CD22; CD30; CD70; CD123; CD138; CD33; CD44; CD44v7 / 8; CD38; CD44v6; B7H3 (CD276), B7H6; KIT (CD117); interleukin-13 receptor subunit α (IL-13Rα); interleukin-11 receptor α (IL-11Rα); prostate stem cell antigen (PSCA); prostate-specific membrane antigen (PSMA); carcinoembryonic antigen (CEA); NY-ESO-1; HIV-1 Gag; MART-1; gp100; tyrosinase; mesothelin; EpCAM; serine 21 (PRSS21); vascular endothelial growth factor receptor; Lewis (Y) antigen; CD24; platelet-derived growth factor receptor β (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); cell surface-associated mucin 1 (MUC1), MUC6; epidermal growth factor receptor family and its mutants; neural cell adhesion molecule (NCAM); carbonic anhydrase IX (CAIX); LMP2; liver ligand A receptor 2 (EphA2); fucose GM1; sialic acid Lewis adhesion molecule (sLe); o-acetyl GD2 ganglioside (OAcGD2); ganglioside GM3; TGS5; high molecular weight melanoma-associated antigen (HMWMAA); folate receptor; tumor vascular endothelial marker 25 1 (TEM1 / CD248); tumor vascular endothelial marker 7 associated (TEM7R); Claudin6, Claudin18.2 (CLD18A2), Claudin18.1; ASGPR1; CDH16; 5T4; 8H9; αvβ6 integrin; B cell maturation antigen (BCMA); CA9; kappa light chain; CSPG4; EGP2, EGP40; FAP; FAR; FBP; embryonic AchR; HLA-A1, HLA-A2; MAGEA1, MAGE3; KDR; MCSP; NKG2D ligand; PSC1; ROR1; Sp17; SURVIVIN; TAG72; TEM1; fibronectin; tendinin; carcinoembryonic variant in tumor necrosis zone; G protein-coupled receptor class C5-member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); globoH glycoceramide Hexose moiety (GloboH); Breast differentiation antigen (NY-BR-1); Uroplakin 2 (UPK2); Hepatitis A virus cell receptor 1 (HAVCR1); Adrenaline receptor β3 (ADRB3); Pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); Lymphocyte antigen 6 complex locus K9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCRγ alternating reading frame protein (TARP); Wilms' blastoma protein (WT1); ETS translocation variant gene 6 (ETV6-AML); Sperminin 17 (SPA17); X antigen family member 1A (XAGE1); Angiopoietin-binding cell surface receptor 2 (Tie2); Melanoma cancer testis antigen-1 (MAD-CT-1); Melanoma cancer testis antigen-2 (MAD-CT-2); Fos-associated antigen 1; p53 mutation 10 Human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosamine transferase V (NA17); Pax-3 (PAX3), a pairing box protein; androgen receptor; Cyclin B1; V-myc avian myeloma virus oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); Cytochrome P450 1B1 (CYP1B1); CCCTC binding factor (zinc finger protein)-like (BORIS); Squamous cell carcinoma antigen 3 recognized by T cells (SART3); Pax-5 pairing box protein (PAX5); proacrosin-binding protein sp32 (OYTES1); Lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); Synovial sarcoma X breakpoint 2 (SSX2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); I Fc fragment of gA receptor (FCAR); Leukocyte immunoglobulin-like receptor subfamily member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); Bone marrow stromal cell antigen 2 (BST2); EGF-like module mucin-like hormone receptor-like 2 (EMR2); Lymphocyte antigen 75 (LY75); Phosphatidylinositol proteoglycan-3 (GPC3); Fc receptor-like 5 (FCRL5); Immunoglobulin λ-like polypeptide 1 (IGLL1).

27. The method of claim 26, wherein, The epidermal growth factor 20 receptor family and its mutants are EGFR, EGFR2, ERBB3, ERBB4 or EGFRvIII.

28. The method as described in claim 25, characterized in that, The target antigen is a pathogen antigen, which is selected from antigens of viruses, bacteria, fungi, protozoa, or parasites.

29. The method as described in claim 28, characterized in that, The viral antigens are selected from: cytomegalovirus antigen, Epstein-Barr virus antigen, human immunodeficiency virus antigen, or influenza virus antigen.

30. The method as described in claim 25, characterized in that, The chimeric antigen receptor includes: (i) Antibodies or fragments thereof that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD28, and CD3ζ; or (ii) Antibodies or fragments thereof that specifically bind to tumor antigens, the transmembrane region of CD28 or CD8, the co-stimulatory signaling domain of CD137, and CD3ζ; or (iii) Antibodies or fragments thereof that specifically bind to tumor antigens, transmembrane regions of CD28 or CD8, costimulatory signaling domains of CD28, costimulatory signaling domains of CD137, and CD3ζ.

31. The method as described in claim 30, characterized in that, The antibody that specifically binds to the tumor antigen of the chimeric antigen receptor is a full-length antibody, scFv, Fab, (Fab'), or a single-domain antibody.

32. Use of the T cells prepared by the method according to any one of claims 1-31, wherein the T cells are used to prepare T cells expressing a chimeric receptor, the chimeric receptor having an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, the extracellular antigen-binding domain specifically recognizing a target antigen.

33. A universal T cell, which is constructed by the method of any one of claims 1-31.

Images